JP7493175B2 - Method for producing glycyrrhetinic acid using microbial triterpene oxidase - Google Patents

Description

The present invention relates to a method for producing glycyrrhetinic acid using triterpene oxidase derived from Aspergillus oryzae.

Glycyrrhetinic acid and glycyrrhizinic acid are known to have industrially useful physiological activities such as anti-inflammatory and whitening effects, and are used in a variety of medicines and cosmetics. Glycyrrhetinic acid can be extracted and purified from the root of licorice (licorice root), a legume plant, using an alcohol-containing aqueous solution. Glycyrrhetinic acid can also be produced by hydrolyzing glycyrrhizinic acid with a strong acid such as sulfuric acid or with microbial enzymes (Patent Document 1, Non-Patent Document 1).

However, there are various issues, such as unstable production of the raw material licorice, difficulty in extracting and refining glycyrrhizinic acid due to the large amount of impurities in licorice root, and the generation of by-products due to the strong acidic conditions during hydrolysis of glycyrrhizinic acid to glycyrrhetinic acid, and the introduction of impurities due to the use of enzymes derived from microorganisms. As a result, it has not been easy to produce glycyrrhizinic acid or glycyrrhetinic acid cheaply and efficiently.

As a method for solving such problems, a method for producing glycyrrhetinic acid using a microorganism into which a gene that is involved in the biosynthetic pathway of glycyrrhetinic acid and that has the activity of oxidizing oleanane-type triterpenes has been introduced has been developed and reported (Patent Document 2).

As shown diagrammatically in Figure 1, the process of biosynthesis of glycyrrhetinic acid includes the steps of: (1) opening the ring of 2,3-oxidosqualene to produce β-amyrin; (2) oxidizing the carbon at position 11 of β-amyrin to produce 11-oxo-β-amyrin; and (3) (i) oxidizing the carbon at position 30 of 11-oxo-β-amyrin to produce 30-hydroxy-11-oxo-β-amyrin; (ii) oxidizing the 30th position of 30-hydroxy-11-oxo-β-amyrin to produce glycyrrhetinaldehyde; and (iii) oxidizing the 30th position of glycyrrhetinaldehyde to produce glycyrrhetinic acid.

Patent Document 2 discloses a transformed yeast into which genes encoding β-amyrin synthase derived from Lotus japonicus (catalyzing the reaction in step <1> above) and β-amyrin 11-oxidase derived from licorice (Glycyrrhiza uralensis) (catalyzing the reaction in step <2> above) and β-amyrin 30-oxidase (catalyzing the reaction in step <3> above) have been introduced. It is described that in this yeast, β-amyrin synthase and β-amyrin 11-oxidase produce 11-oxo-β-amyrin, from which β-amyrin 30-oxidase produces glycyrrhetinic acid and its isomer, 20-epi-glycyrrhetinic acid.

However, the amount of glycyrrhetinic acid accumulated in such transformed yeast was not high, and the amount was lower than that estimated based on the accumulation of biosynthetic intermediates (β-amyrin, 11-oxo-β-amyrin, 30-hydroxy-11-oxo-β-amyrin, glycyrrheticaldehyde, and 30-hydroxy-β-amyrin) and ergosterol that is originally produced by yeast.

Therefore, there remains a strong demand in this field for new methods for producing glycyrrhizinic acid and glycyrrhetinic acid cheaply and efficiently.

Chinese Patent Application Publication No. 101607980 WO2010/024437

Wang, J. et al. , Applied Biochemistry and Microbiology, 2010, Vol. 46, No. 4, pp. 421-425

The present invention aims to provide a new method for producing glycyrrhetinic acid cheaply and efficiently.

The inventors conducted intensive research to solve the above problems and found that cytochrome P450 derived from the koji mold Aspergillus oryzae has the activity of oxidizing the 30-carbon atom of oleanane-type triterpenes. They also found that glycyrrhetinic acid can be produced using a transformant produced by introducing the enzyme, and that the use of the transformant results in high accumulation of glycyrrhetinic acid while accumulating very little contaminants such as 20-epi-glycyrrhetinic acid.

The present invention is based on these findings and includes the following inventions.
[1] Any of the following polypeptides (a) to (c):
(a) a polypeptide comprising the amino acid sequence represented by SEQ ID NO:1;
(b) a polypeptide comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 1, and having an activity of oxidizing the 30th carbon of an oleanane-type triterpene;
(c) a polypeptide comprising an amino acid sequence having 80% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 1 and having an activity of oxidizing the 30th carbon of an oleanane-type triterpene;
A method for producing glycyrrhetinic acid, comprising the step of reacting the above with 11-oxo-β-amyrin.
[2] The method of [1], which is carried out intracellularly.
[3] The production method according to [2], wherein the cell is a transformant that expresses any one of the polypeptides (a) to (c).
[4] The production method according to [3], wherein the cell is a transformant that further expresses β-amyrin synthase and/or oleanane type triterpene 11-position oxidase.
[5] The method according to [3] or [4], wherein the host of the transformant is a microorganism.
[6] Any of the following polypeptides (a) to (c):
(a) a polypeptide comprising the amino acid sequence represented by SEQ ID NO:1;
(b) a polypeptide comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 1, and having an activity of oxidizing the 30th carbon of an oleanane-type triterpene;
(c) a polypeptide comprising an amino acid sequence having 80% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 1 and having an activity of oxidizing the 30th carbon of an oleanane-type triterpene;
A transformant capable of producing glycyrrhetinic acid, which expresses the above.
[7] The transformant according to [6], further expressing β-amyrin synthase and/or oleanane-type triterpene 11-position oxidase.
[8] The transformant according to [6] or [7], wherein the host of the transformant is a microorganism.

According to the present invention, glycyrrhetinic acid can be produced cheaply and efficiently.

FIG. 1 shows a schematic diagram of the process of biosynthesis of glycyrrhetinic acid. 2 shows total ion chromatograms of the TMSO derivatives of the following samples by GC-MS analysis: (A) a sample extracted from the reaction of a yeast strain expressing CYP5106A1 in contact with 11-oxo-β-amyrin; the arrows indicate the peaks of 30-hydroxy-11-oxo-β-amyrin (13.0 min) and glycyrrhetinic acid (14.3 min); (B) a sample extracted from the reaction of a yeast strain not expressing CYP5106A1 in contact with 11-oxo-β-amyrin; (C) 30-hydroxy-11-oxo-β-amyrin; (D) glycyrrhetinic acid. 3 shows mass spectra around the following peaks in the total ion chromatogram of GC-MS analysis of TMS derivatives of the following samples: (A) A sample extracted from the reaction of contacting a yeast strain expressing CYP5106A1 with 11-oxo-β-amyrin; peak around 13.0 minutes. (B) A sample extracted from the reaction of contacting a yeast strain expressing CYP5106A1 with 11-oxo-β-amyrin; peak around 14.3 minutes. (C) 30-hydroxy-11-oxo-β-amyrin; peak around 13.0 minutes. (D) Glycyrrhetinic acid; peak around 14.3 minutes. FIG. 4 shows the result of sequence alignment between the amino acid sequence of CYP5106A1 (SEQ ID NO: 1), the amino acid sequence of AnCYP5106A1 homolog (SEQ ID NO: 135), and the amino acid sequence of AnCYP5106A1 homolog (gap-filled) (SEQ ID NO: 136). 5 shows the GC retention time measurement results for 29-hydroxy-11-oxo-β-amyrin and 20-epi-glycyrrhetinic acid in the transformed yeast strains YJT177 and YJT201. Each peak represents the following: (1): β-amyrin; OA: oleanolic acid (internal standard); (2): 11-oxo-β-amyrin; (3): 30-hydroxy-11-oxo-b-amyrin; (4): 29-hydroxy-11-oxo-b-amyrin; GA: glycyrrhetinic acid; (6): 20-epi-glycyrrhetinic acid.

The "polypeptide" used in the present invention is a polypeptide that has the activity of oxidizing the 30th carbon of an oleanane-type triterpene. "Oleanane-type triterpene" means a C30 isoprenoid having a pentacyclic oleanane skeleton and consisting of six isoprene units. Examples of such oleanane-type triterpenes include, but are not limited to, oleanolic acid, hederagenin, β-amyrin, camelliagenin, soyasapogenol, saicogenin, 11-oxo-β-amyrin, 30-hydroxy-11-oxo-β-amyrin, and glycyrrhetaldehyde.

In the present invention, "activity to oxidize the carbon at position 30 of an oleanane-type triterpene" particularly means one or more, preferably all, activities selected from the group consisting of activity to catalyze the reaction of oxidizing the carbon at position 30 of 11-oxo-β-amyrin to produce 30-hydroxy-11-oxo-β-amyrin, activity to catalyze the reaction of oxidizing the 30 position of 30-hydroxy-11-oxo-β-amyrin to produce glycyrrhetaldehyde, and activity to catalyze the reaction of oxidizing the 30 position of glycyrrhetaldehyde to produce glycyrrhetinic acid.

The "polypeptide" used in the present invention may be any polypeptide having the above activity, and is not particularly limited. For example, a polypeptide belonging to cytochrome P450 may be used. Cytochrome P450 (also called "cytochrome P450" or "CYP") refers to a group of reduced protoheme-containing protein enzymes known as drug metabolizing enzymes. This enzyme catalyzes a monooxygenation reaction in which a monooxygen atom is bonded to a substrate using oxygen and electrons derived from an electron donor such as NAD(P)H provided via an appropriate electron carrier protein (in the case of this enzyme, NADPH-cytochrome P450 reductase or cytochrome b5 is used), and water is generated at the same time. In the present invention, a cytochrome P450 derived from a microorganism belonging to the genus Aspergillus may be used. Examples of microorganisms belonging to the genus Aspergillus include Aspergillus oryzae, Aspergillus flavus, Aspergillus minisclerotigenes, Aspergillus parasiticus, Aspergillus noboparasiticus, Aspergillus sergii, Aspergillus transmotanensis, Aspergillus arachidocola, Aspergillus pseudotamarii, Aspergillus pseudocaelatus, Aspergillus caelatus, Aspergillus tamarii, etc., but are not limited to these.

The "polypeptide" used in the present invention can be specifically identified as any one of the following polypeptides (a) to (c):

(a) A polypeptide comprising or consisting of the amino acid sequence represented by SEQ ID NO:1.
The present polypeptide corresponds to "CYP5106A1" (registered in GenBank: BAJ04467.1), which is a molecular species of cytochrome P450 derived from the koji mold Aspergillus oryzae and is represented by the amino acid sequence shown in SEQ ID NO:1.

(b) A polypeptide that contains an amino acid sequence represented by SEQ ID NO:1 in which one or several amino acids have been deleted, substituted or added, or that consists of the amino acid sequence, and that has the activity of oxidizing the 30th carbon of an oleanane-type triterpene.

Here, "one or several" means 1 to 20, preferably 1 to 10, more preferably 1 to 5, and even more preferably 1 to 3. The polypeptide of (b) includes, but is not limited to, amino acid substitution, deletion, or addition mutants of CYP5106A1 shown in (a) that have the activity of oxidizing the 30th carbon of an oleanane-type triterpene.

(c) A polypeptide that contains an amino acid sequence having 80% or more sequence identity with the amino acid sequence represented by SEQ ID NO:1 or consists of said amino acid sequence and has the activity of oxidizing the 30th carbon of an oleanane-type triterpene.

Here, "sequence identity" means 80% or more, preferably 85% or more, more preferably 90%, even more preferably 95%, even more preferably 97% or more, particularly preferably 98% or more, and especially preferably 99% or more sequence identity to the full length of the amino acid sequence represented by SEQ ID NO: 1. Sequence identity can be determined using well-known programs such as BLAST, FASTA, and CLUSTALW. Polypeptides of (c) include, for example, orthologs of CYP5106A1 shown in (a) derived from other biological species, which have the activity of oxidizing the 30th carbon of oleanane-type triterpenes (but are not limited to these).

In the above polypeptides (b) and (c), it is preferable that the sequence region corresponding to the 130th to 142nd amino acid residues of the amino acid sequence represented by SEQ ID NO: 1 does not contain any mutations such as amino acid substitution, deletion, or addition. If the region contains a mutation, the activity of oxidizing the 30th carbon of the oleanane-type triterpene may be reduced or deleted. The "corresponding sequence region" can be identified by sequence alignment using well-known programs such as BLAST, FASTA, and CLUSTALW.

The "polypeptide" used in the present invention may be a fragment of the polypeptides (a) to (c) above, so long as it has the activity of oxidizing the 30th carbon of an oleanane-type triterpene. Here, the "fragment of a polypeptide" refers to a region of at least 50, 100, 200, 300, or 400 consecutive amino acids in the polypeptides (a) to (c) above.

The polypeptide of the present invention may be obtained, for example, from a microorganism belonging to the genus Aspergillus using a conventionally known method, or may be synthesized by a conventionally known chemical synthesis method, or may be biosynthesized by a transformant produced using a polynucleotide encoding the polypeptide in accordance with conventionally known gene recombination technology.

In particular, the polypeptides (b) and (c) can be obtained by introducing a mutation into the polypeptide (a) using a conventionally known method. Examples of methods for introducing a mutation include, but are not limited to, the Kunkel method, the gapped duplex method, site-specific mutagenesis, a mutation introduction method using a commercially available mutation introduction kit (e.g., Mutant-K (TaKaRa) or Mutant-G (TaKaRa)), LA PCR in vitro Mutagenesis series kit (TaKaRa), etc.), a method using a mutagen (e.g., an alkylating agent such as ethyl methanesulfonate or N-methyl-N'-nitro-N-nitrosoguanidine), and a method using ultraviolet light.

In the present invention, glycyrrhetinic acid can be produced by allowing the above polypeptide to act on 11-oxo-β-amyrin.

The production of glycyrrhetinic acid by reacting the above polypeptide with 11-oxo-β-amyrin can be carried out in vitro or intracellularly. When carried out in vitro, the polypeptide can be reacted with 11-oxo-β-amyrin in an appropriate reaction solution. The composition of the reaction solution is not particularly limited as long as it contains an electron donor such as NADPH, an electron carrier protein, etc., and the pH and salt concentration are optimal activity conditions for the polypeptide. The "electron carrier protein" that can be used in the present invention may be any protein that has the activity of reducing the polypeptide using NADPH, such as NADPH-cytochrome P450 reductase and cytochrome b5. The "electron carrier protein" also includes fragments of the protein as long as it has the above activity. There is no limitation on the biological species from which the electron carrier protein is derived. For example, NADPH-cytochrome P450 reductase derived from the plant Medicago truncatula, microorganisms Aspergillus oryzae, Saccharomyces cerevisiae, etc. can be used. Cytochrome b5 derived from the plant Glycyrrhiza uralensis, microorganisms Aspergillus oryzae, Saccharomyces cerevisiae, etc. can be used.

When acting intracellularly, the above-mentioned polypeptide can be directly administered to a suitable host (organism or cell) and cultured. Alternatively, an expression vector constructed by incorporating a polynucleotide encoding the polypeptide can be introduced into a suitable host, and the resulting transformant can be cultured. The polynucleotides encoding the polypeptides (a) to (c) are not particularly limited as long as they are polynucleotides encoding the polypeptides. For example, examples of polynucleotides encoding the polypeptides include any of the following polynucleotides (d) to (g).

(d) a polynucleotide having the base sequence shown in SEQ ID NO:2.
The polynucleotide having the base sequence shown in SEQ ID NO:2 encodes the CYP5106A1 derived from Aspergillus oryzae.

(e) A polynucleotide having a base sequence in which one or more bases are deleted, substituted or added in the base sequence shown in SEQ ID NO:2 and which encodes the polypeptide.

Here, "one or several" means 1 to 60, preferably 1 to 30, more preferably 1 to 15, even more preferably 1 to 9, and even more preferably 3 to 6.

(f) A polynucleotide having a base sequence that has 80% or more sequence identity to the base sequence shown in SEQ ID NO:2 and that encodes the polypeptide.

Here, "sequence identity" means that the sequence identity is 80% or more, preferably 85% or more, more preferably 90%, even more preferably 95%, even more preferably 97% or more, particularly preferably 98% or more, and especially preferably 99% or more, relative to the entire length of the base sequence shown in SEQ ID NO: 2. Sequence identity can be determined using well-known programs such as BLAST, FASTA, and CLUSTALW.

(g) A polynucleotide having a base sequence that hybridizes under stringent conditions to a base sequence complementary to the base sequence shown in SEQ ID NO:2 and that encodes the polypeptide.

Here, "stringent conditions" refers to conditions under which so-called specific hybrids are formed and non-specific hybrids are not formed, and refer to conditions under which, for example, hybridization is carried out in the presence of 15 to 750 mM, preferably 15 to 500 mM, more preferably 15 to 300 mM sodium salt at a temperature of 25 to 70°C, preferably 50 to 70°C, more preferably 55 to 68°C, followed by washing in the presence of 15 to 750 mM, preferably 15 to 500 mM, more preferably 15 to 300 mM sodium salt at a temperature of 50 to 70°C, preferably 55 to 70°C, more preferably 60 to 65°C.

The polynucleotide used in the present invention may be a fragment of the polynucleotides (d) to (g) above, so long as it encodes a polypeptide having the activity of oxidizing the 30th carbon of an oleanane-type triterpene. Here, "a fragment of a polynucleotide" means a continuous region of at least 150, 300, 600, 900, or 1200 bases in the base sequence of the polynucleotides (d) to (g) above. Such fragments include those that encode fragments of the above polypeptides.

The polynucleotide used in the present invention may also have a base sequence before splicing, i.e., a base sequence corresponding to a pre-mRNA containing an intron.

