JPH02200191A - Protein and region relating to expression and excretion thereof - Google Patents

Abstract

PURPOSE:To contrive to improve the yield of pectic acid lyase by culturing in a medium a transformed bacterium prepared by transforming a bacterium with a recombined plasmid containing a protein which is a pectinic acid lyase III gene. CONSTITUTION:A DNA molecule or a derivative thereof (e.g. plasmid pNN3) coding a region relating to the expression and excretion of a protein (the pectinic acid lyase II gene of an Erwinia bacterium) containing a DNA sequence of the formula is inserted into an Escherichia coli HB101 strain to give a transformed Escherichia coli strain HB101/pNN3 (A). The strain A is cultured in a medium containing casamino acid, etc., to give a cultured product (B). The component B is purified by an ion exchange method, etc., to provide the pectinic acid lyase III having the following properties; action: reacts with polygaractoronide to produce an unsaturated galacturonide; substrate specificity: acts with pectin; the optimal pH: 6-11; the optimal temperature: 60 deg.C; is activated with Ca ions and is inhibited with EDTA; mol.wt.: approximately 36000 (SDS polyacrylamide gel electrophoresis method), etc.

Description

DETAILED DESCRIPTION OF THE INVENTION [Field of Industrial Application] The present invention relates to areas related to protein expression and secretion. More specifically, the present invention relates to
The present invention relates to a DNA molecule or a derivative thereof containing a region involved in the expression and secretion production of the pectic acid lyase gene of a bacterium of the genus Nia). Furthermore, the present invention relates to a method for producing pectate lyase (1) using a recombinant plasmid containing the above region and the pectate lyase III gene, and to pectate lyase (2).

[Conventional technology]

Pectic acid lyase has been studied to be applied to the production of valves such as Kozo and Mitsumata, and industrial applications are being developed. Pectate lyase, which is being considered for this use, has been isolated and purified from a culture of bacteria belonging to the genus Erwinia, and a technology for producing pectate lyase in large quantities at low cost is desired.

Many attempts have been made to produce large quantities of proteins using genetic recombination, and there are already many reports on this technology.Especially, the host-vector system, which uses E. coli as a host, has a wide variety of hosts and vectors. , the easiest to genetically manipulate. However, Escherichia coli has the disadvantage of not being able to secrete proteins outside the bacterial body, and is not suitable for producing proteins that are harmful to Escherichia coli or for producing large quantities of proteins.

On the other hand, several vectors are known that allow Escherichia coli to secrete and produce proteins. For example, the gene of alkalophilic bacillus and the plasmid p derived from colicin factor of E. coli.
Plasmid pEAP 2 [
CKa to et al., Eurj, Appl, Microbi
ol.

Biotechnol, 18, 339 (1983)
, 5erraLia taarcescens protease gene (Yanagita et al., J., Bacter.
fol, .

Yogon 1083 (1986)), etc.

However, many such vectors are not yet known, and even if these vectors are used, not all polypeptides can be secreted and produced.

Erwinia carot
ovora) is a Durham-negative bacterium that is classified as a member of the enterobacteria group and is closely related to Escherichia coli, but secretes and produces several enzymes including pectate lyase.

It is generally said that Durham-negative bacteria do not secrete and produce enzymes and proteins because their cell membranes are lipid bilayers, but pectate lyase from Erwinia carotovora crosses that membrane and is secreted into the culture medium. The mechanism by which this occurs is not clear.

An example of transforming Escherichia coli with the pectate lyase gene of a bacterium belonging to the genus Erwinia and secreting and producing pectate lyase in Escherichia coli (Tsuyumu et al., Symbiosi
s, i, 103 (1986)), but in the case of JP-A-63-68087, pectic acid lyase ① is not secreted and produced in E. coli, and it is not clear what causes this difference.

There are multiple isozymes of pectate lyase produced by Erwinia bacteria, and some of them have been reported. (Kotoujanski et al., Ann
u,Rev,Phytopathol,, 25.40
5 (1987)) Erwinia chrysanthemi (E, c
hrysanthemi), five isozymes are known: alkaline, weakly alkaline, and neutral.
It is broadly divided into Erwinia carotovora has two types of isozymes: an alkaline isozyme and a weakly alkaline isozyme.

In the case of Erwinia carotovora, it has been reported that two types of alkaline pectate lyases are produced, but the existence of other pectate lyases is unknown (Sugiura et al., J. Gen.

