JPH02124092A - Production of batroxobin by genetic recombination - Google Patents

Abstract

PURPOSE:To obtain a gene-recombinated batroxobin by constructing a manifestation vector containing DNA capable of coding amino acid sequence of batroxobin and culturing a host cell transformed thereby, etc. CONSTITUTION:A DNA capable of coding a fused protein between batroxobin and another polypeptide is integrated into a manitestation vector functional in a coliform bacillus host cell and the coliform bacillus host cell is transformed by the resultant batroxobin manifestation vector. A desired transformant is selected and cultured to manifestate a batroxobin-containing fused protein. The manifestated fused protein is then purified and subsequently cut, thus obtaining the desired batroxobin.

Description

DETAILED DESCRIPTION OF THE INVENTION Field of Industrial Application The present invention relates to batroxovi/ produced by genetic recombination technology. Further details: Expression vector containing DNA encoding batroxobin alone or together with DNA encoding other polypeptides, transformant carrying the expression vector, method for producing batroxobin using the transformant , and the genetically recombinant batroxobin obtained by the method.

PRIOR ART AND PROBLEMS TO BE SOLVED BY THE INVENTION Natural batroxobin is a thrombin-like enzyme protein produced by South American rattlesnakes. Since this substance has the effect of specifically cleaving fibrinogen A chain to produce soluble fibrin, it can be used for various diseases such as circulatory system diseases, such as blood circulation disorders due to decreased cardiac function, especially inhibition of peripheral blood flow. useful for the prevention and treatment of

Conventionally, natural batroxobin has been obtained by isolation and purification from the venom of the above-mentioned viper, as there was no known human method to obtain it, and there were concerns about stable supply, and the problem was that it was expensive. was.

Means for Solving the Problems In order to stably and inexpensively supply batroxobin, the present inventors have conducted extensive research with the aim of commercializing the production of this substance using genetic recombination technology. That is, a batroxobin expression vector is constructed by inserting DNA encoding batroxobin into an appropriate expression vector, a host cell is transformed with the expression vector, the obtained transformant is cultured in a medium, and from the culture, An attempt was made to isolate batroxobin.

By the way, the DNA sequence encoding natural batroxobin is already known, and has been disclosed, for example, in JP-A-63-49084 together with its deduced amino acid sequence.
The DNA is derived from Escherichia coli, which has been deposited at the National Institute of Microbiology, Agency of Industrial Science and Technology under deposit number FERMP-8913.
It can be obtained by treating plasmid pBat-2, which is isolated from D H1 (pBat-2) in a conventional manner, with a restriction enzyme. D encoding natural batroxobin
The NA sequence and the deduced amino acid sequence are shown in FIG.

In the figure, amino acid numbers -24 to -1 represent the prepro sequence, 1
~231 shows the amino acid content sequence of natural batroxobin.

When producing batroxobin by genetic recombination technology, various host-vector systems can be used. Many hosts derived from prokaryotes, such as Escherichia coli and Bacillus subtilis, or eukaryotes, such as yeast and mammalian emitters, as well as expression vectors suitable therefor, are known to those skilled in the art. They can be appropriately selected, modified and used to suit expression of the batroxobin gene.

However, as a result of repeated research aimed at developing a host-vector system in which the batroxobin gene is efficiently expressed, the present inventors have found that batroxobin was not detected by direct expression in microbial hosts, especially E. coli hosts. However, we found that it can be expressed as a fusion protein with other polypeptides. That is, a DNA encoding a fusion protein of batroxobin and Ike's polypeptide is inserted into a functional expression vector in an E. coli host, and the E. coli host is transformed with the obtained batroxobin expression vector to produce a desired transformant. By selectively culturing in a medium, we succeeded in expressing a batroxobin-containing fusion protein. The expressed fusion protein was then purified and cleaved to separate the desired batroxobin from other polypeptides. Furthermore, the isolated protein was refolded to obtain biologically active batroxobin.

On the other hand, yeast and higher eukaryotic cells, such as mice92
We also succeeded in directly expressing batroxobin by constructing an expression vector compatible with 9 cells, transforming an appropriate host using the vector, and culturing the obtained transformant. In this case, biologically active batroxobin can be obtained without refolding.

The term "genetically recombinant batroxobin" of the present invention includes natural batroxobin produced by genetic recombination methods and derivatives thereof. The derivatives of natural batroxobin referred to herein are those obtained by modifying the DNA encoding natural batroxobin by addition, deletion, and substitution of DNA in genetic recombination techniques, or by modifying the DNA encoding natural batroxobin in host cells when expressing the DNA encoding batroxobin. means an enzyme having the enzymatic activity of natural batroquinpine, which can be produced by selecting and changing the type and degree of glyfusylation from natural batroxobin.

Such examples include oligopeptides (e.g., GlyThrGluPheM) at the N-terminus of native batroxobin.
et-1SerGluPheMet-, etc.), batroxobin without natural glyphsylation [for example, natural batroxobin without glyphsylation (no sugar chain), etc.]. Further, the derivatives include those having batroxobin activity among the following fusion proteins.

Further, when batroxobin is expressed as a fusion protein using a prokaryotic cell as a host, a protective peptide is a preferable example of another polypeptide to be fused to batroxobin. Here, the protective peptide refers to an effect that inhibits the expression of batroxobin (e.g., translation inhibition effect) or an effect that degrades the expressed batroxobin (e.g., intracellular A polypeptide that can protect batroxobin from harmful effects on the production of batroxobin, such as degradative action by protease, and can be easily detached from the fusion protein by, for example, appropriate enzymatic treatment, if necessary. means, and furthermore,
It is desirable that the protein has the ability to insolubilize the fusion protein in E. coli by fusing it to batroxobin.

Preferred examples of such protected peptides include peptides constituting the C-domain of somatomedin (peptide C
d), left half part of γ-interferon (γ
- Peptide (LH protein) or peptide Cd constituting the amino acid sequence 1 to 59 of interferon
and a fusion peptide consisting of LH protein (JP-A-62-6
Blood coagulation number χ is present at the C-terminus of each
Examples include polypeptides to which m-factor-like peptides have been added. These protected peptides are easily removed by allowing thrombin to act on this fusion protein, yielding batroxobin.

That is, according to the production method of the present invention, an expression vector containing DNA encoding the amino acid sequence of batroxobin is constructed, host cells transformed with the expression vector are cultured in a medium, and batroxobin is collected from the culture. Accordingly, recombinant batroxobin can be produced.

The manufacturing method of the present invention will be explained in detail below.

Host cells used in the method of the present invention include bacteria (e.g. Escherichia coli, Bacillus subtilis).
acillus 5ubtilis), yeast (e.g. baker's yeast +1 (Saccharomyces cere)
visiae), as well as cultured human cells and cultured animal cells (e.g. CH○ cells, L929
cells, etc.) and cultured plant cells. Preferred examples of microorganisms are bacteria, in particular bacteria belonging to the genus Escherichia (e.g. E. coliHBIOI ATCC 3369).
4, E, coli HBIOI-16FERM BP-
1372, Ecoli MM294 ATCC314
46, E, col 1D) il ATCC338
49) and baker's yeast (e.g. S. cerevisi
ae AH22ATCC38626, etc.), and preferred examples of animal cells include mouse L929 cells and Chinese hamster overly (CHO) cells.

Usually, when a prokaryotic bacterium, especially Escherichia coli, is used as a host cell, the expression vector includes at least a promoter, an initiation codon, and a D encoding the amino acid sequence of a fusion protein of batroxobin and another polypeptide.
It is composed of NA, a stop codon, a terminator region, and a self-replicatable unit. On the other hand, when eukaryotes, such as yeast or animal cells, are used as host cells, the expression vector is composed of at least a promoter, an initiation codon, a peptide, a DNA encoding the amino acid sequence of batroxobin, and a stop codon. is preferred. Additionally, enhancer sequences, 5''- and 3'-non-coding regions of the Baturosobin, splicing junctions, polyadenylation sites and self-replicating units can also be inserted.

To explain the components of the above expression vector, first, the self-replicable unit preferably contains a selectable marker for transformants (for example, ampicillin resistance).

When using bacteria as a host, the term promoter refers to a promoter-operator region consisting of a promoter, an operator, and a Shine-Talgarno (SD) sequence (eg, AAGG, etc.). Examples of such promoters include conventional promoter-operator regions (e.g., lactose operon, PL-
promoter, trp-promoter, etc.).

An example of a promoter used when yeast is used as a host is the 5 promoter. Examples of promoters used for expression in mammalian cells include the HTLV-LTR promoter SV40 early and late promoter, mouse metallothionein I (MT)
- promoters, etc.

A preferred start codon is the methionine codon (ATG
).

The DNA encoding the signal peptide is pho.
5, t-PA and batroxobin signal peptide encoding DNA.