The polynucleotides used in the present invention may be obtained, for example, from a DNA library or a genomic DNA library of a microorganism belonging to the genus Aspergillus by a conventionally known method, or may be synthesized by a conventionally known method for synthesizing nucleic acid sequences, such as chemical synthesis.

In particular, the polynucleotides (e) and (f) can be obtained by introducing a mutation into the base sequence shown in SEQ ID NO:2 using the method for introducing a mutation described above.

The "expression vector" can be constructed using conventional recombinant gene technology (Sambrook, J. et al., (2012) Molecular Cloning: a Laboratory Manual Fourth Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York), and can be obtained by introducing the polynucleotide into an appropriate vector. The type of vector is not particularly limited, and can be appropriately selected from conventionally known vectors, for example, plasmid vectors such as pESC, pBI, pPZP, pSMA, pUC, pBR, pBluescript, and pTriEX™, viral vectors such as cauliflower mosaic virus (CaMV), bean mosaic virus (BGMV), and tobacco mosaic virus (TMV), and binary vectors such as pBI (but is not limited to these), that can be used in the host to be introduced.

In addition to the polynucleotide, the expression vector may contain an expression regulatory region such as a promoter, enhancer, or terminator, and the polynucleotide may be operably linked to the expression regulatory region. "Operably linked" means that the polynucleotide is positioned and linked so that it is expressed under the control of the expression regulatory region. There are no particular limitations on the types of promoters, enhancers, and terminators to be included in the expression vector, and conventionally known promoters, enhancers, and terminators may be appropriately selected depending on the host to be introduced.

For example, when the host is a yeast, the promoter may be, but is not limited to, the alcohol dehydrogenase gene promoter, the GAL1 promoter, the GAL10 promoter, a promoter derived from a yeast glycolysis gene, the TPI1 promoter, the ADH2-4c promoter, or the like. When the host is a fungus, the promoter may be, but is not limited to, the ADH3 promoter, the tpiA promoter, or the like. When the host is a bacterium, the promoter of the Bacillus stearothermophilus maltogenic amylase gene, the Bacillus licheniformis α-amylase gene, the Bacillus amyloliquefatiens BAN amylase gene, the Bacillus subtilis alkaline protease gene, or the Bacillus pumilus xylosidase gene, or the phage lambda PR or PL promoter, the E. coli lac, trp, or tac promoter, or the like.

Examples of enhancers that can be used include (but are not limited to) SV40 enhancers, CMV enhancers, and CaMV 35S promoter enhancers.

Terminators that can be used include (but are not limited to) the TEF1 terminator, PGK1 terminator, CYC1 terminator, CaMV 35S terminator, the 3' terminator of Escherichia coli lipopolyprotein lpp, the trp operon terminator, the amyB terminator, the ADH1 gene terminator, and the like.

The expression vector may also include a selection marker. Examples of selection markers that can be used include, but are not limited to, drug resistance genes (e.g., tetracycline resistance gene, ampicillin resistance gene, kanamycin resistance gene, hygromycin resistance gene, spectinomycin resistance gene, chloramphenicol resistance gene, neomycin resistance gene, zeocin resistance gene, etc.), fluorescent or luminescent reporter genes (e.g., luciferase, β-galactosidase, green fluorescent protein (GFP)), neomycin phosphotransferase II (NPT II), dihydrofolate reductase, etc.

The expression vector can be introduced into the host by a conventional method such as electroporation, liposome, particle gun, microinjection, or PEG-calcium phosphate. The introduced polynucleotide may be incorporated into the genomic DNA of the host and retained therein or retained therein transiently, or it may remain contained in the expression vector and retained therein or retained therein transiently.

The "host" that can be used in the present invention is not particularly limited as long as the polypeptide can function in the host and/or the polynucleotide introduced by the expression vector can be expressed in the host to produce the polypeptide. For example, the host can be a microorganism (yeast, Escherichia coli, Bacillus subtilis, fungi, etc.), a plant, an animal cell, an insect cell, etc. As the microorganism, yeast, Escherichia coli, Bacillus subtilis, fungi, etc. are preferable, and yeast is particularly preferable. By using a microorganism as a host, it is possible to easily culture and grow it in large quantities, so that glycyrrhetinic acid can be produced easily, stably, and inexpensively, which is effective. As the plant, a leguminous plant is preferable, and a leguminous plant is more preferable. In the present invention, "plant" includes a plant body, a plant organ, a plant tissue, a plant cell, a culture thereof, and a seed.

When the host is unable to biosynthesize oleanane-type triterpenes, glycyrrhetinic acid can be produced by directly providing one or more of β-amyrin and 11-oxo-β-amyrin to the host. Alternatively, in order to provide the host with the ability to biosynthesize oleanane-type triterpenes, glycyrrhetinic acid can be produced by introducing a polynucleotide encoding one or more appropriate oleanane-type triterpene synthases. This makes it possible to select as the host a biological species or biological cells that are inherently unable to biosynthesize oleanane-type triterpenes, making it possible to produce glycyrrhetinic acid.

The above-mentioned "oleanane-type triterpene synthase" includes β-amyrin synthase (sometimes referred to as "OSC1" in this specification) and oleanane-type triterpene 11-position oxidase. "OSC1" is an enzyme that catalyzes the reaction of opening the ring of 2,3-oxidosqualene to produce β-amyrin. In the present invention, "OSC1" also includes fragments of the enzyme as long as the activity of the enzyme is maintained. "Oleanane-type triterpene 11-position oxidase" is an enzyme (sometimes referred to as "CYP88D6" in this specification) that catalyzes the reaction of oxidizing the 11th carbon of β-amyrin to produce 11-oxo-β-amyrin. In the present invention, "oleanane-type triterpene 11-position oxidase" also includes fragments of the enzyme as long as the activity of the enzyme is maintained. OSC1 and oleanane-type triterpene 11-position oxidase derived from any biological species can be used as long as they can be expressed and function in the host. Therefore, OSC1 and oleanane triterpene 11-oxidase may be derived from the same biological species, or may be derived from different biological species. For example, in the present invention, OSC1 derived from a legume plant (such as Lotus japonicus) and oleanane triterpene 11-oxidase derived from a legume plant (such as Glycyrrhiza glabra) can be used.

A polynucleotide encoding one or more suitable oleanane-type triterpene synthases may be introduced into a host in the same expression vector as a polynucleotide encoding a polypeptide having activity of oxidizing the 30th carbon of the oleanane-type triterpene, or each may be introduced into a host in a separate expression vector. The expression of each polynucleotide may be controlled independently or in a coordinated manner. Independent expression control can be achieved, for example, by linking each of the polynucleotides to promoters with different induction conditions or promoters with different expression strengths. Coordinate expression control can be achieved, for example, by linking each of the polynucleotides to the same type of promoter.

In addition, when the host does not have the electron carrier protein, the electron carrier protein may be directly provided, or a polynucleotide encoding the electron carrier protein may be introduced into the host. The polynucleotide encoding the electron carrier protein may be derived from any biological species, as long as it is expressed and can function in the host. Therefore, when a polynucleotide encoding NADPH-cytochrome P450 reductase and a polynucleotide encoding cytochrome b5 are used as the polynucleotide encoding the electron carrier protein, each polynucleotide may be derived from the same biological species or from different biological species. The polynucleotide encoding the electron carrier protein can be introduced into the host using an expression vector. The polynucleotide encoding the electron carrier protein may be the same expression vector as the polynucleotide encoding the above (a) to (c), or may be a different expression vector. The expression of each polynucleotide may be controlled independently or in synchronization with each other. Independent expression control can be achieved, for example, by linking the polynucleotides to promoters with different induction conditions or promoters with different expression strengths. Coordinated expression control can be achieved, for example, by linking each polynucleotide to the same type of promoter.

The host or transformant is cultured under conditions suitable for the host used. The medium may contain a carbon source (e.g., glucose, glycerin, mannitol, fructose, lactose, ethanol, acetic acid, etc.), a nitrogen source (e.g., inorganic nitrogen such as ammonium sulfate and ammonium chloride, organic nitrogen sources such as casein hydrolysate, yeast extract, polypeptone, bactotryptone, beef extract, etc.), inorganic salts (e.g., sodium diphosphate, potassium diphosphate, magnesium chloride, magnesium sulfate, calcium chloride, etc.), vitamins (vitamin B1, etc.), drugs (antibiotics such as ampicillin, tetracycline, kanamycin, etc.), etc. Any known medium suitable for the host used may be used. When yeast is used as the host, YPD medium, YPM medium, YPG medium, YPDM medium, SMM medium, etc. may be used. In addition, when one or more of β-amyrin and 11-oxo-β-amyrin are directly administered to the host, this may be done by including these compounds in the medium, or by culturing them together with other microorganisms that produce β-amyrin and/or 11-oxo-β-amyrin.

Cultivation can be carried out at a temperature of 10 to 50°C, with aeration and stirring as necessary, for several hours to several days.

In the cells of the cultured host or transformant, the polypeptide having the activity of oxidizing the 30-position carbon of the oleanane-type triterpene derived from Aspergillus oryzae acts on 11-oxo-β-amyrin to produce 30-hydroxy-11-oxo-β-amyrin, acts on 30-hydroxy-11-oxo-β-amyrin to produce glycyrrhetaldehyde, and acts on glycyrrhetaldehyde to produce glycyrrhetinic acid. In the reaction for producing glycyrrhetinic acid using the polypeptide, the production of contaminants (e.g., 20-epi-glycyrrhetinic acid, etc.) can be suppressed, and glycyrrhetinic acid with high purity can be produced.

After the cultivation, the produced glycyrrhetinic acid can be recovered using one or more separation and purification means such as solid-phase extraction, liquid-liquid partition extraction, column chromatography, and liquid chromatography.
The present invention will now be described in more detail with reference to examples.

Example 1: Construction of a yeast strain expressing CYP5106A1 derived from Aspergillus oryzae RIB40 A pUC18 plasmid DNA (Nazir, K.H.M.N.H., et al., Arch. Microbiol., 192, 395-408, 2010) containing the CYP5106A1 gene constructed using mRNA from the koji mold Aspergillus oryzae RIB40 strain (NBRC100959) was used as a template, and mixed with two types of primers, CYP5106A1-F (CCTCTTTTGCGTCAGCACTCAT) (SEQ ID NO: 3) and CYP5106A1-R (GGGCTCTAGACTATCGCCCCACCCA)) (SEQ ID NO: 4), and then subjected to Phusion After treating with DNA polymerase (New England Biolabs) at 96°C for 3 minutes, PCR was performed consisting of (96°C, 30 seconds → 55°C, 20 seconds → 72°C, 60 seconds) x 40 cycles. The PCR solution was electrophoresed, and the amplified fragment of about 1.6 kb was purified with QIAquick Gel Extraction Kit (Qiagen). This DNA fragment was treated with T4 polynucleotide kinase (Takara Bio) and then digested with XbaI (Takara Bio). The obtained DNA fragment was mixed with a DNA fragment obtained by linearizing an expression plasmid DNA (Nazir, K.H.M.N.H., et al., Appl. Environ. Microbiol., 77, 3147-3150, 2011) with PshAI (Takara Bio Inc.) and SpeI (Takara Bio Inc.) to perform a ligation reaction, thereby constructing a plasmid expressing CYP5106A1 downstream of the GAPDH promoter. The resulting CYP5106A1 expression plasmid DNA was used to transform the budding yeast Saccharomyces cerevisiae AH22 strain (MATa leu2-3 leu2-112 his4-519 can1) using Fast ^™ -Yeast Transformation Kit (G-Biosciences) to construct a yeast strain expressing the CYP5106A1 gene.

Example 2: Confirmation of 11-oxo-β-amylinylation activity of yeast strain expressing Aspergillus oryzae-derived CYP5106A1 The yeast strain constructed in Example 1 was inoculated into 500 μl of artificial medium containing 80 g glucose, 26.8 g yeast nitrogen base (amino acid-free) (ForMedium), 1.0 g DO Supplement (-Leu) (Takara Bio), 66 mg 5-aminolevulinic acid (Fujifilm Wako Pure Chemical Industries), and 0.1 g 11-oxo-β-amyrin per liter, and cultured with shaking at 28° C. in the dark. After 3 days, 200 μl of the culture solution was removed and mixed with an equal volume of acetone:methanol (1:1) solution, and the entire amount was filtered (pore size 0.45 μm, Whatman). 800 μl of ethyl acetate (FUJIFILM Wako Pure Chemical Industries, Ltd.) was added to the filtrate, and the mixture was vigorously shaken, after which the upper layer (organic layer) was collected. This was repeated three times, and the solvent in the resulting organic layer was removed by drying under reduced pressure, and the residue was dried to solid. This residue was dissolved by adding 50 μl of N-methyl-N-trimethylsilyltrifluoroacetamide (manufactured by Sigma-Aldrich Co., Ltd., hereinafter referred to as MSTFA) and 50 μl of N,N'-dimethylformamide, and heated at 60°C for 30 minutes to carry out a trimethylsilylation reaction (hereinafter referred to as TMSification), which was used as a measurement sample. In addition, 30-hydroxy-11-oxo-β-amyrin and glycyrrhetinic acid (FUJIFILM Wako Pure Chemical Industries, Ltd.) were also similarly converted to TMS to prepare measurement samples. When these were analyzed by GC-MS (analysis conditions in Table 1 below), peaks were detected at the same retention times as the TMS derivatives of 30-hydroxy-11-oxo-β-amyrin (13.0 min) and glycyrrhetinic acid (14.3 min) in the total ion chromatogram of the sample extracted from the reaction in which the yeast strain expressing CYP5106A1 was contacted with 11-oxo-β-amyrin (Figure 2). The mass spectra of these two peaks were consistent with those of 30-hydroxy-11-oxo-β-amyrin and glycyrrhetinic acid (Figure 3), respectively. On the other hand, the peaks corresponding to these were not detected by GC-MS of the sample extracted from the culture of the control yeast not having the CYP5106A1 gene and 11-oxo-β-amyrin and converted to TMS, indicating that CYP5106A1 has the activity of oxidizing 11-oxo-β-amyrin at the 30-position, and that yeast expressing this can produce 30-hydroxy-11-oxo-β-amyrin and glycyrrhetinic acid from 11-oxo-β-amyrin. The preparation and identification of the substrates used in the above test were carried out based on the methods described in Seki, H., et al., Proc. Natl. Acad. Sci. USA, 105, 14204-14209, 2008 and Seki, H., et al., Plant Cell, 23, 4112-4123, 2011.

Example 3: Construction of yeast strain Budding yeast YPH500 (MATalpha ura3-52 lys2-801 amber ade2-101 ochre trp1-Δ63 his3-Δ200 leu2-Δ1) was provided by the National BioResource Project (hereinafter, NBRP). Hereinafter, transformation of budding yeast was performed using Frozen-EZ Yeast Transformation II (Zymo Research).

Example 4 Construction of pPerg7_HIS3_Pmet3_ERG7 Vector Genomic DNA was prepared from budding yeast BY4742 (MATalpha leu2Δ ura3Δ his3-Δ1 lys2Δ, Open Biosystems) using a Yeast DNA Extraction Kit (Thermo Fisher Scientific). Using this DNA as a template, PCR was performed with KOD Plus Neo DNA polymerase (TOYOBO) and both primers Pmet-F2 (GATCGAGCTCTTTAGTACTAACAGAGACTTTTGTCA) (SEQ ID NO: 5) and Pmet-R3 (AAATTCTGTCATAAGCTTAATTATACTTTATTCTTGTTA) (SEQ ID NO: 6) to amplify a DNA fragment of the Met3 gene promoter region. The amplified fragment was purified with MinElute Gel Extraction Kit (Qiagen) to obtain a DNA fragment of approximately 0.5 kbp.

Next, using the same genomic DNA as a template, an ERG7 gene DNA fragment was amplified by PCR using KOD Plus Neo DNA polymerase with both primers ERG7-F1 (AATTAAGCTTATGACAGAATTTTATTCTGACAC) (sequence number 7) and ERG7-R1 (GATCGTCGACAAGCGTATGTGTTTCATATGCC) (sequence number 8), and the amplified fragment was purified to obtain DNA of approximately 2.2 kbp using a MinElute Gel Extraction Kit. The DNA fragment of the Met3 gene promoter region and the ERG7 gene DNA fragment were mixed, and the Met3 gene promoter_ERG7 gene (hereinafter, Pmet3_ERG7 fragment) DNA fragment was amplified by PCR using KOD Plus Neo DNA polymerase with both primers Pmet-F2 (GATCGAGCTCTTTAGTACTAACAGAGACTTTTGTCA) (SEQ ID NO: 5) and ERG7-R1 (GATCGTCGACAAGCGTATGTGTTTCATATGCC) (SEQ ID NO: 8). The resulting amplified fragment was purified with a MinElute Gel Extraction Kit to obtain a DNA fragment of approximately 2.7 kbp. Next, using PrimeSTAR (registered trademark) Max DNA Polymerase (Takara Bio Inc.), vector pYES-DEST52 (Invitrogen) DNA as a template, pYES-URAt-R (AAAACTGTATTATAAGTAAAATGCATG) (SEQ ID NO: 9) and pYES-XhoI-F1 (CTCGAGCATGCATCTAGAGGGCCGCATCATG) (SEQ ID NO: 10) as primers, and KOD Plus Neo DNA polymerase was used to amplify a DNA fragment containing the pYES-derived Amp-pUC ori (hereinafter, Amp-pUC ori fragment), and the resulting amplified fragment was purified with a MinElute Gel Extraction Kit to obtain a DNA of about 2.2 kbp. Thereafter, the ERG7 gene promoter region was amplified by PCR using the genomic DNA of budding yeast BY4742 as a template and KOD Fx Neo DNA polymerase (TOYOBO) with both primers Perg7-340F (TTATAATACAGTTTTGTTAACATTACTATTAAATTCTCAA) (SEQ ID NO: 11) and Perg7-R (AGCTCACTAGTCGACCTGTTTTGTACTTTCTTTGTG) (SEQ ID NO: 12). The resulting amplified fragment was purified with a MinElute Gel Extraction Kit to obtain a DNA fragment of approximately 0.34 kbp (hereinafter, Perg7 fragment). In addition, using vector pESC-His (Stratagene) DNA as a template, PrimeSTAR (registered trademark) Max DNA Polymerase was used to amplify the HIS3 gene DNA fragment with both primers His-F (GTCGACTAGTGAGCTCAGATTGTACTGAGAGTGCAC) (SEQ ID NO: 13) and His-R (ATCGATAAGCTAGCTTCTCCTTACGCATCTGTGC) (SEQ ID NO: 14), obtaining a DNA of approximately 0.9 kbp (hereinafter, the HIS3 fragment).

