JPH02131582A - Deoxyribonucleic acid - Google Patents

Abstract

PURPOSE:To provide a novel DNA having a specific base sequence and autonomous replicating ability and capable of efficiently producing an useful peptide, protein, etc. CONSTITUTION:Autonomous replicating sequence DNA of the mammal cell has a base sequence expressed by the formula. The DNA is produced by the following method: DNA is taken out from a mammal cell and treated with a proper restriction enzyme to give a DNA fragment having proper size, which is then blended with DNA linking protein to afford a DNA-protein linked product. The aimed DNA can be obtained from the DNA-protein linked product by applying ordinary protein separating and obtaining means such as antigenantibody reaction. Gene product can be produced using selfrenewal ability of the resultant DNA sequence in a cultured cell or by a genetic animal and production of a plasmid containing the DNA, mammal cell transformed with the above-mentioned plasmid and gene product obtained by using the transformed cell are useful.

Description

[Detailed description of the invention] <Industrial application field> The present invention relates to a novel DNA.

Conventional technology> Methods for producing peptides using genetic engineering include a method in which Escherichia coli, Bacillus subtilis, etc. are made to produce peptides, proteins, etc. using plasmid, and a method in which peptides, proteins, etc. are produced in a host using viral DNA. Methods for producing proteins and the like are known.

However, these methods are not necessarily satisfactory in terms of plasmid stability, limited cell types, and production efficiency.

The present inventor has developed a self-replicating sequence derived from mouse cells (Auto
nomous Replicatin3 Sequen
ce, A R S ) containing the DNA fragment! #
This fragment is an Eco fragment with approximately 2500 bases.
It was reported that R1 and 13gl I+ cleavage fragments (Reference 1).

The inventor investigated the properties of this ARS fragment and found that ARS is c-myc ij! We discovered that c-myc protein has a specific affinity with DNA-binding proteins such as myc-protein, which is a gene product, and that c-myc protein binds to the c-myc gene itself and regulates its expression. Based on these findings, we have made it possible to isolate and obtain ARS from various mammalian cells using myc-protein, etc., and furthermore, we have made it possible to isolate and obtain ARS from various mammalian cells using myc-protein, etc.
The present invention was completed by discovering that useful bebutides, proteins, etc. can be efficiently produced using ARS).

Structure of the Invention The present invention relates to a self-replicating sequence DN^ of mammalian cells,
In addition, regarding a plasmid containing the self-replicating sequence DNA, a promoter, and a gene for producing vebutides (including a translation initiation codon) of a complemented mammalian cell, and a mammalian cell transformed with this plasmid, furthermore, The present invention relates to a method for producing bebutides using self-replicating sequence DNA, plasmid or transformed cells.

ARS is an origin of replication when eukaryotic chromosomes self-replicate. To obtain this, do the following:

That is, DNA is extracted from mammalian cells and treated with an appropriate restriction enzyme (preferably a six base recognition enzyme, for example, old ndl).
ll, EcoRI, BamHI) to obtain DNA fragments of appropriate size (usually 1000 to 1000
000bp) and mixed with a DNA-binding protein to generate a DN^-protein conjugate.

A DNA-binding protein is a protein that exists in the cell nucleus and controls the functional expression of DNA, has an affinity for DNA, and is classified as a non-histone protein. For example, c-myc protein (see reference 13), V
-01,! IIC protein (see reference 14), N-n
+yc protein (see Reference 15), c-myb protein (see Reference 15), v-myb protein (see Reference 15), c
-fos protein (see reference 15), v-fos protein (
(See Reference 15). p53 (see reference 15), SV40
T antigen (see Reference 16) and RB gene product (Reference 1
Examples include myc protein, myb protein, etc. (see 7).

After the DNA-protein complex is produced, the desired DNA can be obtained by applying ordinary protein separation and obtaining means such as antigen-antibody reaction.

That is, if it is difficult to obtain a DNA-protein complex as it is, by binding it with an antibody against the DNA-binding protein and further binding a substance that specifically binds to this antibody, such as protein A, A complex with a fairly large molecular weight is formed and easily precipitated, making it easy to separate and obtain.