DNA encoding the amino acid sequence of batroxobin, a fusion protein of batroxobin and Ike's polypeptide, or a signal peptide can be obtained by, for example, synthesizing partial or total DNA using a DNA synthesizer, or by using a transformant [ For example, E. coli DH-1 (pBa
t2) FERM P-8913, etc.], the natural batroxobin cDNA or genomic DNA inserted into a vector [e.g., pBat=2, etc. 1] is treated in a conventional manner (e.g., restriction enzyme digestion, bacterial alkali The DNA can be roughened by dephosphorylation using phosphatase, phosphorylation using T4 polynucleotide kinase, and ligation using T4 DNA ligase.

Examples of the stop codon include commonly used stop codons (eg, TAG, TGA, etc.).

Terminator regions include natural or synthetic terminators (eg, synthetic rd phage terminator 1, etc.).

A self-replicable unit is a DNA sequence that is capable of autonomously replicating the entire DNA of the expression vector it occupies in a host cell, including natural plasmids, artificially modified plasmids (e.g., DNA prepared from natural plasmids). fragments) and synthetic plasmids. Preferred examples of such plasmids include plasmid pB R322 or an artificially modified version thereof (a DNA fragment obtained by treating pBR322 with an appropriate restriction enzyme) when using Escherichia coli as a host cell. For example, pJDB219, pJDB207, p
MMIO2 is mentioned, and when animal cells are used as host cells, for example, plasmid pS V 2dhfr A
TCC37145, plasmid pdBPV-MMTne
o ATCC37224, plasmid pSV2neo
ATCC37149 is mentioned.

Examples of the enhancer sequence include the 5V4Q enhancer sequence.

Examples of the polyadenylation site include the 5V4Q polyadenylation site.

As a splicing junction, for example, SV
There are 40 splicing junctions.

When a bacterium is used as a host, the batroxobin expression vector of the present invention contains a promoter, an initiation codon, a DNA encoding the amino acid sequence of a fusion protein of batroxobin and another polypeptide, a stop codon, and a terminator region. With a replicable unit,
If necessary, use an appropriate NA fragment (e.g., a linker with a restriction enzyme recognition sequence, etc.) sequentially from the upstream to the lower point, using a conventional method (e.g., restriction enzyme digestion, T4
Phosphorylation using polynucleotide kinase, T4 DNA
ligation using ligase). When animal cells, particularly mammalian cells, are used as hosts, the expression vector of the present invention contains DNA encoding the enhancer sequence, promoter region, 5''-noncoding region, start codon, signal peptide and amino acid sequence of batroxobin, stop codon, 3
- The non-coding region, the splicing site and the polyadenylation site can be prepared by sequentially and circularly linking from upstream to downstream into a suitable self-replicable unit by the conventional techniques described above.

Next, the expression vector of the present invention is introduced into the selected host cell. Conventional methods known to those skilled in the art (for example, in the case of E. coli, the Kushner method; in the case of yeast, the sauce (
KUR) method, in the case of animal cells, phosphoric acid/carunium method,
A transformant can be obtained by introducing the vector by microinjection method, etc.).

Next, in order to produce the recombinant batroxobin of the present invention, the obtained transformant containing the expression hector is cultured in a medium.

Typically, the medium contains a carbon source (e.g., glucose, glycerin, mannitol, fructose, lactose, etc.) and an inorganic or organic nitrogen source (e.g., ammonium sulfate, ammonium chloride, casein hydrolyzate, yeast extract, polypeptone, batatotributon, beef extracts, amino acids, etc.). Optionally, other ingredients such as inorganic salts (e.g. sodium or potassium dihydrogen phosphate, dipotassium hydrogen phosphate, magne/rum chloride, magnesium sulfate, calcium chloride), vitamins (e.g.
Vitamin B, ), antibiotics (eg, ampicillin), etc. may be added to the medium.

The medium for animal cells may optionally contain growth promoting substances and/or
Alternatively, commercially available media supplemented with mammalian serum can be used.

The transformant of the present invention is generally cultured at a pH of 5.5 to 8.
．． 5 (preferably pH 7-7.5), 18-40'C (
Preferably at 25 to 38°C), it may be carried out for 5 to 50 hours.

The batroxobin expressed by the transformant is then isolated. When using bacteria such as Escherichia coli as host cells, the cells are first filtered or Collected by centrifugation, cell walls and/or cell membranes were removed using conventional methods (e.g., treatment with lysozyme and/or ultrasound).
Destroy it and turn it into debris. Isolation and purification of the fusion protein from this debris can be carried out using general techniques for the purification and isolation of natural or synthetic proteins [e.g., dissolving the protein in an appropriate solvent (e.g., 8M urea aqueous solution, 6M guanidium salt aqueous solution, etc.). , dialysis, gel filtration, column chromatography, high performance liquid chromatography, affinity chromatography using an anti-batroxobin antibody, etc.]. When yeast or animal cells are used as host cells, the produced batroxobin is separated and usually exists as an active form in the culture solution, so the culture filtrate can be extracted by filtering (or centrifuging) the culture. (supernatant liquid) was obtained, and this 11,! The liquid (supernatant liquid) can be purified by the usual method described above.

In the above, if the host cell is a bacterium such as E. coli,
The protected peptide is removed by subjecting the isolated and purified fusion protein to a suitable enzymatic treatment (e.g., treatment with thrombin if blood coagulation factor XIIIJ prisoner-like peptide or batroxobin is attached to the N-terminus). The target product, batroxobin, is obtained.

By refolding the thus separated batroxobin, biologically active batroxobin can be obtained. The present inventors have surprisingly discovered that refolding in the presence of glycerin and in the absence of a reducing agent results in much more efficient refolding than in the presence of a reducing agent.

The recombinant batroxobin obtained by the above production method is useful as a drug for treating diseases of the circulatory system, such as diseases caused by disorders of peripheral circulation such as heart disease. In order to use the recombinant batroxobin of the present invention for treatment, it is mixed with a pharmaceutically acceptable carrier, formulated into an appropriate dosage form such as an injection or infusion, and administered parenterally to mammals including humans. Administer directly.

Pharmaceutically acceptable carriers for batroxobin formulations of the present invention include various organic or inorganic carrier materials commonly used in preparing pharmaceutical compositions containing peptides or proteins (e.g., serum albumin, etc.). be done.

The administration method and dosage of the recombinant batroxobin of the present invention can be determined in accordance with the already commercially available natural batroxobin.

In this specification, literature names are written with numbers in parentheses as necessary, and the details are summarized in a list at the end of the specification.

E. coli, yeast, and animal cells used for construction and transformation of the batroxobin expression vector of the present invention are explained below.

Escherichia coli JM83 (1) was used as a recipient bacterium in a transformation experiment when cloning synthetic oligomers using pUc18 (commercially available from Pharmacia). E. coli strains DI(l(2) and MM294(3) were used as recipient bacteria in transformation experiments when constructing other plasmids. HBIOI-16FERM
BP-1872 is MC4100 (Town R
This strain was transformed with the htpR16 mutation (4) derived from 16) and was used as a host for a heterologous gene expression experiment.

Baker's yeast (Saccharomyces cerev)
isiae)A H22ATCC38626(5) is
It was used as a host for heterologous gene expression experiments.

The host for expression experiments using cultured animal cells is mouse L9.
No. 29 (commercially available from Inu Nippon Pharmaceutical) was used.

The enzymes used for constructing the expression vector for the hydroxobin gene of the present invention are commercially available, and their main sources are listed below.

Among the restriction enzymes used in constructing the expression plasmid, C1al was purchased from Boehringer and Ndel was purchased from BRL. Other restriction enzymes were purchased from Toyobo. The reaction conditions for cleavage were in accordance with the attached directions for use. T4 DNA ligase (]igase), and T4
polynucleotide kinase (polynucleotide kinase)
de kinase) was purchased from Takara Shuzo.

DNA polymerase l [
K lenow fragment]
was purchased from BRL.

As thrombin, one manufactured by Kakashi Seiyaku Co., Ltd. was used. All these enzymes were also used according to the attached instructions.

Abbreviations used in the following examples and the accompanying drawings have the following meanings: Amp, ampicillin; Tc, tetracycline; R, tj; Bat, , batroxobin S
MC, somatomedin-C; α-hANP, human atrial natriuretic diuretic hormone; pro, fromomotor; ter, terminator; 1 pro, tryptophan promoter; fd ter, fd phage terminator; fusion5 pro, ■5 promoter; MT pro-, mouse metallothionein promoter, LH, γ-interferon left half; C
d, C domain of somatomedin-C tPA, human tissue plasminogen activator.

In addition, the abbreviations of amino acids and nucleotides were determined according to the usual method in the technical field.

The plasmids involved in the construction of the expression vector of the present invention are as follows. pBat-2 (Figure 1) is pUc1
Ba is added to the EcoR1 site in the polycloning site of 3.
This is a plasmid into which an EcoRI fragment of tcDNA has been inserted (6). This plasmid was used in transformants E, co
liDHl(pBat-2) can be isolated from FERMP-8913 by a conventional method. pLSDi (Figure 1) is a tryptophan promoter (Trp pro,
) downstream of LH-3MC structural gene and rd ter
(7). p
LS-T2 (Figure 6) is Trppro.