Using the previously obtained Pmet3_ERG7 fragment as a template, PCR was performed with PrimeSTAR (registered trademark) Max DNA Polymerase and both primers Pmet-F5 (AGCTAGCTTATCGATTTAGTACTAACAGAGACTTTTG) (SEQ ID NO: 15) and ERG7-HpaI-R (AGATGCATGCTCGAGGTTAACAGGTGCTATACACAAG) (SEQ ID NO: 16) to amplify a DNA fragment with a restriction enzyme HpaI site added to the 3' site of Pmet3_ERG7 (hereinafter, Pmet3_ERG7_HpaI fragment), and the obtained amplified fragment was purified with a MinElute Gel Extraction Kit.

Next, the Perg7 DNA fragment and the HIS3 fragment were mixed, and a PCR reaction was carried out using PrimeSTAR (registered trademark) Max DNA Polymerase without adding any primers. After that, both primers Perg7-340F (TTATAATACAGTTTTGTTAACATTACTATTAAAATTCTCAA) (SEQ ID NO: 11) and His-R (ATCGATAAGCTAGCTTCTCCTTACGCATCTGTGC) (SEQ ID NO: 14) were added, and the PCR reaction was continued to amplify the Perg7_HIS3 DNA. The resulting amplified fragment was then purified using a MinElute Gel Extraction Kit, and a DNA fragment of approximately 1.3 kbp corresponding to Perg7_HIS3 was obtained.

Next, the Perg7_HIS3 and Pmet3_ERG7_HpaI DNA fragments were mixed and a PCR reaction was carried out using PrimeSTAR (registered trademark) Max DNA Polymerase without adding any primers. After that, both primers Perg7-340F (TTATAATACAGTTTTGTTAACATTACTATTAATTCTCAA) (sequence number 11) and ERG7-HpaI-R (AGATGCATGCTCGAGGTTAACAGGTGCTATACACAAG) (sequence number 16) were added and the PCR reaction was continued to amplify the Perg7_HIS3-Pmet3_ERG7 DNA. The amplified fragment was then purified using a MinElute Gel Extraction Kit to obtain a DNA fragment of approximately 4.0 kbp corresponding to Perg7_HIS3-Pmet3_ERG7. The resulting Perg7_HIS3-Pmet3_ERG7 and Amp-pUC ori fragment were then ligated using an In-Fusion (registered trademark) HD Cloning Kit to construct the plasmid pPerg7_HIS3-Pmet3_ERG7.

Example 5: Construction of plasmid pESC-His-GuCPR1-GuCYB5 Using GeneArt ^™ Strings ^™ DNA Fragments synthesis (Invitrogen), a DNA fragment having a sequence for constructing restriction enzyme SacI and NotI sites in the untranslated regions at the 5' and 3' ends of a gene (hereinafter, GuCPR1; SEQ ID NO:138) encoding Glycyrrhiza uralensis-derived CPR1 (registered in Genbank as QCZ35624.1; SEQ ID NO:137) was synthesized. The obtained DNA fragment was mixed with a DNA fragment of a pESC-His vector (Stratagene) digested with the restriction enzymes SacI and NotI, and ligated using In-Fusion (registered trademark) HD Cloning Kit to construct pESC-His-GuCPR1 in which GuCPR1 was linked downstream of the Gal10 promoter.

Next, a search was conducted for a polypeptide having a high amino acid sequence identity with Artemisia anguicida cytochrome B5 (Paddon, C. J., et al., Nature., 496, 528-532, 2013, GenPept registration AFX82679.1; SEQ ID NO: 139) in the Glycyrrhiza uralensis database (http://ngs-data-archive.psc.riken.jp/Gur/blast.pl), and a polypeptide having an amino acid sequence identity of 78% (Unigene23309, hereinafter, GuCYB5 (SEQ ID NO: 140)) was found. A DNA fragment having a sequence for constructing restriction enzyme SalI and XhoI sites in the untranslated regions at the 5' and 3' ends of the gene (SEQ ID NO: 141) encoding this GuCYB5 was synthesized using GeneArt ^™ Strings ^™ DNA Fragments synthesis. The resulting DNA fragment was mixed with a DNA fragment of pESC-His-GuCPR1 digested with restriction enzymes SalI and XhoI (both from Takara Bio Inc.), and ligated using In-Fusion (registered trademark) HD Cloning Kit to construct pESC-His-GuCPR1-GuCYB5 in which GuCYB5 is connected downstream of the Gal1 promoter.

Example 6: Construction of plasmid pPerg7-Pgal1_GuCYB5-Pgal10_GuCPR1-HIS3-Pmet_ERG7 Using the plasmid pESC-His-GuCPR1-GuCYB5 obtained in Example 5 as a template, PCR was performed using PrimeSTAR (registered trademark) Max DNA Polymerase with both primers, Tcyc1-R-SalI (TACAAAAACAGGTCGACTTCGAGCGTCCCAAAAACC) (SEQ ID NO: 17) and pESC-His-1881-F (TCTCAGTACAATCTGTCCATTCGCCATTCAGGCTG) (SEQ ID NO: 18), to amplify the expression units of GuCPR1 and GuCYB5. This was mixed with a DNA fragment obtained by digesting pPerg7-HIS3-Pmet3_ERG7 constructed in Example 4 with restriction enzymes SalI and SacI (both from Takara Bio Inc.), and ligated using In-Fusion (registered trademark) HD Cloning Kit to construct the plasmid pPerg7-Pgal1_GuCYB5-Pgal10_GuCPR1-HIS3-Pmet3_ERG7t3_ERG7.

Example 7: Obtaining DNA fragment of erg7::Pgal1_GuCYB5-Pgal10_GuCPR1-HIS3-Pmet3_ERG7 The plasmid pPerg7-Pgal1_GuCYB5-Pgal10_GuCPR1-HIS3-Pmet3_ERG7 obtained in Example 6 was digested with the restriction enzyme HpaI (Takara Bio Inc.) to obtain a DNA fragment of erg7::Pgal1_GuCYB5-Pgal10_GuCPR1-HIS3-Pmet3_ERG7.

Example 8: Construction of plasmid pPgal1_ERG20-Pgal10_ERG9-Pgal1_ERG1 Using the DNA of vector pESC-His as a template, a DNA fragment of a region including the Gal10 promoter and the Gal1 promoter was amplified with PrimeSTAR (registered trademark) Max DNA Polymerase and both primers GAL10-EcoRI-F (gaattcgaattttcaaaaattcttac) (SEQ ID NO: 19) and GAL1-BamH-R (ggatccggggttttttttctcc) (SEQ ID NO: 20), and purified with a MinElute Gel Extraction Kit to obtain a DNA fragment of about 0.7 kbp (Pgal10-Pgal1). Furthermore, using pESC-His DNA as a template and PrimeSTAR (registered trademark) Max DNA Polymerase, a region containing the CYC1 terminator was amplified with both primers pESC-His3089-F (GCTTGGTACCGCGGCTAGC) (SEQ ID NO: 21) and pESC-His-3430R (TGAGCTGATACCGCTCGCC) (SEQ ID NO: 22), and purified with a MinElute Gel Extraction Kit to obtain a DNA fragment of about 0.3 kbp (hereinafter, CYC1 terminator DNA fragment-a). Similarly, a region containing the ADH1 terminator was amplified using both primers pESC-His1751-F (GCCGGCGAACGTGGCGAGAAAG) (SEQ ID NO: 23) and pESC-His-2268-R (GAGCTCTTAATTAACAATTCTTCG) (SEQ ID NO: 24), and purified using the MinElute Gel Extraction Kit to obtain a DNA fragment of approximately 0.5 kbp. Next, using PrimeSTAR (registered trademark) Max DNA Polymerase and the vector pYES-DEST52 as a template, a region containing the Gal1 promoter was amplified with both primers DEST52-GAL1p-DraIII-F (agggcgatggcccactacgtgACGGATTAGAAGCCGCCGAG) (SEQ ID NO: 25) and GAL1-BamH-R (ggatccggggttttttttctcc) (SEQ ID NO: 20), and purified with a MinElute Gel Extraction Kit to obtain a DNA fragment of about 0.3 kbp (CYC1 terminator DNA fragment-b). PCR was performed using PrimeSTAR (registered trademark) Max DNA Polymerase with both primers pYES-CYC1t-F (TCTAGAGGGCCGCATCATGT) (SEQ ID NO: 26) and pYES-CYC1t-R (cgccacgttcgccggCAGCTTGCAAATTAAAGCCT) (SEQ ID NO: 27) to amplify the CYC1 terminator DNA fragment-b, which was then purified using a MinElute Gel Extraction Kit.

Furthermore, using the genomic DNA of budding yeast BY4742 as a template, a DNA fragment of the ERG1 gene was amplified by PCR using KOD Fx Neo DNA polymerase with both primers ERG1-GAL1-F (gagaaaaaacccccggatccATGTCTGCTGTTAACGTTGCAC) (sequence number 28) and ERG1-CYC1t-R (GCTAGCCGCGGTACCAAGCttaaccaatcaactcaccaaaca) (sequence number 29), and a DNA of approximately 1.5 kbp (ERG1 fragment) was purified and obtained using the MinElute Gel Extraction Kit. Similarly, a DNA fragment of the ERG9 gene was amplified by PCR using KOD Fx Neo DNA polymerase with both primers ERG9-GAL10-F (aagaatttttgaaaattcgaattcATGGGAAAGCTATTACAATTGGC) (SEQ ID NO: 30) and ERG9-ADH1t-R (GAAGAATTGTTAATTAAGAGCTCTcacgctctgtgtaaagtgta) (SEQ ID NO: 31), and a DNA of about 1.3 kbp (ERG9 fragment) was purified and obtained using the MinElute Gel Extraction Kit. Similarly, an ERG20 DNA fragment was amplified by PCR using KOD Fx Neo DNA polymerase with both primers ERG20-GAL1-F (gagaaaaaaacccccggatccATGGCTTCAGAAAAGAAATTAGG) (SEQ ID NO: 32) and ERG20-CYC1t-R (CATGATGCGGCCCCTCTAGActatttgcttctcttgtaaactttg) (SEQ ID NO: 33), and a DNA of about 1.1 kbp (ERG20 fragment) was obtained using the MinElute Gel Extraction Kit.

Next, the 5' untranslated region of the TRP1 gene (hereinafter referred to as TRP1_5' linker) was amplified by PCR using KOD Fx Neo DNA polymerase with both primers Trp-303-His3430-F (ggcgagcggtatcagctcaATAGCTTGTCACCTTACGTAC) (sequence number 34) and Trp-PmacI-His-3435-R (accgtattaccgcctCACGTGCTCAATAGTCACC) (sequence number 35), and then DNA of approximately 0.1 kbp was purified and obtained using the MinElute Gel Extraction Kit. Next, using this DNA as a template, PCR was performed using PrimeSTAR (registered trademark) Max DNA Polymerase with both primers GAL1-CYC1t-F (gagaaaaaacccccggatccgagCTCGAGCGGTATCAGCTCAA) (SEQ ID NO: 36) and Trp-PmacI-His-3435-R (accgtattaccgcctCACGTGCTCAATAGTCACC) (SEQ ID NO: 35) to amplify TRP1_5'linker having a sequence complementary to the 3' end of the GAL1 promoter at its end, and a DNA of about 0.1 kbp was purified and obtained using a MinElute Gel Extraction Kit. This DNA fragment was mixed with the GAL1 promoter DNA fragment amplified using the vector pYES-DEST52 as a template, and the PCR reaction was carried out using PrimeSTAR (registered trademark) Max DNA Polymerase without adding a primer. Then, both primers pESC-DraIII-F (agggcgatggcccactac) (SEQ ID NO: 37) and Trp-PmacI-His-3435-R (accgtattaccgcctCACGTGCTCAATAGTCACC) (SEQ ID NO: 35) were added, and the PCR reaction was continued to amplify the DNA to which the GAL1 promoter_TRP1_5'linker DNA fragment was connected. The resulting amplified fragment was then purified with the MinElute Gel Extraction Kit to obtain a DNA fragment of about 1.5 kbp. Next, using pESC-TRP (Stratagene) DNA as a template, pESC-His3435-F (aggcggtaatacggttatcc) (SEQ ID NO: 38) and pESC-DraIII-R (gtgggccatcgccctgatag) (SEQ ID NO: 39) primers were used to amplify the region excluding the ADH1 terminator to the CYC1 terminator of the pESC-TRP plasmid using PrimeSTAR (registered trademark) Max DNA Polymerase. The resulting amplified fragment was then purified with a MinElute Gel Extraction Kit to obtain a DNA fragment of about 4.7 kbp. This DNA fragment and the DNA fragment of GAL1 promoter_TRP1_5'linker were mixed and ligated using In-Fusion (registered trademark) HD Cloning Kit to construct a plasmid in which GAL1 promoter_TRP1_5'linker was inserted into pESC-TRP (hereinafter, pESC-TRP-Pgal1_TRP1linker). This plasmid DNA was digested with restriction enzymes BamHI and XhoI to obtain a DNA fragment of pESC-TRP-Pgal1_TRP1linker. The ADH1 terminator DNA fragment amplified using pESC-TRP as a template and the CYC1 terminator DNA fragment-b were mixed, and a PCR reaction was carried out using PrimeSTAR (registered trademark) Max DNA Polymerase without adding a primer. Then, pYES-CYC1t-F (TCTAGAGGGCCGCATCATGT) (SEQ ID NO: 26) and pESC-His-2268-R (GAGCTCTTAATTAACAATTCTTCG) (SEQ ID NO: 24) were added and the PCR reaction was continued to amplify DNA in which the ADH1 terminator and the CYC1 terminator DNA fragment-b (hereinafter, Tcyc1-b-Tadh1) were joined. The resulting amplified fragment was then purified with a MinElute Gel Extraction Kit to obtain a DNA fragment of about 0.6 kbp. The DNA fragment of Tcyc1-b-Tadh1 and the DNA fragment of ERG20 were mixed, and PCR reaction was carried out using PrimeSTAR (registered trademark) Max DNA Polymerase without adding any primers. Then, both primers ERG20-GAL1-F2 (aaaaaaccccggatccATGGCT) (SEQ ID NO: 40) and pESC-His-2260-R (AATTAACAATTCTTCGCCAGAG) (SEQ ID NO: 41) were added, and the PCR reaction was continued to amplify the DNA of ERG20_Tcyc1-b-Tadh1. The resulting amplified fragment was then purified with MinElute Gel Extraction Kit to obtain a DNA fragment of about 1.7 kbp. Next, the Pgal10-Pgal1 DNA fragment and the ERG9 DNA fragment were mixed, and PCR reaction was carried out using PrimeSTAR (registered trademark) Max DNA Polymerase without adding a primer, and then ERG9-ADH1t-R (GAAGAATTGTTAATTAAGAGCTCTcacgctctgtgtaaagtgta) (SEQ ID NO: 31) and GAL1-BamH-R (ggatccggggttttttttctcc) (SEQ ID NO: 20) were added to further continue the PCR reaction, thereby amplifying the ERG9_Pgal10-Pgal1 fragment in which ERG9 was connected downstream of Pgal10. The amplified fragment was then purified with MinElute Gel Extraction Kit to obtain a DNA fragment of about 2.0 kbp. The ERG1 DNA fragment and the CYC1 terminator DNA fragment-a were mixed, and PCR reaction was carried out using PrimeSTAR (registered trademark) Max DNA Polymerase without adding a primer. ERG1-GAL1-F (gagaaaaaaacccccggatccATGTCTGCTGTTAACGTTGCAC) (SEQ ID NO: 28) and pESC-His-3430R (TGAGCTGATACCGCTCGCC) (SEQ ID NO: 22) were added, and the PCR reaction was continued to amplify the ERG1_Tcyc1-a fragment in which the CYC1 terminator DNA fragment-a was connected downstream of ERG1. The resulting amplified fragment was then purified using a MinElute Gel Extraction Kit to obtain a DNA fragment of approximately 1.8 kbp. Then, the ERG9_Pgal10-Pgal1 fragment and the ERG1_Tcyc1-a fragment were mixed, and a PCR reaction was carried out using PrimeSTAR (registered trademark) Max DNA Polymerase without adding a primer. Then, ERG9-ADH1t-R (GAAGAATTGTTAATTAAGAGCTCTcacgctctgtgtaaagtgta) (SEQ ID NO: 31) and CYC1t-XhoI-3430R (GCTGATACCGCTCGAGgcagccgaac) (SEQ ID NO: 42) were added, and the PCR reaction was further continued to amplify ERG9_Pgal10-Pgal1_ERG1_Tcyc1. The amplified fragment was then purified using a MinElute Gel Extraction Kit to obtain a DNA fragment of approximately 3.8 kbp. The DNA fragment of pESC-TRP-Pgal1_TRP1linker obtained above was mixed with the ERG9_Pgal10-Pgal1_ERG1_Tcyc1 fragment and the ERG20_Tcyc1-b-Tadh1 fragment, and ligated using an In-Fusion (registered trademark) HD Cloning Kit to construct the plasmid pPgal1_ERG20-Pgal10_ERG9-Pgal1_ERG1 in which the Pgal1_ERG20_Tcyc1-Tadh1_ERG9_Pgal10-Pgal1_ERG1_Tcyc1 fragment was inserted into pESC-TRP.