Microboil, 30, 167 (1984)
These two alkaline enzymes exhibit properties as shown in Table 1. The enzyme of the present invention has different properties from these two enzymes and is a novel enzyme.

[Problem to be solved by the invention]

The vector described in JP-A No. 63-68087 can secrete and produce a heterologous protein when the host is a bacterium belonging to the genus Erwinia. The drawback was that it didn't.

E. coli is a versatile host whose genetic analysis has progressed, and there are not many types of vector systems suitable for secretory production in E. coli. Therefore, developing secretory producing vectors in E. coli is difficult for practical purposes and research. It is advantageous to proceed.

The inventors have discovered that Erwinia carotovora F! They succeeded in cloning the novel pectate lyase (■) gene from r, and after extensive research, they completed the present invention.

That is, the present invention relates to a plasmid capable of secreting and producing proteins not only in Erwinia bacteria but also in E. m.

Furthermore, pectate lyase ① decomposes galacturonic acid polymers by transelimination, and pectate lyase 1. It is a novel enzyme with different properties from pectate lyase III, and the present invention provides a novel method for producing pectate lyase using a transformed strain transformed with the pectate lyase III gene.

[Means to solve problems]

The present invention relates to pectate lyase III of Erwinia bacteria.
It relates to DNA containing regions involved in gene expression and secretion.

More specifically, the present invention resides in a DNA molecule encoding a region involved in protein expression and secretion, or a derivative thereof, comprising the following DNA sequence.

ACCAAAGTTATTTGGAAACT 8
8AAAGTAAAA ATAAL, 'l1lL+1 The structural gene of pectate lyase■ is thought to start from the start codon ATG, which is located around the 6th position of the moon, from a comparison with the pectate lyase I gene, and from this ^TG 179-
The sequence up to the 181st GCG is considered to be a signal sequence for secretion. In addition, the consensus sequence for the -35 region and -10 region, which are the regions recognized and bound by RNA polymerase, is the sequence TT from the 33rd to the 38th region.
GAAA and sequence TATAA from position 49 to position 55
A is the SD sequence that is the site where ribosomes bind to mRNA, and the sequence AG is from position 101 to position 106.
GAGs are considered to be applicable. The invention also includes derivatives of these sequences. These derivatives are natural or artificially obtained variants of the above DNA molecules, similar DNA sequences that can be derived chemically or biochemically from these sequences, and have expression and secretion functions. say something

The present invention also provides a DNA sequence encoding a peptide related to protein secretion consisting of a DNA sequence encoding the following amino acid sequence.
A molecule or its derivatives.

Nl2-Met-Lys-Tyr-Leu-Leu-P
ro-3er-Ala-Ala-Ala-Gly-Le
u-Leu-Leu-Leu-Ala-8Ia-Gln
-Pro-Thr-Met-Ala-Ala That is, this amino acid sequence is a signal sequence that causes the downstream protein to be secreted out of the bacterial cell.

As mentioned above, the above DNA sequence is a region involved in the expression and secretion of proteins, especially the gene for pectic acid lyase ①, and promotes the expression and secretion of this enzyme. is also effective for the expression and secretion of other proteins than this enzyme. Furthermore, the DNA sequence encoding the above amino acid sequence is effective in secreting pectate lyase (2) as well as other proteins.

Furthermore, the present invention provides a pectate lyase, which is characterized by culturing a transformed strain obtained by transforming a plasmid containing the pectate lyase III gene or a derivative thereof, and obtaining pectate lyase (■) from the culture. ■
In addition, there is a novel pectic acid lyase (■).

The present invention will be explained in detail below.

(Isolation of pectate lyase III gene) The pectate lyase III gene can be found from the chromosome gene bank of Erwinia carotovora Er using a base sequence corresponding to the amino acid sequence near the N-terminal amino acid of pectate lyase ① as a probe.

The chromosome gene bank was created by digesting the Erwinia carotovora Er chromosome with EcoRI, introducing it into the EcoRI site of 7g tWES/λB, and completing it into Escherichia coli BNN45 strain. To obtain the desired pectate lyase clone from the bank, N of pectate lyase
Chemically synthesize a DNA sequence corresponding to the terminal amino acid sequence,
Positive plaques were selected by plaque hybridization. A large amount of phage DNA from the obtained plaque was prepared, and the foreign gene was cut out using EcoRI, ligated to the EcoRI site of pBR329, and pNN
I got 1.