This plasmid contains an SD sequence downstream of the LH-3MC gene, and the LH-3MC gene is polydystrically cloned (8). pCL aHtrp3 t (Figure 4)
is a Cd/LH gene/α- downstream of Trppro.
This is an expression plasmid in which the structural genes of hANP (Yuko and fd ter) were cloned (9). pB R-PH
O/lac Z (Fig. 7) is the pH of yeast in pBR322.

5 genes (including expression control/regulatory regions and signal sequences)
This is a plasmid in which the E. coli IacZ gene is cloned. pMM102 (Figure 7) is the E of pBR322.
This is a vector for E. coli and yeast in which a 2 μm plasmid derived from yeast is cloned into the coR1 site. ps
T112 (FIG. 8) is an expression plasmid for animal cells in which the cDNA of human tissue plasminogen activator is cloned downstream of the mouse metallothionein gene promoter. This plasmid is used for transformants E
coli DH-1 (psTl 12) FERM BP
-1966 by conventional methods.

All batroxobin expression vectors of the present invention are plasmids. Among them, plasmids pBat-9S49, pB
at-3S50, pBat-3S51 are suitable for expressing the fusion tanno-N+ plasmids in prokaryotes, especially Escherichia coli, preferably E. coli, and plasmids pMM107 and pMM]05 are eukaryotes,
In particular, the former is suitable for expressing notroxobin or a fusion protein using yeast and mouse 929 cells as hosts.

These expression vectors have been inserted into appropriate Escherichia coli and deposited at the Institute of Microbial Technology, Agency of Industrial Science and Technology under the following deposit numbers.

Transformant Deposit number Esche
richiacoliHBIO1-16/pBat-3
S49 FERMP-+0324Escherich
iacolit (BIOI-16/pBat-3S50
FERMP-10325Escherichiac
oliHB101-16/pBaL-3S51 FE
RMP-10326 Escherichia coli
HB 101-16/pMM 105 F E
RM P-+0327Escherichia co
li MM294/pMM 107 F E
RM P-10328 The present invention will be described in detail with reference to Examples below.

Example 1 Transformation of Escherichia coli The transformation of Escherichia coli in the present invention was carried out according to the following conditions and methods unless otherwise specified.

The recipient bacteria used for transformation were placed in sterile ψa medium [Bacto Tryptone 20
g, Bacto yeast extract (Bacto yeast ex
tract), M, Mg5O, 7H, 05g, agar (
Agar) 159, H, Ol (, p in KOH
(adjusted to H7,6) at 30°C or 37°C.
Cultured overnight. One or two single colonies grown on the above plate were inoculated into 51 sterile ψb medium (ψa medium without agar). 30'
After incubation at 37°C or 37°C for about 2 hours (0, D,...
= 0.3), 5Rρ bacterial solution was sterilized with 10011IQ ψb
The cells were subcultured into a medium and further cultured at the same temperature. O, D, eoo
When the temperature reached 48°C, the culture solution was allowed to stand still under water cooling for 5 minutes, and then centrifuged at 4000 x 9.4°C for 5 minutes.
(Trbl) (30mM KOAc, 100mM R
bCQ, 10mM CaCQ, 5QmM MnC
Q., 15% (v/v) glycerol, 0.2 MAcO
The mixture was gently suspended in p) with H (adjusted to 5,8 and sterilized by filtration). 4000x9.4
After centrifugation for 5 min at °C, the precipitate was washed with 4N transformation buffer 11 (TfbII) (10mM
P I FES (or MOPS), 75mM C
aCQt, lomMRbc4.15% (V//V) glycerol, adjusted to pH 6.5 with IN KOH, filter sterilized) and allowed to stand still under water cooling. After 15 minutes, the aliquots of 0.2 mQ were quickly frozen and
Stored at °C. When necessary, it was melted under water cooling for 10 to 15 minutes and used as follows. DN of 10-20μC
Solution A was added, and the mixture was allowed to stand still under water cooling for 30 to 45 minutes, and then heated/cocked at 37°C for 3 minutes (if the recipient bacteria was htpR) or at 42°C for 90 seconds.

After leaving to stand for about 90 seconds under water cooling, add 0.8i (!) of ψb medium and incubate at 30°C or 37°C for 1 hour. ), use sterile Riichi agar medium containing Amp100γ or Te12.57 (Batato tryptone 10g, Hakuto yeast extract 5g, NaCQ59, agar 15g, 82
0 N! , adjusted to pH 7.4 with IN NaOH)]
It was applied to. Cultured overnight at 30'C or 37°C. Plasmid DN7~ was prepared from the transformant using the alkaline extraction method of Birnboim et al.
10).

Example 2 Construction of Intermediate Plasmid pBat-3SI The respective restriction enzymes were used as directed to create pBat2 [this plasmid was first transformed into coli D f (-1 (pBat
2) EcoRI-Ndel fragment (can be isolated from FERM P-8913 by a conventional method) (approximately 1.6 base pairs (hereinafter abbreviated as bp) containing the structural gene of batroxobin)
was prepared.

Similarly, EcoRl -Nd of plasmid pLS-DI (see European Patent Application Publication No. 0219814)
An el fragment (approximately 22 Kbp containing the E. coli origin of replication) was prepared.

The two EcoRI-Nde I fragments obtained above were
4 DNA ligase. In addition, all ligations of DNA fragments in the following examples were performed using T4.
This was carried out by a conventional method in the presence of DNA ligase.

Next, according to the method described in Example 1, Escherichia coli MM294 was transformed with the ligation reaction mixture, plasmid pBat-3SI was isolated from ampicillin-resistant transformants, and EcoRI (cleaved at one site), EcoRI -
BamHI (cutting at 2 places), RsaI (cutting at 3 places)
It was confirmed that the desired plasmid was obtained by digestion.

A schematic diagram of the construction of plasmid pBat-3SI is shown in FIG.

Example 3 Construction of intermediate plasmid pBat-5S2 1) Synthesis of oligonucleotides Oligonucleotides ■ to ■ used in this example and subsequent examples were subjected to fully automatic DNA synthesis n (Mode 1
381 A, Applied B iosystem
(manufactured by S Company) according to the instructions.

The base sequence of the synthesized DNAΔ portion was confirmed by the Maxam-Gilbert method (11).

These oligomers are shown in Table 1 below.

Table 1 Synthetic oligonucleotides AATTCATGGTCA TTGGAGGT GATGAATGTGACATAA Eight TGAACATCCTTTCCT TGCATT
CATGTAC ■ATGAATGCAAGGAAAG ■GATGTTCATTTATGTC ■ACATTCATCACCT ■CCAATGACCATG [Stock], A ATTCA TGGATGATCTGCC
G A CTGTAG A ACTG CAAG TG
GTA CCTCGAGTGA ■CCAATCACTCG AGGTA CCA CT
TGCAGTTCT,'1CAGTCGGCAG AT
CATCCATG This oligonucleotide was then used to construct an intermediate plasmid with an appropriate distance between the SD sequence and the methionine initiation codon.

2) Construction of plasmid pUC-BatL1 (1) Ligation of oligonucleotides JA] Oligonucleotides (1), (2), (2), and (2) were mixed in an amount of 0.8 nmol each, and subjected to ethanol precipitation.

The 5° end of each oligonucleotide was phosphorylated using dry iL T 4 polynucleotide kinase (hereinafter referred to as "kinase treatment"), followed by ligation.

[B] Oliconucleotide ■, ■, ■, ■, ■Each Q,
8 nmol was mixed and subjected to ethanol precipitation, and after drying, kinase treatment and ligation reaction were performed.

[C] The reaction solutions of [A] and [B] above were mixed and ligated for an additional hour, followed by EcoRI digestion, and the resulting mixture was subjected to polyacrylamide gel electrophoresis to obtain the desired 65 bp fragment.

(2) Construction of plasmid pUC-BatL1 D obtained by digesting plasmid pUc18 with EcoRI and KpnI
The NA fragment and the 65 bp fragment obtained in 1) were subjected to a ligation reaction, and the resulting ligation reaction mixture was used to transform Escherichia coli JM83. A transformant exhibiting ampicillin resistance was selected, and plasmid pU was extracted from the transformant.
C-B atLl was isolated and EcoRI-PvuI
I, EcoRI＼valve■, 1 normal R1-shadow fat I, abdominal infarction I-dan μ■, Rsal-PvuH? It was confirmed that the plasmid was the desired plasmid by ligation.

3) Construction of plasmid pBat-3S2 Plasmid pB
at-5SI was partially digested with Rsa1 (cleaved at one site, reaction conditions were added to Niblasmid DNA2001iρ (approximately 45 μg).
Double concentration Rsali buffer [50mM Tris-HCC (
p[(8,0), 35mM MgC(!z, 25Q1M
NaCQ, 35xM 2-mercaptoethanol, 5
00μg/πQ bovine serum albumin] 60μQ and enzyme 3
Add μQ (15 units) and 39 μQ of distilled water to
Incubate at 7°C for 1 hour), then EcoRI7t'!
The resulting fragment and the plasmid pU obtained in 2) above
Rsal-EcoRI fragment of C-BajL2 (63b
p) was subjected to a ligation reaction.