Antibodies may be prepared using conventional methods, such as N-my
c gene third exon (part specific to N-myc)
is expressed using Escherichia coli, and the produced protein is purified and then immunized into mice using a conventional method, and the IgG fraction is collected from the antiserum and used. Also, commercially available products (for example, Onkor's anti-m
yc protein antibody; α-myc) may also be used. Protein A is a bacterial cell suspension of Staphylococcus aureus (P7155: Sigma), a carrier-conjugated product (A8
arose FP^-l; Cosmo Bio Inc., Sep
haroseCL-4B (Pharmacia) is also commercially available.

DNA can be isolated from a DNA-protein complex (e.g., a DNA-myc protein antibody-protein A complex) by using a conventional method, such as using a reagent such as 2-mercabutoethanol or decomposing the protein. enzymes (Proteas)
e K: Sigma, Protease No. 24
568: Merck & Co.) to decompose the protein portion and remove it by phenol extraction to obtain DNA (see Reference 10).

The DNA fragment that has specific affinity with the DNA-binding protein thus obtained contains ARS DNA. That is, an extremely important fact discovered by the present inventors is that DNA-binding proteins and ARS have a very strong affinity.

ARS-containing DNA fragments can be added to ARS as needed.
It can be used as a DNA fragment of an appropriate length containing only RS or ARS. The operation and techniques such as DNA processing and screening for producing useful substances such as Bebutyto using this ARS can be done by referring to the examples and using general techniques. It will be easy for a knowledgeable person to understand and implement.

In addition, it is quite possible that the base sequence of ARS may be slightly different due to differences in the animal species of the cell from which it is derived, due to differences in the species of the cell, or due to ARS in other parts of the same cell. Conceivable. Therefore, ARS does not necessarily have to be completely the same as the base sequence of ARS isolated as described above in order to be used, and some bases may be replaced or removed, or bases may be added. Whether or not it is possible and suitable for efficient production of the target product can be confirmed by ordinary level tests and research with reference to the explanations in this specification.

Regarding the present invention, ARS that can be isolated or used include mice, rats, guinea pigs, cows, horses, sheep, goats,
Examples include those derived from cells of rabbits, monkeys, chimpanzees, humans, etc.; however, those derived from mouse or human cells, for which cell culture techniques are well developed, are particularly suitable.

Although there are no particular restrictions on the cells used as raw materials for obtaining ARS-containing DNA, it is convenient to use cells that produce large amounts of DNA-binding proteins. Examples include c-Illyc protein, v-myc protein,
N-myc protein, c-myb protein, v-myb protein, c-fos protein, v-fOS protein, p53, SV4
0 T antigen, cells producing RB gene products, such as human HL-60 cells, human IMR cells, human RaJi
There are cells, mouse FM3AM cells, etc. Conventional genetic recombination techniques may be used to construct the plasmid of the present invention containing ARS, which is suitable for producing bebutides (Reference 7
reference).

In addition, generally known sentinel cells and techniques can be used for the introduction of plasmids into cells, the types of cells used, and cell proliferation methods, and methods that will be improved in the future, cultured cells, culture media, etc. It may also be possible to apply (see References 8 to 10).

Some examples of common methods will be further explained below.

Examples of promoters that can be used include various cell-derived promoters such as the thymidine kinase promoter and immunoglucose purine promoter, or promoters derived from mammalian cells such as the SV40 T antigen promoter, early promoter, and herpesvirus thymidine kinase promoter. Examples include promoters of infecting viruses.

A normal ATG can be used as the translation initiation codon.

Examples of the peptides to be produced include insulin, growth hormone, interferons, tumor necrosis factor, lymphokines such as interleukin, peptides of various enzymes, proteins, and glycoproteins that can be used as pharmaceuticals. can.

Examples of genes for producing peptides include a DNA encoding the amino acid sequence of the peptides described above, and a gene in which a BoliA signal for terminating translation is arranged 3° downstream of the DNA.

For the production of the plasmid of the present invention, D
The NA fragment, the promoter translation initiation codon, and the gene for producing peptides are linked together in a desired sequence, and then ARS is added to form a circle.

Note that there is no need to specifically consider the direction and position of the ARS.

The obtained plasmid can be introduced into various mammalian cells to produce transformed cells using transfection using calcium phosphate, microinjection method, liposome method, brotoplast fusion method, etc. can. Examples of cultured cells include mouse NS-1 and F.
M3A, human HL-60, u937, Daudi and Raji, etc. may be mentioned.

The desired bebutides can be produced by propagating these transformed cells.

In this case, one of the features of the present invention is that the cell from which the ARS was derived and the cell to which the plasmid is introduced do not need to be the same species.