Example 9: Construction of pTrp1Gene plasmid Using the genomic DNA of budding yeast BY4742 as a template, a DNA fragment of about 1.4 kbp of the TRP1 gene containing the promoter region was amplified by PCR using KOD Fx Neo DNA polymerase with both primers Trp-BglII-F (acgaggccctttcgtGTTTAAACAGCAGATCTGATGACTGGTC) (SEQ ID NO: 43) and Trp-BglII-R (accgtattaccgcctGTTTAAACAGATCTTTTATGCTTGC) (SEQ ID NO: 44), and the DNA of about 1.4 kbp was purified and obtained using the MinElute Gel Extraction Kit. Next, using the pESC-TRP vector DNA as a template, a DNA fragment of the pESC vector region not containing the TRP1 gene was amplified by PCR using PrimeSTAR (registered trademark) Max DNA Polymerase with both primers pESC-His3435-F (aggcggtaatacggttatcc) (SEQ ID NO: 38) and pESC-trp-6526R (acgaaagggcctcgtgatac) (SEQ ID NO: 45), and a DNA of about 5.8 kbp was purified and obtained using the MinElute Gel Extraction Kit. The TRP1 gene DNA amplified by PCR from the genomic DNA of BY4742 and the DNA of a region other than TRP1 amplified from pESC-TRP were mixed and ligated using In-Fusion (registered trademark) HD Cloning Kit to obtain the pTrp1Gene plasmid.

Example 10: Obtaining DNA fragment of trp1::Pgal1_ERG20-Pgal10_ERG9-Pgal1_ERG1-TRP1 The DNA fragment of the plasmid pPgal1_ERG20-Pgal10_ERG9-Pgal1_ERG1 obtained in Example 8 was digested with restriction enzymes DraIII (New England Biolab) and XhoI to obtain Pgal1_ERG20-Pgal1
A DNA fragment of 0_ERG9-Pgal1_ERG1 was obtained. Using the DNA of pTrp1Gene obtained in Example 9 as a template, a DNA fragment containing the pESC vector was amplified by PCR using PrimeSTAR (registered trademark) Max DNA Polymerase with both primers Ptrp-225-F (gttcggctgcCTCGAATATATGTGTACTTTGCAGT (SEQ ID NO: 46)) and Ptrp-373-R (CTTCTAATCCGTCACTGTCAGCTCTTTTAGATCGG (SEQ ID NO: 47)). These were subjected to an In-Fusion reaction using the In-Fusion (registered trademark) HD Cloning Kit to construct the plasmid pTrp-ERG20-9-1 in which the DNA fragment of Pgal1_ERG20-Pgal10_ERG9-Pgal1_ERG1 was inserted upstream of the TRP1 promoter of pTrp1Gene (-373 to -225 region). This plasmid DNA was digested with the restriction enzyme BglII (Takara Bio Inc.) to obtain the DNA fragment of trp1::Pgal1_ERG20-Pgal10_ERG9-Pgal1_ERG1-TRP1.

Example 11: Construction of plasmid pPgal1_ERG10-Pgal10_ERG19-Pgal1_ERG12 Using the genomic DNA of budding yeast BY4742 as a template, the DNA fragment of ERG10 was amplified by PCR using KOD Fx Neo DNA polymerase with both primers ERG10-GAL1-F (gagaaaaaaaccccggatccATGTCTCAGAACGTTTACATTG) (SEQ ID NO: 48) and ERG10-CYC1t-R (CATGATGCGGCCCCTCTAGATCATATCTTTTCAATGACAATAGAG) (SEQ ID NO: 49), and a DNA of about 1.2 kbp (ERG10 fragment) was obtained using the MinElute Gel Extraction Kit. Similarly, an ERG12 DNA fragment was amplified by PCR using KOD Fx Neo DNA polymerase with both primers ERG12-GAL1-F (gagaaaaaaccccggatccATGTCATTACCGTTCTTAACTTC) (SEQ ID NO: 50) and ERG12-CYC1t-R (GCTAGCCGCGGTACCAAGCTTATGAAGTCCATGGTAAATTCG) (SEQ ID NO: 51), and a DNA of about 1.3 kbp (ERG12 fragment) was obtained using the MinElute Gel Extraction Kit. Similarly, a DNA fragment of ERG19 was amplified by PCR using KOD Fx Neo DNA polymerase with both primers ERG19-GAL10-F (aagaatttttgaaaattcgaattcATGACCGTTTACACAGCATCC) (SEQ ID NO: 52) and ERG19-ADH1t-R (GCTCTTAATTAACAATTCTTCGTTATTCCTTTGGTAGACCAGTCT) (SEQ ID NO: 53) to obtain a DNA of about 1.2 kbp (ERG19 fragment) using the MinElute Gel Extraction Kit. The DNA fragment of Tcyc1-b-Tadh1 and the DNA fragment of ERG10 prepared in <Example 8> were mixed, and a PCR reaction was carried out using PrimeSTAR (registered trademark) Max DNA Polymerase without adding a primer, and then both primers ERG10-GAL1-F2 (aaaaaaccccggatccATGTCT) (SEQ ID NO: 54) and ADH1t-Link-R (TTGTTAATTAAGAGCAGAGGTTTGGTCAAGTC) (SEQ ID NO: 55) were added and the PCR reaction was continued to amplify the DNA of ERG10_Tcyc1-b-Tadh1. The amplified fragment obtained was then purified using MinElute Gel Extraction Kit to obtain a DNA fragment of about 1.8 kbp. Next, the Pgal10-Pgal1 DNA fragment and the ERG19 DNA fragment obtained in Example 8 were mixed, and a PCR reaction was carried out using PrimeSTAR (registered trademark) Max DNA Polymerase without adding a primer. Then, ERG19-ADH1t-R (GCTCTTAATTAACAATTCTTCGTTATTCCTTTGGTAGACCAGTCT) (SEQ ID NO: 53) and GAL1-BamH-R (ggatccggggttttttttctcc) (SEQ ID NO: 20) were added, and the PCR reaction was continued to amplify an ERG19_Pgal10-Pgal1 fragment in which ERG19 was connected downstream of Pgal10. The resulting amplified fragment was then purified using a MinElute Gel Extraction Kit to obtain a DNA fragment of approximately 1.9 kbp. Furthermore, the DNA fragment of ERG12 and the CYC1 terminator DNA fragment-a obtained in Example 8 were mixed, and a PCR reaction was carried out using PrimeSTAR (registered trademark) Max DNA Polymerase without adding a primer. Then, ERG12-GAL1-F (gagaaaaaaccccggatccATGTCATTACCGTTCTTAACTTC) (SEQ ID NO: 50) and pESC-His-3430R (TGAGCTGATACCGCTCGCC) (SEQ ID NO: 22) were added, and the PCR reaction was continued to amplify an ERG12_Tcyc1-a fragment in which the CYC1 terminator DNA fragment-a was connected downstream of ERG12. Thereafter, the resulting amplified fragment was purified using a MinElute Gel Extraction Kit to obtain a DNA fragment of about 1.6 kbp. Then, the ERG19_Pgal10-Pgal1 fragment and the ERG12_Tcyc1-a fragment were mixed, and a PCR reaction was carried out using PrimeSTAR (registered trademark) Max DNA Polymerase without adding a primer. Then, ERG19-ADH1t-R (GCTCTTAATTAACAATTCTTCGTTATTCCTTTGGTAGACCAGTCT) (SEQ ID NO: 53) and CYC1t-XhoI-3430R (GCTGATACCGCTCGAGgcagccgaac) (SEQ ID NO: 42) were added, and the PCR reaction was further continued to amplify ERG19_Pgal10-Pgal1_ERG12_Tcyc1. Thereafter, the resulting amplified fragment was purified using a MinElute Gel Extraction Kit to obtain a DNA fragment of about 3.5 kbp. The DNA fragment of pESC-TRP-Pgal1_TRP1linker obtained in <Example 8>, the ERG19_Pgal10-Pgal1_ERG12_Tcyc1 fragment, and the ERG10_Tcyc1-b-Tadh1 fragment were mixed and ligated using In-Fusion (registered trademark) HD Cloning Kit to construct the plasmid pPgal1_ERG10-Pgal10_ERG19-Pgal1_ERG12 in which the Pgal1_ERG10_Tcyc1-Tadh1_ERG19_Pgal10-Pgal1_ERG12_Tcyc1 fragment was inserted into pESC-TRP.

Example 12 Construction of pUra3Gene Plasmid Genomic DNA was extracted from budding yeast INVSc1 (MATa his3Δ1 leu2 trp1-289 ura3-52/Matalpha hisΔ1 leu2 trp1-289 ura3-52, Invitrogen) using a Yeast DNA Extraction Kit. Using the genomic DNA as a template, a region including the promoter and its upstream region of the URA3 gene was amplified by PCR using KOD Fx Neo DNA polymerase with both primers Ura-SmaI-F (acgaggccctttcgtCCCGGGCGGATTACTACCGTTG) (SEQ ID NO: 56) and Ura-600-F_C (CTGTTCGGAGATTACCGAATC) (SEQ ID NO: 57), and a DNA fragment of approximately 0.6 kbp was obtained using the MinElute Gel Extraction Kit. Using the DNA of plasmid pESC-Ura (Stratagene) as a template, the latter half of the Ura3 gene was amplified by PCR using PrimeSTAR (registered trademark) Max DNA Polymerase and both primers, Ura-600-F (GATTCGGTAATCTCCGAACAG) (SEQ ID NO: 58) and Ura-SmaI-R (accgtattaccgcctCCCGGGTAATAACTGATATAATTAAATTG) (SEQ ID NO: 59), and a DNA fragment of about 1.0 kbp was obtained using a MinElute Gel Extraction Kit. These DNA fragments were mixed and used as a template to perform PCR using both primers Ura-SmaI-F (acgaggccctttcgtCCCGGGCGGATTACTACCGTTG (SEQ ID NO: 56) and Ura-SmaI-R (accgtattaccgcctCCCGGGTAATAACTGATATAATTAAATTG) (SEQ ID NO: 59) with PrimeSTAR (registered trademark) Max DNA Polymerase to amplify DNA containing the Ura3 promoter and its upstream region as well as the URA3 gene. The amplified DNA was then subjected to MinElute Gel Extraction. A DNA fragment of about 1.6 kbp was obtained using the In-Fusion® HD Cloning Kit. This DNA fragment was mixed with a DNA fragment of about 5.88 kbp obtained by removing TRP1 from pESC-Trp prepared in Example 9, and ligated using the In-Fusion® HD Cloning Kit to construct the pUra3Gene plasmid.

Example 13: Obtaining DNA fragment of ura3::Pgal1_ERG10-Pgal10_ERG19-Pgal1_ERG12-URA3 Using the DNA of pPgal1_ERG10-Pgal10_ERG19-Pgal1_ERG12 constructed in Example 11 as a template, a primer set was prepared using PrimeSTAR (registered trademark) Max DNA PCR product with both primers pESC-DraIII-F (agggcgatggcccactac) (SEQ ID NO: 37) and CYC1t-XhoI-3430-R (GCTGATACCGCTCGAGgcagccgaac) (SEQ ID NO: 42). A region containing Pgal1_ERG10-Pgal10_ERG19-Pgal1_ERG12 was amplified by PCR using Polymerase, and a DNA fragment of about 5.6 kbp was obtained using the MinElute Gel Extraction Kit. Using the DNA of the pUra3Gene plasmid constructed in Example 12 as a template, the entire pUra3Gene was amplified by PCR using PrimeSTAR (registered trademark) Max DNA Polymerase with both primers Pura-239-F (TCGAGCGGTATCAGCGGTTTCAGGGTCCATAAAGC) (SEQ ID NO: 60) and Pura-239-R (gtgggccatcgccctCCACAGCCACATTAACCTTC) (SEQ ID NO: 61), and a DNA fragment was obtained using a MinElute Gel Extraction Kit. These DNA fragments were mixed and ligated using In-Fusion (registered trademark) HD Cloning Kit to construct a plasmid pUra-ERG10-19-12 in which Pgal1_ERG10-Pgal10_ERG19-Pgal1_ERG12 was inserted into the upstream region of the URA3 promoter of pUra3Gene. The pUra-ERG10-19-12 plasmid DNA was then digested with the restriction enzyme SmaI (Takara Bio Inc.) to obtain the ura3
A DNA fragment of::Pgal1_ERG10-Pgal10_ERG19-Pgal1_ERG12-URA3 was obtained.

Example 14: Construction of plasmid pPgal1_IDI1-Pgal10_ERG13-Pgal1_ERG8 Using the genomic DNA of budding yeast BY4742 as a template, the DNA fragment of ERG8 was amplified by PCR using KOD Fx Neo DNA polymerase with both primers ERG8-GAL1-F (gagaaaaaaaccccggatccATGTCAGAGTTGAGAGCCTTC) (SEQ ID NO: 62) and ERG8-CYC1t-R (GCTAGCCGCGGTACCAAGCTTATTTATCAAGATAAGTTTCCGG) (SEQ ID NO: 63), and a DNA of about 1.4 kbp (ERG8 fragment) was obtained using MinElute Gel Extraction Kit. Similarly, an ERG13 DNA fragment was amplified by PCR using KOD Fx Neo DNA polymerase with both primers ERG13-GAL10-F (aagaatttttgaaaattcgaattcATGAAACTCTCAACTAAAACTTTGTT) (SEQ ID NO: 64) and ERG13-ADH1t-R (GCTCTTAATTAATCAAATTCTTCGTTATTTTTTAACATCGTAAGATCTTC) (SEQ ID NO: 65), and a DNA of about 1.5 kbp (ERG13 fragment) was obtained using the MinElute Gel Extraction Kit. Similarly, a DNA fragment of IDI1 was amplified by PCR using KOD Fx Neo DNA polymerase with both primers IDI1-GAL1-F (gagaaaaaaccccggatccATGACTGCCGACAACAATAGTA) (SEQ ID NO: 66) and IDI1-CYC1t-R (CATGATGCGGCCCTCTAGATTATAGCATTCTATGAATTTGCCTG) (SEQ ID NO: 67), and a DNA of about 0.9 kbp (IDI1 fragment) was obtained using the MinElute Gel Extraction Kit. The DNA fragment of Tcyc1-b-Tadh1 and the DNA fragment of IDI1 prepared in <Example 8> were mixed, and a PCR reaction was carried out using PrimeSTAR (registered trademark) Max DNA Polymerase without adding a primer, and then both primers IDI1-GAL1-F2 (aaaaaaccccggatccATGACT) (SEQ ID NO: 68) and ADH1t-Link-R (TTGTTAATTAAGAGCAGAGGTTTGGTCAAGTC) (SEQ ID NO: 55) were added and the PCR reaction was continued to amplify the DNA of IDI1_Tcyc1-b-Tadh1. The amplified fragment obtained was then purified using MinElute Gel Extraction Kit to obtain a DNA fragment of about 1.5 kbp. Next, the Pgal10-Pgal1 DNA fragment and the ERG13 DNA fragment obtained in Example 8 were mixed, and a PCR reaction was carried out using PrimeSTAR (registered trademark) Max DNA Polymerase without adding a primer. Then, both primers, ERG13-ADH1t-R (GCTCTTAATTAACAATTCTTCGTTATTTTTTTAACATCGTAAGATCTTC) (SEQ ID NO: 65) and GAL1-BamH-R short (CCGGGGTTTTTTCTCCTTG) (SEQ ID NO: 20), were added, and the PCR reaction was continued to amplify an ERG13_Pgal10-Pgal1 fragment in which ERG13 was connected downstream of Pgal10. The resulting amplified fragment was then purified using a MinElute Gel Extraction Kit to obtain a DNA fragment of approximately 2.2 kbp. Furthermore, the DNA fragment of ERG8 and the CYC1 terminator DNA fragment-a obtained in Example 8 were mixed, and a PCR reaction was carried out using PrimeSTAR (registered trademark) Max DNA Polymerase without adding a primer. Then, ERG8-GAL1-F (gagaaaaaacccccggatccATGTCAGAGTTGAGAGCCTTC) (SEQ ID NO: 62) and pESC-His-3430R (TGAGCTGATACCGCTCGCC) (SEQ ID NO: 22) were added, and the PCR reaction was continued to amplify an ERG8_Tcyc1-a fragment in which the CYC1 terminator DNA fragment-a was connected downstream of ERG8. The resulting amplified fragment was then purified using a MinElute Gel Extraction Kit to obtain a DNA fragment of approximately 1.7 kbp. Then, the ERG13_Pgal10-Pgal1 fragment and the ERG8_Tcyc1-a fragment were mixed, and a PCR reaction was carried out using PrimeSTAR (registered trademark) Max DNA Polymerase without adding a primer. Then, ERG13-ADH1t-R (GCTCTTAATTAACAATTCTTCGTTATTTTTTTAACATCGTAAGATCTTC) (SEQ ID NO: 65) and CYC1t-XhoI-3430R (GCTGATACCGCTCGAGgcagccgaac) (SEQ ID NO: 42) were added, and the PCR reaction was further continued to amplify ERG13_Pgal10-Pgal1_ERG8_Tcyc1. The amplified fragment was then purified with MinElute Gel Extraction Kit to obtain a DNA fragment of about 3.9 kbp. The DNA fragment of pESC-TRP-Pgal1_TRP1linker obtained in Example 8, the ERG13_Pgal10-Pgal1_ERG8_Tcyc1 fragment, and the IDI1_Tcyc1-b-Tadh1 fragment were mixed and ligated using In-Fusion (registered trademark) HD Cloning Kit to construct the plasmid pPgal1_IDI1-Pgal10_ERG13-Pgal1_ERG8 in which the Pgal1_IDI1_Tcyc1-Tadh1_ERG13_Pgal10-Pgal1_ERG8_Tcyc1 fragment was inserted into pESC-TRP.