The resulting ligation reaction mixture was used to incubate E. coli MM294.
was transformed, and plasmid pBat-3S2 was isolated from the ampicillin-resistant transformant.

It was confirmed that the plasmid was the desired plasmid.

A schematic diagram of the construction of plasmid pBat-3S2 is shown in FIG.

Example 4 Construction of intermediate plasmid pBat-3S3 After plasmid pLS-DI was digested with BamHI, DN
The ends were blunt-ended with A polymerase I (Flenow fragment). Rough PstI digestion was performed to obtain a fragment of approximately 16 Kbp.

After transforming plasmid pBaL-3S2 into PstIi,
) Ipa1 partial digestion (one site cleavage, reaction conditions Niblasmid DNA 200μQ (about 18μg) and 5x concentration of HCl buffer overnight (:5Q, vM Tris-HCI!)
(1)87.5), 35th order M texture 7gc ρ2,5
Q
(Incubated at 7°C for 1.5 hours) to obtain a fragment of approximately 1.5 Kbp.

About 1.6 Kbp and about 1.5 Kbp prepared in ``2.
The DNA fragments were ligated, and E. coli DHI was transformed with the resulting ligation reaction mixture. Plasmid pBat-3S from ampicillin-resistant transformants
Separate 3, BamHI (cut at one place), BamHI
-EcoRI and EcoRI -3al I digestion confirmed that the plasmid was the desired plasmid.

A schematic diagram of the construction of plasmid pBat-3S3 is shown in FIG.

Example 5 Intermediate plasmid pBat-3SI encoding a fusion protein of peptide Cd and batroxobin
Construction of O 1) EcoRI of plasmid pCL aHtrp3 t
- Preparation of Pst I fragment A fragment encoding approximately 0.85 Kbp encoding peptide Cd was prepared by EcoRI-Pst I digestion.

2) EcoRI-Ps of plasmid pBat-3S3
Approximately 2.35K of plasmid pBat-8S3 was prepared in the same manner as the preparation of the t1 fragment.
A bp EcoRI-Pst I fragment was prepared.

3) Ligation substantially according to the method of Example 2 to about 0.0.
The 85 Kbp DNA fragment was 2.35 Kb obtained in 2).
The resulting ligation solution was used to transform Escherichia coli DHI. From the ampicillin-resistant transformant, plasmid pBat-3SI
EcoRIPstl, C1aI-Pst
It was confirmed that the plasmid was the desired plasmid by transfection with PstI and HindlII-PstIi.

A schematic diagram of the construction of plasmid pBat-ss10 is shown in FIG.

Example 6 Fusion protein expression plasmid, pBat-
Expression of fusion protein by transformant carrying 3SIO Using the plasmid pBat-3SIO prepared in Example 5, E. coli ) (Blo
Transform t-16FERM BP-1872 and transform pB
A transformed bacterium harboring at-3SIO was used in the following expression experiment. Sterile L-A mp (ampicillin 507
Shiichi broth: L-agar medium with agar removed)
M! After inoculation, culture at 30°C overnight, and make 0.1sf of bacterial solution.
Transfer f to a new sterile L-Amp3i and heat at 30°C.
(previous culture). After about 8 hours, the 0.51Q pre-preculture was subcultured into 5011!12L-Amp, and further cultured overnight at 30'C (preculture).

20 inches of pre-culture solution to 400. Sterilized main culture solution of mC [■10
(@concentration M9 storage solution (NatHPO4・l 2H-0
1529, KH, Po, 309, NaCQ 59, NH
.

CI:ll0g, H,Olf2, ION Adjusted to pH 74 with NaOH), ■40% glucose, ■0.5% casamino acid, ■thiamine hydrochloride 10xy/mc, 02001
11MMgSO4, l QxM CaCL, ■A mp
519/MQ; After sterilizing ■～■ separately, add ■ to the solution of ■, add 1/10 of ■, 1/80 amount of ■, and 1/2 amount of ■.
00 amount, 1/100 amount of ■, and 1/200 amount of ■] were inoculated and cultured at 30'C. After culturing for about 3 hours (0
゜D,, o, #0.6), 3-indole acrylic acid (
IAA) was added to the main culture solution to give a final yield of 10γ. Bacterial fluid was collected between 1 and 3 hours.

20-40! The culture solution (!) was centrifuged to collect bacteria. As a result of observing the collected bacteria with an optical microscope, it was found that there were insoluble protein lumps (l nclusion bo
dy) was observed. Add 1/10 amount of l Q r to the precipitate
1M PBS 25zM EDTA (NaCf28.
OIF, KCaO929, Na, HPO, 12H, 0
2,99, K.H.

Po, 0.29, EDTA (2Na) 3.739, Na
OHO,459,H,Ol(,ION pH with NaOH
(adjusted to 8.0) was added. After suspending under water cooling, ultrasonication was performed twice for 1 minute. 30000xy for 30 minutes, 4
After centrifugation at °C, the supernatant was kept as the PBS soluble fraction. For the precipitate, add 8M urea, l
001M Tris-HCi2 (pH 8,0) 25M EDTA was added to 1/10ffi of the culture solution and suspended, and then the same ultrasonic treatment as above was performed twice. 30000
After centrifugation for 30 minutes at 4°C, the supernatant was
It was saved as a BS-insoluble fraction. Determination of expression efficiency and molecular weight of expressed proteins was performed using Laemmli
5DS-PAGE was performed according to method (12) of i). As a result of 15% 5DS-PAGE, it was found that the fusion protein of peptide Cd and batroxobin was highly expressed in the PBS-insoluble fraction.

Furthermore, it was revealed by high performance liquid chromatography that the amount of the fusion protein expressed from the transformant carrying pBat-3SIO was approximately 40zy/(1 culture solution).

Example 7 Construction of pBat-3S49, an expression plasmid having a thrombin cleavage site and encoding a fusion protein of peptide Cd and batroxobin 1) Construction of plasmid pUC-BatL2 (1) Oligonucleotide ligation Example 3, Using oligonucleotides ■ to ■, [phase], and ■ listed in Table 1,
DNA encoding a factor-like amino acid sequence (thrombin cleavage site) was prepared.

Ligation of synthetic oligomers was performed as follows.

[A] Oricomer - Q, 5r+mol of each of ■, ■, ■, ■, ■, ■, and ■ were mixed, and ethanol precipitation was performed. After drying, it was subjected to kinase treatment and further treated with Lyke 7:I.

[B]: Oligomer [phase], ■ is Q and 5nmo, respectively.
The mixture was mixed with ethanol, subjected to ethanol precipitation, and after dry bombing, was subjected to kinase treatment.

[C]: Mix the CAI solution and [B] solution, and then add 1
After ligature treatment for an hour, the mixture was subjected to EcoRI digestion. The reaction solution was subjected to 17.5% polyacrylamide gel electrophoresis to purify the desired 104 bp fragment.

(2) Ligation of oligomer and plasmid pUc
18 was subjected to restriction enzyme 1 RI and K pn I digestion to obtain an Eco RI 7Kpnl fragment. This fragment and 1
) and the 104bp fragment prepared in [C] were ligated. E. coli JM83 was transformed with the ligation solution, and plasmid p was extracted from the ampinrin-resistant transformant.
It was confirmed that UC-BatL2 was isolated and a plasmid was obtained.

2) Construction of plasmid pUC-Batl Rsal-BamHI of plasmid pBat-3S3 obtained in Example 4
Fragment (approximately 0.6 Kbp) and pUC-B obtained in 1) above
Rsa1 partial digestion of atL2 (one site cleavage, reaction conditions Niblasmid DNA 75 μQ (approximately 9011 g) and IO (@
Concentration of R3altl solution [100+nM Tris-HC
C (pH 8,0), 70m~i MgCL, 500mM
NaCC 170mM 2-mercaptoethanol, Img
/mQ bovine serum albumin] 15μυ and Rsa12μc
(10 units) and 58 μC of distilled water to 37°
The resulting fragment was incubated at C for 40 minutes and ligated with a fragment (approximately 2.7 Kbp) obtained by BamH1 digestion. E. coli MM29 in the reaction mixture of Ligey/Yon reaction
4 was transformed, plasmid pUCBatl was isolated from the ampicillin-resistant transformant, and HindIII, H
indIII-BamHI.

The desired plasmid was confirmed by incubation with human Xho[-Pvullt.

3) Construction of plasmid pBat-3S49 Plasmid p
The EcoRI-BamHI fragment (approximately 2.4 Kbp) of Bat-3SIO and the 1-parallel R[-degraded Hl fragment (approximately 650 bp) of plasmid pUC-Bat 1] were each separately combined and ligated. Escherichia coli MM294 was transformed with the ligated solution, and plasmid pBat-3S49 was isolated from the ampicillin-resistant transformant, and it was confirmed that EcoRI-BamH mido was obtained.