The transformed cells can be cultured using conventional culture methods for the cells used, such as DMEM (Du
lbecco's modified Eagle's
3 in the presence of carbon dioxide
There is a method of culturing at 7°C or growth within the peritoneal cavity of an animal (see References 8 to 1O).

If the produced bebutides are free in the culture medium, they can be subjected to conventional separation methods such as centrifugation or gel filtration, or if they are accumulated in cells, they can be processed by normal separation methods after crushing the lipids. or from ascites by conventional methods.

EXAMPLES The present invention will be further explained below with reference to Examples, but is not limited thereto.

The plasmid pMIJ65 (Reference 1) was treated with EcoRI and Bgl I+ to obtain a DNA fragment with a base pair number of about 2500. This fragment was added to EcoRI-B of plasmid pKsV10 (manufactured by Pharmacia).
It was inserted into the glI1 region to create plasmid pARS65.

Blasmid pAGO (Reference 2) was treated with BaIIIHI to isolate a fragment containing the herpesvirus-derived thymidine kinase gene. This fragment was inserted into the Ban+HI site of the above plasmid pARS65 to prepare plasmid p65-tk. This plasmid was grown in E. coli Kl2 C600.

(E. coli Kl2 C600 ARS-1, Chokoken accession number FERMBP-1443).

Blasmid pMTIOD (Reference 3) was treated with BaII+t
11 and Pvu II, the SV40T antigen gene with the early promoter was isolated. P of the gene
A Ram}II linker (manufactured by Takara Shuzo) was attached to the vu II site.

The resulting fragment was transformed into Ba of plasmid pARS65.
m}II site to obtain plasmid p65-T.

3) Expression of protein (thymidine kinase) The plasmid p65-tk obtained in 1) was transformed into FM3Atk cells according to the liposome method (Reference 4).

When performing transformation, use 20mM containing 50mM EDTA.
Using M Tris buffer (pl{ 7.5) and phosphatidylserine, liposomes were prepared using a known method (
It was prepared according to literature 5).

After transformation, cells were cultured in DMEM containing 100 calf serum at 37° C. in the presence of 50% carbon dioxide. Two days later, the medium was replaced with HAT medium.

Transformed cells, namely FM3Atk'' cells, appeared after about 1 week. After 2 weeks, each colony was isolated and cultured in IAT medium until the number of cells reached about 10. During this period, the colonies multiplied by about 60 times. The number of times has passed.

When attempting to transform 1,000 cells using this method, approximately 300 to 400 transformed cells were obtained. Therefore, it was confirmed that p65-tk was proliferating in FM3Atk- cells and that the thymidine kinase gene was expressed.

4) Examination of copy number From the above 10' cells, the Hart (}Iirt) method (
Low molecular weight DNA was extracted according to Reference 6). To confirm that the plasmid had replicated in the transformed cells, the obtained ON8 was treated with the restriction enzyme Dpn I.

The adenine moiety of p65-tk introduced into FM3Atk- cells is methylated, but the one replicated in the cells is not methylated. Dp mouth I is methylated DN
Since only A is selectively cleaved, the plasmid that has replicated in the cell is not cleaved, but only the plasmid that has entered the cell is cleaved into multiple DNA fragments. Therefore, plasmids replicated in cells can be easily distinguished by electrophoresis.

After Dpn I treatment, DNA was separated by agarose gel electrophoresis (Reference 7), and this was subjected to Southern tube analysis (Reference 11). That is, hybridization was performed using p65-tk labeled with 32p as a probe, and then X
When autoradiography was performed using photosensitive film and bands that hybridized with the probe were detected, p65-t was detected in all 20 clones examined.
k as extrachromosomal DNA? It was confirmed that 311.

The number of copies per cell was 100-200 based on photosensitivity. This plasmid was used to transform cells into HAT medium by 10%
Even when the cells were cultured in DMEM containing F calf serum, stable replication was observed, and no alterations were observed in the DNA.

Furthermore, it was confirmed that this plasmid stably existed in cells even after 150 times of multiplication.

5) Replication of plasmid pARS-65 in various cells pARS-65 was transfected into mouse NS-1 cells, human HL-60 cells, and human U937 cells, respectively, according to the above method, and R
The cells were cultured at 37° C. in the presence of constant carbon dioxide using 11M1 1640 medium. After 40 hours, extrachromosomal low-molecular-weight iDNA was analyzed according to method 4) above. As a result N
It was established that approximately 500 copies of pARS-65 were replicating in S-1 cells, approximately 10,000 copies in IL-7+55: and approximately 100 copies in U937 cells.