The pectate lyase III gene is located near the pectate lyase III gene and can be found downstream of the pectate lyase I gene in plasmid pNN1 containing the pectate lyase I gene. The restriction enzyme map of this region is shown in Figure 1, and the region that hybridizes with the probe prepared for the N-terminal amino acid sequence of pectate lyase
This is a 0.3 Kb fragment of I.

When the base sequence upstream from this fragment and the PstI site was determined by the dideoxy chain termination method, it was found that the SD sequence, TATA box, and a sequence thought to be a signal region were linked to the structural gene downstream thereof. (Fig. 2) Since the structural gene continued further downstream from the EcoRI site, the gene below the EcoRI site was newly cloned by the method shown below.

Plasmid pNN3 is constructed by the method shown in FIG.

That is, pNN1 was cut with old ndI[I and PstI to generate the l1ind m -PstI fragment (1,9 Kb
) was obtained, and P of the multi-cloning site of pUc119 was obtained.
pNNll is constructed by subcloning between stI and H4ndnI sites. On the other hand, chromosomal DNA of Erwinia carotovora Er was prepared, cut with Pstl to prepare a 2.2 Kb fragment, and the previously prepared p
Plasmid pNN3 is obtained by inserting and ligating into the Pstl site of NNli.

This plasmid is transformed into E. coli strain 88101, and an E. coli transformed strain that produces pectate lyase can be obtained using the formation of a halo on an agar medium containing pectin as an indicator. Although the host E. coli is not particularly limited, E. coli 101 (manufactured by Takara Shuzo) is exemplified. Obtained E. coli transformed strain HBIOI/pNN
3 is the 1st microbiological research institute at the Institute of Microbial Technology, Agency of Industrial Science and Technology.
It has been deposited as No. 0479.

The transformed strain E. coli HBIOI/pNN 3 secretes and produces pectate lyase (2) in the culture when cultured in LB medium containing ampicillin or M9 medium supplemented with casamino acids and glucose.

The medium used for the production of pectic acid lyase is not limited to the above-mentioned medium, and any medium can be used as long as it allows E. coli to grow.

(Production of pectic acid lyase■ by Erwinia bacteria) Plasmid pNN 3 was transferred to Escherichia coli HBIOI/pNN 3
prepared from Ito et al. (8grfc, Bio1.ch
Erwinia carotovora Br was transformed by electroporation according to the method of Em., 52, 293 (1988)), and transformed strains were selected using ampicillin resistance as an index.

When the transformed strain is precultured in LB medium containing ampicillin and then cultured in M9 medium containing pectin and casamino acids, a large amount of pectate lyase is produced in the culture.

The medium used for the production of pectic acid lyase is not limited to the above-mentioned medium, and any medium can be used as long as Erwinia bacteria can grow. , juice dregs,
Examples include pectin, pectic acid, galacturonic acid, glucose, sucrose, and maltose. Examples of the nitrogen source include cornstarch liquor, soy flour, casein, casamino acids, yeast extract, meat extract, peptone, and inorganic ammonium salts and nitrates.

In addition, other phosphoric acid, Fe", Mg, Ca", M
It is desirable to include inorganic salts such as n"Zn" and Na"+K'.

Pectic acid lyase (2) can be purified by conventionally known methods, such as gel filtration, ion exchange, various chromatography methods such as adsorption columns, alone or in combination. Particularly effective is a method using a combination of a cation exchange resin such as carboxymethyl toyobal (manufactured by Tosoh), hydroxyapatite, gel filtration, and isoelectric focusing.

Pectate lyase in the culture supernatant is fractionated by hydroxyapatite column chromatography using a concentration gradient of 10 to 200 mM potassium phosphate as the effluent solvent, in addition to active fractions of pectate lyase I and pectate lyase ■. It was confirmed that this product contained a highly active fraction of pectate lyase (■) between the two, and that pectate lyase (■) was produced in large amounts. (Figure 4).

Furthermore, as shown in FIG. 4, there is almost no activity of pectate lyase (■) in the culture of the wild strain of Erwinia carotovora Er.

The physicochemical properties of purified pectic acid lyase (■) are as follows.

(1) Action: Acts on polygalacturonide, α-1 of galacturonic acid
,4 bonds are cleaved to produce unsaturated galacturonic acid with a double bond at the reducing end.