A schematic diagram of the construction of plasmid pBat-3S49 is shown in FIG.

Example 8 Expression plasmid pBat-3S 50 encoding a fusion protein of LH protein and batroxobin having a thrombin cleavage site, and expression plasmid pB encoding a fusion protein of LH protein, peptide Cd, and batroxobin having a thrombin cleavage site
Construction of at-3S51 1) EcoRI-P of plasmid pBat-SS49
Preparation of stl fragment EcoRI-Pstl fragment of pBat-3S49 (
Approximately 23 Kbp) was prepared.

2) Plasmids pLS-T2 and pCL aHtrp3
Preparation of EcoRl-Pst T fragment of t 1) Partial digestion of LS-T2 with EcoRI (one site cut,
Reaction conditions 40 μg of Niblasmid DNA (approximately 40 μg) was mixed with 40 μρ of EcoRI relaxation solution (described above), 2 μ12 of enzyme (50 units), and 118 μρ of distilled water and kept at 37°C for 10 minutes), followed by Pstl digestion. The desired fragment (approximately 1.06 Kbp) was prepared.

On the other hand, plasmid pCL aHtrp3 t (see European Patent Application Publication No. 0206769) was converted to Ec.

R1 partial digestion [1 site cleavage, reaction conditions/Plasmid D
5x concentration of Eco in N A 40 uC (approximately 8μ9)
RT buffer [50aM Tris-HCC(1)H7,
5), 35j1MM g CQ t, 2501M Na
CQ, 35zM2-mercaptoethanol, 500μ2
/, 1ρun serum albumin 140μρ and enzyme 2μρ(
50 units) and 118 μQ of distilled water and boil at 37°.
After incubating for 1 minute at C, Pstliflization was performed and Cd
- Approximately 1.05 Kbp EcoRI coats LH
-Pstl fragment was prepared.

3) Ligation The approximately 2.3 Kbp EcoRI-Ps fragment obtained in 1) and the 1.06 Kbp fragment obtained in 2) were ligated, and E. coli MM294 was transformed with the ligation solution to construct plasmid pBat-3S50. did. On the other hand,
The approximately 2.3 Kbp fragment obtained in 1) and the approximately 1.05 Kbp fragment obtained in 2)
Kbp fragment was ligated and E. coli MM29
Plasmid pBat-3 by transforming 4
S51 was constructed. Plasmids pBat-3S50 and pBa were obtained from each ampicillin-resistant transformant.
Separate t-3S51 and extract Xhol, EcoR1-Ps
eyes, Hind[-P stI and C1ar-Pstli
It was confirmed that the plasmid was the desired plasmid.

Plasmids pBatSS50 and pBat-SS51
A schematic diagram of the construction is shown in Figure 6.

A fusion protein expression plasmid with a thrombin cleavage site, pBat-3S49, pBat-
Large g holding 3S50 and pBat-3S51! j
Expression of batroxobin from J bacterium l) Transformation and expression E. coli HBIOI-16 was transformed with each of the titled plasmids according to the method described in Example 1, and each of the obtained transformants was transformed in the same manner as in Example 6. The cells were cultured and treated as described in Example 6 to obtain a PBS-soluble fraction and a PBS-insoluble fraction. 15% 5DS-PAGE was performed to determine the protein expression efficiency and molecular weight. As a result, pBaL-
3S49, pBat-3S50 or pBat-3S5
It was observed that the batroxobin fusion protein was highly expressed in the PBS-insoluble fraction of E. coli harboring 1.

Moreover, their expression levels were at the same level as in pBat-3SIO (approximately 40o/(culture solution)).

2) Transformant E, coli) I B 101 16/
pBatSS49, E, coliHB 101-16/
pBat-3S5Q or E, coliHBlol
16/Rough purification of fusion protein expressed from pBatSS51 In the same manner as in Example 6, each transformant was cultured separately (main culture solution 40 (ML), after adding 3-indole acrylic acid, 2. Total bacterial solution 1200 in 5 hours
Bacteria were collected by centrifugation at 0Xi+ for 10 minutes at 4°C. As a result of observing the collected bacterial cells with an optical microscope, it was found that there were insoluble protein lumps inside the bacterial cells.
was recognized. LomMPBS-25mME to the precipitate
Add DTA (pH 8,0) at 8xC and suspend under water cooling.
Ultrasonication was performed twice for 1 minute.

After centrifugation at 30,000×9.20 minutes at 4°C, 10IQ of 50% (v/v) aqueous glycerin solution was added to the precipitate and sonicated in the same manner as above. After centrifugation at 20,000Xy for 20 minutes at 4°C, the above glycerin aqueous solution was added to the precipitate and washed in the same manner. After centrifugation at 20,000
M Tris-HCC (pH 8,0) 25mM EDT
Add 4 ml (l) of A (pH 8,0) U solution, perform sonication in the same manner as above, and centrifuge at 30,000Xy for 20 minutes at 4°C to obtain a supernatant. It was stored as a crude product.

Example 10 Separation of batroxobin by digestion of the fusion protein with thrombin l) Crude purified product of the fusion protein prepared in Method Example 9.2) 5
μg, 10mM Tris-11 (1! (pH 80
) 5 to 8 μρ (l uni, l−/μe) of thrombin and 27 to 30 μg of purified water were added to make the total amount 40 μQ. When processing a large amount of fusion protein, it is sufficient to mix the crude product, thrombin, and purified water in the same proportions. 3
After reacting at 7°C for 6 hours, the presence or absence of digestion of the fusion protein by thrombin was examined by 5DS-PAGE.

2) Influence of the amount of thrombin used and urea concentration The crudely purified fusion protein expressed using plasmid pBat-3S49 was digested with thrombin according to the method of 1) above in the presence of various concentrations of The influence of both urea and 8 degrees on the digestive effect was investigated. Urea concentrations are 8M, 4M, 2M and IM.

As a result, in the presence of 2M urea, digestion of the fusion protein was observed when 10 units of thrombin was used.

In the presence of 1M1i element, 1 unit of thrombin.

Digestion of the fusion protein was observed just by using
When using Unit, the fusion protein was completely cleaved.

Based on this result, the subsequent digestion reaction with thrombin was performed using 5μQ of the crude fusion protein product described in Example 1O, thrombin 5-8μ12 (1 unit/μ), and purified water 27μQ.
~30 μg was used. pBatSS100 (a plasmid containing a fusion polypeptide without a rhombin digestion site), pBatSS49 and pBat-3S51
The fusion protein obtained from the transformant containing
As a result of treatment with thrombin, thrombin-digested fragments were observed only in the fusion proteins obtained from transformants containing pBat-3S49 or 51, which contain the amino acid sequence derived from blood coagulation factor XI.

3) Determination of the amino acid sequence of the protein produced by thrombin digestion. ) as above 1
), and the resulting reaction mixture was subjected to 15% 5DSPAGE.

Cut out the Kel part containing the protein of interest and extract it from Max Yield (~1axY 1eld) (A T T
O? The protein was eluted from the cell using a gel solution (manufactured by F.F.).

After concentrating the eluate, high performance liquid chromatography (YM
CAP-302 column, detection conditions are 210 nm, flow rate 1
The main peak was fractionated. Approximately 20μ9/r! Approximately 2 mQ of the eluted Q was used to determine the N-terminal amino acid sequence. The entire sample was transferred to a sequencer (A pplied bio
The mixture was dried on a reaction filter of Systems (vapor phase sequencer) and subjected to Edman reaction (13). The PTH (phenylthiohydantoin)-amino acid solution obtained from the sequencer was dried and then poured into an acetonitrile solution. PTH-amino acids were identified in acetonitrile solution using liquid chromatography. the result,
It was revealed that the sequence is valine-isoleucine-glycine-glycine-aspartic acid from the N-terminus.

This sequence is identical to naturally occurring mature batroxobin. This means that the amino acid sequence derived from blood coagulation factor XI was specifically recognized and digested by thrombin. Amino acids and D near the N-terminus of batroxobin in the expressed protein determined in this way
The NA sequence is shown in FIG.

Example 11 Activation by Paste Folding of a Protein Expressed by an E. coli Host Batroxobin obtained by digestion in Example 10 above was refolded.

1) Preparation of protein for refolding 0.8j of fusion protein solution subjected to cleavage reaction with thrombin! f
2 on 15% 5DS-polyacrylamide gel electrophoresis (
2 mm thick) to separate proteins. The gel portion containing the protein of interest was cut out, cut into pieces of about 2 mm square, and the protein was electrophoretically eluted from the gel using Max Yield. Four times the volume of cold acetone was added to the collected eluate, and the mixture was allowed to stand at -80°C for 30 minutes.

After centrifugation at -10 °C for 20,000 x 9.20 min, the precipitate was washed with 80% acetone, vacuum dried, and then mixed with 8M urea-100mM Tris-HCf225mM
It was dissolved in a mixture of EDTA (p) 18.0) to obtain a protein for refolding.