Therefore, it was confirmed that pARS-65 replicates in cells of species other than mice, and it was suggested that p65-tk also has this replication ability.

Example 2 1) Isolation of ARS from human cells (see Figure 3) Human HL-
The DNA of 60 cells was subjected to the SOS-Proteinase K method (pr
teinase κ) (Reference 7), and the old nd
Processed with ■. From the obtained DNA fragment, myc
In order to extract a DNA fragment having affinity with the protein, the following operations were performed according to a known method (Reference 12). That is, the DN^ fragment was added to HL60 nuclear extract (
(a large amount of +nyc protein is present) and incubated at 0°C for 30
A DNA-myc protein conjugate was generated by reacting for a minute. Next, an antibody against myc protein (αmyc, manufactured by Onco) was added, and DNA-ffiyc protein - a myc? One coalescence was formed. Furthermore, an aqueous solution of Staphylococcus aureus containing protein^, which specifically binds to αBc, was added to form a DNA-myc protein-αmyc-protein complex. Since the complex precipitates, it is separated and 0. 1kSD
S and O. Tris buffer containing 1M sodium chloride
After washing with (pH 7.5), 7mM containing l0SDS.
Add 2-mercabutoethanol aqueous solution and incubate at 30°C.
DN8 was allowed to react for 0 minutes. 1 of the reaction mixture
The supernatant was isolated by centrifugation at 5,000 x g for 5 minutes.

This was extracted with phenol to obtain the desired DN^ fragment, and then the old n of pUc19 (manufactured by Pharmacia) was extracted with phenol.
d Inserted into the II+ site. Furthermore, the number of base pairs of the obtained DNA fragment was examined by agarose gel electrophoresis and was found to be approximately 200. The obtained plasmid was purified by E. coli K12C 60
(E. coli Kl2 C 600
ARS-2, Choikoken accession number FERM BP-14
44).

The above IL-60 nuclear extract was prepared as follows. That is, culture medium of HL-60 cells (5X10'/II
Cells were collected by centrifugation and washed with phosphate buffer and physiological saline. This was further diluted with a hypotonic aqueous solution (2
0mM }IEPES. p}l 7.5, 5InM potassium chloride, 0.5mM magnesium chloride, 0.5+nM
dithiothreitol, 0.2+nM sucrose). This was suspended in 5 ml of a hypotonic aqueous solution (the above aqueous solution minus the glue) and allowed to stand for 10 minutes. This was raised and lowered 40 times using a Dounce homogenizer, and then 3000
Centrifugation was performed at X g for 10 minutes to obtain a precipitate.

This precipitate is the nucleus, so add it to 2.5 ml of aqueous solution (5 ml).
ml HEPES, pH 7.5, 1 (n sucrose) and temporarily stored in liquid nitrogen. This was slowly dissolved at 0°C, and a 5M aqueous sodium chloride solution was added to a final concentration of 0.
The solution was added to 1M and treated at θ°C for 5 minutes. This was centrifuged at 15,000 x g for 20 minutes, and the supernatant was obtained as a nuclear extract.

Above E. Blasmids grown in coll K12 C600! #Release (Reference 7), l{indll! When treated with pHL, the plasmid was not cleaved with old ndll+, suggesting that the plasmid was rearranged by the bacterium, and this plasmid was named pHL IIyC.

Plasmid pUc19 contains B in addition to }find III.
Since it has restriction enzyme cleavage sites such as amHI and Narl, the above plasmid was treated with Ram}II and Narl, and the DNA fragment having the smaller molecular weight of the two generated fragments was isolated.

Using this fragment as a template, we prepared a 32p-labeled probe and performed Southern hybridization with HL-60 cell DNA (Reference 11). As a result, we found that the probe hybridized with HL-60 fiDNA8. It was confirmed that the fragment having the NarI-Bam}11 site at both ends (NarI-Bam}II fragment) contained DNA derived from l{L-60 cells.