Example 15: Obtaining pAde2Gene plasmid Using the genomic DNA of budding yeast BY4742 as a template, a DNA fragment containing the ADE2 promoter and its upstream region as well as the ADE2 gene region was amplified by PCR using KOD Fx Neo DNA polymerase with both primers Ade2-HpaI-F (acgaggccctttcgtTAACACTTCCTCTACCATTGCAT) (SEQ ID NO: 69) and Ade2-HpaI-R (accgtattaccgcctGTTAACAGATCTCACAATCATG) (SEQ ID NO: 70), and a DNA fragment of about 1.4 kbp was purified and obtained using the MinElute Gel Extraction Kit. This DNA fragment was mixed with an approximately 5.88 kbp DNA fragment obtained by removing TRP1 from pESC-Trp prepared in Example 9, and ligated using In-Fusion (registered trademark) HD Cloning Kit to construct the pAde2Gene plasmid.

Example 16: Acquisition of DNA fragment of ade2:: Pgal1_IDI1-Pgal10_ERG13-Pgal1_ERG8-ADE2 Using the DNA of the plasmid pPgal1_IDI1-Pgal10_ERG13-Pgal1_ERG8 obtained in Example 14 as a template, a DNA fragment was cloned using PrimeSTAR (registered trademark) Max DNA PCR with both primers pESC-DraIII-F (agggcgatggcccactac) (SEQ ID NO: 37) and CYC1t-XhoI-3430-R (GCTGATACCGCTCGAGgcagccgaac) (SEQ ID NO: 42). The Pgal1_IDI1-Pgal10_ERG13-Pgal1_ERG8-ADE2 region was amplified by PCR using PCR polymerase, and a DNA of about 5.7 kbp was purified and obtained using a MinElute Gel Extraction Kit. Using the DNA of the plasmid pAde2Gene obtained in <Example 15> as a template, a region excluding a part of the upstream region of the ADE2 promoter of pAde2Gene was amplified by PCR using PrimeSTAR (registered trademark) Max DNA Polymerase and both primers, Pade2-400F (TCGAGCGGTATCAGCTACCTTTTGATGCGGAATTGAC) (SEQ ID NO: 71) and Pade2-430R (GTGGGCCATCGCCCTCATGAAACTAGGCAACTTTTCG) (SEQ ID NO: 72), and the DNA fragment was purified and obtained using a MinElute Gel Extraction Kit. These DNA fragments were mixed and ligated using In-Fusion® HD Cloning Kit to construct the plasmid pAde-IDI1-ERG13-8 in which Pgal1_IDI1-Pgal10_ERG13-Pgal1_ERG8 was inserted into the upstream region of the ADE2 promoter of pAde2Gene. Then, the pAde-IDI1-ERG13-8 plasmid DNA was digested with the restriction enzyme HpaI to create ade2::Pgal1_IDI1
-Pgal10_ERG13-Pgal1_ERG8-ADE2 DNA fragment was obtained.

Example 17: Construction of plasmid pESC-OSC1tadh1-upc2-1-tHMG1 Using the genomic DNA of budding yeast BY4742 as a template, a DNA fragment containing the first half of the UPC2 gene (hereinafter, upc2-1a) into which a mutation was introduced to replace the glycine at the 888th residue from the N-terminus of UPC2 with aspartic acid was amplified by PCR using KOD Fx Neo DNA polymerase with both primers UPC2-F1 (ttgaaaattcgaattcATGAGCGAAGTCGGTATACAGA) (SEQ ID NO: 73) and upc2-1-R1 (ATGCATATCACCACCTCCACTG) (SEQ ID NO: 74), and about 2.7 kbp of DNA was obtained using a MinElute Gel Extraction Kit. Next, PCR was similarly performed using both primers, upc2-1-F1 (GGTGGTGATATGCATATGATGC) (SEQ ID NO: 75) and UPC2-R1 (ttaagagctcagaTCTATCATAACGAAAATCAGAG) (SEQ ID NO: 76), to amplify a DNA fragment containing the latter half of the UPC2 gene into which a mutation had been introduced to replace the glycine residue at the 888th residue from the N-terminus of UPC2 with aspartic acid (hereinafter, upc2-1b), and a DNA of about 0.1 kbp was obtained using a MinElute Gel Extraction Kit.

Next, the DNA fragments of upc2-1a and upc2-1b were mixed and used as a template, and the full-length UPC2 was amplified by PCR using PrimeSTAR (registered trademark) Max DNA Polymerase with both primers UPC2-F1 (ttgaaaattcgaattcATGAGCGAAGTCGGTATACAGAG (SEQ ID NO: 73) and UPC2-R1 (ttaagagctcagaTCTATCATAACGAAAAAATCAGAG) (SEQ ID NO: 76). A DNA of about 2.8 kbp was purified using the Kit to obtain DNA of the UPC2 mutant (hereinafter, upc2-1). A DNA fragment obtained by digesting the plasmid vector pESC-TRP with the restriction enzymes BglII and EcoRI (both Takara Bio Inc.) was mixed with the DNA fragment of upc2-1 and ligated using In-Fusion (registered trademark) HD Cloning Kit to construct the plasmid pESC-upc2-1. Next, the DNA of pESC-upc2-1 was digested with the restriction enzymes DraIII and NgoMIV (New England Biolab), and a DNA of about 9.1 kbp was obtained using the MinElute Gel Extraction Kit. Similarly, the pYES3-ADH-OSC1 plasmid (Seki, H., et al., Proc. Natl. Acad. Sci. USA, 105, 14204-14209, 2008) as a template, and the primers ADH1p-F (agggcgatggcccaccGTTTCCTCGTCATTGTTCTCG) (SEQ ID NO: 77) and ADH1t-R1 (cgccacgttcgccggatccgtgtggaagaac) (SEQ ID NO: 78) were used to amplify the ADH1 promoter fragment by PCR using PrimeSTAR (registered trademark) Max DNA Polymerase. japonicum) derived oxidosqualene cyclase gene (LjOSC1)_ADH1 terminator region containing about 2.8 kbp of DNA (Padh1p_LjOSC1_Tadh1) was mixed and ligated using In-Fusion (registered trademark) HD Cloning Kit to construct the plasmid pESC-OSC1tadh1-upc2-1. Using the genomic DNA of budding yeast BY4742 as a template, HMGR-F1 (GGGCCCGGGCGTCGACatggCTGCAGACCAATTGG) (SEQ ID NO: 79) and HMGR-R1 (ACCAAGCTTACTCGAGTTAGGATTTAATGCAGGTGAC) (SEQ ID NO: 80) as primers, KOD Fx Neo A DNA fragment of the HMG1 gene (hereinafter, tHMG1) from which the membrane binding region and a part of the linker region had been removed was amplified by PCR using DNA polymerase, and a DNA fragment of about 1.6 kbp was obtained using the MinElute Gel Extraction Kit. This DNA was mixed with a DNA fragment obtained by digesting the plasmid pESC-OSC1tadh1-upc2-1 with the restriction enzymes SalI and XhoI, and then ligated using the In-Fusion (registered trademark) HD Cloning Kit to construct the plasmid pESC-OSC1tadh1-upc2-1-tHMG1.

Example 18: Construction of pLys2Gene plasmid Using the genomic DNA of budding yeast INVSc1 as a template, the region including the C-terminal portion of the LYS2 gene and the downstream of the terminator was amplified by PCR using KOD Fx Neo DNA polymerase with both primers Lys2-1812-HpaI-F (acgaggccctttcgtTAACAGGAACGATCGTACTC) (SEQ ID NO: 81) and Lys2-HpaI-R (accgtattaccgcctGTTAACGATTAAATCCATTGTGTTTTC (SEQ ID NO: 82)), and the resulting product was subjected to MinElute Gel Extraction. A DNA of about 2.0 kbp was purified using an In-Fusion (registered trademark) HD Cloning Kit. This DNA was mixed with a DNA fragment of about 5.8 kbp obtained by amplification from pESC-TRP in Example 9, and ligated using an In-Fusion (registered trademark) HD Cloning Kit to construct a plasmid pLys2Gene.

Example 19: Obtaining DNA fragment of lys2::LYS2-Pgal10_upc2-1-Pgal1_tHMG1 The plasmid pESC-OSC1tadh1-upc2-1-tHMG1 obtained in Example 17 was digested with restriction enzymes HpaI and XhoI to obtain a 5.8 kbp DNA fragment consisting of the Tadh1-Tadh1_upc2-1_Pgal10-Pgal1_tHMG1 region using a MinElute Gel Extraction Kit. Furthermore, the CYC1 terminator DNA region was amplified by PCR using PrimeSTAR (registered trademark) Max DNA Polymerase with the pESC-OSC1tadh1-upc2-1-tHMG1 DNA as a template and both primers HMGR-XhoI-F (TAAATCCTAACTCGAGTAAGC) (SEQ ID NO: 83) and CYC1t-XhoI-3430R (GCTGATACCGCTCGAGgcagccgaac) (SEQ ID NO: 42), and a DNA fragment of about 0.4 kbp was obtained using the MinElute Gel Extraction Kit. Furthermore, using the pLys2Gene plasmid obtained in Example 18 as a template, a DNA fragment containing the pESC vector portion from the terminator region of the LYS2 gene and the C-terminal region of the LYS2 gene was amplified by PCR using PrimeSTAR (registered trademark) Max DNA Polymerase and both primers, Tlys2-F (TCGAGCGGTATCAGCAAGGTTGAGCATTACGTATG) (SEQ ID NO: 84) and Lys2-Tadh1-R (GAAATTCGCTTAGTTTTAAGCTGCTGCGGAGCTTC) (SEQ ID NO: 85), and a DNA fragment of approximately 6.3 kbp was obtained using a MinElute Gel Extraction Kit. These three DNA fragments were mixed and ligated using In-Fusion (registered trademark) HD Cloning Kit to construct the plasmid pLys2-Pgal10_upc2-1-Pgal10_tHMG1 in which the Tadh1-Tadh1_upc2-1_Pgal10-Pgal1_tHMG1_Tcyc1 unit was inserted into the 3' untranslated region of the LYS2 gene of pLys2Gene. This pLys2-Pgal10_upc2-1-Pgal10_tHMG1 plasmid DNA was digested with the restriction enzyme HpaI to obtain the DNA fragment lys2::LYS2-Pgal10_upc2-1-Pgal1_tHMG1.

Example 20: Construction of plasmid pYES-gal7-Ptef1_Kan-Pgal1_MtCPR2 Using the Pmet3-ERG7 fragment obtained in Example 4 as a template, Pmet-F5 (AGCTAGCTTATCGATTTAGTACTAACAGAGACTTTTG) (SEQ ID NO: 15) and ERG7_660-R5 (AGATGCATGCTCGAGCTAAAGTAACCAAGTTTCAGGAGG) (SEQ ID NO: 86), a DNA fragment in which a restriction enzyme SphI site was connected to Pmet3-ERG7 was amplified by PCR using PrimeSTAR (registered trademark) Max DNA Polymerase, and the amplified DNA was subjected to MinElute Gel Extraction. A 1.2 kbp fragment (Pmet3-ERG7_S) was obtained using the PCR kit. Using the DNA of the plasmid pENTR (registered trademark)/D-TOPO (Invitrogen) as a template, a region containing the kanamycin resistance gene (hereinafter, KanR) was amplified by PCR using PrimeSTAR (registered trademark) Max DNA Polymerase with both primers URAp-Kan-F (AAACAAAAACCTGCAGTAATACAAGGGGTGTTATG) (SEQ ID NO: 87) and Kan-URAt-R (TTATAATACAGTTTTGAATTCTGATTAGAAAACTCATCG) (SEQ ID NO: 88), and about 0.9 kbp of DNA was obtained using the MinElute Gel Extraction Kit. Using pTEF1/Zeo plasmid (Life Technologies) as a template, the TEF1 promoter region was amplified by PCR using KOD Fx Neo DNA polymerase with both primers TEF1-EM-7-F-link (ATCGATAAGCTAGCTGCCGGCCAGATCTGAGCTC) (SEQ ID NO: 89) and EM7-Kan-R (TTGAATATGGCTCATGGTTTAGTTCCTCACC) (SEQ ID NO: 90), and about 0.5 kbp of DNA (Ptef1) was obtained using the MinElute Gel Extraction Kit. Using the DNA of the plasmid pYES-DEST52 as a template, a region of the plasmid excluding a portion including the CYC1 terminator from the GAL1 promoter was amplified by PCR using both primers pYES-ClaI-R (ATCGATAAGCTAGCTTTTCAATTC) (SEQ ID NO: 91) and pYES-XhoI-F1 (CTCGAGCATGCATCTAGAGGGCCGCATCATG) (SEQ ID NO: 10) and PrimeSTAR (registered trademark) Max DNA Polymerase, and a DNA of about 3.0 kbp (pYES-URA3) was obtained using a MinElute Gel Extraction Kit. Next, the pYES-URA3 fragment and the Pmet3-ERG7_S fragment were mixed and ligated using In-Fusion (registered trademark) HD Cloning Kit to obtain the plasmid pYES-Pmet3_ERG7-URA3. Using this plasmid DNA as a template, the region of this plasmid excluding the URA3 gene was amplified by PCR using PrimeSTAR (registered trademark) Max DNA Polymerase with both primers pYES-URAp-R (CTGCAGGTTTTTGTTCTGTGC) (SEQ ID NO: 92) and pYES-URAt-F (AAAACTGTATTATAAGTAAAATGCATG) (SEQ ID NO: 9), and a DNA of about 3.5 kbp was obtained using the MinElute Gel Extraction Kit. This DNA fragment and the DNA fragment of KanR were mixed and ligated using In-Fusion (registered trademark) HD Cloning Kit to obtain pYES-Pmet7_ERG7-KanR in which the URA3 gene of pYES-Pmet7_ERG7-URA3 was replaced with KanR. Furthermore, using this plasmid DNA as a template, the region excluding the upstream part of the URA3 gene of this plasmid was amplified by PCR using PrimeSTAR (registered trademark) Max DNA Polymerase with both primers Pmet-F5 (AGCTAGCTTATCGATTTAGTACTAACAGAGACTTTTG) (SEQ ID NO: 15) and Km-F (ATGAGCCATATTCAACGGGA) (SEQ ID NO: 93), and about 4.2 kbp of DNA was obtained with MinElute Gel Extraction Kit. This DNA fragment and the DNA fragment of Ptef1 were mixed and ligated using In-Fusion (registered trademark) HD Cloning Kit to construct the plasmid pYES-Pmet3-ERG7-Ptef1_KanR in which Ptef1 was inserted upstream of KanR. Using this plasmid pYES-Pmet3-ERG7-Ptef1_KanR as a template, the Ptef1_KanR_Tura3 region was amplified by PCR using PrimeSTAR (registered trademark) Max DNA Polymerase with both primers TEF1-EM-7-F-link (ATCGATAAGCTAGCTGCCGGCCAGATCTGAGCTC) (SEQ ID NO: 89) and -pYEC-Tura_R (GTCGACGAGCTCGAGCCTTTTTCAATGGGTAATAACTG) (SEQ ID NO: 94), and about 1.5 kbp of DNA was obtained using the MinElute Gel Extraction Kit.

Next, using the genomic DNA of budding yeast BY4742 as a template, PCR was performed using KOD Fx Neo DNA polymerase with both primers Pgal80-F (CCTTTTTCAATGGGTTAAACCAAACCTAAAGGTATTAAC) (SEQ ID NO: 95) and Pgal80-R (CTCGAGCTCGTCGACGACGGGAGTGGAAAGAACGG) (SEQ ID NO: 96) to amplify the promoter region of GAL80. A DNA of about 0.4 kbp (Pgal80) was obtained using the MinElute Gel Extraction Kit. Similarly, PCR was performed using KOD Fx Neo DNA polymerase with both primers Tgal80-F (AGCTAGCTTATCGATAGCATCTTGCCCTGTGCTTG) (SEQ ID NO: 97) and Tgal80-R (accgtattaccgcctGTTAACAGTTTGTTTGATCAT) (SEQ ID NO: 98) to amplify the terminator region of GAL80, and a DNA of about 0.4 kbp (Tgal80) was obtained using the MinElute Gel Extraction Kit. In addition, the plasmid DNA of pYES-Pmet3-ERG7-Ptef1_KanR was used as a template, and the portion excluding the Pmet3_ERG7_Tcyc1 and Ptef1_KanR_Tura3 regions of the vector was amplified by PCR using PrimeSTAR (registered trademark) Max DNA Polymerase with both primers, and a DNA fragment of about 0.8 kbp (PYES_pUCori) was obtained with MinElute Gel Extraction Kit. The PYES_pUCori fragment, Pgal80 fragment, Tgal80 fragment, and Ptef1_KanR_Tura3 fragment were mixed and ligated using In-Fusion (registered trademark) HD Cloning Kit to obtain the plasmid pPgal80-KanR-Tgal80. A DNA having the sequence of the gene (hereinafter, MtCPR2; SEQ ID NO: 143) of NADPH-cytochrome P450 reductase derived from Medicago truncatula (GenPept registration XP_003602898.1; SEQ ID NO: 142) was synthesized using GeneArt ^™ Strings ^™ DNA Fragments synthesis. This DNA was mixed with a DNA fragment of pESC-TRP plasmid digested with restriction enzymes SalI and XhoI, and then ligated using In-Fusion (registered trademark) HD Cloning Kit to construct pESC-MtCPR2-TRP. Using this plasmid DNA as a template, the Pgal1_MtCPR2 region was amplified by PCR using PrimeSTAR (registered trademark) Max DNA Polymerase with both primers Pgal1-F-NgoMIV (CTCAGATCTGGCCGGCACGGATTAGAAGCCGCCGAG) (SEQ ID NO: 99) and MtCPR-R (GGCAAGATGCTATCGACCAAGCTTACTCGAGTTAC) (SEQ ID NO: 100), and a DNA of about 2.6 kbp was obtained using a MinElute Gel Extraction Kit. This DNA fragment was mixed with a DNA fragment of pGal80-KanR-Tgal80 digested with restriction enzymes NgoMIV and ClaI, and ligated using In-Fusion (registered trademark) HD Cloning Kit to obtain the plasmid pGal80-KanR-Pgal1_MtCPR2_Tgal80. Using the genomic DNA of budding yeast YPH500 prepared with the Yeast DNA Extraction Kit (Thermo Fisher Scientific) as a template, the 30th to 1010th bases of the GAL7 gene were amplified by PCR using KOD Fx Neo DNA polymerase with both primers Gal7-1010-R (CCTTTTTCAATGGGTTAACAATTCAAAACCAACCAAG) (SEQ ID NO: 101) and Gal7-30-F (TTGAAAAAGGCTCGAGAGCCATTCCCATAGACGTTAC) (SEQ ID NO: 102). A DNA fragment of about 1.0 kbp (gal7 internal fragment) was obtained using the MinElute Gel Extraction Kit. Similarly, the GAL1 terminator region was amplified by PCR using KOD Fx Neo DNA polymerase with both primers Tgal1-1605F (TGTTTGGTAACTCGAGCTTTGTTCAGAAACAACTTCTC) (SEQ ID NO: 103) and Tgal1-2386-R (accgtattaccgcctGTTAACCGAAAGATCTTCTCTATGG) (SEQ ID NO: 104), and a DNA fragment of about 0.8 kbp (Tgal1) was obtained using the MinElute Gel Extraction Kit. The above-obtained plasmid pGal80-KanR-Pgal1_MtCPR2_Tgal80 was used as a template, and the KanR-Pgal1_MtCPR2 region was amplified by PCR using PrimeSTAR (registered trademark) Max DNA Polymerase with both primers pYEC-Tura_R1 (TCGAGCCTTTTTCAATGGGTAATAACTG) (SEQ ID NO: 105) and MtCPR-R1 (AGCTCGAGTTACCAAACATCTCTTAAG) (SEQ ID NO: 106). Then, a DNA fragment of about 4.0 kbp (KanR-Pgal1_MtCPR2) was obtained using the MinElute Gel Extraction Kit. This DNA fragment and the Tgal1 fragment were mixed, and PCR was carried out using PrimeSTAR (registered trademark) Max DNA Polymerase without adding a primer. Then, both primers pYEC-Tura_R1 (TCGAGCCTTTTTCAATGGGTAATAACTG) (SEQ ID NO: 105) and Tgal1-2386-R (accgtattaccgcctGTTAACCGAAAGATCTTCTCTATGG) (SEQ ID NO: 104) were added and further PCR was carried out to obtain a DNA fragment of about 4.8 kbp (KanR-Pgal1_MtCPR2_Tgal1) using MinElute Gel Extraction Kit. The KanR-Pgal1_MtCPR2_Tgal1 fragment, the gal70 internal fragment, and the PYES_pUCori fragment were mixed and ligated using In-Fusion (registered trademark) HD Cloning Kit to construct the plasmid pYES-gal7-Ptef1_Kan-Pgal1_MtCPR2.

Example 21: Obtaining DNA fragment of Δgal1,7,10::Ptef1_Kan-Pgal1-MtCPR2 The DNA of the plasmid pYES-gal7-Ptef1_Kan-Pgal1_MtCPR2 obtained in Example 20 was digested with the restriction enzyme HpaI to obtain a DNA fragment of Δgal1,7,10::Ptef1_Kan-Pgal1-MtCPR2.

Example 22: Construction of plasmid pYES-gal7-Ptef1_Kan-Pgal1_MtCPR1 The NADPH-cytochrome P450 reductase derived from Medicago sativa (GenPept registration XP_003610109.1 (SEQ ID NO: 144)) has an amino acid sequence identity of 70% with the NADPH-cytochrome P450 reductase derived from Medicago sativa (GenPept registration XP_003602898.1) described in Example 20. A DNA fragment having the sequence of this gene (hereinafter, MtCPR1 (SEQ ID NO: 145)) was obtained by synthesis using GeneArt ^™ Strings ^™ DNA Fragments. This DNA fragment was mixed with a DNA fragment of pESC-TRP plasmid digested with restriction enzymes SalI and XhoI, and ligated using In-Fusion (registered trademark) HD Cloning Kit to construct pESC-MtCPR2-TRP. Using this plasmid DNA as a template, the Pgal1_MtCPR1 region was amplified by PCR using PrimeSTAR (registered trademark) Max DNA Polymerase with both primers Pgal1-F-NgoMIV (CTCAGATCTGGCCGGCACGGATTAGAAGCCGCCGAG) (SEQ ID NO: 99) and MtCPR-R (GGCAAGATGCTATCGACCAAGCTTACTCGAGTTAC) (SEQ ID NO: 100), and a DNA of about 2.6 kbp was obtained with MinElute Gel Extraction Kit. The DNA obtained in this manner was digested with the restriction enzyme XhoI to obtain a Pgal1_MtCPR1/XhoI fragment. In addition, the vector portion excluding Pgal1-MtCPR2 was amplified by PCR using TER-EM-7-F-link (ATCGATAAGCTAGCTGCCGGCCAGATCTGAGCTC) (SEQ ID NO: 89) and Tgal1-1605F (TGTTTGGTAACTCGAGCTTTGTTCAGAACAACTTCTC) (SEQ ID NO: 103) with the DNA of the plasmid pYES-gal7-Ptef1_Kan-Pgal1_MtCPR2 obtained in Example 20 as a template and PrimeSTAR (registered trademark) Max DNA Polymerase, and the amplified vector portion was extracted by MinElute Gel Extraction. A DNA fragment of about 5.0 kbp (Tgal1-gal7-KanR_Ptef1) was obtained using the In-Fusion® HD Cloning Kit. This DNA fragment was further digested with the restriction enzyme NgoMIV, mixed with the Pgal1_MtCPR1/XhoI fragment, and ligated using the In-Fusion® HD Cloning Kit to construct the plasmid pYES-gal7-Ptef1_Kan-Pgal1_MtCPR1.

Example 23: Obtaining DNA fragment of Δgal1,7,10::Ptef1_Kan-Pgal1_MtCPR1 The DNA of the plasmid pYES-gal7-Ptef1_Kan-Pgal1_MtCPR1 obtained in Example 22 was digested with the restriction enzyme HpaI to obtain Δgal1,7,10:
: A DNA fragment of Ptef1_Kan-Pgal1_MtCPR1 was obtained.

<Example 24> Construction of yeast strain YJT8 Budding yeast YPH500 was transformed with the DNA fragment erg7::Pgal1_GuCYB5-Pgal10_GuCPR1-HIS3-Pmet3_ERG7 obtained in <Example 7>. The resulting transformed yeast strain was then transformed with the DNA fragment trp1::Pgal1_ERG20-Pgal10_ERG9-Pgal1_ERG1-TRP1 obtained in <Example 10>. The transformed yeast strain thus obtained was transformed with the DNA fragment ura3::Pgal1_ERG10-Pgal10_ERG19-Pgal1_ERG12-URA3 obtained in <Example 13>. The transformed yeast strain thus obtained was then transformed with the DNA fragment ade2::Pgal1_IDI1-Pgal10_ERG13-Pgal1_ERG8-ADE2 obtained in Example 16. The transformed yeast strain thus obtained was further transformed with the DNA fragment lys2::LYS2-Pgal10_upc2-1-Pgal1_tHMG1 obtained in Example 19 to obtain the yeast strain YJT8.

Example 25: Construction of yeast strains The yeast strain YJT8 was transformed with the DNA fragment of Δgal1,7,10::Ptef1_Kan-Pgal1_MtCPR1 obtained in Example 23, or the DNA fragment of Δgal1,7,10::Ptef1_Kan-Pgal1-MtCPR2 obtained in Example 21, to obtain yeast strain YJT8a or yeast strain YJT8b, respectively.

Example 26: Construction of pESC-CYP88D6, an oleanane triterpene 11-position oxidase (CYP88D6) yeast expression vector. Using the synthetic gene sequence CYP88D6 (SEQ ID NO: 147) of Glycyrrhiza uralensis β-amyrin 11-position oxidase CYP88D6 (SEQ ID NO: 146) cloned into pUC-57 as a template, synCYP88D6-F1 (aaaaaaccccggatccATGGAAGTACACTGGGTCTG) (SEQ ID NO: 107) and synCYP88D6-R1 (ccgcggtaccaagcttTCAGGCACAGGATACTTTGATG) (SEQ ID NO: 108), the vector was subjected to PCR using PrimerSTAR (registered trademark) Max DNA PCR. After treatment with Polymerase (TAKARA) at 95°C for 2 minutes, PCR consisting of (98°C for 10 seconds → 55°C for 5 seconds → 72°C for 15 seconds) x 26 cycles was performed to amplify a DNA fragment containing CYP88D6. The PCR solution was electrophoresed, and the amplified fragment of about 1.5 kbp was purified with MinElute Gel Extraction Kit (Qiagen). On the other hand, using pESC-LEU (Stratagene) DNA as a template, the region excluding the upstream of the LEU2 gene of pESC-LEU was amplified using PrimerSTAR (registered trademark) Max DNA Polymerase with both primers LEU2d-F (aaaaaggcgccGAAATCGGCAAAATCCCTTATAAATC) (SEQ ID NO: 109) and LEU2d-R (TTTCggcgccttttttatatatatttcaaggatatac) (SEQ ID NO: 110). A DNA of about 7.0 kbp was obtained using the MinElute Gel Extraction Kit. This DNA fragment was cyclized using an In-Fusion (registered trademark) HD Cloning Kit to obtain a plasmid pESC-LEUd in which the promoter region of the LEU2 gene was shortened. This plasmid DNA was digested with the restriction enzymes BamHI and HindIII. These were subjected to an In-Fusion reaction using an In-Fusion (registered trademark) HD Cloning Kit (Clontech), to obtain pESC-CYP88D6, a CYP88D6 yeast expression vector.

Example 27: Construction of pESC-OSC1-CYP88D6, a vector for co-expression of CYP88D6 and β-amyrin synthase (LjOSC1) in yeast. Using the artificial synthetic gene sequence (SEQ ID NO: 149) of β-amyrin synthase (OSC1) (SEQ ID NO: 148) of Lotus japonicus cloned into a pENTR™/D-TOPO (registered trademark) entry vector as a template, the vector was cloned into PrimerSTAR (registered trademark) Max DNA PCR product using OSC1-NotI-F (CACTAAAGGGCGGCCATGTGGAAGTTGAAAGTTGC) (SEQ ID NO: 111) and OSC1-SacI-R (GAATTGTTAATTAAGTTAAAACAGCGGTAGATGGC) (SEQ ID NO: 112). After treating with Polymerase (TAKARA) at 95 ° C for 2 minutes, PCR consisting of (98 ° C 10 seconds → 55 ° C 5 seconds → 72 ° C 30 seconds) × 36 cycles was performed to amplify a DNA fragment containing OSC1. The PCR solution was electrophoresed, and the amplified fragment of about 2.3 kb was purified with MinElute Gel Extraction Kit (Qiagen). Meanwhile, pESC-CYP88D6 prepared in Example 26 was also digested with the restriction enzymes NotI and SacI, and these were subjected to an In-Fusion reaction using In-Fusion (registered trademark) HD Cloning Kit to obtain pESC-OSC1-CYP88D6, a co-expression vector in yeast of CYP88D6 and LjOSC1.

Example 28: Preparation of budding yeast ADH2 promoter DNA fragment Using the genomic DNA of budding yeast BY4742 prepared using Yeast DNA Extraction Kit (Thermo Fisher Scientific) as a template, both primers Padh2-NgoMIV-F (cgccacgttcgccgGCAAAACGTAGGGGCAAAC) (SEQ ID NO: 113) and Padh2-R (TGTGTATTACGATATAGTTAATAG) (SEQ ID NO: 114) were used, and the mixture was treated with KOD FX Neo DNA polymerase (TOYOBO) at 94°C for 1 minute, followed by PCR consisting of (98°C for 10 seconds → 60°C for 30 seconds → 68°C for 60 seconds) x 33 cycles. The PCR solution was subjected to electrophoresis, and the amplified fragment of about 0.59 kb was purified using a MinElute Gel Extraction Kit (Qiagen) to obtain a DNA fragment of the budding yeast ADH2 promoter.

Example 29 Preparation of Saccharomyces cerevisiae TEF1 terminator DNA fragment Using the genomic DNA of budding yeast BY4742 as a template, primers TEF1ter-F (TCTAGAGGGCCGCATGGAGATTGATAAGACTTTTCTAG) (SEQ ID NO: 115) and TEF2ter-R (atataaaaaaggcgccTGAAAAAAGAGGGGAATTTTTAG) (SEQ ID NO: 116) were used, and the mixture was treated with KOD FX Neo DNA polymerase (TOYOBO) at 94°C for 1 minute, followed by PCR consisting of (98°C for 10 seconds → 60°C for 30 seconds → 68°C for 60 seconds) x 33 cycles. The PCR solution was subjected to electrophoresis, and the amplified fragment of about 0.17 kb was purified with a MinElute Gel Extraction Kit (Qiagen) to obtain a budding yeast TEF1 terminator DNA fragment.

<Example 30>
Preparation of CYP5106A1 gene of Aspergillus oryzae A CYP5106A1-N-terminal DNA fragment (740 bp) and a CYP5106A1-C-terminal DNA fragment (915 bp) were synthesized using GeneArt ^™ Strings ^™ DNA Fragments synthesis (Invitrogen). After mixing the two DNA fragments, they were treated with PrimerSTAR (registered trademark) Max DNA Polymerase (TAKARA) at 95°C for 2 minutes, and then PCR consisting of (98°C for 10 seconds → 55°C for 5 seconds → 72°C for 15 seconds) x 13 cycles was performed to amplify the DNA fragment. The PCR solution was subjected to electrophoresis, and the amplified fragment of about 1.6 kb was purified using a MinElute Gel Extraction Kit (Qiagen) to obtain a DNA fragment of CYP5106A1 of the koji mold Aspergillus oryzae (SEQ ID NO: 132).

<Example 31> Preparation of ADH2 promoter _ CYP5106A1 DNA fragment The ADH2 promoter DNA fragment obtained in <Example 28> and the CYP5106A1 DNA fragment obtained in <Example 30> were mixed and treated with PrimerSTAR (registered trademark) Max DNA Polymerase (TAKARA Co., Ltd.) at 95 ° C for 2 minutes, and then PCR consisting of (98 ° C 10 seconds → 50 ° C 10 seconds → 72 ° C 20 seconds) × 4 cycles was performed, and Padh2-NgoMIV-F (cgccacgttcgccgGCAAAACGTAGGGGCAAAC) (SEQ ID NO: 113) and link to Both primers #88-R (ATGCGGCCCTCTAGATCA) (SEQ ID NO: 117) were added, and the mixture was further treated at 95°C for 2 minutes, followed by PCR consisting of (98°C for 10 seconds → 50°C for 5 seconds → 72°C for 20 seconds) x 33 cycles. The PCR solution was electrophoresed, and the amplified fragment of about 2.2 kb was purified with MinElute Gel Extraction Kit (Qiagen), to obtain the DNA fragment of ADH2 promoter_CYP5106A1.

Example 32: Preparation of ADH2 promoter_CYP5106A1_Ttef1 DNA fragment The ADH2 promoter_CYP5106A1 DNA fragment obtained in Example 31 and the budding yeast TEF1 terminator DNA fragment obtained in Example 29 were mixed, and the resulting mixture was diluted with PrimerSTAR (registered trademark) Max DNA. After treatment with Polymerase (TAKARA) at 95°C for 2 minutes, PCR consisting of (98°C for 10 seconds → 50°C for 10 seconds → 72°C for 20 seconds) x 4 cycles was performed, and then both primers Padh2-NgoMIV-F (cgccacgttcgccgGCAAAACGTAGGGGCAAAC) (SEQ ID NO: 113) and TEF1ter-R (atataaaaaaggcgccTGAAAAAAGAGGGGAATTTTTAG) (SEQ ID NO: 116) were added, and further treatment was performed at 95°C for 2 minutes, followed by PCR consisting of (98°C for 10 seconds → 55°C for 5 seconds → 72°C for 20 seconds) x 33 cycles. The PCR solution was subjected to electrophoresis, and the amplified fragment of about 2.4 kb was purified with a MinElute Gel Extraction Kit (Qiagen) to obtain a DNA fragment of ADH2 promoter_CYP5106A1_Ttef1.