(2) Substrate specific pectin, deesterified pectic acid, α-1,4
It acts on oligogalaculuronides, which are oligomers of galacturonic acid connected by bonds, and whose reducing end is unsaturated galacturonic acid.

(3) Optimum pH The activity is maximum at pH 10.0, and it is stable in the pH range of 6 to 11.

(4) Optimum temperature and thermal stability The optimal temperature is 60°C, and it is thermally stable up to 40°C.

(5) Effect of metal ions and inhibitors It is activated by Ca ions, and its optimum Ca111 degree is 0.2mM. It is also inhibited by EDTASEGTA-.

(6) Molecular weight The molecular weight is approximately 36,000 as determined by SDS polyacrylamide gel electrophoresis.

The properties of this pectate lyase (2) were compared with those of the conventionally known pectate lyases I and (2), and the results are shown in Table 1, indicating that pectate lyase (2) is a new enzyme.

Optimal Ca concentration (mM) 0.2 0.6 0
．． 2 Molecular weight 36,50037.00036,000
Inhibition by EDTA + + +EGTA
The present invention will be described in detail below with reference to Examples.

〔Example〕

General operations related to gene handling, such as extraction of chromosomal DNA and plasmids from bacterial cells, preparation, digestion with restriction enzymes, agarose gel electrophoresis, DI from gels
Unless otherwise specified, operations such as recovery of JA, ligation of DNA fragments, and transformation should be carried out under general conditions, such as "'Molecular Cloning, a 1a
laboratory manual” (Maniatt
s et al., Gold Spring Harbor L
Laboratory (1982)), ``Biotechnology Experiment Manual J'' (edited by Yamauchi et al., Sankyo Publishing).

In addition, enzymes such as restriction enzymes used in experiments were those manufactured by Zenshuzo, Nippon Gene, and Toyobo unless otherwise specified.

The restriction enzyme site of plasmid pNN1 of 1.6-1ase 1 and the position of the pectic acidase I gene are shown in FIG.

Escherichia coli HBIOI/pNN 1 containing pNN 1 was cultured with shaking in LB medium at 37° C. overnight, and after harvesting, plasmid pNN 1 was prepared by the alkaline 3DS method.

pNN1 was digested with old ndl[I and EcoRI,
．． separated by 8% agarose gel electrophoresis; 2.
The 2 kb old ndI[r-EcoRI fragment was extracted from the gel and purified by phenol and chloroform extraction.

Similarly, EcoRT was obtained from pNN1 by BcoRI digestion.
-EcoRI fragment (8,7kb), former ndI
[[The former ndI[r-HindIII fragment (5,1 kb) was prepared by digestion.

The 2.2 kb old nd m-EcoRI fragment was further converted into Ban1-Pst I, or Ban II-Ps
The EcoRI-EcoRI fragment (8,7 kb) was digested with old ndll[, HindI[-H
The 3ndm fragments (5,1 kb) were each further digested with Pstl and subjected to 1.5% agarose gel electrophoresis.

The gel after electrophoresis was plotted on a Hybond N filter (manufactured by Amajam), and Southern blotting was performed using a 0.4 kb sequence near the N-terminus of the pectic acidase I gene as a probe, and detection was performed using X-ray film.

PstI-Ec, which is different from the pectic acidase I gene
The oRI fragment (0.3 kb) and the fragment containing the fragment (0.3 kb) hybridized strongly with the probe.

Next, this Pst I-EcoRI fragment and Ps
The tI-old ndl [I fragment (1,9 kb) was inserted into the plasmid puc119 multiple cloning site Pst
I, EcoRI site and PstI, former ndI [
[The nucleotide sequences were determined by subcloning between the sites and the dideoxy chain termination method (Figure 2).

The structural gene of pectate lyase ■ is thought to start from the start codon ATG, which is located around position 116, based on comparison with the pectate lyase I gene, and it starts from 20 ATG to 17
The sequence from GCG positions 9 to 181 is considered to be a signal sequence for secretion. In addition, the consensus sequence of the 35 region and -toiu region, which is the region recognized and bound by RNA polymerase, includes the sequence TT from the 33rd to the 38th region.
GAAA and sequence TATAA from position 49 to position 55
A, and the SD sequence, which is the site where ribosomes bind to mRNA, has the sequence AGG from position 101 to position 106.
AGA is considered to be applicable.