2) Reholding Refolding was performed using each of the following methods A to E.

Method-A The above refolding protein is A 2 B 60
1, add alkaline YT solution (50mMKH.

1) O,, 50mM NaCff, 1mM EDTA,
pH 107, containing about 0.8M urea). After standing at room temperature for 1 hour, IN HCρ was added to adjust the pH to 7.

After further standing at room temperature for 1 hour, bovine serum albumin was added to a final concentration of 01%, and the resulting mixture was diluted to 10mM.
Dialyzed against PBS-25mM EDTA(+)H7). After performing dialysis overnight at 4°C, batroxobin in the dialyzed fluid was measured by immunoassay (RIA) according to method 4) below.

Method-B (mixed disulfide method) The above refolding protein is Ats.

Add buffer (50mM TrisH) to 0.02
CQ, 50 mM CaCQx, pH 9,0, was degassed under vacuum for 15 minutes before use, followed by a few minutes of nitrogen bubbling). Furthermore, cysteine (Cys) was added to the final concentration of 3.
After adding the solution to a concentration of mM, it was allowed to stand at room temperature for 20 hours.

The pH was adjusted to 4 by adding glacial acetic acid, and the mixture was allowed to stand at room temperature for 3 hours. Bovine serum albumin was added to a final concentration of 0% and mixed with 10mM PBS 25mM EDTA (pH 7).
Dialyzed against.

- After performing dialysis overnight at 1°C, batroxobin in the dialyzed fluid was measured by RIA according to method 4) below.

Method-〇The above protein for refolding is Ateo-〇,
Buffer solution (roomM Tris, 2
M guanidine hydrochloride, 10mM reduced glutathione, 1m
After adding M oxidized glutathione (pH 8.5), the mixture was left standing at room temperature for 20 hours. Add glacial acetic acid to adjust pH to 6,
The mixture was allowed to stand at room temperature for 3 hours. Bovine serum albumin was added to a final concentration of 0.1% in 10mM PBS-25m.
Dialyzed against MEDTA (pH 7). After overnight dialysis at 4°C, hatroxobin in the dialysis solution was determined using RIA using the method described in 4) below.

Method-D (S-sulfonation method) The above refolding protein is A, 8o-0.0
Buffer (25mM sodium borate, 2M urea, 5mM EDTA, 2mM reduced glutathione, 1mM oxidized glutathione, pH 8.5)
After adding it to the solution, it was left to stand at room temperature for about 20 hours. Bovine serum albumin was added to a final concentration of 81% O to 50mM.
Dialysis was performed against NH3HCO (pH 7.8). 4°
After performing dialysis overnight with C, batroxobin in the dialyzed fluid was measured by RIA according to method 4) below.

Method-E (dilution method) 0.5 to 25u9 of protein for upper fat holding
/x (l) of dilution buffer (50mM Tris
pH 8,0120% glycerol, 150mM NaCf
f, 0.1mM EDTA, 1mM DTT, Ol m
g/m (l bovine serum albumin) and then allowed to stand at room temperature for 20 hours. Next, batroxobin in the buffer solution was measured by RIA according to method 4) below.

Table 2 shows the results of refolding by each method of A to E above.

Table 2 Comparison of refolding method Nyorori holding efficiency A 6.289
0.013B 1.6
0.016C41,80,042D 1.58
0.0016E O,920,03 As shown in Table 2, when refolding was carried out using methods known in various literature as a protein paste folding method, batroxobin was obtained with a maximum efficiency of about 0.04%. In order to obtain a larger amount of batroxobin, refolding conditions were investigated using the following method.

3) Examination of reholding conditions A new holding method was examined under the conditions of holding method E as shown in 2).

- Factors that affect refolding efficiency in boat fishing include a) purity and concentration of foreign protein, b) pH,
Examples include c) ionic components of the solution, and d) presence or absence of thiol compounds.

First, we investigated various thiol compounds in d) and found that by removing the thiol compound (reducing agent) using method E, the refolding efficiency increased approximately 23 times (0.70
%).

Furthermore, the above a) to C) were studied.

First, the protein amount is IAta. =500μy/,w(
1 and varying the heterologous protein concentration, DTT
As a result of refolding using a buffer solution containing no ., the optimum concentration was 2.5 μ9/waste ρ.

Furthermore, in experiments in which refolding was performed by changing the pH of the buffer solution, the highest refolding effect was found at pH
It was obtained around 7.

Finally, the protein concentration was set to 2.5μ9/mQ and the pH
Refolding was performed by changing the concentration of NaC12 contained in Step 7. As a result, the concentration of NaCl2 was changed from OM to 0.
．． When changing to 6M, the holding effect increased by about 10 times, and an efficiency of about 3% was obtained with R[A.

From the above results, refolding was successful with approximately 100 times the efficiency compared to the conventional protein glue folding method, and the preferred conditions are that the protein concentration is 1
~5μq/l (1, pH 6.5-8.5, NaCQ concentration 0.4-1.3M).

11) Quantification of refolded protein Next, the refolded batroxobin was determined by radioimmunoassay (RIA).

Refolded batroxobin samples and batroxobin preparations at various concentrations (0, 31, 0, 63, 1
, 25, 2, 5, 5, 10, 2 On'i/ , =, and assay buffer (PBS-25mM
EDTA-0.5% bovine serum albumin) 400μQ and batroxobin antiserum (IO5x mR1ff1)
115I-batroxobin (10
After adding 100 μQ of 5 cpm/xQ (prepared using the Iodogen method (14)) and mixing, the mixture was allowed to stand overnight at 4°C. Normal rabbit serum (norma
After adding and mixing 100 μQ of rabbit γ-globulin antiserum and 900 μ of 5% polyethylene glycol 6000, the mixture was further left to stand at 4°C. After about 25 hours, 3000
Centrifuge at 9.4°C for 130 minutes, remove the supernatant, and transfer to a card Auto GAMMA Counter.
The radioactivity of the precipitate was measured using a method to quantify batroxobin.

Example 12 Thrombin-like activity of refolded batroxobin protein Using the batroxobin protein prepared in Example 11, its thrombin-like activity was measured using a fibrinogen agar plate.

Quickly create a plate by mixing agar (10 m9/mQ in PBS)5, mQ and bovine fibrinogen solution (Miles Scientific, plasminogen free, O64% in PBS) 5xQ. did. Samples or batroxobin debris (0,31,0,63,1,2
5, 2, 5, 5, 10, 20n9/z (10μa each
After being placed on the plate, it was left to stand at 37°C overnight. The diameter of the cloudy circle was measured and batroxobin was quantified.

It was thus confirmed that the above-mentioned refolding protein refolded by Method-E had recovered its thrombin-like activity.

Example 13 Expression plasmid pMM107 in yeast
Construction l) Construction of plasmid pBat-3S17 Plasmid pBat-3S3 prepared in Example 4 was incubated with EcoRI? t'
After ligation, blunt ends were made using DNA polymerase I (Fre/T fragment). The obtained DNA fragment and kinase-treated KpnI linker (CGGTACCG
) was ligated with. E. coli MM294 was transformed with the ligation solution, plasmid pBat-3S17 was isolated from the ampinrin-resistant transformant, and Ec
It was confirmed that the desired plasmid was obtained by oRI and Kpnl digestion.

2) Construction of plasmid pBat-3S19 (1) Preparation of Kpnl-PstI fragment of plasmid pBat-3S17 Plasmid pBat-3S17 was transformed into KpnT and Pst
After I digestion, a fragment of approximately 2.3 Kbp was prepared.

(2) K of plasmid pB R-P HO/1acZ
Preparation of pnlPslI fragment Plasmid pB R-P HO/1acZ was converted into Kpnl
Partial digestion [1 site cut, reaction conditions plasmid DN
Add 40 μρ (about 20 μg) of A solution to 5 times the current pn+ buffer [50 mM Tris-H (J! (pH 7,5),
35xMMgC di7.5Q, xM KCρ, 35MM
Add 2-mercabutene, 500μg/y, 120μ of bovine serum albumin, 5μ of enzyme (50 units) and 35μσ of distilled water, and incubate at 37°C for 30 minutes], then digest with Pstl to obtain approximately 3.5Kbp. fragments were prepared.

(3) Ligation The DNA fragments prepared in (1) and (2) above were subjected to a ligation reaction, and E. coli MM was added to the ligation solution.
294 was transformed. Plasmid pBat-SSI9 was isolated from ampicillin-resistant transformants and transformed into Eco
The desired plasmid was confirmed by digestion with RI-H1ndll, BamHI, and Kpn■.

3) Construction of expression plasmid pMM107 (1) Preparation of PstI-Bgl fragment of plasmid pBat-3S19
A fragment of approximately 4.2 Kbp was prepared by digestion.

(2) Pst I-B of plasmid pMM I O2
Preparation of amHI fragment Plasmid pMM 102 was isolated from BamHI and Pstl.
A fragment of approximately 8.6 Kbp was prepared.