When the base pair number of the Narl-BaIIltll fragment was examined by agarose gel electrophoresis, it was found to be approximately 200.
It was ~300. The old n d II+ site and Narl site of pUc19 are 131 base pairs apart, and the old n d II1 site and Bam
The HI site is 35 base pairs apart, and the Pstl site and B
am old site is 25 base pairs away. Furthermore, the Pst1 site was retained in plasmid p}ILmyc. Therefore, the number of base pairs of DNA derived from IL-60 cells in the plasmid pHLmyc was estimated to be approximately 120. After elucidating this base sequence, we found that Borylinka's old n d
99 bases were confirmed in the II1 site. The arrangement is shown below.

GTATGATACAGATCGTGAGAATACG
TAGCCTCGTCACCATTGAGCAGTAC
GTTGTACTGGAAGAGACCATGCTCT
GACACTGCACGACGTGACAGCATCInvert repeats for this sequence.
ted repeat), it was suggested that it may have a hairpin structure as shown in FIGS. 5 and 6. Based on this, from 12 to 59 of the 99 bases above
or l7 to 74 are the most important self-replicating sequences (ARS
) is considered to be the base sequence of

2) Confirmation that plasmid ILmyc has ARS IL-60 cells were transformed with pILmyc using the liposome method, and then the copy number was examined according to the above method. Met.

Blasmid pmyc (manufactured by Onco, structural gene of myc and Rous sarcoIIla virus)
The myc structural gene and LTR were isolated by treating the myc long terminal repeat promoter (LTR) with Bam old, Hindll+, and EcoRI. This product was inserted into the EcoRIBam}II region of p}ILmyc to create a plasmid pARSmyc. Human U937 cells were transformed with this plasmid by the liposome method, and cultured at 37°C in the presence of clear carbon dioxide using RPMI1640 medium containing 1096 calf serum.

After 3 days, the amount of lyc gene mRNA in the cells was examined using the Northern hybridization method (Reference 7), and p
When compared with the amount of mRNA gene in U937 cells that do not have ARS, it was about 100 times higher. Therefore, it was considered that mRNA was transcribed from the myc gene of plasmid pARsmyc.

Group X ■1 l) Subcloning of human c-myc gene human c
-myc gene (Mol. Cell Bio+.,
The former ndlll-Kpn I region (approximately 1200 b
p) and }Iindllll-Pst I region (approximately 2
00bp) were subcloned into pUc18 and pUc19, respectively. The plasmids of the clones were named pmyc (H1K) and pmyc (}I-P), respectively.

2) Hind II! -κpnl fragment and old ndlll-PstI fragment and c-
Binding to myc protein Gel shift assay is a method that has been frequently used in recent years to examine the binding between DNA and protein. This is an isotope-labeled DN
A simple method, such as binding A to a protein and simply running it on a polyacrylamide gel, converts the DNA-protein complex into a DNA-protein complex.
This method takes advantage of the fact that the movement of is delayed in gel (see Reference 18).

A nuclear extract was taken from IL-60 cells, which produce a large amount of C-1yc protein, and this was used as a c-myc protein source.
The old ndlll -Kpn I fragment and the old ndTI1 -Pst I fragment of the c-myc gene were mixed with the nuclear extract, incubated at 30°C for 15 minutes, and then poured onto a 5t polyacrylamide gel.

On the other hand, the above extract was reacted with c-myc antibody and treated with each fragment in the same manner. As a result, both fragments bound to the protein, but this was inhibited by prior treatment with c-myc antibody.

From this, the Hindll-Pst I fragment (
It was found that there is a c-myc protein binding site within 210 nucleotides).

pBc (H-κ) with former ndIII and Kpn
In I, pmyc (II-P) was replaced with old ndll+ and P
stI to obtain [lN^ fragments, which were mixed with c-+nyc protein, antibody, protein A, and proteolyzed and deproteinized in the same manner as in Example 2. Hindlll-κpnl fragment and old ndlll-Pst I fragment were obtained.

The base sequence of this old ndlll-Pst I fragment was determined by the dideoxy method. This is shown below.

+ +0
20AAGCTTGT
TT GGCCGTTTTTAGGGTTTGTTG
GAATTTTTTTTTTCGTCTATG
TACTTTGTGAATTATTTCACCG T
TTGCCATTACCGGTTCTCC ATA
GGGTGATGTTCATTAGC AGTGG
TGATAGGTTTAATTTT CACATCT
CTTATGCGGTTGA ATAGTCACC
TCTGAACCAAT TTTTCCTCCAG
TAACTCCTCTTTCTTCGGACCT
TCT. GCAG The predicted secondary structural formula of this sequence is shown in FIG. In addition, pARs65 of mouse ARS and pHLmy of human ARS
FIG. 8 shows a portion complementary to c and its vicinity. The asterisk indicates the part where the bases match, and the underlined part corresponds to the stem (axis) part of the stem-lube structure that is considered essential for ARS, and is thought to be an important ON^ sequence as the starting point of self-replication. In particular, TGAATAG
TCAC is considered a very important sequence. Also, a portion forming a loop, for example CATCTCTTTATG
GGT is considered to be important as a recognition site for DNA binding protein (myc protein), and the sequence CATC
It can be said that TCTTTATGCGGTTGAATAGTCAC is used for actual expression of ARS activity.

Based on these facts, the self-replication ability of the above DNA sequence or various DNA sequences containing it can be used in cultured cells or in transgenic animals.
plasmids containing the DNA, mammalian cells transformed with the plasmids, and methods for producing gene products using them are considered to be extremely useful.

Various embodiments using self-replicating sequences consisting of the above DNA sequences are shown.

(a) Plasmid containing self-replicating sequence DNA, promoter and peptide production gene (including translation start codon) of mammalian cells (b) Self-replicating sequence DNA, promoter and peptide production of mammalian cells A method for producing peptides by propagating in cells a plasmid containing a gene for peptide production (including a translation initiation codon). A method of injecting a plasmid containing a codon) into a fertilized egg of a mammal, and producing a transgenic animal from this fertilized egg. (e) Self-replicating sequence DNA of sentinel cells. A method for producing peptides by culturing the above-mentioned transformed mammalian cell (f), which has been transformed with a plasmid containing a promoter and a peptide-producing gene (including a translation initiation codon). E. plasmid containing plasmid pmyc(11-P). co
li MV1184 is stored as FERM BP-1932 at the Microbial Technology Research Institute.

Example 4 In the same manner as in Example 2, various plasmids were obtained using various lipid nuclear DNAs, proteins, and antibodies.

The relationship between plasmid names and their raw materials is shown in the table.

pmyc (H-κ), pmyc (H-P),
pIMR-N and pRJ-53, respectively, in Example 1-3.
) The cell was introduced into cells using the liposome method as described below, and the copy number was examined. Blasmid names, cells used and copy numbers are shown in the table.

Effects of the Invention> According to the present invention, plasmids are efficiently replicated in various mammalian cells by the action of ARS, that is, the number of copies of plasmid per cell is large, so the production efficiency of gene products is excellent. Therefore, the present invention is a method for producing bebutides using genetic engineering. References Document I Mo1. Cell. BIol,. 5. 56
3-568 (1985) Reference 2 Proc. Natl
．． Acad. Sci. USA, 76.3755 (19
79J Reference 3 J. Virology, 48, 481-
491 (1981) Reference 4 Science, 215
, 166 (1982) Reference 5 Proc. Natl.
Acad. Sci. USA, 75.4194 (197
8) Reference 6 J. Mo1. Bio1. ,93,503-
517 (1975) Reference 7 T. Maniatis
et al. Molecular ll:loning
．． Cold Spring Harbor Labor
atory (1982) Literature 8 Edited by Munemura Cell Culture Manual Kodansha Literature 9 κ. Habel et al.
．． ,Foundamental Technique
n VIrology, Academjc Press
,N. Y. (1969) Literature lOκruse & Pa.
tterson ,Tissue CultureAc
academic Press,N. Y. (1973) Reference 11 J. Mo1.8io+. , 26, 385-36
9 (1967) Reference 12 MoIJe11.8io+
．． , 3, 1958-1968 (1983) Reference 13
Science 225, 718-720 (198
4) Reference 14 Nature 296, 262-264
(1982) Reference 15 Annu. Rev. Bio
che+++. 52, 301-310 (1983) Reference 11i Call 13, 165 (1978) Reference 1
7 Science 235. 1394-1399
(1987) Reference 18 Nucleic Acid R
es. ,9 3047 ~306G (198!)

[Brief explanation of drawings]

Figures 1 to 4 are schematic diagrams of plasmid construction;
Figures 7 to 7 are estimated secondary structures. FIG. 8 is a comparison diagram of DNA sequences.

Claims (1)

[Claims] DNA with the following base sequence [There is a gene sequence]