Example 33: Construction of vector pESC-Leu2d-CYP5106A1-OSC1-CYP88D6 pESC-OSC1-CYP88D6 was digested with restriction enzymes NgoMIV and KasI (New England Biolab), and then mixed with the ADH2 promoter_CYP5106A1_Ttef1 DNA fragment obtained in Example 32. The resulting mixture was subjected to an In-Fusion reaction using an In-Fusion (registered trademark) HD Cloning Kit (Clontech) to obtain the yeast co-expression vector pESC-Leu2d-CYP5106A1-OSC1-CYP88D6.

Example 34: Construction of pESC-Leu2d-Padh2_CYP72A63L149I-Tcyc1-OSC1-CYP88D6 Using pUC-57 plasmid DNA containing the synthetic gene sequence of alfalfa CYP72A63 (Genscript) as a template, synCYP72A63-F1 (gagaaaaaaacccccggatccATGGAAGTTTTTTAGTTTCCTAC) (SEQ ID NO: 118) and synCYP72A63-R1 (CATGATGCGGCCCTCTAGATCATAATTTGTGTAAGATAATAGAAG) (SEQ ID NO: 119) primers and PrimeSTAR (registered trademark) Max DNA Polymerase was added, and the mixture was treated at 95°C for 2 minutes, followed by 37 cycles of (98°C, 10 seconds → 55°C, 5 seconds → 72°C, 20 seconds) PCR to amplify a DNA fragment containing CYP72A63. The PCR solution was electrophoresed, and the amplified fragment of about 1.6 kb was purified using a MinElute Gel Extraction Kit. The resulting DNA fragment of CYP72A63 and the DNA fragment of CYC1 terminator DNA fragment-b obtained in Example 8 were mixed, and the mixture was diluted with PrimeSTAR (registered trademark) Max DNA Extraction Kit. Polymerase was added, and the mixture was treated at 95°C for 2 minutes, followed by PCR consisting of (98°C for 10 seconds → 55°C for 5 seconds → 72°C for 20 seconds) x 4 cycles. Then, both primers synCYP72A63-F1 (gagaaaaaaacccccggatccATGGAAGTTTTTATGTTTCCTAC) (SEQ ID NO: 118) and DEST52-CYC1t-R (cgccacgttcgccggCAGCTTGCAAATTAAAGCCT) (SEQ ID NO: 27) were added, and the mixture was further treated at 95°C for 2 minutes, followed by PCR consisting of (98°C for 10 seconds → 55°C for 5 seconds → 72°C for 20 seconds) x 24 cycles to amplify the CYP72A63-CYC1 terminator, and then subjected to MinElute Gel Extraction. A DNA fragment of about 1.8 kbp was purified using a PCR kit. The CYP72A63-CYC1 terminator DNA fragment was mixed with the ADH2 promoter DNA fragment obtained in Example 28, and the mixture was diluted with PrimeSTAR (registered trademark) Max DNA. Polymerase was added, and the mixture was treated at 95°C for 2 minutes, followed by PCR consisting of (98°C for 10 seconds → 50°C for 10 seconds → 72°C for 20 seconds) x 4 cycles. Then, both primers Padh2-NgoMIV-F (cgccacgttcgccgGCAAAACGTAGGGGCAAAC) (SEQ ID NO: 113) and DEST52-CYC1t-KasI-R (atataaaaaaggcgccAGCTTGCAAAATTAAAGCCT) (SEQ ID NO: 120) were added, and the mixture was further treated at 95°C for 2 minutes, followed by PCR consisting of (98°C for 10 seconds → 55°C for 5 seconds → 72°C for 20 seconds) x 24 cycles. The PCR solution was subjected to electrophoresis, and a DNA fragment of about 2.4 kbp corresponding to ADH2 promoter_CYP72A63_CYC1 terminator (hereinafter, Padh2_CYP72A63_Tcyc1) was obtained using a MinElute Gel Extraction Kit. Using this Padh2_CYP72A63_Tcyc1 DNA fragment as a template, both primers Padh2-NgoMIV-F (cgccacgttcgccgGCAAAACGTAGGGGCAAAC) (SEQ ID NO: 113) and A63opt_443_R (ATACCTACTGACAAGTACTTGG) (SEQ ID NO: 121) were used, and PrimeSTAR (registered trademark) Max DNA Polymerase was added. After treatment at 95°C for 4 minutes, PCR consisting of (98°C for 10 seconds → 55°C for 5 seconds → 72°C for 15 seconds) x 27 cycles was performed to amplify DNA from the ADH2 promoter to the 5'-end 443 bp of the CYP72A63 gene (hereinafter, CYP72A63-a). The PCR solution was electrophoresed, and a DNA fragment of about 1.0 kbp was purified using MinElute Gel Extraction Kit. Then, primer A63opt-149I_F (CTTGTCAGTAGGTATCATTGATCATGAAGG) (SEQ ID NO: 122) in which the codon for the 149th amino acid residue leucine (CTA) of CYP72A63 was replaced with the codon for isoleucine (ATT) and primer DEST52-CYC1t-R (cgccacgttcgccggCAGCTTGCAAATTAAAGCCT) (SEQ ID NO: 27) were used, and the PCR product was extracted with PrimeSTAR (registered trademark) Max DNA Extraction Kit. After treating with polymerase at 95°C for 4 minutes, PCR consisting of (98°C for 10 seconds → 55°C for 5 seconds → 72°C for 15 seconds) x 27 cycles was performed to amplify a DNA fragment from the 428th base from the 5'-end start codon of the CYP72A63 gene to the CYC1 terminator (hereinafter, CYP72A63-b). The PCR solution was electrophoresed, and a DNA fragment of about 1.4 kbp was obtained using a MinElute Gel Extraction Kit. pESC-OSC1-CYP88D6 was digested with restriction enzymes NgoMIV and KasI (both New England Biolab), and then mixed with the DNA fragments of CYP72A63-a and CYP72A63-b obtained above, and ligated using In-Fusion (registered trademark) HD Cloning Kit to construct the yeast expression vector pESC-Leu2d-Padh2_CYP72A63L149I_Tcyc1-OSC1-CYP88D6.

Example 35: Construction of expression vector pESC-Leu2d-Padh2_CYP72A63L149I-OSC1-CYP88D6 Using the DNA of pESC-Leu2d-Padh2_CYP72A63L149I_Tcyc1-OSC1-CYP88D6 constructed in Example 34 as a template,
Padh2-NgoMIV-F (cgccacgttcgccgGCAAAACGTAGGGGCAAAC) (SEQ ID NO: 113) and link to #88-R (ATGCGGCCCTCTAGATCA) (SEQ ID NO: 117) were used as primers, and the mixture was treated with PrimeSTAR (registered trademark) Max DNA Polymerase at 95 ° C for 2 minutes, followed by PCR consisting of (98 ° C for 10 seconds → 55 ° C for 5 seconds → 72 ° C for 20 seconds) × 30 cycles. The PCR solution was electrophoresed, and a DNA fragment of about 2.2 kbp corresponding to Padh2_CYP72A63L149I was obtained using the MinElute Gel Extraction Kit. Next, this DNA fragment, the DNA fragment of the budding yeast TEF1 terminator obtained in Example 29, and the DNA fragment of pESC-OSC1-CYP88D6 digested with the restriction enzymes NgoMIV and KasI were mixed and reacted using In-Fusion (registered trademark) HD Cloning Kit to obtain the yeast co-expression vector pESC-Leu2d-Padh2_CYP72A63L149I-OSC1-CYP88D6.

Example 36 Preparation of Cytochrome P450 Monooxygenase Gene Derived from Aspergillus nominus NRRL13137 For cytochrome P450 monooxygenase derived from Aspergillus nomius NRRL13137 (hereinafter referred to as "CYP5106A1 homolog"), which has an amino acid sequence identity of 79% with CYP5106A1 derived from Aspergillus oryzae, a DNA fragment consisting of about 600 bp corresponding to the N-terminal side of the amino acid sequence, and a DNA fragment consisting of about 1000 bp corresponding to the C-terminal side of the amino acid sequence were synthesized by GeneArt ^™ Strings ^™ DNA Fragments synthesis (Invitrogen). After mixing both DNA fragments, the mixture was treated with PrimerSTAR (registered trademark) Max DNA Polymerase (TAKARA) at 95°C for 2 minutes, and then PCR consisting of (98°C for 10 seconds → 55°C for 5 seconds → 72°C for 15 seconds) x 13 cycles was performed to amplify the DNA fragment. The PCR solution was electrophoresed, and amplification of the approximately 1.6 kb AnCYP5106A1 homolog DNA fragment (SEQ ID NO: 133) was confirmed.

Example 37: Preparation of ADH2 promoter_AnCYP5106A1 homolog_Ttef1 DNA fragment The AnCYP5106A1 homolog DNA fragment obtained in Example 36 and the budding yeast TEF1 terminator DNA fragment obtained in Example 29 were mixed, and the resulting mixture was diluted with PrimerSTAR (registered trademark) Max DNA. After treatment with Polymerase (TAKARA) at 95°C for 2 minutes, PCR consisting of (98°C for 10 seconds → 50°C for 10 seconds → 72°C for 15 seconds) x 4 cycles was performed, and then both primers AnCYP5106A1 homolog-F (CTATTAACTATCGTAATACACAATGTCCTTCGTTTCCGTTATCAT) (SEQ ID NO: 123) and TEF1ter-R (atataaaaaaggcgccTGAAAAAAGAGGGGAATTTTTTAG) (SEQ ID NO: 116) were added, and further treatment was performed at 95°C for 2 minutes, followed by PCR consisting of (98°C for 10 seconds → 50°C for 5 seconds → 72°C for 15 seconds) x 27 cycles. The PCR solution was electrophoresed to confirm the amplification of a DNA fragment of AnCYP5106A1homolog_Ttef1 of about 1.8 kb. Next, the DNA fragment of AnCYP5106A1homolog_Ttef1 and the ADH2 promoter DNA fragment obtained in Example 28 were mixed, and the mixture was subjected to amplification using PrimerSTAR (registered trademark) Max DNA. After treatment with Polymerase (TAKARA) at 95°C for 2 minutes, PCR consisting of (98°C for 10 seconds → 50°C for 10 seconds → 72°C for 20 seconds) x 4 cycles was performed, and then both primers Padh2-NgoMIV-F (cgccacgttcgccgGCAAAACGTAGGGGCAAAC) (SEQ ID NO: 113) and TEF1ter-R (atataaaaaaggcgccTGAAAAAAGAGGGGAATTTTTAG) (SEQ ID NO: 116) were added, and further treatment was performed at 95°C for 2 minutes, followed by PCR consisting of (98°C for 10 seconds → 55°C for 5 seconds → 72°C for 20 seconds) x 27 cycles. The PCR solution was subjected to electrophoresis, and the amplified fragment of about 2.4 kb was purified using a MinElute Gel Extraction Kit (Qiagen) to obtain a DNA fragment of ADH2 promoter_AnCYP5106A1 homolog_Ttef1.

Example 38: Construction of vector pESC-AnCYP5106A1homolog-OSC1-CYP88D6 pESC-OSC1-CYP88D6 was digested with restriction enzymes NgoMIV and KasI (New England Biolab), and then mixed with the ADH2 promoter_AnCYP5106A1homolog_Ttef1 DNA fragment obtained in Example 37. The resulting mixture was subjected to an In-Fusion reaction using an In-Fusion (registered trademark) HD Cloning Kit (Clontech) to obtain the yeast expression vector pESC-Leu2d-AnCYP5106A1homolog-OSC1-CYP88D6.

Example 39: Preparation of ADH2 promoter_AnCYP5106A1 homolog (gap-filled)_Ttef1 DNA fragment The full-length amino acid sequence identity between AnCYP5106A1 homolog (sequence number 135) and CYP5106A1 is 79%, but AnCYP5106A1 homolog is missing 13 consecutive residues from the 130th to 142nd amino acids from the N-terminus of CYP5106A1 (Figure 4). Thus, a DNA fragment of ADH2 promoter_AnCYP5106A1 homolog (gap-filled)_Ttef1 was prepared as an expression unit containing a polynucleotide (SEQ ID NO: 134) encoding AnCYP5106A1 homolog (gap-filled) (SEQ ID NO: 136) in which a sequence of 13 amino acids from 130 to 142 positions from the N-terminus of CYP5106A1 was inserted after the 129th glutamic acid residue of AnCYP5106A1 homolog.

First, to amplify the DNA of the region including the amino acid sequence from the N-terminus of the ADH2 promoter to the 129th amino acid of the AnCYP5106A1 homolog and the N-terminal portion of the 13 amino acid sequence to be inserted immediately after that (hereinafter referred to as "AnCYP5106A1 homolog (gap-filled)-a"), the DNA of ADH2 promoter_AnCYP5106A1 homolog_Ttef1 obtained in Example 37 was used. The NA fragment was used as a template, and both the Padh2-NgoMIV-F (cgccacgttcgccgGCAAAACGTAGGGGCAAAC) (SEQ ID NO: 113) and AnCYP5106A1 homolog-GF-R (GCCAAGTTCTTACCGAAAACATTCATCTTTTCCAACAAAGAAGATGGTTTG) (SEQ ID NO: 124) primers were used, and amplification was performed using PrimerSTAR (registered trademark) Max. After treating with DNA Polymerase (TAKARA) at 95°C for 2 minutes, the mixture was further treated at 95°C for 2 minutes, and then PCR consisting of (98°C for 10 seconds → 55°C for 5 seconds → 72°C for 15 seconds) x 27 cycles was performed to amplify the DNA fragment of AnCYP5106A1 homolog (gap-filled)-a. The PCR solution was electrophoresed, and the amplified fragment of about 1 kb was purified with MinElute Gel Extraction Kit (Qiagen). Next, in order to amplify the DNA from the C-terminal portion of the 13 amino acid sequence to be inserted to the amino acid sequence from the 130th amino acid from the N-terminus of AnCYP5106A1 homolog to the C-terminus and Ttef1 (hereinafter referred to as "AnCYP5106A1 homolog (gap-filled)-b"), the ADH2 promoter_AnCYP5106A1 homolog_Ttef1 obtained in Example 37 was The DNA fragment was used as a template, and both primers, AnCYP5106A1 homolog-GF-F (CGGTAAGAACTTGGCTACTGTTGAAGGTGCTGATTGGCAAAG) (SEQ ID NO: 125) and TEF1ter-R (atataaaaaaggcgccTGAAAAAAGAGGGGGAATTTTTAG) (SEQ ID NO: 116), were used to amplify the DNA using PrimerSTAR (registered trademark) Max. After treating with DNA Polymerase (TAKARA) at 95°C for 2 minutes, the mixture was further treated at 95°C for 2 minutes, and then PCR consisting of (98°C for 10 seconds → 55°C for 5 seconds → 72°C for 15 seconds) x 27 cycles was performed to amplify the DNA fragment of AnCYP5106A1homolog(gap-filled)-b. The PCR solution was electrophoresed, and the amplified fragment of about 1.4 kb was purified with MinElute Gel Extraction Kit (Qiagen), and the DNA fragment of AnCYP5106A1homolog(gap-filled)-b was obtained.

Example 40: Construction of pESC-Leu2d-AnCYP5106A1 homolog (gap-filled)-OSC1-CYP88D6 pESC-OSC1-CYP88D6 was digested with restriction enzymes NgoMIV and KasI (both from New England Biolab), and then mixed with the DNA fragments of AnCYP5106A1 homolog (gap-filled)-a and AnCYP5106A1 homolog (gap-filled)-b obtained in Example 39. The DNA fragments were then amplified using In-Fusion (registered trademark) HD Cloning. The yeast expression vector pESC-Leu2d-AnCYP5106A1homolog(gap-filled)-OSC1-CYP88D6 was obtained by in-fusion reaction using an expression kit (Clontech).

Example 41: Construction of expression vector for AnCYP5106A1 homolog (gap-filled) and CYP5106A1 chimeric gene A21/A14. The vector pESC-Leu2d-AnCYP5106A1 homolog (gap-filled)-OSC1-CYP88D6 obtained in Example 40 was used as a template, and both primers Padh2-NgoMIV-F (cgccacgttcgccgGCAAAACGTAGGGGCAAAC) (SEQ ID NO: 113) and CYP5106A-425-R (TCAACAGTAGCCAAGTTCTTAC) (SEQ ID NO: 126) were used to construct an expression vector for AnCYP5106A1 homolog (gap-filled) and CYP5106A1 chimeric gene A21/A14 using PrimeSTAR (registered trademark) Max DNA primer. After treating with Polymerase at 95 ° C for 4 minutes, PCR consisting of (98 ° C 10 seconds → 55 ° C 5 seconds → 72 ° C 15 seconds) × 30 cycles was performed to amplify a DNA fragment from the ADH2 promoter to the N-terminal 137th amino acid residue of AnCYP5106A1 homolog (gap-filled) (hereinafter, A2-1 DNA fragment). The PCR solution was electrophoresed, and a DNA fragment of about 1.0 kbp was obtained using MinElute Gel Extraction Kit. At the same time, the DNA of the vector pESC-Leu2d-CYP5106A1-OSC1-CYP88D6 obtained in Example 33 was used as a template, and primers CYP5106A-411-F (CTTGGCTACTGTTGAAGGTG) (SEQ ID NO: 127) and TEF1ter-R (atataaaaaaggcgccTGAAAAAAGAGGGGAATTTTTAG) (SEQ ID NO: 116) were used to amplify the DNA of the vector pESC-Leu2d-CYP5106A1-OSC1-CYP88D6 obtained in Example 33 using PrimeSTAR (registered trademark) Max DNA PCR. Polymerase was added, and the mixture was treated at 95°C for 4 minutes, followed by 30 cycles of PCR (98°C for 10 seconds → 55°C for 5 seconds → 72°C for 15 seconds) to amplify a DNA fragment from the N-terminal 138th amino acid residue of CYP5106A1 to the TEF1 terminator (hereinafter, A1-4 DNA fragment). The PCR solution was electrophoresed, and a DNA fragment of about 1.4 kbp was obtained using the MinElute Gel Extraction Kit. Next, the A2-1 DNA fragment, the A1-4 DNA fragment, and the pESC-OSC1-CYP88D6 fragment digested with the restriction enzymes NgoMIV and KasI were mixed and ligated using the In-Fusion (registered trademark) HD Cloning Kit to obtain the yeast co-expression vector pESC-Leu2d-A21/A14-OSC1-CYP88D6 containing the chimeric gene (A21/A14) expression unit of AnCYP5106A1 homolog (gap-filled) (1-141aa)/CYP5106A1 (142-534aa).

Example 42: Construction of expression vector for AnCYP5106A1 homolog (gap-filled) and CYP5106A1 chimeric gene A22/A15 Using the vector pESC-Leu2d-AnCYP5106A1 homolog (gap-filled)-OSC1-CYP88D6 obtained in Example 40 as a template, Padh2-NgoMIV-F (cgccacgttcgccgGCAAAACGTAGGGGCAAAC) (SEQ ID NO: 113) and CYP5106A1-859-R (TAGAGGACAACAAATCAGCATGAGC) (SEQ ID NO: 128), PrimeSTAR (registered trademark) Max DNA After treating with Polymerase at 95 ° C for 4 minutes, PCR consisting of (98 ° C 10 seconds → 55 ° C 5 seconds → 72 ° C 15 seconds) × 30 cycles was performed to amplify a DNA fragment from the ADH2 promoter to the N-terminal 282nd amino acid residue of AnCYP5106A1 homolog (gap-filled) (hereinafter, A2-2 DNA fragment). The PCR solution was electrophoresed, and a DNA fragment of about 1.4 kbp was obtained using MinElute Gel Extraction Kit.

Next, the DNA of the vector pESC-Leu2d-CYP5106A1-OSC1-CYP88D6 obtained in Example 33 was used as a template, and primers CYP5106A1-845-F (ATTTGTTGTCCTCTATTTTGGCTCC) (SEQ ID NO: 129) and TEF1ter-R (atataaaaaaggcgccTGAAAAAAAGAGGGGAATTTTTTAG) (SEQ ID NO: 116) were used to amplify the DNA using PrimeSTAR (registered trademark) Max DNA PCR product. After adding polymerase and treating at 95°C for 4 minutes, PCR consisting of (98°C for 10 seconds → 55°C for 5 seconds → 72°C for 15 seconds) x 30 cycles was performed to amplify a DNA fragment from the N-terminal 283rd amino acid residue of CYP5106A1 to the TEF1 terminator (hereinafter, A1-5 DNA fragment). The PCR solution was electrophoresed, and a DNA fragment of about 1.0 kbp was obtained using MinElute Gel Extraction Kit. Next, the A2-2 DNA fragment, the A1-5 DNA fragment, and the pESC-OSC1-CYP88D6 fragment digested with the restriction enzymes NgoMIV and KasI were mixed and ligated using the In-Fusion (registered trademark) HD Cloning Kit to obtain the yeast co-expression vector pESC-Leu2d-A22/A15-OSC1-CYP88D6 containing the chimeric gene (A22/A15) expression unit of AnCYP5106A1 homolog (gap-filled) (1-286aa)/CYP5106A1 (287-534aa).

<Example 43> Construction of expression vectors for AnCYP5106A1 homolog (gap-filled) and CYP5106A1 chimeric gene A23/A16 Using the vector pESC-Leu2d-AnCYP5106A1 homolog (gap-filled)-OSC1-CYP88D6 obtained in <Example 40> as a template, Padh2-NgoMIV-F (cgccacgttcgccgGCAAAACGTAGGGGCAAAC) (SEQ ID NO: 113) and -CYP5106A-1286-R (AATGGATCTGGACCCCATTG) (SEQ ID NO: 130), PrimeSTAR (registered trademark) Max DNA After treating with Polymerase at 95 ° C for 4 minutes, PCR consisting of (98 ° C 10 seconds → 55 ° C 5 seconds → 72 ° C 15 seconds) × 30 cycles was performed to amplify a DNA fragment from the ADH2 promoter to the N-terminal 424th amino acid residue of AnCYP5106A1 homolog (gap-filled) (hereinafter, A2-3 DNA fragment). The PCR solution was electrophoresed, and a DNA fragment of about 1.9 kbp was obtained using MinElute Gel Extraction Kit. Next, using the DNA of the vector pESC-Leu2d-CYP5106A1-OSC1-CYP88D6 obtained in Example 33 as a template, and both primers CYP5106A-1272-F (GGGTCCAGATCCATTGGCTTG) (SEQ ID NO: 131) and TEF1ter-R (atataaaaaaggcgccTGAAAAAAAGAGGGGAATTTTTTAG) (SEQ ID NO: 116), a primer sequence was synthesized using PrimeSTAR (registered trademark) Max DNA PCR product. After adding polymerase and treating at 95°C for 4 minutes, PCR consisting of (98°C for 10 seconds → 55°C for 5 seconds → 72°C for 15 seconds) x 30 cycles was performed to amplify a DNA fragment from the N-terminal 425th amino acid residue of CYP5106A1 to the TEF1 terminator (hereinafter, A1-6 DNA fragment). The PCR solution was electrophoresed, and a DNA fragment of about 0.5 kbp was obtained using MinElute Gel Extraction Kit. Next, the A2-3 DNA fragment, the A1-6 DNA fragment, and the pESC-OSC1-CYP88D6 fragment digested with the restriction enzymes NgoMIV and KasI were mixed and ligated using an In-Fusion (registered trademark) HD Cloning Kit to obtain a yeast co-expression vector pESC-Leu2d-A23/A16-OSC1-CYP88D6 containing an expression unit for the chimeric gene (A23/A16) of AnCYP5106A1 homolog (gap-filled) (1-428aa)/CYP5106A1 (429-534aa).

Example 44: Preparation of yeast strains YJT201 and YJT179 The yeast strain YJT8a obtained in Example 25 was transformed with pESC-Leu2d-CYP5106A1-OSC1-CYP88D6 constructed in Example 33, or pESC-Leu2d-CYP72A63L149I-OSC1-CYP88D6 constructed in Example 34 to obtain yeast strain YJT201 or yeast strain YJT179, respectively.

Example 45: Preparation of transformed yeast strains YJT184 and YJT177 The yeast strain YJT8b obtained in Example 25 was transformed with pESC-Leu2d-CYP5106A1-OSC1-CYP88D6 constructed in Example 33, or pESC-Leu2d-CYP72A63L149I-OSC1-CYP88D6 constructed in Example 34 to obtain yeast strain YJT184 or yeast strain YJT177, respectively.

Example 46: Preparation of strains YJT223 and YJT224 The yeast YJT8b strain constructed in Example 25 was transformed with pESC-Leu2d-AnCYP5106A1 homolog-OSC1-CYP88D6 constructed in Example 38, or with pESC-Leu2d-AnCYP5106A1 homolog (gap-filled)-OSC1-CYP88D6 constructed in Example 40 to obtain strains YJT223 and YJT224, respectively.

Example 47: Preparation of strains YJT225 and YJT226 The yeast YJT8a strain constructed in Example 25 was transformed with pESC-Leu2d-AnCYP5106A1homolog-OSC1-CYP88D6 constructed in Example 38, or with pESC-Leu2d-AnCYP5106A1homolog(gap-filled)-OSC1-CYP88D6 constructed in Example 40 to obtain strains YJT225 and YJT226, respectively.

Example 48: Preparation of strains YJT247, YJT248, and YJT249 The yeast strain YJT8a obtained in Example 25 was transformed with the expression vector pESC-Leu2d-A21/A14-OSC1-CYP88D6 constructed in Example 41, or the expression vector pESC-Leu2d-A22/A15-OSC1-CYP88D6 constructed in Example 42, or the expression vector pESC-Leu2d-A23/A16-OSC1-CYP88D6 constructed in Example 43, to obtain strains YJT247, YJT248, and YJT249, respectively.

Example 49: Confirmation of accumulated amount of product in yeast strains YJT201, YJT179, YJT184, and YJT177 The yeast strains YJT201, YJT179, YJT184, and YJT177 constructed in Example 44 and Example 45 were inoculated into SC-His/Trp/Leu/Ura/Lys/Ade medium containing 4% (w/v) glucose (containing 40 g glucose, 6.7 g yeast nitrogen base (amino acid-free) (BD Difco ^™ ), and 0.05 mg each of L-arginine, L-aspartic acid, L-cysteine, L-glutamic acid, L-phenylalanine, L-serine, L-threonine, L-tyrosine, and L-valine per liter), and cultured at 30°C with shaking at 200 rpm. After 30 hours, the culture solution of each yeast strain was centrifuged at 2,100×g for 5 minutes at room temperature to obtain a culture solution volume of 0.6, where the OD600 nm value was multiplied by the volume (mL) of the culture solution. The precipitate was suspended in 10 mL SP medium (SC-His/Trp/Leu/Ura/Lys/Ade medium containing 2% (w/v) glucose, 0.5% (w/v) galactose, and 1 mM L-methionine) and cultured with shaking at 30° C. and 230 rpm. Three days after the start of culture, 2 ml of supplemented medium (aqueous solution containing 10% (w/v) glucose and 2.5% (w/v) galactose) was added to each culture solution, and 7 days after the start of culture, 2 ml of 2.5% (w/v) ethanol aqueous solution was added. Ten days after the start of the culture, 0.4 ml of ethyl acetate (FUJIFILM Wako Pure Chemical Industries, Ltd.) was added to 0.5 ml of the culture solution and mixed, and the upper layer (ethyl acetate layer) was collected as much as possible. This operation was repeated three times, and the collected ethyl acetate layers were combined and then removed by drying under reduced pressure. 0.5 ml of methanol:chloroform (1:1) was added to the residue and mixed well, and then centrifuged at 15,000 rpm for 5 minutes at room temperature. 15 ul of the supernatant was dried under reduced pressure in a glass container, dissolved in 50 μl of MSTFA, and heated at 80° C. for 50 minutes to prepare a sample for GC-MS analysis. The GC-MS conditions used are shown in Table 2 below. The identification and quantification of the products were performed using β-amyrin (EXTRASYNTHESE Co., Ltd.), glycyrrhetinic acid (FUJIFILM Wako Pure Chemical Industries, Ltd.), and the method described in Seki, H. , et al. , Proc. Natl. Acad. Sci. USA, 105, 14204-14209, 2008, and Seki, H., et al., Plant Cell, 23, 4112-4123, 2011, 11-oxo-β-amyrin, 30-hydroxy-11-oxo-β-amyrin, and 30-hydroxy-β-amyrin were used as standards, and the determination was made by comparing the GC retention time and MS spectrum. However, the identification and quantification of glycyrrhetic aldehyde were made with reference to the expected molecular weight, GC retention time, and signal intensity of the 30-hydroxy-β-amyrin standard.

As a result, the average amount of glycyrrhetinic acid accumulated in the YJT179 strain, which is based on the yeast YJT8a strain and expresses CYP72A63L149I, was 18 mg/L, while the average amount accumulated in the YJT201 strain, which is based on the same strain and expresses CYP5106A1, was 62 mg/L. In addition, the YJT177 strain, which expresses CYP72A63L149I based on the yeast YJT8b strain, accumulated an average of 45 mg/L of glycyrrhetinic acid, while the YJT184 strain, which expresses CYP5106A1 based on the same strain, accumulated an average of 49 mg/L. Regardless of the original strain for breeding and the molecular species of NADPH-cytochrome P450 reductase used as an electron transfer protein to the oleanane-type triterpene 30-position oxidase, the yeast strain expressing CYP5106A1 accumulated a higher amount of glycyrrhetinic acid than the yeast strain expressing CYP72A63L149I, suggesting that it is preferable for fermentation production of glycyrrhetinic acid. (Table 3 below)

In addition, peaks corresponding to 29-hydroxy-11-oxo-β-amyrin and 20-epi-glycyrrhetinic acid (determined by comparing GC retention times and MS spectra) were detected in the extract of YJT177, which has CYP72A63L149I, but these peaks were not detected in the extract of YJT201, which has CYP5106A1 (Figure 5). This result suggests that yeast expressing CYP5106A1 does not accumulate by-products other than glycyrrhizinic acid compared to existing CYP72A63 and its mutants, and is preferable for fermentative production of glycyrrhizinic acid.

<Example 50> Confirmation of the amount of accumulated products in AnCYP5106A1 homolog and AnCYP5106A1 homolog (gap-filled) in yeast strains YJT223, YJT224, YJT225, and YJT226 The yeast strains YJT223, YJT224, YJT225, and YJT226 obtained in <Example 46> and <Example 47> were cultured by the method described in <Example 49>, and the amount of accumulated oleanane triterpenes extracted from each of the cells was compared. The results are shown in Table 4 below. No oleanane triterpenes with oxidized carbon at the 30th position were detected from the yeast strains (YJT223, YJT225) into which the AnCYP5106A1 homolog gene was introduced. On the other hand, 30-hydroxy-11-oxo-β-amyrin was detected from yeast strains (YJT224, YJT226) into which the AnCYP5106A1 homolog (gap-filled) gene was introduced, but glycyrrhetaldehyde and glycyrrhetinic acid were hardly detected. This result suggests that CYP5106A1 has not only the activity of hydroxylating 11-oxo-β-amyrin at the 30-position, but also the activity of oxidizing it to glycyrrhetinic acid, and that the sequence consisting of 13 amino acids deleted in AnCYP5106A1 homolog is important for the activity of hydroxylating the 30-position carbon of oleanane-type triterpenes, but does not contribute much to the subsequent oxidation activity.

<Example 51> Verification of 30-position oxidase activity of oleanane triterpene of chimeric molecule of CYP5106A1 and AnCYP5106A1 homolog (gap-filled) in yeast strains YJT201, YJT226, YJT247, YJT248, and YJT249 The yeast strains YJT201, YJT226, YJT247, YJT248, and YJT249 obtained in <Example 44>, <Example 47>, and <Example 48> were cultured by the method described in <Example 49>, and the accumulation amount of oleanane triterpene extracted from each cell was compared. The results are shown in Table 5 below. Accumulation of 30-hydroxy-11-oxo-β-amyrin was confirmed in YJT226 as in Example 50, but accumulation of its oxidized products, glycyrrhetaldehyde and glycyrrhetinic acid, could not be detected. On the other hand, accumulation of glycyrrhetaldehyde and glycyrrhetinic acid could be detected in YJT249 expressing chimeric gene A23/A16 encoding a polypeptide in which the sequence of 110 amino acids on the C-terminus (425th to 534th from the N-terminus) of the full length 534 amino acids of AnCYP5106A1 homolog (gap-filled) is replaced with the amino acid sequence of the same position in CYP5106A1, suggesting that this amino acid region is important for the function of further oxidizing the 30-hydroxy-11-oxo-β-amyrin hydroxyl group to a carboxylic acid. In addition, the amino acid identity between this chimera and CYP5106A1 was 85%. The accumulation profiles of oleanane-type triterpenes in YJT247 and YJT248 were almost the same, and the amount of glycyrrhetinic acid accumulated was almost the same as that of YJT201, suggesting that the amino acid sequence from the 283rd to 424th amino acids from the N-terminus of CYP5106A1 has the function of promoting the oxidation of the hydroxyl group at position 30 of oleanane-type triterpenes.

Claims (5)

Any of the following polypeptides (a) to (c):
(a) a polypeptide comprising the amino acid sequence represented by SEQ ID NO:1;
(b) a polypeptide comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 1, and having an activity of oxidizing the 30th carbon of an oleanane-type triterpene;
(c) a polypeptide comprising an amino acid sequence having 85% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 1 and having an activity of oxidizing the 30th carbon of an oleanane-type triterpene;
A method for producing glycyrrhetinic acid, comprising the step of reacting the above with 11-oxo-β-amyrin. The production method according to claim 1, which is carried out in a transformant (excluding humans) that expresses any one of the polypeptides (a) to (c) , and the host of the transformant is a yeast, fungus, plant, or animal cell . The production method according to claim 2 , wherein the transformant further expresses β-amyrin synthase and/or oleanane type triterpene 11-position oxidase. Any of the following polypeptides (a) to (c):
(a) a polypeptide comprising the amino acid sequence represented by SEQ ID NO:1;
(b) a polypeptide comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 1, and having an activity of oxidizing the 30th carbon of an oleanane-type triterpene;
(c) a polypeptide comprising an amino acid sequence having 85% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 1 and having an activity of oxidizing the 30th carbon of an oleanane-type triterpene;
A transformant (excluding humans) having the ability to produce glycyrrhetinic acid, which expresses
A transformant, wherein the host of the transformant is a yeast, fungus, plant, or animal cell . The transformant according to claim 4 , further expressing β-amyrin synthase and/or oleanane-type triterpene 11-position oxidase.