(3) Ligation The DNA fragments prepared in (1) and (2) above were subjected to a ligation reaction, and the resulting ligation solution was used to transform Escherichia coli MM294. Plasmid pMM107 was isolated from ampicillin-resistant transformants and
The desired plasmid was confirmed by digestion with RI, Hindll, and BamHI.

A schematic diagram of the construction of plasmid pMM 107 is shown in FIG.

This expression plasmid pMM 107 in yeast was used to transform yeast AH22, and the deduced amino acid sequence near the batroxobin N-terminus of the protein expressed by the resulting yeast transformant and the processing site deduced therefrom were converted to As shown in the figure.

Example 14 Transformation of yeast with expression plasmid pMMI O7 1) Transformation Using the expression plasmid pMMIO7 obtained in Example 13 above, baker's yeast AH2 was transformed according to the KUR method of Wooden et al. (16).
2 was transformed.

Sterile minimal medium without leucine [Y MM (-L e
u) Medium, ■ Difco Yeast nitrogen base without amino acids.
e) 7y, agar powder 209/distilled water 880jl &, ■
40% glucose, 01M K2HPO4KHtP04
Buff 7 - pH 7.5, ■H mixed solution (uracil 0.4
9, TrpO14g, Hiso, 49, Argo, 49
, Meto, 49, Tyr O, 69, Leuo, 6g
, l1e0.6? , Lys O, 6g, Val 3. O
A mixed solution of g and Phel, 29 dissolved in distilled water IQ), ■ 5% Asp solution overnight, ■ 5% Thr solution, these ■
~ After sterilizing ■ separately, add 50 rtt of ■ to the solution of ■.
(1, 10 villages for ■, 50 scraps for ■, 5II for ■! 7!,
The transformants that formed colonies were used in subsequent expression experiments.

2) Baker's yeast AH2 carrying plasmid pMM107
Expression of batroxobin from 2 and measurement of activity Transformants were cultured in the following manner.

Sterilize the non-leucine auxotrophic transformed bacteria at 10ffiρ.
M M (-L eu) liquid medium [Y M M (-L
eu) culture medium with agar powder removed] after inoculation, 30
'C and cultured overnight. New sterilization of bacteria solution 10sQ
M (-L eu) Liquid medium 200j! The seeds were subcultured in the evening and cultured at 30'C for 2 to 3 days (preculture). After sufficiently growing the recombinant yeast, incubate the preculture at 200 mC with 400 mC.
Bacteria were harvested by centrifugation at 0×95 minutes. 40I7 bacterial cells
f! Sterilized main culture solution [0Mg50.0.59, NaCl
! O, I9, CaC (!20.1g, KCQ 1.0
g, Hiso, 02g, Asn2.0g, adenine 0.
4g, distilled water 934Q, ■40% glucose, ■5%
Asp solution, ■ 5% Thr solution, ■ Vitamin preservation solution (thiamine 20mg, pyridoquinone 20y9, nicotinic acid 2
0rx9, pantothenic acid 2011g, piotin 0.2+
9 and 1 g of inositol dissolved in distilled water IQ), ■ Trace element preservation solution (H3BO460JIg, MnS
○t30iy, ZnSO4・7H, 0300mg, C
u SO4・51 (2040m9, FeCQ3・6
H20250zy, Na2Mo○4-2H70
25mg dissolved in distilled water IQ), ■~■ were sterilized separately, and then 50+ (■) and 5M (■) were added to the solution (■).
1, ■ by adding 5 JII and 2, ■ by adding 5 shoulder Q, and ■ by 1 shoulder Q] and then suspended in sterilized main culture solution of 20 IIIQ. The entire suspension was inoculated into 300J112 sterilized main culture, and culture was continued at 30°C. Bacterial fluid was collected between 6 and 12 hours. 20. The W12 culture solution was centrifuged at 1000×9.10 minutes at 4°C to collect bacteria. 10+nMPBS-25 of 8sQ to the precipitate
After adding and washing with mM EDTA (described above), 111Q
10mM PBS-25mM EDTA-InM
After adding PMSF and suspending under water cooling, glass beads (
19 (diameter 0.45 mm) was added. 2 using a mixer
Vigorous stirring was performed for a minute. 100 after stirring twice
Centrifugation was performed at 4°C for 00x910 min, and the supernatant was saved as a sample.

Example II, 4 shows that hatroxobin is expressed.
) Confirmed by RIA according to the method described (1.3μ
g/Q culture solution). Furthermore, the results of measurements using fibrinogen acid plates according to the method described in Example 12 showed that the biological activity of hatroxobin expressed from yeast was approximately equivalent to the RIA value.

3) Measurement of molecular weight The molecular weight of batroxobin expressed from yeast was estimated by the following method.

In the expression experiment described in 2) above, samples cultured for 10 hours were used, and thymography (Z y
mography) was performed to estimate the molecular weight of batroxobin expressed from yeast.

After the samples were separated by 15% 5DS-PAGE, the gel was washed with 25% Triton X-100 aqueous solution (200
x (D). After gentle stirring at room temperature for about 3 hours, it was washed with distilled water, then dried on a filter paper and placed on a fibrinogen agar plate (described above) at 37 °C.
C and kept warm overnight. Natural batroxobin was used as a comparison sample and treated similarly. As a result, in the case of batroxobin expressed from yeast, 30. OOO±20
Activity was detected at the molecular weight position of 00.

Example 15 Expression plasmid pMMI05 in animal cells
Construction of plasmid pBat-3S18 Plasmid pBat-3S3 prepared in Example 4 was constructed using IEcoRl (
After 1 year of development, DNA polymerase I (fragment)
The ends were made blunt using The obtained plasmid and the kinase-treated BglllJ linker (CAGATCT
G) was played as a ligame. Colon IMM294 was transformed with the ligation solution. Isolate plasmid pBat-3S18 from anpinlin-resistant transformant,
The desired plasmid was confirmed by Bglll digestion.

2) Construction of plasmid pST-Xho [Plasmid ps
Tl12 [Transformant E containing plasmid psT112
scherichia coli DHL (psT1
12) has been deposited as Microtechnology Research Institute No. 1966] is S ma l Ii! Fragment obtained by ligation and Xhol linker-CCCT CGAGG subjected to kinase treatment
) and played a live game. E. coli MM294 was transformed with the ligation solution. The desired plasmid pST-Xbol was isolated from the ampinrin-resistant transformant and confirmed to be the desired plasmid by Xhol digestion.

3) Construction of expression plasmid FpMM 105 in animal cells (1) Plasmid pBat-SS]8 BgltJ-X
h.

Preparation of I fragment Plasmid pBat-3S18 was transformed into Bgll and Xh
.

After digestion with I, an approximately 0.7 Kbp fragment was prepared.

(2) BglII-Xh of plasmid psT-Xhol
Preparation of ol fragment Plasmid pST-Xhol was transformed with BglII and Xho
A fragment of approximately 5.8 Kbp was prepared.

(3) DNA fragments obtained in (1) and (2) above are ligated/
E. coli MM294 was transformed with the reaction solution. Plasmid pMM10D was isolated from ampicillin-resistant transformants and transformed into Ec.

RI, Hind[H2CcoRI-H1ndlI
It was confirmed that the plasmid was the desired plasmid by If culture.

A schematic diagram of the construction of plasmid pMM100 is shown in FIG.

[obtained target plasmid pMM] 05 was used to transform cultured animal cell mouse L929, and the predicted amino acid sequence near the batroxobin N-terminus of the protein expressed by the obtained transformant and the predicted proseno/ing site were extracted. It is shown in Figure 9.

Example 16 Transformation of cultured animal cells with expression plasmid pMMI05 and expression ■) Transformation Transformation of cultured animal cells was carried out by Graham (Graham).

This was carried out according to the calcium phosphate co-precipitation method of F. et al.17). That is, plasmid pSV 2 neo
ATCC37198 (0,1μ9) and plasmid pMM
Co-transformation with 105 (30Izy) was performed.

Mouse L 929 cells were cultured with a diameter of IQcx in MEM medium containing IQ% unborn fetal serum. !
(DME~1), the expression plasmid (p
MM105) and marker plasmid (pS ■2neo
) and co-precipitated with calcium phosphate were added.

After culturing overnight in a CO2 incubator, the culture solution was changed to a new non-selective medium (DMEM as described above) and further cultured overnight. Next, the culture solution was mixed with selective medium (G, 418 (GI[3CO
DMEM containing 500 tt s/, qQ,
) and culture for 24 to 48 hours, then divide the cells into 96-well plates (1 x 10 cells/well) using the same selective medium.
100 μQ medium/well). Culture was continued while replacing the medium with a selective medium every 3 or 4 days.

2) Expression of batroxobin from a transformant carrying plasmid pMM105 Using the cells grown in the selective medium in 1) above,
The expression status of batroxobin was investigated.

The medium in the well where cell proliferation was observed on a 96-well plate was mixed with metallothionein promoter induction medium (2mM sodium butyrate, 40μM ZnO, 2
The cells were replaced with D~iEM containing % fetal serum and cultured for 24 hours. Batroxobin activity in the culture solution was measured by RIA, and the highest production amount (approximately 10μ9/(l culture solution)
Cells showing this were selected as hatroxobin-producing cells,
It was named MMI 05.

3) Purification of fusion protein expressed from cultured animal cells A high school graduate organism was further obtained by cloning MM105 (transformed mouse 929 cells capable of producing batroxobin) described in 2) above. Approximately 5
Approximately 400 y (l) of culture was carried out using a transformed strain capable of producing 0 to 100 μy/Q culture solution.
The mixture was centrifuged at 2000xy for 10 minutes at 4°C, and the supernatant was purified by affinity chromatography using KEL coupled with batroxobin antibody.

From the culture supernatant containing about 13.8μ9 of batroxobin, elution buffer (0.2M green-HCQ, Q, 5MN
About 12μ9 of batroxobin was purified and recovered by aC (!pH 2,0). When the eluate from the affinity chromatography was analyzed on 15% 5DS-PAGE, a main band was present where the electrophoretic mobility matched that of the batroxobin sample.

The affinity column used above was prepared using batroxobin antiserum (using rabbit, 16B9.τQ, an equal volume of PBS was added, and then a saturated ammonium sulfate solution was added to 9.-IQ, and the mixture was heated at 4°C. Stir for 1 hour at 4°C.
After standing for 5 hours, centrifugation was carried out for 30 minutes at 20,000:<9, and the precipitate was diluted with 20 mM +) acid buffer (pH 80) 2.
Dialyzed overnight against Q. The dialysed fluid was purified using a DEAE cellulose column washed with 20mM phosphate-enriched 1iN (pH 8,0) to obtain a crudely purified batroxobin antibody of approximately 35.4z9/32+C.

Of that, 2079 minutes and 18m of coupling viyui &
Dialysis was performed against (0,1 fvl Na)ic○31)H8,O).

BrCN-activated Sepharose 4B (Pharma/A) 1.21y equivalent (approximately 5-IQ Kel) swelled and washed with lmM HCQ 300MQ in the dialysis solution
The mixture was stirred for 2 hours in a 7U chamber. Further, KEL was stirred for 2 hours with blocking reagent I saved it.

4) Western analysis of the protein expressed from L929
Confirmation by Plotting In order to confirm that the main band obtained by 5DS-PAGE in 3) above is batroxobin, Western plotting was performed using the following method.

A 0.45 μm membrane filter was applied to the gel subjected to 5DS-PAGE.
Transfer buffer (Tris 6,069, Glycino 2
8゜89, methanol 4001Q, add water and bring the total volume to 2
Soak in water) and remove air bubbles completely.
Transplotting device (Bio-Rad, TRA
NS BLOT), electrophoresis was performed at 60 mA for 1 hour, and then overnight at 120 mA.

Filkoo was added to 3% gelatin solution "T B S buffer (T
ris4,849, Na(J! 58.489.2(H
, 01 INHcc (adjusted to pH 7.5) for 1 hour, and then replaced with a 1% gelatin solution containing batroxobin antibody. After about an hour and a half, 0.05% Twe
Filters were washed with en20 solution (made using TBS buffer). 3 washes of 5 minutes, 6 washes of 10 minutes
After one purification, POD-labeled rabbit [gG
It was soaked in a 1% gelatin solution for about 1 hour. 0.05%
Washing with Tween 20 solution was performed twice for 5 minutes and twice for 10 minutes. Solution A [5,1ρ Add coloring reagent (horseradish beluox/lase coloring agent) to cold methanol
eradish peroxidase color d
development) reagent) dissolved in 15 parts]
and B solution (25 μC of 30% hydrogen peroxide solution added to 25 μC of TBS buffer) were prepared and mixed immediately before use, and then added to the filter to develop color. the result,
The main band, which showed the same electrophoretic mobility as the product obtained in 3), developed the same color as the standard product, and was confirmed to be batroxobin.

The documents cited in this specification are shown below.

Reference 1, Messing, J. (197
9) Recombinant DNA Technic
al Bulletin, N I HPublica
tion No. 79 99.2, No. 2,432
, Lanahan, D. (1983)
J.M.

1, Biol Seven Days, 557-5803, Meselson, i'i4. and Yuan, R. (1968) Nature
2±7.11104, Tobe (T,
), I to, K, and Yur
a, T.) (1984) Mo1. Gen, Gene
t195.10-16 5 Kurjan (J.) and Herskowitz (1.) (1
982) Ce1l 30.96, I to
, N,), Tanaka, N, ),
Miha/(M1hashi, S, ) and Yamashina (1.X1987) J.
Biol, Chem, 262.37 and 8. European Patent Application Publication No. 021981/1 Publication 9, Saito (Y, ), Ishii (I)
5hii, Y,), Koya7 (Koyama,
S, ), Tsuji (K,), Yamata (
Yamada, H.), Terai (Terai,
T, ), Kobayashi 7 (Kobayashi, M, )
, Ono (○no, T,), Chive (Niwa, M,
), Ueda+ [, ) and Kikuchi (K
1kuchi, H8), (1987) J, Bio
chem tU2.111-122 10, Birnboim, H.C. and Doly, J. (1979)
Nucleic Ac1dsRcs, 7.1513 1
523 11 Maxam, A. and Gilbert, W. (1980)
Methods Enzymo165.499-5
60 12 Laemmli (1970)
) NaLure 227, 680 68513
, Chang, J.Y., C.
Reaser, E. T. (, ) and Bently, K. W. (1976) Bioc.
hem, J, 153. (3Q7111, Salacinski, P, R, McLean, C, Sykes)
es, J.) Clemento Jones (Cle
ment-Jones, VV) and Laurie (
Lowry, P. J.) (1981) Anal.
Biochem, I 7. I 36-146
15, Hager, D.A. and Burgess, R.R. (1980)
Anal, Biochem.

109.76-86 16, Hashimoto, H. and Kimura, A. (1985) Hak
kou-to-Kogyo (in J apanese
) 43, 630-63717, Graham
am, F., L.) and van der Eb, A. J. (1973)
)～' irology 52.456-467

[Brief explanation of drawings]

Figure 1 is a schematic diagram of the construction of pBat-3SI, No. 21 is a schematic diagram of the construction of pBat-3S2, and Figure 3 is a schematic diagram of pBat-3S2 construction.
Figure 4 is a schematic diagram of the construction of pBaL-3SIO, Figure 5 is a schematic diagram of the construction of pBat-3S49, and Figure 6 is a schematic diagram of the construction of pBaL-3S49.
The figure shows a schematic diagram of the construction of pBat-3S50 and pBatss51, FIG. 7 shows a schematic diagram of the construction of pMM 107, FIG. 8 shows a schematic diagram of the construction of pMM]05, and FIG. DNA near the N-terminus of hatroxobin in the protein expressed by the transformant
a schematic diagram showing the sequence and the amino acid sequence deduced therefrom and the processing sites defined therefrom (IL;
FIG. 10 is a schematic diagram showing the sequence formula of DNA encoding natural batroxobin and the amino acid sequence deduced therefrom. Patent Applicant FujitR Yakuhin Kogyo Co., Ltd. Agent Patent Attorney Maeda Ao (2 others)-Ten-zu deT N CoreAGAAGTCTCCGCTTGGGTTATCTGA
TTAGGTTGCAAACAGCTTGCCACGC
AGAGTTGAAGCTATTomie TTCATGTACTACTCTCCCCGGTATT
TCTGTGGP! 1eHehiTyrT:/rSerP
roArgTyrPheCysG 1380
．． 400TACCCAAAGG
AGAAGTTCATτTGTCCCAATAATyr
ProLysGLuLysPheIlecysProA
s*Ly10 diagram (1) AACCAGCTGC dingTAA゛dingTTGATCAAA
TAAAG DingGCTGCTTGATCAFigure 10AAGCTTTTTTDingAGACTCAAATAGGA
CTGCCTTTGGANOCCTGTTTTATGGT
GAGGTGCAAAATTTTCTGACTCTNOC
TTCTGGACAGTGTGGTCCTTGATG
CTCTCTGAGC”ATCATCAGTGCTAG
AATATTCTCTTCTATGTTAGTT-.

Claims (1)

[Claims] 1. Genetically recombinant batroxobin. 2. Batroxobin according to claim 1, which is free from natural glycosylation. 3. The batroxobin according to claim 1, which is not glycosylated. 4. DNA encoding the amino acid sequence of batroxobin
An expression vector containing. 5. The expression vector according to claim 4, which contains DNA encoding the amino acid sequence of a fusion protein of batroxobin and another polypeptide. 6. A transformant carrying the expression vector according to claim 4 or 5. 7. A method for producing batroxobin, which comprises culturing the transformant according to claim 6 in a medium and separating batroxobin from the resulting culture.