Furthermore, the following amino acid sequence is considered to be a signal sequence that instructs the secretion of the protein encoded by the downstream structural gene to the outside of the bacterial cell.

NH, -Met-Lys-Tyr-Leu-Leu-P
ro-Ser-Ala-8la-Ala-Gly-Le
u-Leu-Leu-Leu-Ala-Ala-Gln
-Pro-Thr-Met-Ala-Ala The structural gene of pectate lyase ■ continues further downstream beyond the HcoRI site, so the remaining structural genes were extracted from the chromosomal DNA of Erwinia carotovora Er as shown below. Cloned.

EcoR chromosomal DNA of Erwinia carotovora Er
l, PstI + old ndI [[, also EcoRI + Hi
Pstl-EcoRI fragment containing the pectate lyase III gene (0.3 kb
) as a probe, 2.2k
It was revealed that the fragment hybridized with the PstI-Pstl fragment of b.

Therefore, we attempted cloning according to the policy shown in Figure 3. p
Old ndI [[-Pstl fragment (1,
9 kb) was subcloned into the multiple cloning site of pUc119 to construct pNNll. In addition, the chromosomal DNA of Erwinia carotovora Er was digested with Pstl, and a fragment of about 2.2 kb was extracted from the gel and subjected to 0.8 agarose gel electrophoresis.
tl site and transformed into Escherichia coli HBIOI to show ampicillin resistance.
Transformants were selected by colony hybridization using an EcoRI fragment (0.3 kb) as a probe, and using pectate lyase activity as an indicator. Plasmids were extracted from these strains, and plasmids pN with different pectate lyase I and restriction enzyme maps were extracted.
Got N3. This strain was deposited with the Institute of Microbial Technology, Agency of Industrial Science and Technology (Feikoken Bacterium Deposit No. 10479).

The 0.3 kb Pst I of this plasmid pNN3
-The base sequence of the EcoRI fragment is P of pNN1.
It is completely identical to the slow EcoRI fragment (0.3 kb), and pNN3 is considered to be the originally intended pectate lyase III gene.

2. Penase by Escherichia coli) IB
IOI/pNN 3 was cultured in LB medium containing 50 μg/rd ampicillin until the stationary phase, and after centrifugation, the pectate lyase activity of the supernatant was measured using the method of Sugiura (J.
Gen, Appl, Microbiol, 30.16
7 (1984)). Pectate lyase activity was 150 units/-.

Erbiny Karobou petin plasmid pN
N3 was added to Erwinia carotovora Er (Tohoku University conserved national strain, AMS60B2) using the method of Tto et al. (Agrjc).

Biol, Chem, Dish, 293 (198B)) was transformed by electroporation, and strains showing resistance to ampicillin were selected. Note that this strain was not consigned to the Microbial Technology Research Institute. The transformed strain was incubated overnight in LB medium containing 100 μs/d of ampicillin.
Culture was performed with shaking at 0°C. After centrifugal sterilization, remove the culture supernatant for 20 m
It was dialyzed against M potassium phosphate buffer and reconstituted in a CM-) Jovar column equilibrated with the buffer. Elution is 0~
The active fractions were collected and concentrated by ultrafiltration and applied to a 5 ephadex G-75 column (
2.5φ x 90cm). The active fractions were collected, passed through a hydroxyapatite column, eluted with 10 to 200 mM potassium phosphate buffer (pH 6, 8), and the pectate lyase activity of each fraction was measured. The results are shown in Figure 4, and pectate lyase (■) is the conventionally known pectate lyase (■).

It was eluted at a different position from ①, and showed strong activity in both positions, which was previously unknown. Produced pectate lyase I
The total activity of , Il, and III was about 5 times that of the wild strain.

The optimal pH of purified pectic acid lyase ■ is 10.0
(Figure 5) It was stable in the pH range of 6 to 11 (Table 2), the optimum temperature was 60°C (Figure 6), and it was stable at temperatures up to 40°C (Figure 7). It was also activated by calcium ions (Table 3) and inhibited by EDTA and EGTA.

M e t a 1 activity
(units/rut)Ca
28, 5Cd
<1Zn
OCu
<1Mn OSr
IMg
<1Ni
06゜0 7.0 B, 0 9.0 10.0 ni-phosphate K-phosphate Tris-HCI Trts-) ICI Caps-NaOH [Comparative example] Wild strain of Erwinia carotovora was incubated overnight in LB medium for 30 days.
Cultured with shaking at °C. After sterilization by centrifugation, the culture supernatant was passed through a hydroxyapatite column and eluted with 10 to 20 hM potassium phosphate buffer (pH 6,8), and the pectate lyase activity of each percentage was measured. The results are as shown in FIG. 4, with almost no activity observed in both pectate lyase (2).

〔Effect of the invention〕

According to the present invention, a DNA sequence related to the expression and secretion of pectate lyase was provided, and by using this DNA sequence, the production yield of pectate lyase by a microorganism was increased.

Furthermore, a novel enzyme, pectate lyase (■), was provided.

[Brief explanation of the drawing]

FIG. 1 is a restriction enzyme map of pNN 1, and the region indicated by [ ] is the region containing the DNA molecule of the present invention. Figure 2 shows the base sequence of the pectate lyase III gene containing the DNA molecule of the present invention, the amino acid sequence of pectate lyase determined from the sequence, and, for comparison, the pectate lyase III gene of the invention of JP-A-63-68087. The nucleotide sequence and amino acid sequence of the gene are shown. In this figure, the * mark indicates the base portion that matches the pectic acidase I gene and the ■ gene, and the boxed portion indicates the portion where the amino acid sequences of the two match. FIG. 3 shows a method for constructing a plasmid containing the pectate lyase III gene containing the gene sequence of the present invention. The part indicated by the thick black line is E, carotovoraEr.
The region derived from the chromosomal DNA of The white thick line is the re-cloned E, caroto.
The region derived from the chromosomal DNA of voraEr is shown. Figure 4 shows E, CarOtO containing plasmid pNN3.
The elution curve when the culture supernatant of VOraEr was purified using a hydroxyapatite column is shown. In addition, as a comparative example, IE without plasmid, carotovora
■ Showing the results when Er culture supernatant was similarly purified.
. ■ and ■ indicate pectic acid lyase r, n, and m, respectively. O-O is wild type, ... is E, ca containing pNN3
rotovora Er results are shown. Muum indicates the concentration of potassium phosphate used for elution. FIG. 5 shows the optimum pH of pectate lyase (■). pH
7,0,7,5 is 50mM potassium phosphate (×). pH 7,4 to pH 9,0 is 50mM Tris-HCI
(Δ), pH 8,9 to pH 10,8 is 50mM Ca
Measured using ps-NaO)I (○). FIG. 6 shows the optimum reaction temperature of pectate lyase (2), and FIG. 7 shows the temperature stability of pectate lyase (2).

Claims (1)

[Claims] 1) A DNA molecule or a derivative thereof encoding a region related to the expression and secretion of a protein comprising the following DNA sequence [There is a gene sequence] 2) For secretion of a protein comprising the following amino acid sequence A DNA molecule encoding such a peptide or a derivative thereof NH_2-Met-Lys-Tyr-Leu-Leu-
Pro-Ser-Ala-Ala-Ala-Gly-L
eu-Leu-Leu-Leu-Ala-Ala-Gl
n-Pro-Thr-Met-Ala-Ala 3) The protein is pectate lyase I of Erwinia bacteria.
Region related to protein expression and secretion according to claim 1 or 2, which is a II gene 4) Pectate lyase III (1) having the following properties
Action Acts on polygalacturonide, cleaves the α-1,4 bond of galacturonic acid, and produces unsaturated galacturonide with a double bond at the reducing end. (2) Substrate specific pectin, deesterified pectic acid, α-1,4
It acts on oligogalacturonide, which is an oligomer of galacturonic acid connected by a bond, and whose reducing end is an unsaturated galacturonide. (3) Optimum pH The activity is maximum at pH 10.0, and it is stable in the pH range of 6 to 11. (4) Optimal temperature and thermal stability The optimal temperature is 60°C, and it is thermally stable up to 40°C. (5) Effect of metal ions and inhibitors It is activated by Ca ions, and its optimal Ca concentration is 0.
It is also inhibited by EDTA and EGTA. (6) Molecular weight The molecular weight is approximately 36,000 as determined by SDS polyacrylamide gel electrophoresis. 5) Transform Escherichia coli or bacteria belonging to the genus Erwinia with a recombinant plasmid containing the pectate lyase III gene or its derivative, culture the resulting transformed strain, and obtain pectate lyase III from the culture. A method for producing pectate lyase III, characterized in that: