JP7486953B2 - Compositions and methods for cell-targeted therapy - Google Patents

Description

The present invention relates to compositions and methods for cell-targeted therapy.

CROSS REFERENCE This application claims priority to U.S. Provisional Patent Application No. 62/508,272, filed May 18, 2017, and U.S. Provisional Patent Application No. 62/508,833, filed May 19, 2017, each of which is incorporated by reference in its entirety for all purposes.

SEQUENCE LISTING This application contains a Sequence Listing that has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy created on May 17, 2018 is 51887-706 601 It is called SL.txt and has a size of 27,689 bytes.

Adoptive transfer of T cells with engineered anti-tumor or anti-pathogen specificity is under development. In such strategies, exogenous immune receptors, such as alpha beta T cell receptors or gamma delta T cell receptors or chimeric antigen receptors, with a specific anti-tumor or anti-pathogen specificity are transplanted onto autologous T cells from the patient or into the corresponding allogeneic T cells in the case of allogeneic stem cell transplantation into the patient. Also, for example, leukemia patients undergoing blood stem cell transplantation become lymphodepleted during treatment. Thus, such patients may also benefit from the infusion of donor T cells engineered to express, for example, a specific anti-leukemia T cell receptor. The compositions and methods described herein include cells expressing receptors that selectively recognize a unique configuration in proteins expressed by one or more MHC-associated genes, where the unique configuration is associated with one or more pathologies.

INCORPORATION BY REFERENCE All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

The present invention provides a pharmaceutical composition comprising a dosage form of a polypeptide construct that selectively binds to CD277 on cancer cells, or a dosage form of a cell expressing a polypeptide construct that selectively binds to CD277 on cancer cells, and at least one of (i) a dosage form of a substance that enhances RhoB GTPase activity in the cancer cells, and (ii) a dosage form of a substance that enhances phosphoantigen activity in the cancer cells. In one embodiment, the pharmaceutical composition comprises a dosage form of a substance that enhances RhoB GTPase activity and a dosage form of a substance that enhances phosphoantigen activity. In one embodiment, the pharmaceutical composition comprises a dosage form of an agent that enhances the activity of RhoB GTPase and a dosage form of an agent that enhances the activity of a phosphoantigen, where the agent that enhances the activity of a phosphoantigen is administered before, simultaneously with, or after the agent that enhances the activity of RhoB GTPase. In one embodiment, an agent that enhances the activity of RhoB GTPase enhances translocation of RhoB GTPase to the cell membrane of a cancer cell, retains RhoB GTPase at the cell membrane of a cancer cell, enhances translocation of RhoB GTPase from the nucleus of a cancer cell, enhances expression of a gene or transcript encoding RhoB GTPase, enhances the stability of RhoB GTPase, enhances the interaction of RhoB GTPase with CD277, activates RhoB GTPase, enhances the interaction of RhoB GTPase with GTP, reduces the interaction of RhoB GTPase with GDP, increases the amount of GTP in the cancer cell, increases the availability of GTP in the cancer cell, or any combination thereof. In one embodiment, CD277 may be in the J configuration. In one embodiment, the polypeptide construct comprises at least one of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence. In one embodiment, the polypeptide construct comprises at least one variant or fragment of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence. In one embodiment, the polypeptide construct comprises at least one variant or fragment of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence, wherein the gamma-TCR polypeptide sequence can be a gamma9-TCR polypeptide sequence or a fragment thereof. In one embodiment, the polypeptide construct comprises at least one variant or fragment of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence, wherein the delta-TCR polypeptide sequence can be a delta2-TCR polypeptide sequence or a fragment thereof. In one embodiment, the pharmaceutical composition can be administered to a subject comprising at least one of a solid cancer and a leukemia. In one embodiment, the pharmaceutical composition can be administered to a subject comprising acute myeloid leukemia. In one embodiment, the pharmaceutical composition can be administered to a subject comprising at least one of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence. The subject may comprise a mutation in a gene that correlates with expression or activity of RhoB GTPase. In one embodiment, the pharmaceutical composition may be administered to a subject that comprises a mutation in a gene that correlates with reduced expression or activity of RhoB GTPase. In one embodiment, the pharmaceutical composition may be administered to a subject that comprises a mutation in a gene that may correlate with reduced or inhibited interaction of CD277 with RhoB GTPase. In one embodiment, the substance that enhances the activity of RhoB GTPase may function by indirectly or directly binding to RhoB GTPase. In one embodiment, the substance that enhances the activity of phosphoantigen may function by indirectly or directly binding to RhoB GTPase. In one embodiment, the dosage form of the polypeptide construct comprises a sequence that comprises at least 60% identity to a sequence in Table 3 or Table 4. In one embodiment, the substance that enhances the activity of phosphoantigen may be a mevalonate pathway inhibitor. In one embodiment, the agent that enhances the activity of a phosphoantigen can be an aminobisphosphonate. In one embodiment, the agent that enhances the activity of a phosphoantigen can be at least one of pamidronate and zoledronate. In one aspect, an agent that enhances the activity of RhoB GTPase enhances translocation of RhoB GTPase to the cell membrane of a cancer cell, retains RhoB GTPase in the cell membrane of a cancer cell, enhances translocation of RhoB GTPase from the nucleus of a cancer cell, enhances expression of a gene or transcript encoding RhoB GTPase in a cancer cell, enhances the stability of RhoB GTPase, enhances the interaction of RhoB GTPase with CD277, activates RhoB GTPase in a cancer cell, enhances the interaction of RhoB GTPase with GTP in a cancer cell, reduces the interaction of RhoB GTPase with GDP in a cancer cell, increases the amount of GTP in a cancer cell, increases the availability of GTP in a cancer cell, or any combination thereof.

The present specification discloses a method of treatment comprising administering a pharmaceutical composition to a subject in need of treatment. In one embodiment, the subject comprises a mutation in a gene that correlates with reduced or inhibited interaction of CD277 with RhoB GTPase. In one embodiment, the subject comprises at least one of a solid cancer and a leukemia.

The present specification discloses a method of treatment comprising administering to a subject in need of treatment a pharmaceutical composition comprising a substance selected from the group consisting of substances that enhance the activity of RhoB GTPase in cancer cells of the subject, or a pharmaceutical composition comprising a polypeptide construct that selectively binds to CD277 on the cancer cells. In one embodiment, the method may further comprise administering to the subject in need of treatment a substance that enhances the activity of a phosphoantigen in cancer cells of the subject in need of treatment.

The present disclosure discloses a method of treatment comprising administering to a subject in need of treatment a formulation of a polypeptide construct that selectively binds to CD277 on a cancer cell or a formulation of a cell expressing a polypeptide construct that selectively binds to CD277 on a cancer cell, and at least one of (i) a formulation of a substance that enhances the activity of RhoB GTPase in the cancer cell, and (i) a formulation of a substance that enhances the activity of a phosphoantigen in the cancer cell. In one embodiment, the treatment comprises administering a formulation of a substance that enhances the activity of RhoB GTPase and a formulation of a substance that enhances the activity of a phosphoantigen. In one embodiment, the substance that enhances the activity of RhoB GTPase can be a mevalonate pathway inhibitor. In one embodiment, the substance that enhances the activity of RhoB GTPase can be a mevalonate pathway inhibitor, which can be an aminobisphosphonate. In one embodiment, the agent that enhances the activity of RhoB GTPase may be a mevalonate pathway inhibitor, which may be at least one of pamidronate and zoledronate. In one embodiment, the polypeptide construct comprises at least one variant or fragment of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence. In one embodiment, the polypeptide construct comprises at least one variant or fragment of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence, where the gamma-TCR polypeptide sequence may be a gamma9-TCR polypeptide sequence or a fragment thereof. In one embodiment, the polypeptide construct comprises at least one variant or fragment of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence, where the delta-TCR polypeptide sequence may be a delta2-TCR polypeptide sequence or a fragment thereof. In one embodiment, the cell may be an alpha beta T cell. In one embodiment, the agent that enhances the activity of a phosphoantigen may function by indirectly or directly binding to the phosphoantigen. In one embodiment, the method may further comprise administering a formulation comprising a cytokine. In one embodiment, the formulation of the polypeptide construct comprises a sequence comprising at least 60% identity to a sequence in Table 3 or Table 4.

The present specification discloses a method of treatment comprising administering to a subject in need of treatment a pharmaceutical composition comprising an agent that enhances the activity of RhoB GTPase in cancer cells of the subject and a pharmaceutical composition comprising cells expressing a Vγ9Vδ2 T cell receptor, wherein T cells isolated from the subject secrete at least one-fold less of a small protein compared to comparable T cells isolated from a comparable subject not receiving the treatment. In one embodiment, the small protein can be a cytokine. In one embodiment, the small protein can be a cytokine and is IFNγ. In one embodiment, T cells isolated from the subject secrete at least five-fold less of a small protein compared to comparable T cells isolated from a comparable subject not receiving the treatment. In one embodiment, T cells isolated from the subject secrete at least ten-fold less of a small protein compared to comparable T cells isolated from a comparable subject not receiving the treatment.

The present specification discloses a method of treatment comprising administering to a subject in need of treatment a dosage form of a substance that enhances the activity of RhoB GTPase in cancer cells and a dosage form of a substance that enhances the activity of a phosphoantigen in cancer cells. In one embodiment, the substance that enhances the activity of RhoB GTPase can be a mevalonate pathway inhibitor. In one embodiment, the substance that enhances the activity of RhoB GTPase can be a mevalonate pathway inhibitor that can be an aminobisphosphonate. In one embodiment, the substance that enhances the activity of RhoB GTPase can be a mevalonate pathway inhibitor that can be at least one of pamidronate and zoledronate. In one embodiment, the substance that enhances the activity of a phosphoantigen functions by indirectly or directly binding to a phosphoantigen. In one embodiment, the method may further include administering a formulation of a polypeptide construct that selectively binds to CD277 on cancer cells, or a formulation of cells expressing the polypeptide construct that selectively binds to CD277 on cancer cells.

The present invention provides compositions comprising engineered cells expressing a polypeptide construct that selectively binds to a J configuration or J confirmation of CD277 on a target cell. In some cases, a polypeptide construct described herein that selectively binds to a J configuration of CD277 on a target cell is provided, where the polypeptide construct is expressed in an engineered cell. Also provided are nucleotide sequences comprising a polypeptide construct described herein that selectively binds to a J configuration of CD277 on a target cell.

The present invention provides methods and compositions comprising a polypeptide construct that selectively binds to the J configuration of CD277 on a target cell, a nucleotide sequence encoding the polypeptide construct, or a cell expressing the polypeptide construct. In some embodiments, the polypeptide construct that binds to the J configuration of CD277 on a target cell comprises at least one γδ T cell receptor or a fragment or variant thereof.

The present invention provides compositions comprising engineered cells expressing a polypeptide construct that selectively binds to a configuration of CD277 formed as a result of metabolic changes in distressed cells, such as cancer cells, where the metabolic changes cause expression of a general stress molecule that is upregulated upon transformation or distress. In certain embodiments, this configuration can be a J configuration. In some cases, the J configuration of CD277 occurs as a result of translocation of RhoB in the distressed cells.

The present invention provides engineered cells that express a polypeptide construct comprising a γδ T cell receptor (TCR) or a fragment thereof that selectively binds to the J configuration of CD277 on a target cell. In some cases, the γδ T cell receptor (TCR) or a fragment thereof comprises at least one of the Vγ9 and Vδ2 chains and fragments thereof. In some cases, the engineered cells described herein can be administered to a subject with at least one additional agent selected from an intermediate of the mammalian mevalonate pathway (e.g., isopentenyl pyrophosphate (IPP)) and an intermediate of the microbial 2-C-methyl-D-erythitol 4-phosphate (MEP) pathway.

The present invention provides unbiased genome-wide screening methods to identify mediators of activation of a given receptor in a particular cell, e.g., a tumor cell. Systems and kits are provided for use in the unbiased genome-wide screening methods. Additionally, the present specification discloses compositions that target mediators identified by the screening methods described herein. In certain embodiments, compositions are provided that are useful for enhancing or restoring optimal activation of a given receptor, e.g., Vγ9Vδ2 TCR.

In certain embodiments, a method is provided for providing an effective treatment for a condition that would benefit from target cell clearance, e.g., cancer, comprising providing a composition comprising a cell that contains a polypeptide construct described herein, or that contains nucleotides encoding same, or that expresses same, and optionally at least one substance useful for enhancing the formation of a J configuration of CD277 or the binding of the polypeptide construct to the J configuration.

The present invention provides pharmaceutical compositions comprising a polypeptide construct that selectively binds to the J configuration of CD277 on a target cell, wherein the polypeptide construct is expressed in an engineered cell. In some embodiments, the polypeptide construct binds to the J configuration of CD277 with high selectivity compared to CD277 molecules that are not in the J configuration. In some embodiments, the target cell is a cancer cell. In some embodiments, the target cell is a leukemia cell.

In some embodiments, the polypeptide construct comprises at least one of a γ-TCR polypeptide sequence or a δ-TCR polypeptide sequence, or at least one variant or fragment of a γ-TCR polypeptide sequence or a δ-TCR polypeptide sequence. In some embodiments, the γ-TCR polypeptide sequence is a γ9-TCR polypeptide sequence or a fragment thereof. In some embodiments, the δ-TCR polypeptide sequence is a δ2-TCR polypeptide sequence or a fragment thereof. In yet another embodiment, CD277 exists as a dimer.

The present invention provides a method for treating cancer in a subject, comprising administering to the subject an effective amount of a pharmaceutical composition comprising a polypeptide construct that selectively binds to CD277 on cancer cells when the CD277 molecule is in the J configuration, where the polypeptide construct may optionally be expressed in an engineered cell. The present invention further provides a method for removing cancer cells in a subject in need of removal of cancer cells, comprising administering to the subject an effective amount of a pharmaceutical composition comprising a polypeptide construct that selectively binds to CD277 on cancer cells when the CD277 molecule is in the J configuration, or an effective amount of engineered cells expressing the polypeptide construct.

In some cases, the polypeptide construct recognizes the J configuration of CD277 with high selectivity compared to CD277 molecules that are not in the J configuration. In some embodiments, the formation of the J configuration requires at least an interaction between RhoB and CD277 and/or compartmentalization of CD277. In some embodiments, the formation of the J configuration requires an interaction between an intracellular phosphoantigen and CD277 after said interaction between RhoB and CD277. In some cases, the polypeptide construct comprises at least one of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence, or at least one variant or fragment of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence.

In some cases, the method includes administering an agent that enhances translocation of RhoB GTPase to the cell membrane of the cancer cell or administering an agent that modulates RhoB GTPase, where the agent targets at least one of a GTPase activating protein (GAP), a guanine nucleotide exchange factor (GEF), and a guanine nucleotide dissociation inhibitor (GDI). In some cases, the method includes genotyping the subject for a mutation that correlates with expression or activity of RhoB GTPase. In some cases, the method includes genotyping a gene selected from genes encoding a protein selected from a GTPase activating protein (GAP), a guanine nucleotide exchange factor (GEF), and a guanine nucleotide dissociation inhibitor (GDI), where the protein modulates RhoB GTPase.

The present invention provides a method for engineering T cells, comprising: a) preparing immune cells expressing a small amount of an additional (intrinsic) co-receptor; b) preparing a nucleic acid sequence encoding a γ9-T cell receptor chain and a nucleic acid sequence encoding a δ2-T cell receptor chain, wherein the γ9-T cell receptor chain and the δ2-T cell receptor chain selectively bind to CD277 when CD277 is in the J configuration; and c) introducing the nucleic acid sequence of step b) into T cells to obtain engineered T cells containing a γ9δ2 T cell receptor comprising the γ9-T cell receptor chain of step b) and the δ2-T cell receptor chain of step b).

The present invention further provides a method of screening target cells for genetic or epigenetic (epigenetic) mutations that result in lack of T cell receptor recognition, comprising: a) contacting a cell expressing a T cell receptor with a target cell; b) detecting a level of immune activation of the cell expressing the T cell receptor; c) identifying the target cell as one of i) having a genetic or epigenetic mutation if immune activation is below a threshold level, or ii) not having a genetic or epigenetic mutation if immune activation is above a threshold level; and d) comparing the target cell genotype to a control genotype to identify the genetic or epigenetic mutation if immune activation is below the threshold level.

In some embodiments, the target cell is a cancer cell. In some cases, the T cell receptor is a Vγ9Vδ2 T cell receptor. In some cases, detecting the level of immune activation comprises quantifying production of at least one cytokine by cells expressing the T cell receptor. In some embodiments, the cytokine is at least one of interferon-γ and TNFα. In some cases, the genetic or epigenetic variation is a single nucleotide polymorphism. In some cases, the zygosity of the target cell correlates with having the genetic or epigenetic variation or not having the genetic or epigenetic variation. In some cases, the method further comprises identifying a gene proximal to the genetic or epigenetic variation. In some cases, the gene is located within about 300,000 base pairs of the genetic or epigenetic variation.

In some embodiments, the method further comprises modulating expression of the gene and evaluating the effect of the modulation on the amount of immune activation of T cell receptor-expressing cells (cells expressing a T cell receptor). In some cases, the modulation comprises knocking out the gene. In some cases, the T cell receptor-expressing cells and the target cells are T cells. In some cases, the control genotype is the genotype of the control cells, where the control cells, upon contact with the T cell receptor-expressing cells, cause immune activation of the T cell receptor-expressing cells. In some cases, the immune activation of the T cell receptor-expressing cells is characterized by at least a two-fold increase in cytokine production or a similar functional readout. In some cases, the immune activation of the T cell receptor-expressing cells is characterized by at least a ten-fold increase in cytokine production or a similar functional readout. In some cases, the immune activation of the T cell receptor-expressing cells is characterized by at least a 100-fold increase in cytokine production or a similar functional readout. In some cases, the contacting comprises adding the T cell receptor-expressing cells and the control cells to the same vessel. In some cases, the contacting includes adding the T cell receptor-expressing cells and the control cells to the same container.

In some embodiments, the target cell is a B cell leukemia cell line. In some embodiments, the target cell is an Epstein-Barr virus transformed cell. In some embodiments, the genetic mutation is located in a gene that encodes a protein that regulates Rho GTPase. In some cases, the protein is a GTPase activating protein or a guanine nucleotide exchange factor. In some cases, the genetic mutation results in reduced or inhibited interaction of CD277 with RhoB GTPase.

The present invention provides a method comprising: a) screening a subject for a mutation in a gene encoding a protein, where the protein post-translationally regulates Rho GTPase in a target cell of the subject; and b) treating the subject with a Vγ9Vδ2 TCR+ T cell mediated therapy if the mutation does not reduce or inhibit formation of a J configuration in CD277. In some embodiments, the target cell is a cancer cell. In some embodiments, the target cell is a leukemia cell. In some aspects, the protein is a GTPase activating protein or a guanine nucleotide exchange factor. In some embodiments, the screening comprises genotyping the gene or a portion thereof. In some embodiments, the screening comprises a method selected from nucleic acid amplification, sequencing, and oligonucleotide probe hybridization.

The present invention provides a method for removing cancer cells in a subject in need of removal of the cancer cells, comprising: a) administering to the subject a substance that enhances the activity of RhoB GTPase in the cancer cells of the subject; and b) administering T cells that express a Vγ9Vδ2 T cell receptor. In some embodiments, the substance enhances translocation of RhoB GTPase to the cell membrane of the cancer cell. In some embodiments, the substance maintains RhoB GTPase at the cell membrane of the cancer cell. In some embodiments, the substance enhances translocation of RhoB GTPase from the nucleus of the cancer cell. In some embodiments, the substance enhances expression of a gene or transcript encoding RhoB GTPase. In some embodiments, the substance enhances the stability of RhoB GTPase. In some embodiments, the substance enhances the interaction of RhoB GTPase with CD277. In some embodiments, the substance activates RhoB GTPase. In some embodiments, the substance enhances the interaction of RhoB GTPase with GTP. In some embodiments, the substance reduces the interaction of RhoB GTPase with GDP.

In some cases, the agent increases the amount of GTP in the cancer cells. In some cases, the agent increases the availability of GTP in the cancer cells. In some cases, the agent is attached to a moiety that binds to a cell surface molecule on the cancer cells, thereby targeting the agent to the cancer cells. In some cases, the moiety comprises a small molecule compound. In some cases, the moiety comprises a peptide. In some cases, the moiety comprises an antibody or antigen-binding fragment. In some cases, the agent increases the amount of intracellular phosphoantigen in the cancer cells.

In some cases, the method includes administering an additional agent that increases the amount of intracellular phosphoantigen in the cancer cells. In some cases, the additional agent is a mevalonate pathway inhibitor. In some embodiments, the mevalonate pathway inhibitor is an aminobisphosphonate. In some embodiments, the aminobisphosphonate is at least one of pamidronate and zoledronate. In some cases, the subject has at least one of a solid cancer and a leukemia. In some cases, the leukemia is acute myeloid leukemia. In some cases, the subject has a mutation in a gene that results in decreased expression or activity of RhoB GTPase.

The present invention provides a method of eliminating cancer cells in a subject in need of elimination of the cancer cells, comprising administering to the subject an agent that enhances activity of RhoB GTPase in the cancer cells of the subject. In some cases, the method comprises administering to the subject a T cell. In some cases, the T cell expresses a Vγ9Vδ2 T cell receptor. In some cases, the T cell is engineered or genetically modified to express a Vγ9Vδ2 T cell receptor. In some cases, the T cell is engineered or genetically modified to overexpress a Vγ9Vδ2 T cell receptor.

The present invention provides a system comprising a polypeptide construct and a cytotoxic cell, wherein the polypeptide construct selectively binds to CD277 on a target cell when CD277 is complexed with RhoB GTPase on the target cell, and the polypeptide construct is expressed in an engineered cell.

The present invention further provides a method for identifying a locus associated with activation of a receptor in a target cell, the method comprising: a) identifying cells that induce a phenotype comprising said activation of a receptor in the target cell; b) identifying the zygosity of cells exhibiting said phenotype; c) obtaining genotypic information for said cells, wherein said genotypic information defines a genotype at each of a plurality of loci across a range of cells; and d) correlating the identified cellular zygosity with a genotype at one of the plurality of loci across the cells to identify the activated locus.

In some embodiments, the genotype information defines a single nucleotide polymorphism at each of a plurality of loci. In some cases, the receptor is a Vγ9Vδ2 T cell receptor or a fragment thereof. In some cases, the target cell is a cancer cell. In some cases, the target cell is a leukemia cell. In some cases, the phenotype is the production of IFNγ. In some cases, a gene is located proximal to at least one of the plurality of loci. In some cases, the activation of the receptor involves a polypeptide construct of the target cell that selectively binds to a J configuration of CD277 on cells of the cell type. In some cases, the J configuration correlates with an activation locus.

The present invention provides a method comprising: a) obtaining a target cell from a subject; b) contacting the target cell with at least one modified effector cell expressing an exogenous polypeptide construct; c) detecting a level of immune activation of the modified effector cell expressing the polypeptide construct; and d) identifying the target cell as having a nucleotide sequence polymorphism if the immune activation is above a threshold level.

In some cases, one or more of the target cells is a cancer cell. In some cases, the exogenous polypeptide construct comprises a Vγ9Vδ2 T cell receptor or a fragment thereof. In some cases, said detecting the level of immune activation comprises quantifying production of at least one cytokine by modified effector cells expressing the exogenous polypeptide construct. In some cases, the cytokine is interferon-γ. In some cases, the nucleotide sequence polymorphism is a single nucleotide polymorphism.

In some cases, the method further comprises identifying a gene proximal to the nucleotide sequence polymorphism. In some cases, the gene is located within about 300,000 base pairs of the nucleotide sequence polymorphism. In some embodiments, the method further comprises treating the subject with an effective amount of the exogenous polypeptide construct. In some cases, the modified effector cell expressing the polypeptide construct is a T cell. In some cases, contacting a target cell with at least one modified effector cell expressing an exogenous polypeptide construct comprises contacting a CD277 molecule on at least one surface of the target cell with the exogenous polypeptide construct. In some cases, the exogenous polypeptide construct selectively binds to a J configuration of a CD277 molecule.

The present invention provides a method comprising: a) obtaining a target cell from a subject that expresses CD277; b) contacting the target cell with a cell expressing an exogenous polypeptide construct that selectively binds to a J configuration of the CD277 molecule; and c) detecting recognition of the J configuration of the CD277 molecule by the polypeptide construct. In some embodiments, one or more of the target cells are cancer cells. In some cases, the polypeptide construct comprises a Vγ9Vδ2 T cell receptor or a fragment thereof. In some cases, detecting recognition of the J configuration of the CD277 molecule comprises quantifying production of at least one cytokine by cells expressing the polypeptide construct. In some cases, the cytokine is interferon-γ. In some cases, the method further comprises administering to the subject an effective amount of the polypeptide construct. In some cases, the cells expressing the polypeptide construct are T cells.

The present invention provides a method for predicting a positive therapeutic response in a subject to treatment with a polypeptide construct capable of recognizing CD277 or an engineered cell expressing the polypeptide construct, the method comprising: a) identifying a target cell of the patient as having a nucleotide sequence polymorphism associated with RhoB activity; and b) predicting the subject for a positive therapeutic response based on said identification of the target cell as having a nucleotide sequence polymorphism. In some embodiments, the polypeptide construct recognizes the J configuration of CD277 and binds thereto directly or indirectly via one or more additional biological factors.

In some embodiments, the method further comprises administering the polypeptide construct to a subject. In some embodiments, one or more of the target cells are cancer cells. In some cases, the nucleotide sequence polymorphism is a single nucleotide polymorphism. In some cases, the activity of RhoB is increased compared to RhoB activity in a subject lacking the nucleotide sequence polymorphism. In some cases, the method further comprises predicting a poor therapeutic response in a second subject based on identifying a target cell of the second subject as lacking the nucleotide sequence polymorphism.

The present invention provides a method comprising: a) obtaining a first set of cells from a first subject that express a CD277 molecule; b) identifying the first set of cells as having at least one of i) elevated RhoB activity relative to a second set of target cells obtained from a second subject and ii) a nucleotide sequence polymorphism associated with elevated RhoB activity; and c) administering to the first subject a polypeptide construct having selective affinity for a CD277 configuration on the first set of cells relative to a CD277 configuration on a second group of cells, or engineered cells expressing said polypeptide construct.

In some cases, one or more of the first group of cells are cancer cells. In some cases, one or more of the first group of cells are leukemia cells. In some cases, the CD277 configuration on the first set of cells is a J configuration. In some embodiments, the nucleotide sequence polymorphism is a single nucleotide polymorphism.

The present invention provides a method for predicting a positive therapeutic response in a subject to treatment with a polypeptide construct capable of recognizing a CS277 molecule or an engineered cell expressing the polypeptide construct, the method comprising: a) obtaining a target cell expressing a CD277 molecule from a subject; b) identifying the J configuration of the CD277 molecule expressed in the target cell; and c) predicting a subject that will show a positive therapeutic response based on said identification of the J configuration of the CD277 molecule.

In some cases, the method further comprises administering the polypeptide construct to the subject. In some cases, the method further comprises predicting a poor therapeutic response in the second subject based on identifying a CD277 molecule in a target cell of the second subject as lacking a J configuration. In some cases, one or more of the target cells are cancer cells. In some cases, the method further comprises identifying a nucleotide sequence polymorphism associated with activity of RhoB in the target cell. In some cases, the activity of RhoB is increased compared to RhoB activity in a subject lacking the nucleotide sequence polymorphism. In some cases, the nucleotide sequence polymorphism is a single nucleotide polymorphism. In some embodiments, the prediction is based on both the identification of a J configuration of a CD277 molecule and the identification of a nucleotide sequence polymorphism.

The present invention provides a method for treating cancer in a subject having cancer cells that are CD277 positive, comprising administering to the subject an effective amount of a pharmaceutical composition comprising a pharma- ceutically acceptable substance that selectively binds, directly or indirectly via one or more additional biological agents, to a J configuration or J confirmation of CD277 on the cancer cells. In some embodiments, the pharma- ceutically acceptable substance comprises a polypeptide construct that selectively binds to a J configuration of CD277 on the cancer cells. In some embodiments, the polypeptide construct comprises at least one of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence. In some embodiments, the polypeptide construct comprises at least one variant or fragment of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence. In some cases, the gamma-TCR polypeptide sequence is a gamma9-TCR polypeptide sequence or a fragment thereof. In some cases, the delta-TCR polypeptide sequence is a delta2-TCR polypeptide sequence or a fragment thereof.

In some cases, the pharma- ceutically acceptable substance binds to the J-configuration of CD277, either directly or indirectly via one or more additional biological agents, with high selectivity relative to CD277 molecules that are not in the J-configuration. In some embodiments, the target cell is a cancer cell. In some embodiments, the target cell is a leukemia cell. In some cases, CD277 exists as a dimer.

The features of the present invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments in which the principles of the present disclosure are utilized and the accompanying drawings.

DETAILED DESCRIPTION OF THE PRESENT EMBODIMENT In one aspect, the present invention provides T cells that induce a robust anti-tumor response. The anti-tumor response may be brought about by binding of immune cells expressing a receptor, such as γ9δ2 TCR, to a target, such as a tumor cell. Binding of tumor cells to immune cells may be enhanced by improving receptor-target interactions. In one aspect, the present invention provides compositions and methods for enhancing binding of immune cells expressing γ9δ2 TCR to a target. In one aspect, the method may include enhancing activity of RhoB GTPase. In one aspect, the method may include enhancing activity (e.g., accumulation) of phosphoantigens. RhoB GTPase and phosphoantigens are involved in enhancing expression of CD277 on the surface of tumor cells, thereby improving or enabling interaction of tumor cells expressing CD277 with immune cells containing γ9δ2 TCR. In one embodiment, the present invention provides a method comprising improving inside-out signaling of a tumor cell, thereby allowing it to be recognized by immune cells. In one embodiment, the present invention provides an agent that enhances inside-out signaling of a tumor cell by enhancing expression of CD277 on the surface. The agent may act directly or indirectly on CD277. Expression of CD277 may be enhanced by stimulating phosphoantigens and RhoB GTPase in tumor cells. In one embodiment, the agent may act directly or indirectly on RhoB GTPase. In one embodiment, the agent may act directly or indirectly on phosphoantigens. In one embodiment, an agent that may enhance the activity of RhoB GTPase, phosphoantigens, or a combination thereof may act indirectly or directly. In one embodiment, a substance capable of enhancing the activity of RhoB GTPase, phosphoantigen or a combination thereof can bind to a secondary factor, which can enhance the activity of RhoB GTPase and/or phosphoantigen. In one embodiment, a substance capable of enhancing the activity of RhoB GTPase, phosphoantigen or a combination thereof can bind to several upstream factors, which can enhance the activity of RhoB GTPase and/or phosphoantigen. In one embodiment, up to 10 factors upstream of RhoB GTPase or phosphoantigen can be stimulated, and the activity of RhoB GTPase and/or phosphoantigen is enhanced.

In one embodiment, the present invention provides a composition comprising immune cells comprising a γ9δ2 TCR and an agent that enhances the activity of RhoB GTPase and phosphoantigens. In one embodiment, the γ9δ2 TCR-mediated response can be enhanced by an agent such as pamidronate or by the expression of additional adhesion agents. In some embodiments, activation can be followed by recognition of a target, such as a cancer cell expressing CD277. Target recognition can be brought about by the CDR3 region of the γ9δ2 TCR and by changes in the location of CD277. In some embodiments, T cell activation can utilize membrane flexibility to form a synapse involving the T cell and the tumor cell. In some embodiments, T cell activation can include microclustering of CD277 at the cell membrane upon interaction of the γ9δ2 TCR.

All terms are intended to be understood as they would be understood by one of ordinary skill in the art. Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.

The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described.

Although various features of the invention may be described in the context of a single embodiment, those features may also be described separately or in any suitable combination. Conversely, although the invention may, for clarity, be described herein in the context of separate embodiments, the invention may also be practiced in a single embodiment.

The following definitions are complementary to those in the art and relate to this application and should not be imputed to any related or unrelated entity (e.g., any co-owned patents or applications). Although any methods and materials similar or equivalent to those described herein can be used in carrying out the tests of the present disclosure, the preferred materials and methods are described herein. Thus, the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

In this application, the use of the singular includes the plural unless otherwise indicated. It should be noted that singular expressions used herein include plural referents unless the context clearly indicates differently. In this application, the use of "or" means "and/or" unless otherwise indicated. Furthermore, the use of the word "comprises" and other forms such as "includes," "including," and "including" is not limiting.

As used herein, the term "autologous" and its grammatical equivalents can mean derived from the same thing. For example, a sample (e.g., cells) can be removed, processed, and later returned to the same subject (e.g., patient). Autologous processes are distinguished from allogeneic processes, in which the donor and recipient are different subjects.

As used herein, "activation" and its grammatical equivalents may refer to the process by which a cell transitions from a resting state to an active state. This process may include responding to antigen, migration, and/or phenotypic or genetic changes to a functionally active state. For example, the term "activation" may refer to the stepwise process of T cell activation. For example, T cells may require at least two signals to become fully activated. The first signal may occur after engagement of the TCR with the antigen-MHC complex. The second signal may occur through engagement of a costimulatory molecule. In vitro, anti-CD3 can mimic the first signal, and anti-CD28 can mimic the second signal.

References herein to "some embodiments," "embodiments," "one embodiment," or "other embodiments" mean that the particular feature, structure, or characteristic described in connection with the embodiment is included in at least some embodiments, but not necessarily in all embodiments of the invention.

As used herein and in the claims, the words "comprise" (and any form of include, such as "comprises" and "includes"), "have" (and any form of have, such as "have" and "has"), "include" (and any form of include, such as "includes" and "included"), or "contain" (and any form of contain, such as "contains" and "contained") are inclusive or open ended and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment described herein can be implemented with respect to any method or composition of the invention, and vice versa. Additionally, the compositions of the invention can be used to accomplish the methods of the invention.

As used herein, the term "about" in reference to a reference numerical value and its grammatical equivalents may include the numerical value itself and a range of values above and below (plus or minus) 10% of that numerical value. For example, the amount "about 10" includes 10 and any amount between 9 and 11. For example, the term "about" in reference to a reference numerical value may also include a range of values above and below (plus or minus) 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of that value.

As used herein, the term "cytotoxicity" may refer to an unintended or undesired change in the normal state of a cell. The normal state of a cell may refer to the state that appears or exists before the cell is exposed to a cytotoxic composition, agent and/or condition. Generally, a cell in a normal state is a cell in a homeostatic state. The unintended or undesired change in the normal state of a cell may be manifested, for example, in the form of cell death (e.g., programmed cell death), reduced replicative capacity, reduced cell integrity (e.g., membrane integrity), reduced metabolic activity, reduced developmental capacity, or any of the cytotoxic effects disclosed in this application.

"Isolated" means that the nucleic acid is removed from its natural environment. "Purified" means that a given nucleic acid is increased in purity, regardless of whether it is removed from the natural state (including genomic DNA and mRNA) or synthesized (including cDNA) and/or amplified under laboratory conditions, where "purity" is a relative term rather than "absolute purity." However, it should be understood that nucleic acids and proteins can be formulated with diluents or adjuvants and still be, for practical purposes, isolated. For example, nucleic acids are typically mixed with an acceptable carrier or diluent when used for introduction into a cell.

As used herein, "percent identity" refers to the percentage of amino acid (or nucleic acid) residues in a candidate sequence that are identical to amino acid (or nucleic acid) residues in a reference sequence after aligning the sequences and introducing gaps, if necessary, to obtain maximum percent identity (i.e., gaps can be introduced in one or both of the candidate and reference sequences for optimal alignment, and non-homologous sequences can be ignored for comparison purposes). Alignment for purposes of determining percent identity can be accomplished in a variety of ways within the skill of the art, for example, using publicly available computer software such as BLAST, ALIGN, or Megalign (DNASTAR) software. The percent identity of two sequences can be calculated by aligning a test sequence with a comparison sequence using BLAST, determining the number of amino acids or nucleotides in the aligned test sequence that are identical to amino acids or nucleotides at the same positions in the comparison sequence, and dividing the number of identical amino acids or nucleotides by the number of amino acids or nucleotides in the comparison sequence.

As used herein, the term "peripheral blood lymphocytes" (PBLs) and its grammatical equivalents may refer to lymphocytes that circulate in the blood (e.g., peripheral blood). Peripheral blood lymphocytes may refer to lymphocytes that are not localized to an organ. Peripheral blood lymphocytes may include T cells, NK cells, B cells, or any combination thereof.

As used herein, the term "phenotype" and its grammatical equivalents can refer to the complex of observable characteristics or traits of an organism, such as the organism's morphological characteristics, development, biochemical or physiological properties, phenology, behavior, and behavioral outcomes. Depending on the context, the term "phenotype" can sometimes refer to the complex of observable characteristics or traits of a population.

As used herein, "polynucleotide" or "oligonucleotide" refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. The term refers only to the primary structure of the molecule. Thus, the term includes double- and single-stranded DNA, triple-stranded DNA, and double- and single-stranded RNA. It also includes modified forms of polynucleotides, for example, by methylation and/or capping, as well as unmodified forms of polynucleotides. The term is also intended to include molecules that contain non-naturally occurring or synthetic nucleotides and nucleotide analogs.

As used herein, the term "peripheral blood lymphocytes" (PBLs) and its grammatical equivalents may refer to lymphocytes that circulate in the blood (e.g., peripheral blood). Peripheral blood lymphocytes may refer to lymphocytes that are not localized to an organ. Peripheral blood lymphocytes may include T cells, NK cells, B cells, or any combination thereof.

"Polypeptide" is used interchangeably with "one or more polypeptides" and "protein" and refers to a polymer of amino acid residues. A "mature protein" is a full-length protein that may include glycosylation or other modifications typical of proteins in a given cellular environment.

Nucleic acids and/or nucleic acid sequences are said to be "homologous" if they are derived, naturally or artificially, from a common ancestral nucleic acid or nucleic acid sequence. Proteins and/or protein sequences are said to be homologous if their coding DNA is derived, naturally or artificially, from a common ancestral nucleic acid or nucleic acid sequence. Homologous molecules may be referred to as homologs. For example, any naturally occurring protein described herein may be modified by any available mutagenesis method. This mutagenized nucleic acid, when expressed, encodes a polypeptide that is homologous to the protein encoded by the original nucleic acid. Homology is generally inferred from the sequence identity between two or more nucleic acids or proteins (or sequences thereof). The exact percentage of identity between sequences useful for establishing homology varies depending on the nucleic acid and protein in question, but no more than 25% sequence identity is typically used to establish homology. Higher levels of sequence identity, such as 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more sequence identity, can also be used to establish homology.

The term "identical" or "sequence identity" in the context of two nucleic acid sequences or amino acid sequences of a polypeptide refers to residues in those two sequences that are identical when aligned for maximum matching over a particular comparison window. In one class of embodiments, the polypeptides herein are at least 80%, 85%, 90%, 98%, 99% or 100% identical to a reference polypeptide or a fragment thereof, for example, as measured by BLASTP (or CLUSTAL or any other available alignment software) using default parameters. Similarly, nucleic acids can be described based on the starting nucleic acid. For example, they can be 50%, 60%, 70%, 75%, 80%, 85%, 90%, 98%, 99% or 100% identical to a reference nucleic acid or a fragment thereof, as measured by BLASTN (or CLUSTAL or any other available alignment software) using default parameters. When a molecule is described as having a certain percentage of sequence identity to a larger molecule, it means that when the two molecules are optimally aligned, that percentage of residues in the smaller molecule are found in matching residues in the larger molecule, according to the order in which the two molecules are optimally aligned.

As used herein, the term "T cell" and its grammatical equivalents may refer to a T cell from any source. For example, the T cell may be a primary T cell, e.g., an autologous T cell, a cell line, etc. Also, the T cell may be a human T cell or a non-human T cell.

As used herein, the term "TIL" or tumor infiltrating lymphocytes and its grammatical equivalents may refer to cells isolated from a tumor. For example, TILs may be cells that have migrated to a tumor. TILs may also be cells that have infiltrated a tumor. TILs may be any cell found within a tumor. For example, TILs may be T cells, B cells, monocytes, natural killer (NK) cells, or any combination thereof. TILs may be a mixed population of cells. A population of TILs may include cells of different phenotypes, different degrees of differentiation, different lineages, or any combination thereof.

A "transposon" or "transposable element" (TE) is a vector DNA sequence that changes its position in the genome, sometimes generating or reversing mutations and potentially changing the genome size of a cell. Transposition often results in the duplication of the TE. Class I TEs are copied in two steps. First, they are transcribed from DNA to RNA, and then the resulting RNA is reverse transcribed into DNA. This copied DNA is inserted into the new location in the genome. The reverse transcription step is catalyzed by a reverse transcriptase enzyme that may be encoded by the TE itself. The characteristics of retrotransposons are similar to retroviruses such as HIV. The cut-and-paste transposition mechanism of class II TEs does not involve an RNA intermediate. Transposition is catalyzed by several transposase enzymes. Some transposases bind nonspecifically to any target site in DNA, while others bind to specific DNA sequence targets. The transposase creates staggered cuts at the target site to generate single-stranded 5' or 3' DNA overhangs (sticky ends). This step excises the DNA transposon, which is then ligated to a new target site. This process involves the activity of DNA polymerase to fill the gap and DNA ligase to close the sugar-phosphate backbone. This results in the duplication of the target site. The insertion site of the DNA transposon can be specified by a short direct repeat that can be generated by staggered cuts in the target DNA and filled in by DNA polymerase, followed by a series of inverted repeats that are important for TE excision by the transposase. The cut-and-paste TE can be duplicated when transposition of the cut-and-paste TE occurs during the S phase of the cell cycle, when the donor site has already been duplicated but the target site has not yet been duplicated. In both class I and class II TEs, transposition can be classified as either "autonomous" or "non-autonomous." Autonomous TEs can move on their own, whereas non-autonomous TEs require the presence of another TE in order to move. This is because non-autonomous TEs often lack transposases (in the case of class II) or reverse transcriptases (in the case of class I).

"Transposase" refers to an enzyme that binds to the ends of a transposon and catalyzes the movement of the transposon to another site in the genome by a cut-and-paste mechanism or a replicative transposition mechanism. In some embodiments, the catalytic activity of a transposase can be used to move a gene from a vector into the genome.

The nucleic acid sequences and vectors disclosed or contemplated herein may be introduced into a cell by "transfection," "transformation," "nucleofection," or "transduction." As used herein, "transfection," "transformation," or "transduction" refers to the introduction of one or more exogenous polynucleotides into a host cell using physical or chemical methods. A number of transfection techniques are known in the art, including, for example, calcium phosphate DNA co-precipitation (see, e.g., Murray E. J. (ed.), Methods in Molecular Biology, Vol. 7, Gene Transfer and Expression Protocols, Humana Press (1991)), DEAE-dextran, electroporation, cationic liposome-mediated transfection, tungsten particle-facilitated microbombardment (Johnston, Nature, 346:776-777 (1990)), and strontium phosphate DNA co-precipitation (Brash et al., Mol. Cell, 2001, 144: 1111-1112 (1996)). Biol., 7:2031-2034 (1987)), and nucleofection (Trompeter et al., J. Immunol. Methods 274:245-256 (2003)). After propagation of the infectious particles in suitable packaging cells, many of which are commercially available, the phage or viral vector can be introduced into the host cell.

"Promoter" refers to a region of a polynucleotide that initiates transcription of a coding sequence. A promoter is located on the same strand of DNA upstream (relative to the 5' region of the sense strand) near the transcription start site of a gene. Some promoters are constitutive, which means they are active under all circumstances in a cell, while others are regulated, e.g., inducible promoters, so that they become active in response to a particular stimulus.

The term "promoter activity" refers to the degree of expression of a nucleotide sequence operably linked to a promoter whose activity is being measured. Promoter activity can be measured directly by determining the amount of RNA transcript produced, for example by Northern blot analysis, or indirectly by determining the amount of a product encoded by a linked nucleic acid sequence, such as a reporter nucleic acid sequence linked to the promoter.

As used herein, "inducible promoter" refers to a promoter that is induced to an active state by the presence or absence of a transcriptional regulator, e.g., a biotic or abiotic factor. Inducible promoters are useful because they can enable or disable expression of a gene operably linked to them at certain stages of the development of an organism or in specific tissues. Examples of inducible promoters include alcohol-regulated promoters, tetracycline-regulated promoters, steroid-regulated promoters, metal-regulated promoters, pathogenesis-regulated promoters, temperature-regulated promoters, and light-regulated promoters. In one embodiment, the inducible promoter is part of a genetic switch.

The term "enhancer" as used herein refers to, for example, a DNA sequence that enhances the transcription of a nucleic acid sequence to which it is operably linked. Enhancers can be located several kilobases away from the coding region of a nucleic acid sequence and can result in binding of regulatory factors, changes in patterns of DNA methylation or DNA structure. Many enhancers from a wide variety of sources are well known in the art and are available as or within cloned polynucleotides (e.g., from depositories such as the ATCC and other commercial or private sources). Many polynucleotides that contain a promoter (e.g., the commonly used CMV promoter) also contain enhancer sequences. Enhancers can be located upstream, internal or downstream of a coding sequence. The term "Ig enhancer" refers to an enhancer element derived from an enhancer region mapped within the immunoglobulin (Ig) locus [such enhancers include, for example, the heavy chain (mu) 5' enhancer, the light chain (kappa) 5' enhancer, the kappa and mu intronic enhancers, and the 3' enhancer] (see generally, Paul W.E. (ed.), Fundamental Immunology, 3rd Edition, Raven Press, New York (1993), pp. 353-363; and U.S. Patent No. 5,885,827).

As used herein, "coding sequence" refers to a segment of a polynucleotide that encodes a polypeptide. The region or sequence is bounded by a start codon near the 5' end and a stop codon near the 3' end. A coding sequence may also be referred to as an open reading frame.

As used herein, "operably linked" means that a DNA segment is physically and/or functionally linked to another DNA segment such that the segments function in their intended manner. A DNA sequence encoding a gene product is operably linked to a regulatory sequence when it is directly or indirectly linked to the regulatory sequence, e.g., a promoter, enhancer, and/or silencer, in a manner that allows for regulation of transcription of the DNA sequence. For example, a DNA sequence is operably linked to a promoter when it is linked to the promoter downstream of the transcription start site in the correct reading frame relative to the transcription start site, and transcriptional elongation proceeds across the DNA sequence. An enhancer or silencer is operably linked to a DNA sequence encoding a gene product when it is linked to the DNA sequence in such a way that it enhances or reduces, respectively, the transcription of the DNA sequence. Enhancers and silencers can be located upstream, downstream, or embedded within the coding region of a DNA sequence. A signal sequence DNA is said to be operably linked to a DNA encoding a polypeptide if the signal sequence is expressed as a preprotein that participates in the secretion of the polypeptide. Linking of a DNA sequence to a regulatory sequence is typically accomplished by ligation at an appropriate restriction site or via an adapter or linker inserted within the sequence using a restriction endonuclease known to those skilled in the art.

The term "transcriptional regulator" refers to a biochemical element that acts under certain environmental conditions to prevent or suppress transcription of a promoter-driven DNA sequence (e.g., a repressor or nuclear inhibitory protein) or to permit or stimulate transcription of a promoter-driven DNA sequence (e.g., an inducer or enhancer).

The term "induction" refers to the enhancement of transcription, promoter activity and/or expression of a nucleic acid sequence relative to some basal transcription level, brought about by a transcriptional regulator.

"Target" gene or "heterologous" gene or "gene of interest (GOI)" refers to a gene that is introduced into a host cell by gene transfer. In some cases, the polypeptide constructs described herein are encoded as one or more heterologous genes in an engineered cell.

As used herein, "recombinase" refers to a group of enzymes that can facilitate site-specific recombination between defined sites, where the sites are physically separated on a single DNA molecule, or where the sites are present on separate DNA molecules. The DNA sequences of the defined recombination sites are not necessarily identical. Initiation of recombination depends on protein-DNA interactions, and within the group are numerous proteins that catalyze phage integration and excision (e.g., λ integrase, φC31), resolution of circular plasmids (e.g., Tn3, gamma delta, Cre, Flp), DNA inversion for expression of alternative genes (e.g., Hin, Gin, Pin), assembly of nascent genes (e.g., Anabaena nitrogen fixation genes), and transposition (e.g., IS607 transposon). Most site-specific recombinases are classified into one of two families based on evolutionary and mechanistic relatedness. These are the λ integrase family or tyrosine recombinases (e.g., Cre, Flp, Xer D) and the resolvase/integrase family or serine recombinase family (e.g., φC31, TP901-1, Tn3, gamma delta).

A "recombination attachment site" is a specific polynucleotide sequence recognized by a recombinase enzyme described herein. Typically, two different sites are involved (termed "complementary sites"), one present on the target nucleic acid (e.g., a eukaryotic or prokaryotic chromosome or episome) and one present on the nucleic acid to be integrated into the target recombination site. As used herein, the terms "attB" and "attP" refer to the attachment (or recombination) sites originally derived from the bacterial target and phage donor, respectively, although the recombination sites of individual enzymes may have different names. Recombination sites typically include a left arm and a right arm separated by a core or spacer region. Thus, an attB recombination site consists of BOB', where B and B' are the left and right arms, respectively, and O is the core region. Similarly, attP is POP', where P and P' are the arms, and O is also the core region. After recombination between the attB and attP sites, and concomitant integration of the nucleic acid in the target, the recombination sites flanking the integrated DNA are designated "attL" and "attR". Thus, using the above terminology, the attL and attR sites consist of BOP' and POB', respectively. In some expressions herein, the "O" is omitted, e.g., attB and attP are designated BB' and PP', respectively.

As used herein, the term "CRISPR" refers to a caspase-based endonuclease, including a guide RNA that hybridizes to a recognition site in genomic DNA to direct the caspase to cleave DNA, and a caspase such as Cas9.

As used herein, the term "distressed cell" or "stressed cell" refers to a cell that exhibits a disease or disorder state. Manifestations of distress can include any change in cellular function compared to normal or non-stressed conditions, such as changes in gene transcription or translation, post-transcriptional or post-translational modifications, protein or enzyme activity, conformation of a polypeptide, cell adhesion, cell surface properties, and the ability to recognize or be recognized by other cells. In some embodiments, the particular phenotype of a distressed cell (e.g., an altered pattern of gene expression) is associated with an intracellular abnormality, such as a genetic mutation. In other embodiments, the phenotype of a distressed cell is associated with an abnormality or stressor in the extracellular environment. One example of a distressed cell is a tumor cell. In certain embodiments, a distressed cell can be characterized by the translocation of RhoB to the cell membrane. In some cases, a distressed cell is characterized by the presence of the J configuration of CD277 on the cell surface.

As used herein, "epigenetic change" or "epigenetic modification" refers to any covalent or non-covalent modification of DNA other than a change in the DNA sequence. In certain embodiments, the epigenetic change affects or alters the regulation and/or expression of one or more genes. It is contemplated that the epigenetic change may affect the regulation of genes that are relatively proximal (e.g., within 1 Mbp) to the chromosomal site of the epigenetic modification, or that are distal (e.g., more than 1 Mbp away along the same chromosome or on a different chromosome) to the site of the epigenetic modification. Non-limiting examples of epigenetic changes include DNA methylation and hydroxymethylation, histone modifications such as lysine acetylation, lysine and arginine methylation, serine and threonine phosphorylation, and lysine ubiquitination and sumoylation, and changes in chromatin structure.

In one embodiment, provided may be a composition comprising γδ T cells. γδ T may be a specialized T cell population expressing a γδ T cell receptor. γδ T may combine TCR-enforced specificity with broad non-HLA-restricted anti-tumor reactivity, which may open new avenues in cancer immunotherapy. For example, detection of tumor-infiltrating γδ T cells has been associated with positive clinical outcomes in cancer patients. In one embodiment, γδ T cells may participate in early cancer immune surveillance. In one embodiment, γδ T may be heterogeneous with respect to function and receptor expression. In one embodiment, γδ TCR may be introduced into an immune cell. For example, γδ TCR may be introduced into an αβ T cell. In one embodiment, a method comprising introducing γδ TCR into an immune cell, such as an αβ T cell, may improve the durability of γδ TCR-based therapy. In one embodiment, a method involving the introduction of γδ TCR into immune cells such as αβ T cells can improve the spread of γδ TCR-based therapeutics. In one embodiment, a method involving the introduction of γδ TCR into immune cells such as αβ T cells can overcome clonal heterogeneity of tumor cells in patients with advanced cancer, which represents an improvement over αβ TCR-based approaches. In one embodiment, this improvement can be due to a distinct HLA-independent activation stimulus of γδ TCR, such as a change in lipid metabolism. In one embodiment, a γδ TCR therapeutic can be administered to a subject with a cancer that has a low mutational load.

In one embodiment, the present invention provides a γδTCR therapeutic agent that binds to a target, such as CD277 on a cancer cell. Binding of the γδTCR therapeutic agent can include a spatial and/or conformational change in CD277 expressed on the target. In one embodiment, binding can refer to a direct interaction. In one embodiment, binding can refer to an indirect interaction. Binding can refer to an agent that binds upstream of CD277. In one embodiment, an agent that binds upstream of CD277 can bind about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 factor away from CD277. In some embodiments, the sequence of events that leads to an activated state of CD277, referred to as the J configuration of CD277 or CD277J, can induce TCR-dependent γ9δ2 T cell activation.

In one embodiment, diversity in the CDR3 region of γ9δ2 TCR may contribute to functional heterogeneity and expression of additional co-receptors within the γ9δ2 T cell population. In one embodiment, functional heterogeneity within the γ9δ2 T cell population may result from different phenotypic and transcriptional profiles. In one embodiment, there may be different activation threshold clonal levels contained within the diverse γ9δ2 T cell repertoire against tumor cells. Expression of γδ TCR in αβ T cells may result in variation in the function of γ9δ2 T cell clones. In some embodiments, this variation may not only correlate with the functional avidity provided by the different γ9δ2 TCR. In one embodiment, there may be a low affinity interaction of γ9δ2 TCR with CD277J. In one embodiment, there may be an initial scanning mode of γδ TCR for its target. This initial scanning may be CDR3 dependent and may utilize other contact residues of γδ TCR. In one embodiment, the scan may also utilize pamidronate-inducible adhesion molecules. After the scan mode, CDR3-dependent homolog recognition may be performed, which may utilize the high density recruitment and membrane flexibility of the γ9δ2 TCR during synapse formation, allowing sensing of nanoclusters consisting of CD277J configurations and possible additional membrane molecules on the target side. In one embodiment, the TCR may comprise a percentage of identity of about 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or up to about 100% to the sequences in Table 4. In one embodiment, the γ9δ2 may comprise a percentage of identity of about 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or up to about 100% to the sequences in Table 4. In one embodiment, γ9δ2 can be obtained using a sequence contained in Table 3, or using a sequence that contains about 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or up to about 100% percent identity to a sequence in Table 3.

In one embodiment, a comparison of γδ TCR repertoire diversity between naive cord blood-derived γδ T cells and γδ T cells isolated from peripheral blood of healthy adults may indicate preferential expansion of selected clonotypes. In one embodiment, repertoire skewing towards a few predominant clonotypes may suggest a functional advantage. In one embodiment, there may be no correlation between clonotype frequency and antitumor functional potential of each clone. In one embodiment, repertoire focusing, which occurs in parallel with the acquisition of distinct phenotypic profiles, may reflect the T cell antigen stimulation history of an individual, rather than the in vitro potency of the selected clone. In one embodiment, other receptors besides γ9δ2 TCR may be involved in the induction of tolerance of γ9δ2 T cell clones.

In one embodiment, γ9δ2 TCR obtained from outside the environment of the parental clone can be used to target malignancies very efficiently. In one embodiment, the affinity of the γ9δ2 TCR can be determinative of the activation potency of the αβ TCR when expressed in the same background. In one embodiment, there can be substantial differences in activation potency as measured by γ9δ2 TCR-mediated functional avidity that may not correlate with the intrinsic potency of the parental γδ T cell clone.

In one embodiment, the affinity of the γ9δ2 TCR can be in a range lower than that of the αβ TCR. For example, this can be done by achieving detectable TCR binding only to increasing valency of γ9δ2 TCR multimers to the size of YG beads containing more than 10 γ9δ2 TCRs on the bead surface. In one embodiment, once sufficient interaction avidity is achieved, the difference in binding affinity between individual γ9δ2 TCRs can be significant. In one embodiment, a direct interaction between the extracellular CD277 domain and the γ9δ2 TCR can occur.

In one embodiment, CD277 may undergo spatial and conformational changes. In one embodiment, γ9δ2 TCR may participate in fluid cell membrane interactions with CD277, which may generate higher local density and stabilize cell-cell interactions. In one embodiment, pamidronate stimulation of cancer cells may result in upregulation of adhesion molecules on cancer cells, enhancing cell-cell contacts and stabilizing synapses, resulting in stabilized avidity. In one embodiment, the CDR3 region of γ9δ2 TCR may participate in the recruitment of CD277-expressing cancer cells to synapses. In one embodiment, the agents provided herein may directly or indirectly induce spatial and conformational changes in CD277.

In one embodiment, there may be an increase in BTN3A1 cluster size and a decrease in cluster density. In one embodiment, the change in cluster density creates more space for additional proteins within the BTN3A cluster. In one embodiment, about 10%, 20%, 30%, 40%, 50%, 60% or more of the cluster surface may be occupied by BTN3A dimers. In one embodiment, there may be engagement of additional factors that migrate to the CD277 synapse and a conformational change in CD277 that is regulated via RhoB.

In one embodiment, functional diversity and "repertoire focusing" of γ9δ2 T cells can occur. Vector.

A polynucleotide encoding a polypeptide construct that selectively binds to the J-configuration of CD277, either directly or indirectly through one or more additional biological factors, may be incorporated into a vector as described herein. An "expression vector" or "vector" is any genetic element, e.g., a plasmid, chromosome, virus, transposon, that behaves as an autonomous unit of polynucleotide replication in a cell (i.e., capable of replicating under its own control) or is rendered replicable by insertion into a cellular chromosome, to which another polynucleotide segment is attached, resulting in the replication and/or expression of the attached segment. Suitable vectors include, but are not limited to, plasmids, transposons, bacteriophages, and cosmids. A vector may contain polynucleotide sequences necessary to effect ligation of the vector or insertion of the vector into a desired host cell and to effect expression of the attached segment. Such sequences will vary depending on the host organism. They include promoter sequences to effect transcription, enhancer sequences to enhance transcription, ribosome binding site sequences, and transcription and translation termination sequences. Alternatively, an expression vector may be capable of directly expressing a nucleic acid sequence product encoded therein, without ligation or integration of the vector into a host cell DNA sequence.

The vector may also contain a "selection marker gene." As used herein, the term "selection marker gene" refers to a nucleic acid sequence that allows cells expressing the nucleic acid sequence to be specifically selected in the presence of a corresponding selection agent. Suitable selection marker genes are known in the art and are described, for example, in International Patent Application Publications WO 1992/08796 and WO 1994/28143; Wigler et al., Proc. Natl. Acad. Sci. USA, 77:3567 (1980); O'Hare et al., Proc. Natl. Acad. Sci. USA, 78:1527 (1981); Mulligan & Berg, Proc. Natl. Acad. Sci. USA, 78:1527 (1981); USA, 78:2072 (1981); Colberre-Garapin et al., J. Mol. Biol., 150:1 (1981); Santerre et al., Gene, 30:147 (1984); Kent et al., Science, 237:901-903 (1987); Wigler et al., Cell, 11:223 (1977); Szybalska & Szybalski, Proc. Natl. Acad. Sci. USA, 48:2026 (1962); Lowy et al., Cell, 22:817 (1980); and U.S. Patent Nos. 5,122,464 and 5,770,359.

In some embodiments, the vector is an "episomal expression vector" or "episome," which is replicable in a host cell and persists as an extrachromosomal segment of DNA in the host cell under appropriate selective pressure (see, e.g., Conese et al., Gene Therapy, 11:1735-1742 (2004)). Exemplary commercially available episomal expression vectors include, but are not limited to, episomal plasmids that utilize the Epstein-Barr nuclear antigen 1 (EBNA1) and Epstein-Barr virus (EBV) origin of replication (oriP). The vectors pREP4, pCEP4, pREP7, and pcDNA3.1 from Invitrogen (Carlsbad, Calif.) and pBK-CMV from Stratagene (La Jolla, Calif.) are non-limiting examples of episomal vectors that use T antigen and the SV40 origin of replication instead of EBNA1 and oriP.

Vector Modifications Polynucleotide vectors useful in the methods and compositions described herein can be Good Manufacturing Practice (GMP) compliant vectors. For example, GMP vectors can be of higher purity than non-GMP vectors. In some cases, purity can be measured by bioburden. For example, bioburden can be the presence or absence of aerobes, anaerobes, spore-forming bacteria, fungi, or combinations thereof in the vector composition. In some cases, a pure vector can be low or endotoxin-free. Purity can also be measured by double-stranded primer walking sequencing. Purity of the vector can be determined based on plasmid identity. GMP vectors of the present invention can have a purity 10% to 99% higher than non-GMP vectors. A GMP vector can have a purity that is 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% greater than a non-GMP vector as measured by bioburden, presence of endotoxin, sequencing or a combination thereof.

In some cases, a terminator sequence at the end of the first gene program is used. The terminator sequence may ensure that the transcript is terminated before initiating the second gene program. For example, the expression vector may contain sequences necessary for the termination of transcription and stabilization of the mRNA. Such sequences are commonly available from the 5' and sometimes 3' untranslated regions of eukaryotic or viral DNA or cDNA. These regions may contain nucleotide segments that are transcribed as polyadenylated fragments in the untranslated portion of the mRNA. Cells containing the expression vector are grown under conditions that result in expression of the desired polypeptide, either in vivo or in vitro.

In some cases, a spacer sequence may be used at the end of a first polypeptide encoded by a polynucleotide in a vector. In other cases, a spacer sequence may be used at the end of a second gene in a vector. A spacer sequence may also be used after the first and second genes in a vector.

These vectors can be used to express a polypeptide encoded by a gene or by a portion of a gene of interest. The portion or portions of the gene can be inserted using any method, viral or non-viral. For example, the method can be a non-viral based technique.

Linkers In some embodiments, polynucleotide linkers may be used in the polynucleotides encoding the polypeptide constructs described herein. Polynucleotide linkers may be double-stranded segments of DNA containing desired restriction sites that can be added to obtain a terminal structure compatible with vectors containing the polynucleotides described herein. In some cases, polynucleotide linkers may be useful for modifying vectors containing the polynucleotides described herein. For example, vector modifications including polynucleotide linkers may be changes in the multiple cloning site or addition of a polyhistidine tail. Polynucleotide linkers may also be used to adapt the ends of blunt insert DNA for cloning into restriction enzyme-cleaved vectors with sticky ends. The use of polynucleotide linkers may be more efficient than blunt ligation into vectors and provide a method for the release of inserts from vectors in downstream applications. In some cases, the insert may be a polynucleotide sequence encoding a polypeptide useful for therapeutic applications.

The polynucleotide linker may be an oligomer. The polynucleotide linker may be double stranded, single stranded, or a combination thereof. In some cases, the linker may be RNA. The polynucleotide linker may be ligated to a vector comprising a polynucleotide described herein, in some cases by T4 ligase. To facilitate ligation, an excess of polynucleotide linker may be added to a composition comprising an insert and vector. In some cases, the insert and vector are pretreated prior to introducing the linker. For example, pretreatment with methylase may prevent undesired cleavage of the insert DNA.

In some embodiments, linkers may be used in the polynucleotides described herein. The linkers may be flexible linkers, rigid linkers, in vivo cleavable linkers, or any combination thereof. In some cases, the linkers connect functional domains together (as in the case of flexible and rigid linkers) or may release releasable functional domains in vivo (as in the case of in vivo cleavable linkers).

Linkers may improve biological activity, increase expression yields, and achieve desirable pharmacokinetic profiles. Linkers may also include hydrazones, peptides, disulfides, or thioesters.

In some cases, the linker sequences described herein may include flexible linkers. Flexible linkers may be applied when the domains to be joined require some degree of movement or interaction. Flexible linkers may be composed of small non-polar (e.g., Gly) or polar (e.g., Ser or Thr) amino acids. Flexible linkers may have a sequence consisting mainly of a stretch of Gly and Ser residues ("GS" linker). One example of a flexible linker may have the sequence (Gly-Gly-Gly-Gly-Ser)n (SEQ ID NO:1). By adjusting the copy number "n", it is possible to optimize the length of this exemplary GS linker to achieve proper separation of functional domains or maintain required inter-domain interactions. In addition to GS linkers, other flexible linkers may also be used in recombinant fusion proteins. In some cases, flexible linkers may also be rich in small or polar amino acids such as Gly and Ser, but may contain additional amino acids such as Thr and Ala to maintain flexibility. In other cases, polar amino acids such as Lys and Glu may be used to improve solubility.

J-configuration of CD277 As used herein, "CD277" refers to the membrane-expressed protein butyrophilin BTN3A1, a key molecule in phosphoantigen-induced activation of engineered cells described herein. The CD277 protein is a cell surface protein that can adopt multiple conformations ("conformations"), as shown, for example, in FIG. 11 of the present application. J-configuration or J-confirmation of CD277 is promoted when GTP-bound RhoB promotes spatial redistribution of CD277 by promoting cytoskeletal capture at the plasma membrane, which binds to the B30.2 domain-proximal linking region of CD277. Dissociation of GTP-bound RhoB and corresponding binding of intracellular phosphoantigen (pAG) to the B30.2 domain of CD277 induces a conformational change in the extracellular region of CD277, referred to herein as the J-configuration of CD277. The J configuration is characteristically observed in tumor cells and other distressed cells, where metabolic changes may lead to the expression of certain stress molecules, resulting in the translocation of RhoB in the tumor or distressed cells, and ultimately leading to the formation of a J configuration of CD277. As used herein, as in any related patents and/or patent applications, the terms "J configuration,""Jconformation," and "J confirmation" are used interchangeably.

In certain embodiments, the invention provides methods and compositions comprising polypeptide constructs that specifically bind to the J configuration of CD277 on the surface of such tumor and distress cells. In certain embodiments, the polypeptide constructs described herein comprise a gamma delta TCR or a fragment thereof. In certain embodiments, polynucleotides encoding the polypeptide constructs described herein, and vectors encoding the polynucleotides, are provided. In some cases, engineered cells encoding the polypeptide constructs described herein are provided.

Polypeptide Constructs In some aspects, the invention provides pharmaceutical compositions comprising a polypeptide construct, wherein the polypeptide construct specifically interacts with a J configuration of CD277 on a target cell. In some embodiments, the polypeptide construct is expressed on an engineered cell. In some embodiments, the CD277 is human CD277. In some cases, the polypeptide construct binds to said J configuration of CD277 with at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% greater selectivity than other configurations of CD277. In some cases, the polypeptide construct binds to the J configuration of CD277 with at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold or 8-fold greater affinity than other configurations of CD277. In some embodiments, the polypeptide construct binds to CD277 upon a conformational change of CD277 to a J-configuration, which conformational change is triggered by interaction of CD277 with RhoB GTPase upon translocation of RhoB-GTPase to the plasma membrane. In some embodiments, the polypeptide construct binds to CD277 after CD277 interacts with RhoB GTPase. In some embodiments, the polypeptide construct binds to CD277 when CD277 interacts with phosphoantigen. In some embodiments, the polypeptide construct binds to CD277 when CD277 interacts with phosphoantigen and after CD277 interacts with RhoB GTPase. In some embodiments, the polypeptide construct binds to CD277 when RhoB GTPase is localized to the plasma membrane of a target cell. In some embodiments, the polypeptide construct binds to CD277 when the RhoB GTPase is localized away from the nucleus of the target cell.

The selectivity or affinity of the polypeptide constructs described herein for the J-configuration of CD277 can be determined by any method known to one of skill in the art. For example, a ligand binding assay can be used to detect the presence of CD277-polypeptide construct complex formation and the degree or strength of binding of the polypeptide construct to the J-configuration of CD277. In some embodiments, fluorescence resonance energy transfer (FRET) is used to determine the affinity of binding between a polypeptide construct and the J-configuration of CD277. FRET can detect and measure energy transfer between a pair of photosensitive molecules (e.g., fluorophores) typically positioned in close proximity. One photosensitive molecule, the donor molecule (e.g., the donor fluorophore), initially exists in an electronically excited state and can transfer energy to the other photosensitive molecule, the acceptor molecule (e.g., the acceptor fluorophore). Energy transfer from the donor to the acceptor can be, for example, by dipole-dipole coupling. Measurements of the energy transferred from the acceptor molecule to the donor molecule can be made to estimate the distance between the acceptor and donor, based on the fact that the efficiency of energy transfer (i.e., FRET efficiency) is inversely proportional to the sixth power of the distance between the donor and acceptor. Measurements of FRET can be, for example, by fluorescence detection microscopy (e.g., confocal microscopy) or fluorescence-sensitive cell sorting (e.g., flow cytometry, fluorescence activated cell sorting). Quantification of fluorescence using FRET can be by any one or more of a number of techniques, including sensitized emission, acceptor photobleaching, fluorescence lifetime imaging microscopy (FLIM) FRET, spectral imaging, and/or homoFRET and polarization anisotropy imaging. In some embodiments, FRET is performed using donor and acceptor fluorophores. In some embodiments, FRET is performed using one or more fluorescently labeled antibodies specific for antigens on the cell surface. In some embodiments, FRET is performed using one or more fluorescently labeled dyes that are hydrophobic and can bind to hydrophobic cellular components, such as the plasma membrane. In some embodiments, FRET is performed using a combination of one or more fluorescently labeled antibodies and one or more hydrophobic fluorescent dyes. In some embodiments, the fluorescent lipid conjugate BODIPY FL is used in combination with a fluorescently labeled antibody specific for an epitope on the CD277 protein. In some embodiments, other ligand binding assays are used alone or in combination with FRET to detect the selectivity of the polypeptide constructs described herein for CD277. Non-limiting examples of ligand binding assays contemplated in the present invention include other fluorescence-based methods, such as fluorescence polarization, detection of changes in the angle of light reflection from cell surface components using surface plasmon resonance, radioactivity-based ligand assays, and immunoprecipitation of antibody-labeled cell surface components followed by structural analysis.

In some embodiments, the polypeptide constructs disclosed herein are expressed in a cell. In some embodiments, the polypeptide constructs are expressed on the cell membrane of the cell. In some embodiments, the polypeptide constructs may interact with the cell. In some embodiments, the polypeptide constructs may be bound by a cell surface protein of the cell. In some embodiments, the cell is a cytotoxic cell. Non-limiting examples of cytotoxic cells include T cells, cells expressing at least a functional portion of a T cell receptor (e.g., one that conveys immune activity), and natural killer cells. In some embodiments, the cell expresses a T cell receptor. In some embodiments, the cell expresses at least a portion of a T cell receptor, where the portion has a T cell function (e.g., immune regulation). In some embodiments, the cell is engineered or genetically modified to express at least one chain of a T cell receptor. The at least one chain may be a gamma-T cell receptor chain. The at least one chain may be a delta-T cell receptor chain or a fragment thereof. The at least one chain may be a gamma-9 T cell receptor chain or a fragment thereof. The at least one chain can be a δ2-T cell receptor chain or a fragment thereof. Thus, in some embodiments, the polypeptide construct is a TCR having at least one chain or a fragment thereof (e.g., a γ-T cell receptor chain or a fragment thereof, a δ-T cell receptor chain or a fragment thereof, a γ9-T cell receptor chain or a fragment thereof, or a δ2-T cell receptor chain or a fragment thereof). In some embodiments, the polypeptide construct can be a TCR having two or more chains (e.g., a homodimer or a heterodimer).

In some embodiments, the polypeptide constructs disclosed herein are not expressed by a cell. In some embodiments, the polypeptide constructs are synthetic (e.g., not produced by a cell). In some embodiments, the polypeptide constructs are produced in vitro. In some embodiments, the polypeptide constructs can bind to target cells and cytotoxic cells disclosed herein. In some embodiments, the polypeptide constructs can bind to target cells and cytotoxic cells disclosed herein, thereby placing the target cells in sufficient proximity to the cytotoxic cells to render the cytotoxic cells cytotoxic to the target cells.

The polypeptides and proteins disclosed herein (including functional portions and functional variants thereof) may contain synthetic amino acids in place of one or more naturally occurring amino acids. Such synthetic amino acids are known in the art and include, for example, aminocyclohexanecarboxylic acid, norleucine, α-amino These include n-decanoic acid, homoserine, S-acetylaminomethyl-cysteine, trans-3- and trans-4-hydroxyproline, 4-aminophenylalanine, 4-nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, β-phenylserine β-hydroxyphenylalanine, phenylglycine, α-naphthylalanine, cyclohexylalanine, cyclohexylglycine, indoline-2-carboxylic acid, 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, aminomalonic acid monoamide, N'-benzyl-N'-methyl-lysine, N',N'-dibenzyl-lysine, 6-hydroxylysine, ornithine, α-aminocyclopentanecarboxylic acid, α-aminocyclohexanecarboxylic acid, α-aminocycloheptanecarboxylic acid, α-(2-amino-2-norbornane)-carboxylic acid, α,γ-diaminobutyric acid, α,β-diaminopropionic acid, homophenylalanine, and α-tert-butylglycine.

As used herein, "antibody" refers to a monoclonal or polyclonal antibody. A whole antibody typically consists of four polypeptides: two identical copies of a heavy (H) chain polypeptide and two identical copies of a light (L) chain polypeptide. Each of the heavy chains contains one N-terminal variable (VH) region and three C-terminal constant (CH1, CH2 and CH3) regions, and each light chain contains one N-terminal variable (VL) region and one C-terminal constant (CL) region. The variable regions of each pair of light and heavy chains form the antigen-binding site of the antibody. The VH and VL regions have a similar general structure, and each region contains four framework regions whose sequences are relatively conserved. The framework regions are linked by three complementarity determining regions (CDRs). The three CDRs, known as CDR1, CDR2 and CDR3, form the "hypervariable region" of the antibody, which mediates antigen binding.

"Antigen recognition moiety or domain" means a molecule or a portion of a molecule that specifically binds to an antigen. In one embodiment, the antigen recognition moiety is an antibody, an antibody-like molecule or a fragment thereof, and the antigen is a tumor antigen.

An "antibody-like molecule" can be, for example, a protein that is a member of the Ig superfamily that can selectively bind to a target. MHC molecules and T cell receptors are such molecules. In one embodiment, the antibody-like molecule is a TCR.

"Antibody fragment," "antibody fragment," "functional fragment of an antibody," and "antigen-binding portion" are used interchangeably herein and refer to one or more fragments or portions of an antibody that retain the ability to specifically bind to an antigen (see generally Holliger et al., Nat. Biotech., 23(9):1126-1129 (2005)). An antibody fragment desirably contains, for example, one or more CDRs, a variable region (or a portion thereof), a constant region (or a portion thereof), or a combination thereof. Examples of antibody fragments include, but are not limited to, (i) a Fab fragment, which is a monovalent fragment consisting of the VL, VH, CL and CH1 domains; (ii) a F(ab')2 fragment, which is a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the stalk region; (iii) a Fv fragment, which consists of the VL and VH domains of a single arm of an antibody; (iv) a single-chain Fv (scFv), which is a monovalent molecule consisting of the two domains (i.e., VL and VH) of the Fv fragment linked by a synthetic linker that allows the two domains to be synthesized as a single polypeptide chain (e.g., Bird et al., Science, 242:423-426 (1988); Huston et al., Proc. Natl. Acad. Sci. USA, 85:5879-5883 (1988); and Osbourn et al., Nat. Biotechnol., 16:778 (1998); and (v) diabodies, which are dimers of polypeptide chains, in which each polypeptide chain comprises a VH linked to a VL by a peptide linker that is too short to allow pairing of the VH and VL on the same polypeptide chain, and thus directs pairing between complementary domains on different VH-VL polypeptide chains to provide a dimeric molecule having two functional antigen-binding sites. Antibody fragments are known in the art and are described in further detail, for example, in U.S. Pat. No. 8,603,950.

Engineered T Cell Receptors (TCRs)
In some embodiments, the polypeptide construct that selectively binds to the J configuration of CD277 comprises a T cell receptor (TCR), an engineered TCR or a fragment thereof. In some embodiments, the T cell receptor (TCR) is composed of two chains (αβ or γδ) that pair on the surface of T cells to form a heterodimeric receptor. The αβ TCR is expressed on most T cells in the body and is known to be involved in the recognition of specific MHC-restricted antigens. Each α and β chain is composed of two domains, a constant domain (C) that anchors the protein to the cell membrane and binds to the invariant subunit of the CD3 signaling apparatus, and a variable domain (V) that provides antigen recognition through six loops called complementarity determining regions (CDRs). Each of the V domains can contain three CDRs, e.g., CDR1, CDR2 and CDR3, with CDR3 being contained as a hypervariable region. These CDRs interact with a complex formed between an antigenic peptide bound to a protein encoded by the major histocompatibility complex (pepMHC) (e.g., HLA-A, HLA-B, HLA-C, HLA-DPAl, HLA-DPBl, HLA-DQAl, HLA-DQBl, HLA-DRA or HLA-DRBl complex). In some cases, the constant domain further comprises a linking region that links the constant domain to the variable domain. In some cases, the beta chain further comprises a short diversity region that forms part of the linking region.

In some cases, such TCRs are reactive to specific tumor antigens, e.g., NY-ESO, Mage A3, Titin. In other cases, such TCRs are reactive to specific neo-antigens expressed in the patient's tumor (i.e., patient-specific, somatic, non-synonymous mutations expressed by the tumor). In some cases, engineered TCRs can have enhanced affinity.

In some embodiments, the TCRs are designated using the International Immunogenetics and Genetics (IMGT) TCR nomenclature and linked to the IMGT public database of TCR sequences. For example, there may be several types of alpha chain variable (Vα) regions and several types of beta chain variable (Vβ) regions that are distinguished by framework, CDR1, CDR2, and CDR3 sequences. Thus, in the IMGT nomenclature, the Vα types may be referred to by a unique TRAV number. For example, "TRAV21" defines a TCR Vα region with unique framework and CDR1 and CDR2 sequences, and a CDR3 sequence that is partially defined by amino acid sequences that are conserved among TCRs, but also includes amino acid sequences that vary among TCRs. Similarly, "TRBV5-1" defines a TCR Vβ region with a unique framework and CDR1 and CDR2 sequences, but the CDR3 sequence is only partially defined.

In some cases, the beta chain diversity region is referred to by the abbreviation TRBD in the IMGT nomenclature.

In some cases, the specific sequences defined by the IMGT nomenclature are widely known and would be understood by those skilled in the art of TCR. For example, they can be found in the IMGT public database and in "T cell Receptor Factsbook", (2001) LeFranc and LeFranc, Academic Press, ISBN 0-12-441352-8.

In some embodiments, the αβ heterodimeric TCR is transfected as a full-length chain, e.g., having both a cytoplasmic domain and a transmembrane domain. In some cases, the TCR contains an engineered disulfide bond between residues of each constant domain, e.g., as described in WO 2006/000830.

In some cases, the TCRs described herein are in single chain form. See, for example, WO 2004/033685. Single chain forms include αβ TCR polypeptides of the Vα-L-Vβ, Vβ-L-Vα, Vα-Cα-L-Vβ, Vα-L-Vβ-Cβ, Vα-Cα-L-Vβ-Cβ types, where Vα and Vβ are TCR α and β variable regions, respectively, Cα and Cβ are TCR α and β constant regions, respectively, and L is a linker sequence. In certain embodiments, the single chain TCRs of the present disclosure may have disulfide bonds introduced between residues of the respective constant domains, as described in WO 2004/033685.

In contrast to αβ TCR, γδ TCR is composed of one γ chain and one δ chain. Although γδ T cells are present in the body in much smaller quantities than αβ T cells, they combine potent antitumor effector functions with recognition of widely expressed tumor-associated molecules, and are therefore strong candidates for clinical application in cancer immunotherapy. The majority of γδ T cells are activated in an MHC-independent manner and do not require antigen processing, in contrast to MHC-restricted αβ T cells. Instead, γδ T cells rely on cell-to-cell contact with antigen-presenting cells to directly recognize antigens in the form of intact proteins or non-peptide compounds. In this interaction, the CDR3 domain of the variable region is particularly important. In this interaction, the CDR3 domain of the variable region is particularly important. The orientation of the variable region (V) and constant (C) regions of γδ TCR is unique compared to αβ TCR or antibodies, and arises from the small angle between the Vγ and Cγ domains. Although the structure of the γδ TCR V domain is similar to that of the αβ TCR, the γδ TCR C domain is significantly different. Structural differences in Cγ and Cδ (including the location of the disulfide bond between them) may allow the γδ TCR to form a different recognition/signaling complex than the αβ TCR (Allison et al., "Structure of a human γδ T-cell antigen receptor," Nature, 411:820-824). Activation of γδ T cells by TCR-mediated antigen recognition on target cells can result in the production of cytokines and chemokines and cytolysis of target cells (e.g., tumor cells).

Vγ9Vδ2 T cells, the major γδ T cell subset in human peripheral blood, express the γδ TCR composed of Vγ9 and Vδ2 chains and are specifically activated by intermediates of the mammalian mevalonate pathway, such as isopentenyl pyrophosphate (IPP), or the microbial 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway. Intracellular phosphoantigen (pAg) levels are elevated in tumor cells due to dysregulation of the mevalonate pathway or upon microbial infection, allowing targeting of transformed or infected cells by Vγ9Vδ2 cells. Similarly, intracellular pAg levels can be pharmacologically elevated by treating cells with mevalonate pathway inhibitors, such as aminobisphosphonates (ABPs), thereby sensitizing the cells to recognition by Vγ9Vδ2 T cells.

In some embodiments, the TCRs endogenously expressed by Vγ9Vδ2 T cells may be expressed in αβ T cells engineered to reprogram αβ T cells by expressing one or more Vγ9Vδ2 TCRs. For example, CD4 ⁺ αβ T cells engineered to express one defined Vγ9Vδ2 TCR can be used to functionally screen tumor cells for proteins important for T cell recognition to eliminate variability in recognition by diverse γδ TCR repertoires.

In some embodiments, the Vγ9Vδ2 TCR described herein recognizes the CD277 (BTN3A1) protein expressed by a target cell (e.g., a tumor cell). In some embodiments, the Vγ9Vδ2 TCR described herein recognizes an epitope that includes the J configuration of the CD277 protein expressed on the surface of the target cell. In some embodiments, the Vγ9Vδ2 TCR described herein recognizes an epitope restricted to the J configuration of the CD277 protein expressed on the surface of the target cell.

In some embodiments, the pharmaceutical compositions described herein include a polypeptide construct comprising a Vγ9Vδ2 TCR comprising at least one of a γ-TCR amino acid sequence or a δ-TCR amino acid sequence capable of recognizing CD277 protein on the cell surface of a target cell (e.g., a tumor cell). In some embodiments, the polypeptide construct comprises at least one variant or fragment of a γ-TCR amino acid sequence or a δ-TCR amino acid sequence capable of recognizing CD277 protein on the cell surface of a target cell. The present disclosure contemplates a polypeptide construct comprising any portion or fragment or variant of a γδ TCR capable of recognizing a target cell (e.g., a tumor cell) via a CD277 cell surface molecule. In some aspects, the polypeptide construct comprises at least a portion of a Cγ or Cδ region and at least a portion of a Vγ or Vδ region of a γδ TCR. In some embodiments, the polypeptide construct comprises at least a portion of a Cγ or Cδ region and at least a CDR3 domain of a Vγ or Vδ domain of a γδ TCR. In some embodiments, the polypeptide construct comprises all of the CDR regions of the Vγ9Vδ2 TCR, all of which may participate in binding to a cell surface molecule (e.g., a CD277 molecule) on the surface of a target cell (see, e.g., Wang et al., "V{gamma}2V{delta}2 T cell receptor recognition of prenyl pyrophosphates is dependent on all CDRs," J Immunol, 184, 6209-6222 (2010)).

The TCRs described herein may be conjugated to a detectable label, a therapeutic agent, or a PK-modifying moiety.

Exemplary detectable labels for diagnostic purposes include, but are not limited to, fluorescent labels, radioactive labels, enzymes, nucleic acid probes, and contrast agents.

Effector Cells Effector cells are provided that have been modified to express one or more genes or heterologous genes encoding a polypeptide construct disclosed herein, where the polypeptide construct selectively binds to the J configuration of CD277.

"αβ T cells" or "alpha beta T cells" may be defined in terms of the function of T lymphocytes expressing αβ TCR that recognize peptides bound to MHC molecules (major histocompatibility complex) expressed on the surface of various cells. MHC presents peptides derived from the proteins of the cell. For example, when a cell is infected with a virus, MHC presents the viral peptides, and the interaction of αβ TCR with the MHC complex activates a specific type of T cell, which initiates an immune response that eliminates the infected cell. Thus, αβ T cells may be functionally defined as cells that can recognize peptides bound to MHC molecules. αβ T cells may be identified, for example, using antibodies specific for the αβ T cell receptor (e.g., the BW242 antibody specific for human αβ TCR) as described below. Since the majority of T cells have αβ TCR, αβ T cells may be selected from peripheral blood, for example, via the CD3 antigen. Such selection would also include γδ T cells. From such selected cells, the nucleic acid (or amino acid) sequences corresponding to the αT cell receptor chain and the βT cell receptor chain can be determined. Thus, αβT cells can also be defined as cells that contain nucleic acid (or amino acid) sequences corresponding to the αT cell receptor chain and/or the βT cell receptor chain.

"γδ T cells" or "gamma delta T cells" refer to a small subset of T cells whose antigenic molecules that trigger their activation are largely unknown. Gamma delta T cells may be considered a component of adaptive immunity in that they rearrange TCR genes to generate junctional diversity and develop a memory phenotype. However, the various subsets may also be considered part of innate immunity, when the restricted TCR is used as a pattern recognition receptor. γδ T cells may be identified using antibodies specific for the γδ T cell receptor. Antibodies suitable for FACS are widely available. Conditions are chosen as provided by the antibody manufacturer that allow the selection of negative and/or positive cells. Specific examples of antibodies that may be suitable are available from BD Pharmingen (BD, 1 Becton Drive, Franklin Lakes, NJ USA), TCR-APC (clone B1, #555718), or from Beckman Coulter, pan-TCR-PE (clone I MMU510, #I M1418U). Also, from such selected cells, the nucleic acid (or amino acid sequence) sequence corresponding to the gamma T cell receptor chain and/or the delta T cell receptor chain may be determined. Thus, a gamma delta T cell may also be defined as a cell that contains a nucleic acid (or amino acid) sequence corresponding to a gamma T cell receptor chain.

In one aspect, the compositions disclosed herein can utilize cells. The cells can be primary cells. The cells can be recombinant cells. The cells can be available from a number of sources, including, but not limited to, peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from an infection site, ascites, pleural effusion, spleen tissue, and tumors. For example, any T cell line can be used. Alternatively, the cells can be derived from a healthy donor, a patient diagnosed with cancer, or a patient diagnosed with an infection. In another embodiment, the cells can be part of a mixed population of cells exhibiting different phenotypic characteristics. The cells can also be available from a cell therapy bank. Destroyed cells that are resistant to immunosuppressive treatments are available. The desired cell population can also be selected prior to modification. Selection can include at least one of magnetic separation, flow cytometry selection, and antibiotic selection. The one or more cells can be any blood cell, such as peripheral blood mononuclear cells (PBMCs), lymphocytes, monocytes, or macrophages. The one or more cells may be any immune cell, such as a lymphocyte, B cell, or T cell. The cells may be obtained from whole food, apheresis, or from a tumor sample of the subject. The cells may be tumor infiltrating lymphocytes (TIL). In some cases, the apheresis may be leukapheresis. Leukapheresis is a procedure for isolating blood cells from blood. During leukapheresis, blood may be drawn through a needle in the subject's arm, circulated in a device that separates the whole blood into red blood cells, plasma, and lymphocytes, and then the plasma and red blood cells may be returned to the subject through a needle in the other arm. In some cases, the cells are isolated after the administration of a treatment regimen and cell therapy. For example, apheresis may be performed sequentially or simultaneously with cell administration. In some cases, apheresis is performed before and up to about six weeks after administration of a cell product. In some cases, apheresis is performed -3 weeks, -2 weeks, -1 week, 0, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, or up to about 10 years after administration of the cell product. In some cases, cells obtained by apheresis can be subjected to testing for specific cell lysis, cytokine release, metabolomic studies, bioenergetics studies, intracellular FAC of cytokine production, ELISA spot assays, and lymphocyte subset analysis. In some cases, samples of the cell product or apheresis product can be cryopreserved for retrospective analysis of infused cell phenotype and function.

In one embodiment, the compositions provided herein may comprise TILs. The TILs may be isolated from an organ affected by cancer. One or more cells may be isolated from an organ with cancer, which may be the brain, heart, lungs, eyes, stomach, pancreas, kidneys, liver, intestines, uterus, bladder, skin, hair, nails, ears, glands, nose, mouth, lips, spleen, gums, teeth, tongue, salivary glands, tonsils, pharynx, esophagus, large intestine, small intestine, rectum, anus, thyroid, thymus, bone, cartilage, tendons, ligaments, epirenal glands, skeletal muscle, smooth muscle, blood vessels, blood, spinal cord, trachea, ureters, urethra, hypothalamus, pituitary gland, pylorus, adrenal glands, ovaries, fallopian tubes, uterus, vagina, mammary glands, testes, seminal vesicles, penis, lymph, lymph nodes, or lymphatic vessels. The one or more TILs may be derived from the brain, heart, liver, skin, intestines, lungs, kidneys, eyes, small intestines, or pancreas. The TILs may be derived from the pancreas, kidney, eye, liver, small intestine, lung, or heart. The TILs may be derived from the pancreas. The one or more cells may be pancreatic islet cells, e.g., pancreatic beta cells. In some cases, the TILs may be derived from a gastrointestinal cancer. The TIL cultures may be prepared in a number of ways. For example, the tumor may be excised from non-cancerous tissue or necrotic areas. The tumor may then be fragmented to a length of about 2-3 mm. In some cases, the tumor may be fragmented to a size of about 0.5 mm to about 5 mm, about 1 mm to about 2 mm, about 2 mm to about 3 mm, about 3 mm to about 4 mm, or about 4 mm to about 5 mm. The tumor fragments may then be cultured in vitro using media and a cell stimulant, e.g., a cytokine. In some cases, IL-2 may be used to grow TILs from the tumor fragments.

In some embodiments, the modified effector cells are modified immune cells, including T cells and/or natural killer cells, that have been modified to encode specific nucleic acid sequences for expression of the polypeptide constructs described herein.

The engineered T cells containing an exogenous immune receptor as described herein are T cells engineered to express an exogenous receptor, such as a polypeptide construct that specifically binds to the J configuration of CD277. The exogenous receptor can be expressed from a transgene construct rather than from an endogenous locus. The exogenous receptor can be from a different source, i.e., from another species than the source of the T cells engineered to obtain the engineered T cells containing the exogenous receptor. The exogenous receptor can be from the same source, i.e., from the same species as the source of the T cells engineered to obtain the engineered T cells containing the exogenous receptor. The exogenous receptor can also be an engineered γδ T cell receptor or an engineered αβ T cell receptor, which are engineered to selectively bind to the J configuration of CD277.

In some cases, an engineered T cell receptor is a T cell receptor that has a modified amino acid sequence, which has an amino acid sequence that differs from the corresponding amino acid sequence of an endogenous T cell receptor.

Helper T cells (TH cells) assist other white blood cells in immunological processes including maturation of B cells into plasma cells and memory B cells and activation of cytotoxic T cells and macrophages. In some cases, TH cells are known as CD4+ T cells because they express the CD4 glycoprotein on the cell surface. Helper T cells are activated when MHC class II molecules expressed on the surface of antigen-presenting cells (APCs) present them with peptide antigens. Once activated, helper T cells divide rapidly and secrete small proteins called cytokines, which regulate or support active immune responses. These cells can differentiate into one of several subtypes, including TH1, TH2, TH3, TH17, Th9, or TFH, which secrete different cytokines to promote different types of immune responses.

Cytotoxic T cells (TC cells or CTLs) destroy virus-infected and tumor cells and are also involved in transplant rejection. These cells are also known as CD8+ T cells because they express the CD8 glycoprotein on their surface. These cells recognize their targets by binding to antigens associated with MHC class I molecules, which are present on the surface of all nucleated cells. Through IL-10, adenosine, and other molecules secreted by regulatory T cells, CD8+ cells are inactivated into an anergic state, which prevents autoimmune diseases.

Memory T cells are a subset of antigen-specific T cells that persist for long periods after an infection has resolved. Upon re-exposure to cognate antigen, they rapidly proliferate into large numbers of effector T cells, endowing the immune system with a "memory" of past infection. Memory T cells include several subtypes: stem memory T cells (TSCM), central memory T cells (TCM cells), and two types of effector memory T cells (TEM cells and TEMRA cells). Memory cells can be either CD4+ or CD8+. Memory T cells can express the cell surface proteins CD45RO, CD45RA, and/or CCR7.

Regulatory T cells (Treg cells), previously known as suppressor T cells, play a role in maintaining immune tolerance. Their main role is to shut down T cell-mediated immunity toward the end of the immune response and to suppress autoreactive T cells that have escaped the process of negative selection in the thymus.

Natural killer T cells (NKT cells) bridge the adaptive and innate immune systems. Unlike conventional T cells, which recognize peptide antigens presented by major histocompatibility complex (MHC) molecules, NKT cells recognize glycolipid antigens presented by a molecule called CD1d. Upon activation, these cells can perform functions attributed to both Th and Tc cells (i.e., cytokine production and release of cytolytic/cytocidal molecules). They can also recognize and eliminate some tumor cells and herpes virus-infected cells.

Natural killer (NK) cells are a type of cytotoxic lymphocyte of the innate immune system. In some cases, NK cells provide the first line of defense against viral infections and/or tumor formation. NK cells detect MHC presented on infected or cancer cells, triggering the release of cytokines that can then induce cell lysis and apoptosis. Furthermore, NK cells are able to find stressed cells in the absence of antibodies and/or MHC, thereby enabling a rapid immune response.

In some cases, cells that may be used in cell therapy or in the methods provided herein may be positive or negative for a given factor. In some embodiments, the cells are CD3+ cells, CD3- cells, CD5+ cells, CD5- cells, CD7+ cells, CD7- cells, CD14+ cells, CD14- cells, CD8+ cells, CD8- cells, CD103+ cells, CD103- cells, CD11b+ cells, CD11b- cells, BDCA1+ cells, BDCA1- cells, L-selectin+ cells, L-selectin- cells, CD25+, CD25- cells, CD27+, CD27- cells, CD28+ cells, CD28- cells, CD44+ cells, CD44- cells, CD56+ cells, CD56- cells, CD57+ cells, CD57- cells, CD62L+ cells, CD62L- cells, CD69+ cells, CD69- The cells may be CD45RO+ cells, CD45RO- cells, CD127+ cells, CD127- cells, CD132+ cells, CD132- cells, IL-7+ cells, IL-7- cells, IL-15+ cells, IL-15- cells, lectin-like receptor G1 positive cells, lectin-like receptor G1 negative cells, or differentiated or de-differentiated cells thereof. The examples of factors expressed by the cells are not intended to be limiting, and one of skill in the art will understand that the cells may be positive or negative for any factor known in the art. In some embodiments, the cells may be positive for more than one factor. For example, the cells may be CD4+ and CD8+. In some embodiments, the cells may be negative for more than one factor. For example, the cells may be CD25-, CD44- and CD69-. In some embodiments, the cells may be positive for one or more factors and negative for one or more factors. For example, the cells may be CD4+ and CD8-. The selected cells can then be injected into the subject's body. In some embodiments, the cells can be selected for having or not having one or more predetermined factors (e.g., the cells can be separated based on the presence or absence of one or more factors). In some embodiments, the selected cells can also be expanded in vitro. The selected cells can be expanded in vitro prior to injection. It should be understood that the cells used in any of the methods disclosed herein can be a mixture of any of the cells disclosed herein (e.g., two or more different cells). For example, the methods of the present disclosure can include cells that are a mixture of CD4+ cells and CD8+ cells. In another example, the methods of the present disclosure can include cells that are a mixture of CD4+ cells and naive cells. In some cases, the cells can be stem memory T _SCM cells composed of CD45RO(-), CCR7(+), CD45RA(+), CD62L+ (L-selectin), CD27+, CD28+, and IL-7Rα+, which can also express CD95, IL-2Rβ, CXCR3, and LFA-1, and can exhibit a number of functional attributes characteristic of stem memory cells. The engineered cells can also be central memory T _CM cells comprising L-selectin and CCR7, which can secrete, for example, IL-2, but cannot secrete IFNγ or IL-4. The engineered cells can also be effector memory T _EM cells comprising L-selectin or CCR7, and can produce effector cytokines such as, for example, IFNγ and IL-4. In some cases, a population of cells can be introduced into a subject. For example, the population of cells can be a combination of T cells and NK cells. In other cases, the population may be a combination of naive and effector cells. The population of cells may be TILs.

In particular, a population of T cells can be stimulated in vitro, for example, by contact with an anti-CD2 or anti-CD3 antibody or antigen-binding fragment thereof immobilized on a surface, or by contact with a protein kinase C activator (e.g., bryostatin), sometimes combined with a calcium ionophore. A ligand that binds to an accessory molecule can be used to co-stimulate an accessory molecule on the surface of the T cells. For example, a population of T cells can be contacted with an anti-CD3 antibody and an anti-CD28 antibody under conditions that can stimulate proliferation of the T cells. In some cases, 4-1BB can be used to stimulate the cells. For example, the cells can be stimulated with 4-1BB and IL-21 or another cytokine. An anti-CD3 antibody and an anti-CD28 antibody can be used to stimulate proliferation of either CD4 T cells or CD8 T cells. For example, the substance that provides the signal can be in solution or bound to a surface. The ratio of particles to cells can depend on the particle size relative to the target cells. In other embodiments, cells such as T cells can be combined with agent-coated beads, where the beads and the cells can then be separated and optionally cultured. Each bead can be coated with either anti-CD3 or anti-CD28 antibodies, or in some cases a combination of the two. In another embodiment, the agent-coated beads and cells are not separated but are cultured together prior to culture. Cell surface proteins can be ligated by contacting the T cells with paramagnetic beads (3x28 beads) to which anti-CD3 and anti-CD28 can bind. In some cases, the cells and beads (e.g., DYNABEADS® M-450 CD3/CD28 T paramagnetic beads in a 1:1 ratio) are combined in a buffer, such as phosphate buffered saline (PBS) (e.g., in the absence of divalent cations such as calcium and magnesium). Any cell concentration can be used. The mixture can be cultured for a few hours (e.g., about 3 hours) to about 14 days, or any integer number of hours in between. In another embodiment, the mixture may be cultured for about 21 days or up to about 21 days. Conditions suitable for T cell culture may include a suitable medium (e.g., basal medium or RPMI medium 1640 or X-vivo 5 (Lonza)) that may contain factors necessary for proliferation and survival, which may include serum (e.g., fetal bovine or human serum), interleukin-2 (IL-2), insulin, IFN-g, IL-4, IL-7, GM-CSF, IL-10, IL-21, IL-15, TGF beta, and TNF alpha, or any other additives for cell growth. Other additives for cell growth include, but are not limited to, detergents, plasmanate, and reducing agents, such as N-acetylcysteine and 2-mercaptoethanol. Media can include RPMI 1640, A1 MV, DMEM, MEM, α-MEM, F-12, X-Vivo 1 and X-Vivo 20, Optimizer, can be supplemented with amino acids, sodium pyruvate and vitamins, can be serum-free or supplemented with appropriate amounts of serum (or plasma) or a given combination of hormones and/or cytokines in amounts sufficient for T cell growth and proliferation. In some cases, an 865 mL RPMI bottle can contain 100 mL of human serum, 25 mL of Hepes 1M, 10 mL of 10,000 U/mL and 10,000 μg/mL penicillin/streptomycin, and 0.2 mL of 50 mg/mL gentamicin. After addition of the additives, the RPMI medium can be filtered using a 0.2 μm×1 L filter and stored at 4° C. In some embodiments, antibiotics such as penicillin and streptomycin are included only in the experimental cultures, but not in the cultures of cells that are injected into the subject's body. In some cases, human serum can be thawed in a 37° C. water bath and then heat inactivated (e.g., 56° C. for 30 minutes for 100 mL bottles). Serum can be filtered through 0.8 μm and 0.45 μm filters before addition of media.

In one embodiment, cells can be maintained under conditions necessary to support growth (e.g., appropriate temperature (e.g., 37° C.) and atmosphere (e.g., air + 5% _CO2 ). In some cases, T cells exposed to different stimulation times can exhibit different characteristics. In some cases, soluble monospecific tetrameric antibodies against human CD3, CD28, CD2, or any combination thereof can be used.

Dose of Modified Effector Cells The present invention provides modified effector cells encoding a polypeptide construct that selectively binds to the J configuration of cell surface CD277. In some embodiments, an amount of modified effector cells is administered to a subject in need thereof, the amount being determined based on the potential and efficacy of inducing cytokine-associated toxicity. In some cases, the amount of modified effector cells comprises about 10 ³ to about 10 ¹⁰ modified effector cells/kg. In some cases, the amount of modified effector cells comprises about 10 ⁴ to about 10 ⁸ modified effector cells/kg. In some cases, the amount of modified effector cells comprises about 10 ⁵ to about 10 ⁷ modified effector cells/kg. In some cases, the amount of modified effector cells comprises about 10 ⁶ to about 10 ⁹ modified effector cells/kg. In some cases, the amount of modified effector cells comprises about 10 ⁶ to about 10 ⁸ modified effector cells/kg. In some cases, the amount of modified effector cells comprises about 10 ⁷ to about 10 ⁸ modified effector cells/kg. In some cases, the amount of modified effector cells comprises about 10 ⁵ to about 10 ⁶ modified effector cells/kg. In some cases, the amount of modified effector cells comprises about 10 ⁶ to about 10 ⁷ modified effector cells/kg. In some cases, the amount of modified effector cells comprises about 10 ⁷ to about 10 ⁸ modified effector cells/kg. In some cases, the amount of modified effector cells comprises about 10 ⁸ to about 10 ⁹ modified effector cells/kg. In some cases, the amount of modified effector cells comprises about 10 ⁹ modified effector cells/kg. In some cases, the amount of modified effector cells comprises about 10 ⁸ modified effector cells/kg. In some cases, the amount of modified effector cells comprises about 10 ⁷ modified effector cells/kg. In some cases, the amount of modified effector cells comprises about 10 ⁶ modified effector cells/kg. In some cases, the amount of modified effector cells comprises about 10 ⁵ modified effector cells/kg.

In some embodiments, the modified effector cells are modified T cells encoding a gamma delta TCR or a fragment thereof that selectively binds to the J configuration of CD277. In some cases, the amount of engineered gamma delta TCR T cells comprises about ¹⁰ to about ¹⁰ gamma delta TCR cells/kg. In some cases, the amount of engineered gamma delta TCR cells comprises about ¹⁰ to about ¹⁰ gamma delta TCR cells/kg. In some cases, the amount of engineered gamma delta TCR cells comprises about ¹⁰ to about ¹⁰ gamma delta TCR cells/kg. In some cases, the amount of engineered gamma delta TCR cells comprises about ¹⁰ to about ¹⁰ gamma delta TCR cells/kg.

Cytokines The present invention provides polypeptide constructs and polynucleotides encoding cytokines or variants or derivatives thereof as described herein, and methods and systems comprising same. Cytokines are a class of small proteins of about 5-20 kDa involved in cell signaling. In some cases, cytokines include chemokines, interferons, interleukins, colony stimulating factors, or tumor necrosis factors. In some embodiments, chemokines act as chemoattractants to guide cell migration and are classified into four subfamilies: CXC, CC, CX3C, and XC. Exemplary chemokines include those from the CC subfamily: CCL1, CCL2 (MCP-1), CCL3, CCL4, CCL5 (RANTES), CCL6, CCL7, CCL8, CCL9 (or CCL10), CCL11, CCL12, CCL13, CCL14, CCL15, CCL16, CCL17, CCL18, CCL19, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCL26, CC L27 and CCL28; CXC subfamily: CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9, CXCL10, CXCL11, CXCL12, CXCL13, CXCL14, CXCL15, CXCL16 and CXCL17; XC subfamily: XCL1 and XCL2; and CX3C subfamily: CX3CL1. Interferons (IFNs) include interferons type I (e.g., IFN-α, IFN-β, IFN-ε, IFN-κ and IFN-ω), interferons type II (e.g., IFN-γ) and interferons type III. In some embodiments, IFN-α is further classified into about 13 subtypes, including IFNA1, IFNA2, IFNA4, IFNA5, IFNA6, IFNA7, IFNA8, IFNA10, IFNA13, IFNA14, IFNA16, IFNA17, and IFNA21.

Interleukins are expressed by white blood cells, which promote the development and differentiation of T and B lymphocytes and hematopoietic cells. Exemplary interleukins include IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8 (CXCL8), IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-35, and IL-36.

Tumor necrosis factors (TNFs) are a group of cytokines that regulate apoptosis. In some cases, there are about 19 members within the TNF family, including, but not limited to, TNFα, lymphotoxin-alpha (LT-alpha), lymphotoxin-beta (LT-beta), T-cell antigen gp39 (CD40L), CD27L, CD30L, FASL, 4-1BBL, OX40L, and TNF-related apoptosis-inducing ligand (TRAIL).

Colony stimulating factors (CSFs) are secreted glycoproteins that interact with receptor proteins on the surface of hematopoietic stem cells, which then regulate cell proliferation and differentiation into specific types of blood cells. In some cases, CSFs include macrophage colony stimulating factor, granulocyte macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), or promegapoietin.

In some embodiments, one or more of the methods described herein further include administration of a cytokine. In some cases, the cytokine includes a chemokine, an interferon, an interleukin, a colony stimulating factor, or a tumor necrosis factor. In some cases, one or more of the methods described herein further include administration of a cytokine selected from a chemokine, an interferon, an interleukin, a colony stimulating factor, or a tumor necrosis factor.

Indications In some embodiments, the present specification discloses a method of administering modified effector cells encoding the polynucleotides described herein to a subject having a disorder, such as cancer. In some cases, the cancer is a metastatic cancer. In other cases, the cancer is a recurrent or refractory cancer.

In some cases, the cancer is a solid tumor or a hematological malignancy. In some cases, the cancer is a solid tumor. In other cases, the cancer is a hematological malignancy.

In some cases, the cancer is a solid tumor. Exemplary solid tumors include, but are not limited to, anal cancer, appendix cancer, bile duct cancer (i.e., cholangiocarcinoma), bladder cancer, brain cancer, breast cancer, cervical cancer, colon cancer, cancer of unknown primary (CUP), esophageal cancer, eye cancer, fallopian tube cancer, gastrointestinal cancer, kidney cancer, liver cancer, lung cancer, medulloblastoma, melanoma, oral cancer, ovarian cancer, pancreatic cancer, parathyroid disease, penile cancer, pituitary tumor, prostate cancer, rectal cancer, skin cancer, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, vaginal cancer, or vulvar cancer.

In some cases, the cancer is a hematological malignancy. In some cases, the hematological malignancy includes lymphoma, leukemia, myeloma, or B-cell malignancy. In some cases, the hematological malignancy includes lymphoma, leukemia, or myeloma. In some cases, exemplary hematological malignancies include chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), high-risk CLL, non-CLL/SLL lymphoma, prolymphocytic leukemia (PLL), follicular lymphoma (FL), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), Waldenstrom's macroglobulinemia, multiple myeloma, extranodal marginal zone B-cell lymphoma, nodal marginal zone B-cell lymphoma, leukemia ... The malignancies include B-cell lymphoma, Burkitt's lymphoma, non-Burkitt's high-grade B-cell lymphoma, primary mediastinal B-cell lymphoma (PMBL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, plasma cell myeloma, plasmacytoma, mediastinal (thymic) large B-cell lymphoma, intravascular large B-cell lymphoma, primary effusion lymphoma, or lymphomatoid granulomatosis. In some embodiments, the hematological malignancies include myeloid leukemia. In some embodiments, the hematological malignancies include acute myeloid leukemia (AML) or chronic myeloid leukemia (CML).

In some cases, the present specification is directed to chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), high-risk CLL, non-CLL/SLL lymphoma, prolymphocytic leukemia (PLL), follicular lymphoma (FL), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), Waldenstrom's macroglobulinemia, multiple myeloma, extranodal marginal zone B-cell lymphoma, nodal marginal zone B-cell lymphoma, Burkitt's lymphoma, non-Burkitt's high-grade Disclosed herein are methods of administering modified effector cells described herein to a subject having a hematological malignancy selected from B cell lymphoma, primary mediastinal B cell lymphoma (PMBL), immunoblastic large cell lymphoma, precursor B lymphoblastic lymphoma, B cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, plasma cell myeloma, plasmacytoma, mediastinal (thymic) large B cell lymphoma, intravascular large B cell lymphoma, primary effusion lymphoma, or lymphomatoid granulomatosis. In some cases, disclosed herein are methods of administering modified effector cells to a subject having a hematological malignancy selected from AML or CML.

Source of Immune Effector Cells In certain aspects, embodiments described herein include methods of producing and/or expanding immune effector cells (e.g., T cells, NK cells, or NK T cells) comprising transfecting cells with an expression vector containing a DNA (or RNA) construct encoding a polypeptide that selectively binds to the J configuration of cell surface CD277, and then, optionally, stimulating the cells with feeder cells, recombinant antigen, or antibodies against the receptor to cause the cells to expand. In certain aspects, the cells (or cell populations) engineered to express a polypeptide that selectively binds to the J configuration of cell surface CD277 are stem cells, iPS cells, immune effector cells, or precursors of these cells.

Sources of immune effector cells can include both allogeneic and autologous sources. In some cases, immune effector cells can be differentiated from stem cells or induced pluripotent stem cells (iPSCs). Thus, cells for manipulation according to the present embodiments can be isolated from umbilical cord blood, peripheral blood, human embryonic stem cells or iPSCs. For example, allogeneic T cells can be modified to contain chimeric antigen receptors (and, optionally, to lack functional TCRs). In some aspects, immune effector cells are primary human T cells, such as T cells derived from human peripheral blood mononuclear cells (PBMCs). PBMCs can be collected from peripheral blood or after stimulation with G-CSF (granulocyte colony stimulating factor) from bone marrow or umbilical cord blood. After transfection or transduction (e.g., with a CAR-expressing construct), the cells can be immediately infused or cryopreserved. In one embodiment, after transfection, the cells can be expanded ex vivo as a bulk population for days, weeks or months within about 1, 2, 3, 4, 5 or more days after gene introduction into the cells. In another embodiment, after transfection, the transfectants are cloned and clones that exhibit the presence of a single integrated or episomally maintained expression cassette or plasmid and expression of the chimeric antigen receptor are expanded ex vivo. Clones selected for expansion exhibit the ability to specifically recognize and lyse antigen-expressing target cells. The recombinant T cells can be expanded by stimulation with IL-2 or other cytokines that bind to the common gamma chain (e.g., IL-7, IL-12, IL-15, IL-21, etc.). The recombinant T cells can be expanded by stimulation with artificial antigen presenting cells. The recombinant T cells can be expanded on artificial antigen presenting cells or can be expanded using an antibody such as OKT 3 that crosslinks CD3 on the surface of the T cells. The recombinant T cell subsets can be further selected using magnetic bead-based isolation methods and/or fluorescence activated cell sorting techniques and further cultured in the presence of AaPCs. In another embodiment, the genetically modified cells can be cryopreserved.

T cells can also be obtained from a number of sources, including peripheral blood, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue at the site of infection, ascites, pleural effusion, splenic tissue, and tumors (tumor infiltrating lymphocytes). In certain embodiments of the present disclosure, a number of T cell lines available in the art can be used. In certain embodiments of the present disclosure, T cells can be obtained from a unit of blood collected from a subject using a number of techniques known to those of skill in the art, such as Ficoll® separation. In some embodiments, cells from an individual's circulating blood are obtained by apheresis. Apheresis products typically contain lymphocytes, such as T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets. In one embodiment, cells collected by apheresis can be washed to remove the plasma fraction and place the cells in an appropriate buffer or medium for subsequent processing steps. In one embodiment of the present disclosure, the cells are washed with phosphate buffered saline (PBS). In another embodiment, the wash solution lacks calcium, can lack magnesium, or can lack many, if not all, divalent cations. An initial activation step in the absence of calcium results in enhanced activation. As one of skill in the art will readily appreciate, the wash step can be accomplished by methods known to those of skill in the art, such as by using a semi-automated "flow-through" centrifuge (e.g., Cobe 2991 cell processor, Baxter CytoMate, or Haemonetics Cell Saver 5) according to the manufacturer's instructions. After washing, the cells can be resuspended, for example, in a variety of biocompatible buffers, such as Ca2+-free, Mg2-free PBS, PlasmaLyte A, or other salt solutions with or without buffers. Alternatively, the undesirable components of the apheresis sample can be removed and the cells resuspended directly in culture medium.

In another embodiment, T cells are isolated from peripheral blood lymphocytes by lysis of red blood cells and depletion of monocytes, e.g., by centrifugation through a PERCOLL® gradient or by counterflow centrifugal elutriation. Specific subpopulations of T cells, e.g., CD3+, CD28+, CD4+, CD8+, CD45RA+ and CD45RO+ T cells, can be further isolated by positive or negative selection techniques.

Enrichment of T cell populations by negative selection can be accomplished with a combination of antibodies against surface markers unique to the negatively selected cells. One method is cell sorting and/or selection by negative magnetic immunoadhesion or flow cytometry using a cocktail of monoclonal antibodies against cell surface markers present on the cells being negatively selected. For example, when enriching for CD4+ cells by negative selection, the monoclonal antibody cocktail typically includes antibodies against CD14, CD20, CD11b, CD16, HLA-DR and CD8. In certain embodiments, it may be desirable to enrich or positively select for regulatory T cells, which typically express CD4+, CD25+, CD62Lhi, GITR+ and FoxP3+. Alternatively, in certain embodiments, T regulatory cells are depleted by anti-CD25-conjugated beads or other similar selection methods.

To isolate the desired cell population by positive or negative selection, the concentration of cells and surfaces (e.g., particles such as beads) can be varied. In certain embodiments, it may be desirable to significantly reduce the volume in which the beads and cells are mixed together (i.e., increase the concentration of cells) to ensure maximum contact between the cells and the beads. For example, in one embodiment, a concentration of 2 billion cells/ml is used. In one embodiment, a concentration of 1 billion cells/ml is used. In another embodiment, a concentration of more than 100 million cells/ml is used. In another embodiment, a cell concentration of 10, 15, 20, 25, 30, 35, 40, 45, or 50 million cells/ml is used. In yet another embodiment, a cell concentration of 75, 80, 85, 90, 95, or 100 million cells/ml is used. In another embodiment, a concentration of 125 or 150 million cells/ml may be used. The use of higher concentrations may result in increased cell yield, cell activation and cell proliferation. Additionally, the use of higher cell concentrations may allow for more efficient capture of cells that may weakly express the desired target antigen, such as CD28-negative T cells, or from samples in which a large number of tumor cells are present (i.e., leukemic blood, tumor tissue, etc.). Such cell populations may have therapeutic value and would be desirable to obtain. For example, the use of higher cell concentrations may allow for more efficient selection of CD8+ T cells that normally exhibit weaker CD28 expression.

In related embodiments, it may be desirable to use lower cell concentrations. By significantly diluting the mixture of T cells and a surface (e.g., a particle such as a bead), interactions between the particles and the cells are minimized. This selects for cells that express high amounts of the desired antigen that binds to the particles. For example, CD4+ T cells express higher levels of CD28 than CD8+ T cells, and are captured more efficiently at dilute concentrations. In one embodiment, the cell concentration used is 5x106/ml. In other embodiments, the concentration used can be about 1x105/ml to 1x106/ml and any integer value therebetween.

In other embodiments, the cells can be incubated at 2-10°C or at room temperature for various lengths of time on a rotating device at various speeds.

Alternatively, T cells for stimulation may be frozen after a washing step. After a washing step to remove plasma and platelets, the cells may be suspended in a freezing solution. Although numerous freezing solutions and parameters are known in the art and are useful in this case, one method involves using PBS containing 20% DMSO and 8% human serum albumin, or a medium containing the following: 10% dextran 40 and 5% dextrose, 20% human serum albumin and 7.5% DMSO, or 31.25% Plasmalyte-A, 31.25% dextrose 5%, 0.45% NaCl, 10% dextran 40 and 5% dextrose, 20% human serum albumin, and 7.5% DMSO, or other suitable cell freezing medium containing, for example, Hespan and PlasmaLyte A, and then the cells are frozen to -80°C at a rate of 1°C/min and stored in the vapor phase of a liquid nitrogen storage tank. Other methods of controlled freezing, as well as uncontrolled freezing immediately to -20°C or in liquid nitrogen, may also be used.

In some embodiments, the cryopreserved cells are thawed and washed as described herein and allowed to sit at room temperature for 1 hour prior to activation using the methods of the present disclosure.

Also contemplated in the present disclosure is the collection of blood samples or apheresis products from a subject at a time prior to when the expanded cells described herein may be needed. Thus, a source of expanded cells can be collected at any time needed, and the desired cells, such as T cells, isolated and frozen for later use in T cell therapy for a number of diseases or conditions that would benefit from T cell therapy, such as those described herein. In one embodiment, a blood sample or apheresis is taken from a generally healthy subject. In certain embodiments, a blood sample or apheresis is taken from a generally healthy subject at risk of developing a disease, but who has not yet developed the disease, and the cells of interest are isolated and frozen for later use. In certain embodiments, the T cells can be expanded, frozen, and later used. In certain embodiments, the sample is collected from the patient immediately after diagnosis and prior to treatment of the particular disease described herein. In another embodiment, cells are isolated from a blood sample or apheresis from the subject prior to a number of relevant therapies including, but not limited to, treatment with drugs such as natalizumab, efalizumab, antivirals, chemotherapy, radiation, immunosuppressants such as closporin, azathioprine, methotrexate, mycophenolate and FK506, antibodies, or other immunoablative agents such as CAMPATH, anti-CD3 antibodies, cytoxan, fludarabine, cyclosporin, FK506, rapamycin, mycophenolic acid, steroids, FR901228, and radiation. These drugs inhibit the calcium-dependent phosphatase calcineurin (cyclosporine and FK506) or inhibit p70S6 kinase, which is important in growth factor-induced signal transduction (rapamycin) (Liu et al., Cell 66:807-815, (1991); Henderson et al., Immun 73:316-321, (1991); Bierer et al., Curr. Opin. Immun 5:763-773, (1993)). In another embodiment, cells are isolated for the patient and frozen for later use with bone marrow or stem cell transplantation, T cell ablative therapy using chemotherapeutic agents such as fludarabine, external beam radiation therapy (XRT), cyclophosphamide, or antibodies such as OKT3 or CAMPATH. In another embodiment, cells can be isolated and frozen for later use for treatment following B cell ablative therapy with agents that react with CD20, such as Rituxan.

In another embodiment of the present disclosure, T cells are obtained from a patient immediately after treatment. In this regard, following certain cancer treatments, particularly treatments with drugs that impair the immune system, immediately after treatment during the period when the patient is recovering normally from the treatment, the quality of the T cells obtained may be optimal or improved in terms of their ex vivo expansion capacity. Similarly, following ex vivo manipulation using the methods described herein, these cells may be in a favorable state for enhanced engraftment and in vivo expansion. Thus, it is envisioned in the present disclosure to collect blood cells, including T cells, dendritic cells, or other cells of the hematopoietic system, during this recovery phase. Furthermore, in certain embodiments, mobilization (e.g., mobilization with GM-CSF) and conditioning regimens can be used to generate a state in the subject in which repopulation, recirculation, regeneration, and/or proliferation of certain cell types is favorable, particularly during certain time windows following treatment. Exemplary cell types include T cells, B cells, dendritic cells, and other cells of the immune system.

T Cell Activation and Proliferation In certain embodiments, T cells are provided that comprise a polynucleotide encoding a polypeptide construct described herein that selectively binds to the J configuration of CD277. Whether prior to or after genetic modification of the T cells to express a desired polypeptide construct, the T cells may generally be activated and expanded using methods described, for example, in U.S. Patent Nos. 6,352,694, 6,534,055, 6,905,680, 6,692,964, 5,858,358, 6,887,466, 6,905,681, 7,144,575, 7,067,318, 7,172,869, 7,232,566, 7,175,843, 5,883,223, 6,905,874, 6,797,514, 6,867,041, and U.S. Patent Application Publication No. 20060121005.

"Adoptive T cell transfer" refers to the isolation and ex vivo expansion of tumor-specific T cells to obtain a larger number of T cells than can be obtained by vaccination alone or by the patient's natural tumor response. In the context of the current disclosure, tumor-specific T cells can be obtained, for example, by engineering T cells to express a polypeptide construct described herein that selectively binds to the J configuration of cell surface CD277. The tumor-specific T cells can then be infused into a cancer patient to endow the cancer patient's immune system with the ability to overcome residual tumors with T cells that can attack and kill the cancer. Numerous forms of adoptive T cell therapy are used in cancer treatment, including culturing tumor-infiltrating lymphocytes or TILs, isolating and expanding one specific T cell or clone, and using T cells engineered to potently recognize and attack tumors.

Pharmaceutical Compositions and Dosage Forms In some embodiments, the present specification discloses compositions comprising the polypeptide constructs disclosed herein, polynucleotides encoding same, or engineered cells expressing same, for administration in a subject. In some cases, modified effector cell compositions are provided that encode the polynucleotides or polypeptides disclosed herein, and optionally contain cytokines and/or additional therapeutic substances, such as intermediates of the mammalian mevalonate pathway, such as isopentenyl pyrophosphate (IPP), and intermediates of the microbial 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway. In some embodiments, the pharmaceutical composition may include an agent that enhances the activity of RhoB GTPase in a target cell (e.g., a cancer cell) of a subject. In some embodiments, the agent may increase the translocation of RhoB GTPase to the cell membrane of the cancer cell. In some embodiments, the agent may maintain RhoB GTPase in the cell membrane of the cancer cell. In some embodiments, the substance may increase the translocation of RhoB GTPase from the nucleus of the cancer cell. In some aspects, the substance may increase the expression of a gene or transcript encoding RhoB GTPase. In some embodiments, the substance may increase the stability of RhoB GTPase. In some embodiments, the substance may increase the interaction of RhoB GTPase with BNT3 protein. In some embodiments, the substance may activate RhoB GTPase. In some embodiments, the substance may increase the interaction of RhoB GTPase with GTP. In some embodiments, the substance may decrease the interaction of RhoB GTPase with GDP. In some embodiments, the substance may increase the amount of GTP in the cancer cell. In some embodiments, the substance may increase the availability of GTP in the cancer cell. In some embodiments, the substance can be bound to a moiety that binds to a cell surface molecule on cancer cells, thereby targeting the substance to cancer cells. In some embodiments, the moiety comprises a small molecule compound, a peptide, or an antibody or antigen-binding fragment. In one embodiment, the substance that enhances the activity of RhoB GTPase does so indirectly by binding to a secondary factor that stimulates the activity of RhoB GTPase. The secondary factor can be involved in the RhoB GTPase activation cascade. In one embodiment, the secondary factor can be involved in signal transduction, structural changes, conformational changes, configurational changes, etc. In one embodiment, the substance that enhances the activity of RhoB GTPase can enhance activity at any site upstream of the stimulation pathway of RhoB GTPase. For example, the substance can be "A", which in turn stimulates "B", which in turn stimulates "C", which in turn stimulates RhoB GTPase. In one embodiment, the agent directly stimulates RhoB GTPase without the involvement of any secondary factors. The agent may increase the activity of RhoB GTPase by about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or up to about 100% as compared to a comparable method or composition without a RhoB GTPase stimulator.

In some embodiments, the agent may increase the amount of intracellular phosphoantigen in the cancer cell. In some embodiments, the additional agent is a mevalonate pathway inhibitor. The mevalonate pathway inhibitor may inhibit a factor involved in the production of mevalonate. In one aspect, the mevalonate pathway inhibitor may inhibit a reaction involved in the mevalonate pathway. In one aspect, the mevalonate inhibitor may inhibit an enzyme such as acetoacetyl-CoA, 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA), HMG-CoA reductase, mevalonate-5-phosphate, farnesyl pyrophosphate synthase (FPPS), mevalonate-5-kinase, mevalonate-3-phosphate-5-kinase, phosphomevalonate kinase, mevalonate-5-pyrophosphate decarboxylase, isopentenyl pyrophosphate isomerase, ATP, and combinations thereof. In some embodiments, the mevalonate pathway inhibitor is an aminobisphosphonate. In one embodiment, the agent can be hydrogen sulfide (H ₂ S). In one embodiment, the agent can be DM-22. In some embodiments, the aminobisphosphonate is zoledronate. In one embodiment, the agent can be a statin. In one embodiment, the statin can inhibit the mevalonate pathway. In one embodiment, the agent can be used to treat bone disease, multiple myeloma, or a combination thereof. In one embodiment, the agent that enhances the activity of a phosphoantigen can directly bind to and stimulate the activity of a phosphoantigen. In one embodiment, the agent that enhances the activity of a phosphoantigen does so indirectly by binding to a secondary factor that stimulates the activity or accumulation of the phosphoantigen in the cytoplasm of the tumor cell. The secondary factor can be involved in the phosphoantigen production cascade. In one embodiment, the secondary factor can be involved in translation, signal transduction, structural changes, conformational changes, configurational changes, and the like. In one embodiment, an agent that enhances phosphoantigen activity may enhance activity at any site upstream in the phosphoantigen pathway. For example, the agent is "A," which in turn stimulates "B," which in turn stimulates "C," which in turn stimulates phosphoantigen leading to accumulation in the cytoplasm. In one embodiment, the agent directly stimulates phosphoantigen accumulation without the involvement of any secondary factor. The agent may increase phosphoantigen activity, e.g., phosphoantigen accumulation, by about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or up to about 100% compared to an equivalent method or composition without the phosphoantigen stimulator.

In one embodiment, a synergistic method for tumor cell cytotoxicity may be provided herein. In one embodiment, a method of treatment may include administering one or more agents that enhance expression of CD277 on the cell surface. Agents that may enhance expression of CD277 may act by enhancing RhoB GTPase and/or phosphoantigen activity in the cytoplasm of tumor cells. In one embodiment, tumor cytotoxicity may be increased by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or up to about 100% compared to a comparable method or composition without a phosphoantigen stimulator or a Rho GTPase stimulator or combinations thereof.

In one embodiment, a method for enhancing expression of CD277 on the surface of a tumor cell can be provided, comprising enhancing the activity of an intracellular factor that binds to the inner portion of CD277.

In some embodiments, the various pharma- ceutically active ingredients described herein may be administered to a subject in need thereof in the same pharmaceutical composition. For example, a substance that enhances the activity of RhoB GTPase in a target cell may be administered in the same pharmaceutical composition as a polypeptide construct, a polynucleotide encoding it, or an engineered cell expressing it. Thus, in such pharmaceutical compositions containing multiple pharma- ceutically active ingredients, the multiple pharma- ceutically active ingredients are administered simultaneously to a subject in need thereof. In other embodiments, the different pharma- ceutically active ingredients described herein may be administered to a subject in need thereof in different pharmaceutical compositions. For example, a substance that enhances the activity of RhoB GTPase in a target cell may be administered in different pharmaceutical compositions as a polypeptide construct, a polynucleotide encoding it, or an engineered cell expressing it. In such compositions, a first composition comprising a first pharma- ceutically active ingredient may be administered before, after, or simultaneously with a second composition comprising a second pharma- ceutically active ingredient. For example, in some embodiments, a first composition comprising a polypeptide construct, a polynucleotide construct encoding it, or an engineered cell expressing it is administered to a subject in need thereof prior to administration of a second composition comprising a substance that enhances the activity of RhoB GTPase in a target cell. In some embodiments, a first composition comprising a polypeptide construct, a polynucleotide construct encoding it, or an engineered cell expressing it is administered to a subject in need thereof after administration of a second composition comprising a substance that enhances the activity of RhoB GTPase in a target cell. In some embodiments, a first composition comprising a polypeptide construct, a polynucleotide construct encoding it, or an engineered cell expressing it is administered to a subject in need thereof simultaneously with administration of a second composition comprising a substance that enhances the activity of RhoB GTPase in a target cell. In some cases, a first composition comprising a first pharmaceutically active ingredient may be administered at a predetermined time interval relative to a second composition comprising a second pharmaceutically active ingredient. In some cases, the first composition comprising the polypeptide construct, the polynucleotide construct encoding it, or the engineered cells expressing it is administered to the subject in a single dose once a day, and the second composition comprising the substance that enhances the activity of RhoB GTPase in the target cells is administered in multiple doses at various times during the day. In some cases, the composition comprising the substance that enhances the activity of RhoB GTPase in the target cells is administered as a controlled release formulation for sustained release over a period of time, and the second composition comprising the polypeptide construct, the polynucleotide construct encoding it, or the engineered cells described herein is administered at various intervals during the period of time.

In one aspect, the composition comprising the cells may include a formulation of the cells. With this application in hand, one of skill in the art can determine a therapeutically effective amount of cells for administration. In some cases, about 5×10 ¹⁰ cells are administered to a subject. In some cases, about 5×10 ¹⁰ cells represent the median number of cells administered to a subject. In some embodiments, about 5×10 ¹⁰ cells may be introduced into a subject. In some embodiments, the number of cells is at least about 1 x ¹⁰ cells, at least about 2 x ¹⁰ cells, at least about 3 x ¹⁰ cells, at least about 4 x ¹⁰ cells, at least about 5 x ¹⁰ cells, at least about 6 x ¹⁰ cells, at least about 6 x ¹⁰ cells, at least about 8 x ¹⁰ cells, at least about 9 x ¹⁰ cells, 1 x ¹⁰ cells, at least about 2 x ¹⁰ cells, at least about 3 x ¹⁰ cells, at least about 4 x ¹⁰ cells, at least about 5 x ¹⁰ cells, at least about 6 x ¹⁰ cells, at least about 6 x ¹⁰ cells, at least about 8 x ¹⁰ cells, at least about 9 x ¹⁰ cells, at least about 1 x ¹⁰ cells, at least about 2 x ¹⁰ cells, at least about 3 x ¹⁰ cells, at least about 4 x ¹⁰ cells, at least about 5 x ¹⁰ cells, at least about 6 x ¹⁰ cells, at least about 6 x 10 cells ⁸ cells, at least about 8x10 ⁸ cells, at least about 9x10 ⁸ cells, at least about 1x10 ⁹ cells, at least about 2x10 ⁹ cells, at least about 3x10 ⁹ cells, at least about 4x10 ⁹ cells, at least about 5x10 ⁹ cells, at least about 6x10 ⁹ cells, at least about 6x10 ⁹ cells, at least about 8x10 ⁹ cells, at least about 9x10 ⁹ cells, at least about 1x10 ¹⁰ cells, at least about 2x10 ¹⁰ cells, at least about 3x10 ¹⁰ cells, at least about 4x10 ¹⁰ cells, at least about 5x10 ¹⁰ cells, at least about 6x10 ¹⁰ cells, at least about 6x10 ¹⁰ cells, at least about 8x10 ¹⁰ cells, at least about 9x10 ¹⁰ cells, at least about 1x10 ¹¹ cells, at least about 2x10 ¹¹ cells, at least about 3x10 In some embodiments, at least about ¹ ×10 ¹¹ cells, at least about 4×10 ¹¹ cells, at least about 5×10 ¹¹ cells, at least about 6×10 ¹¹ cells, at least about 6×10 11 cells, at least about 8×10 ¹¹ cells, at least about 9×10 ¹¹ cells, or at least about 1×10 ¹² cells are administered to the subject.

In one embodiment, the subject may receive additional treatment or therapeutic agents. The compositions and methods disclosed herein may include administration of other agents. For example, the additional agents may include cytotoxic/antitumor agents and antiangiogenic agents. Cytotoxic/antitumor agents may be defined as agents that attack and kill cancer cells. Some cytotoxic/antitumor agents may be alkylating agents that alkylate genetic material in tumor cells, such as cisplatin, cyclophosphamide, nitrogen mustard, trimethylene thiophosphoramide, carmustine, busulfan, chlorambucil, verstine, uracil mustard, chromafazine, and dacabanidine. Other cytotoxic/antitumor agents may be antimetabolites for tumor cells, such as cytosine arabinoside, fluorouracil, methotrexate, mercaptopurine, azathioprime, and procarbazine. Other cytotoxic/antitumor agents may be antibiotics such as doxorubicin, bleomycin, dactinomycin, daunorubicin, mithramycin, mitomycin, mitomycin C, and daunomycin. There are numerous liposomal formulations of these compounds available commercially. Still other cytotoxic/antitumor agents may be mitotic inhibitors (vinca alkaloids). These include vincristine, vinblastine, and etoposide. Other cytotoxic/antitumor agents include taxol and its derivatives, L-asparaginase, antitumor antibodies, dacarbazine, azacytidine, amsacrine, melphalan, VM-26, ifosfamide, mitoxantrone, and vindesine.

In some cases, the substance may include an immune stimulant. The immune stimulant may be specific or non-specific. A specific immune stimulant may provide antigen specificity, such as a vaccine or antigen. A non-specific immune stimulant may enhance or stimulate an immune response. The non-specific immune stimulant may be an adjuvant. The immune stimulant may be a vaccine, a colony stimulating substance, an interferon, an interleukin, a virus, an antigen, a co-stimulatory substance, an immunogenic substance, an immunomodulatory substance, or an immunotherapeutic substance. The immune stimulant may be a cytokine, such as an interleukin. One or more cytokines may be introduced into the cells of the invention. The cytokines may be used to enhance cytotoxic T lymphocytes (including adoptively transferred tumor-specific cytotoxic T lymphocytes) to proliferate within the tumor microenvironment. In some cases, IL-2 may be used to promote proliferation of the cells described herein. Cytokines such as IL-15 may also be used. Other relevant cytokines in the field of immunotherapy, such as IL-2, IL-7, IL-12, IL-15, IL-21, or any combination thereof, may also be used. In some cases, IL-2, IL-7, and IL-15 are used to culture the cells of the invention. The interleukin may be IL-2 or aldescoikin. Aldesleukin may be administered in low or high doses. High dose aldesleukin therapy may include intravenous administration of aldesleukin at about 0.037 mg/kg (600,000 IU/kg) every 8 hours for up to about 14 doses, depending on tolerability. The immune stimulant (e.g., aldesleukin) may be administered within 24 hours after cell administration. The immune stimulant (e.g., aldesleukin) may be administered as an infusion over about 15 minutes about every 8 hours for up to about 4 days after cell infusion. The immune stimulant (e.g., aldesleukin) may be administered at a dose of from about 100,000 IU/kg, 200,000 IU/kg, 300,000 IU/kg, 400,000 IU/kg, 500,000 IU/kg, 600,000 IU/kg, 700,000 IU/kg, 800,000 IU/kg, 900,000 IU/kg or up to about 1,000,000 IU/kg. In some cases, aldesleukin may be administered in a dose of about 100,000 IU/kg to 300,000 IU/kg, 300,000 IU/kg to 500,000 IU/kg, 500,000 IU/kg to 700,000 IU/kg, 700,000 IU/kg to about 1,000,000 IU/kg. The immune stimulant (e.g., aldesleukin) may be administered in 1 dose to about 14 doses.

In some cases, the additional agent may include an immunosuppressant as part of the treatment regimen. An immunosuppressant refers to a radiotherapy agent, a biologic, or a chemical. In some cases, the immunosuppressant may include a chemical. For example, the chemical may include at least one member selected from the group consisting of cyclophosphamide, mechlorethamine, chlorambucil, melphalan, ifosfamide, thiotepa, hexamethylmelamine, busulfan, fludarabine, nitrosourea, platinum, methotrexate, azathioprine, mercaptopurine, procarbazine, dacarbazine, temozolomide, carmustine, lomustine, streptozocin, fluorouracil, dactinomycin, anthracycline, mitomycin C, bleomycin, and mithramycin. The chemical may be cyclophosphamide or fludarabine.

Also, the immunosuppressant may include glucocorticoids, cytostatics, antibodies, anti-immunophilins, or any derivatives thereof. Glucocorticoids may suppress allergic reactions, inflammation, and autoimmune conditions. Glucocorticoids may be prednisone, dexamethasone, and hydrocortisone. Immunosuppressive therapy may include any treatment that suppresses the immune system. Immunosuppressive therapy helps to alleviate, minimize, or eliminate transplant rejection in the recipient. For example, immunosuppressive therapy may include immunosuppressants. Immunosuppressants that may be used before, during and/or after transplant include MMF (mycophenolate mofetil (Cellcept)), ATG (antithymocyte globulin), anti-CD154 (CD4OL), anti-CD40 (2C10, ASKP1240, CCFZ533X2201), alemtuzumab (Campath), anti-CD20 (rituximab), anti-IL-6R antibodies (tocilizumab, Actemra), anti-IL-6 antibodies (sarilumab, olokizumab), CTLA4-Ig (Abatacept/Orencia), belatacept (LEA29Y), sirolimus (Rapim), and/or cyclosporine (cyclosporine). These include, but are not limited to, cyclosporine, deoxyspergualin, soluble complement receptor 1, cobra venom factor, compstatin, anti-C5 antibody (eculizumab/Soliris), methylprednisolone, FTY720, everolimus, leflunomide, anti-IL-2R-Ab, rapamycin, anti-CXCR3 antibody, anti-ICOS antibody, anti-OX40 antibody, and anti-CD122 antibody. Additionally, one or more immunosuppressants/drugs may be used together or sequentially. One or more immunosuppressants/drugs may be used for induction or maintenance therapy. The same or different drugs may be used in the induction and maintenance phases. In some cases, daclizumab (Zenapax) may be used for induction therapy, and tacrolimus (Prograf) and sirolimus (Rapimune) may be used for maintenance therapy. Daclizumab (Zenapax) may also be used for induction therapy, and low-dose tacrolimus (Prograf) and low-dose sirolimus (Rapimune) may be used for maintenance therapy. Immunosuppression may also be achieved using non-drug regimens, including, but not limited to, total body irradiation, thymic irradiation, and total and/or partial splenectomy.

In some cases, pharmaceutical compositions are formulated in the usual manner using one or more physiologically acceptable carriers, including auxiliary substances and excipients that facilitate processing of the active compound into a medicament that can be used pharma- ceutically. The appropriate formulation depends on the route of administration selected. Overviews of pharmaceutical compositions described herein are found, for example, in Remington: The Science and Practice of Pharmacy, Nineteenth Ed. (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, H. A. and Lachman, L., eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y., 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Ed. (Lippincott Williams & Wilkins 1999).

The pharmaceutical compositions are prepared in a conventional manner, for example by means of conventional mixing, dissolving, granulating, dragee-making, pulverizing, emulsifying, encapsulating, entrapping or compressing processes, if desired.

In certain embodiments, the composition may also include one or more pH adjusters or buffers, such as acids, such as acetic acid, boric acid, citric acid, lactic acid, phosphoric acid, and hydrochloric acid; bases, such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, sodium lactate, tris-hydroxymethylaminomethane; and buffers, such as citrate/dextrose, sodium bicarbonate, and ammonium chloride. Such acids, bases, and buffers are included in amounts necessary to maintain the pH of the composition in an acceptable range.

In other embodiments, the composition may contain one or more salts in an amount necessary to bring the osmolality of the composition into an acceptable range. Such salts include those containing sodium, potassium or ammonium cations and chloride, citrate, ascorbate, borate, phosphate, bicarbonate, sulfate, thiosulfate or bisulfite anions; suitable salts include sodium chloride, potassium chloride, sodium thiosulfate, sodium bisulfite and ammonium sulfate.

The pharmaceutical compositions described herein are administered by any suitable route of administration, including, but not limited to, oral, parenteral (e.g., intravenous, subcutaneous, intramuscular, intracerebral, intraventricular, intraarticular, intraperitoneal, or intracranial), intranasal, buccal, sublingual, or rectal routes of administration. In some cases, the pharmaceutical compositions are formulated for parenteral (e.g., intravenous, subcutaneous, intramuscular, intracerebral, intraventricular, intraarticular, intraperitoneal, or intracranial) administration.

The pharmaceutical compositions described herein are formulated into any suitable dosage form, including, but not limited to, aqueous oral dispersions, solutions, gels, syrups, elixirs, slurries, suspensions, etc., for oral ingestion by the individual to be treated, solid oral dosage forms, aerosols, controlled release formulations, fast dissolve formulations, effervescent formulations, lyophilized formulations, tablets, powders, pills, dragees, capsules, delayed release formulations, sustained release formulations, pulsatile release formulations, multiparticulate formulations, and mixed immediate release and controlled release formulations. In some embodiments, the pharmaceutical composition is formulated into a capsule. In some embodiments, the pharmaceutical composition is formulated into a solution (e.g., for IV administration). In some cases, the pharmaceutical composition is formulated as an infusion (infusion). In some cases, the pharmaceutical composition is formulated as an injection.

The pharmaceutical solid dosage forms described herein may optionally contain a compound described herein and one or more pharma- ceutically acceptable excipients, such as a compatible carrier, a binder, a filler, a suspending agent, a flavoring agent, a sweetening agent, a disintegrant, a dispersing agent, a surfactant, a lubricant, a colorant, a diluent, a solubilizer, a wetting agent, a plasticizer, a stabilizer, a permeation enhancer, a humectant, an antifoaming agent, an antioxidant, a preservative, or one or more combinations thereof.

In yet other embodiments, a film coating is applied around the composition using standard coating techniques, such as those described in Remington's Pharmaceutical Sciences, 20th Edition (2000). In some embodiments, the composition is formulated into particles (e.g., for administration via capsules) and some or all of the particles are coated. In some embodiments, the composition is formulated into particles (e.g., for administration via capsules) and some or all of the particles are not microencapsulated or coated.

In certain embodiments, the compositions provided herein may include one or more preservatives to inhibit microbial activity. Suitable preservatives include mercury-containing substances, such as merfen and thiomersal, stabilized chlorine dioxide, and quaternary ammonium compounds, such as benzalkonium chloride, cetyltrimethylammonium bromide, and cetylpyridinium chloride.

"Proliferative disease" as referred to herein refers to a unifying concept indicating that excessive cell proliferation and cell-matrix turnover contribute significantly to the pathogenesis of several diseases, including cancer.

As used herein, "subject" or "patient" refers to a mammalian subject diagnosed as having or developing or suspected of having a physiological condition, such as, for example, cancer or an autoimmune condition or infection. In some embodiments, the term "patient" or "subject" refers to a mammalian subject that has a higher than average likelihood of developing cancer. Exemplary patients can be humans, apes, dogs, pigs, cows, cats, horses, goats, sheep, rodents, and other mammals that may benefit from the treatments disclosed herein. Exemplary human subjects can be male and/or female.

"Administering" as used herein means providing a composition of the present disclosure to a patient. By way of non-limiting example, administration, e.g., injection, of the composition may be by intravenous (i.v.), subcutaneous (s.c.), intradermal (i.d.), intraperitoneal (i.p.) or intramuscular (i.m.) injection. One or more such routes may be used. Parenteral administration may be by, for example, bolus injection or by gradual perfusion over time. Alternatively or concurrently, administration may be by oral route. Administration may also be by surgical deposition of a bolus or pellet of cells or placement of a medical device.

"Subject in need thereof" or "patient in need thereof," as used herein, refers to a subject or patient diagnosed with or suspected of having a disease or disorder, such as, but not limited to, a proliferative disorder, such as cancer. In one embodiment, the subject or patient has or is likely to develop a solid tumor or leukemia. In some embodiments, the leukemia can be, for example, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), and chronic myeloid leukemia (CML).

The compositions of the present disclosure may include engineered cells expressing a nucleic acid sequence encoding a polypeptide construct that binds to the J-configuration of CD277 or a vector containing said nucleic acid sequence in an amount effective to treat or prevent a proliferative disease. As used herein, the terms "treatment", "treat" and the like refer to obtaining a desired pharmacological and/or physiological effect. In some embodiments, the effect is therapeutic; that is, the effect partially or completely cures the disease and/or adverse symptoms resulting from the disease. To this end, the methods of the present invention include administering a "therapeutically effective amount" of a composition comprising host cells expressing a nucleic acid sequence of the present invention or a vector containing a nucleic acid sequence of the present invention.

"Therapeutically effective amount" means an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result. The therapeutically effective amount may vary depending on factors such as the condition, age, sex, and weight of the individual, and the ability of the nucleic acid sequences of the invention to elicit a desired response in the individual.

Alternatively, the pharmacological and/or physiological effect can be "prophylactic", i.e., the effect can completely or partially prevent a disease or its symptoms.

"Prophylactically effective amount" means an amount effective, at dosages and for periods of time necessary, to achieve a desired prophylactic result (e.g., prevention of disease onset).

"Antifoaming agents" reduce foaming during processing that can lead to coagulation of the aqueous dispersion, air bubbles in the final coating, or generally impair processing. Exemplary antifoaming agents include silicone emulsions or sorbitan sesquioleate.

"Antioxidants" include, for example, butylated hydroxytoluene (BHT), sodium ascorbate, ascorbic acid, sodium metabisulfite, and tocopherol. In some embodiments, antioxidants enhance chemical stability as needed.

The formulations described herein may benefit from antioxidants, metal chelators, thiol-containing compounds and other common stabilizers. Examples of such stabilizers include, but are not limited to, (a) about 0.5% to about 2% w/v glycerol, (b) about 0.1% to about 1% w/v methionine, (c) about 0.1% to about 2% w/v monothioglycerol, (d) about 1 mM to about 10 mM EDTA, (e) about 0.01% to about 2% w/v ascorbic acid, (f) 0.003% to about 0.02% w/v polysorbate 80, (g) 0.001% to about 0.05% w/v polysorbate 20, (h) arginine, (i) heparin, (j) dextran sulfate, (k) cyclodextrin, (l) pentosan polysulfate and other heparinoids, (m) divalent cations such as magnesium and zinc, or (n) combinations thereof.

"Binders" impart cohesiveness and include, for example: alginic acid and its salts; cellulose derivatives such as carboxymethylcellulose, methylcellulose (e.g., Methocel®), hydroxypropyl methylcellulose, hydroxyethyl cellulose, hydroxypropyl cellulose (e.g., Klucel®), ethylcellulose (e.g., Ethocel®) and microcrystalline cellulose (e.g., Avicel®); microcrystalline dextrose; amylose; magnesium aluminum silicate; polysaccharide acids; bentonite; gelatin; polyvinylpyrrolidone/vinyl acetate copolymers; crospovidone; povidone. starch; pregelatinized starch; tragacanth, dextrin, sugars such as sucrose (e.g., Dipac®), glucose, dextrose, molasses, mannitol, sorbitol, xylitol (e.g., Xylitab®) and lactose; natural or synthetic gums such as acacia, tragacanth, ghatti gum, isapol shell mucilage, polyvinylpyrrolidone (e.g., Polyvidone® CL, Kollidon® CL, Polyplasdone® XL-10), larch arabogalactan, Veegum®, polyethylene glycol, waxes, sodium alginate, etc.

"Carriers" or "carrier substances" include any commonly used excipients in pharmaceuticals and should be selected based on compatibility with the compounds disclosed herein, such as ibrutinib and anticancer drug compounds, and the release profile characteristics of the desired dosage form. Exemplary carrier substances include, for example, binders, suspending agents, disintegrants, fillers, surfactants, solubilizers, stabilizers, lubricants, wetting agents, diluents, and the like. "Pharmaceutically compatible carrier substances" may include, but are not limited to, acacia, gelatin, colloidal silicon dioxide, calcium glycerophosphate, calcium lactate, maltodextrin, glycerin, magnesium silicate, polyvinylpyrrolidone (PVP), cholesterol, cholesterol esters, sodium caseinate, soy lecithin, taurocholic acid, phosphotidylcholine, sodium chloride, tricalcium phosphate, dipotassium phosphate, cellulose and cellulose conjugates, sodium sugar stearoyl lactylate, carrageenan, monoglycerides, diglycerides, pregelatinized starch, and the like. See, e.g., Remington: The Science and Practice of Pharmacy, Nineteenth Ed (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E. , Remington's Pharmaceutical Sciences, Mack Publishing Co. , Easton, Pennsylvania 1975; Liberman, H. A. and Lachman, L. , Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y. Y. , 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Ed. (Lippincott Williams & Wilkins 1999).

"Dispersing agents" and/or "viscosity modifiers" include substances that control the granulation or blending process or the diffusion and homogeneity of the drug throughout the liquid medium. In some embodiments, these substances also enhance the effectiveness of the coating or erosion matrix. Exemplary diffusion enhancers/dispersing agents include, for example, hydrophilic polymers, electrolytes, Tween® 60 or 80, PEG, polyvinylpyrrolidone (PVP; commercially known as Plasdone®), and carbohydrate-based dispersing agents, such as hydroxypropylcellulose (e.g., HPC, HPC-SL, and HPC-L), hydroxypropylmethylcellulose (e.g., HPMC K100, HPMC K4M, HPMC K15M, and HPMC K2M). K100M), sodium carboxymethylcellulose, methylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose phthalate, hydroxypropylmethylcellulose acetate stearate (HPMCAS), amorphous cellulose, magnesium aluminum silicate, triethanolamine, polyvinyl alcohol (PVA), vinylpyrrolidone/vinyl acetate copolymer (S630), 4-(1,1,3,3-tetramethylbutyl)-phenol polymers with ethylene oxide and formaldehyde (also known as tyloxapol), poloxamers (e.g., Pluronics F68®, F88®, and F108®; which are block copolymers of ethylene oxide and propylene oxide); and poloxamines (e.g., Tetronic 908®; also known as Poloxamine 908®; which is a tetrafunctional block copolymer derived from the sequential addition of propylene oxide and ethylene oxide to ethylenediamine (BASF Chemical Industries, Ltd. Corporation, Parsippany, NJ), polyvinylpyrrolidone K12, polyvinylpyrrolidone K17, polyvinylpyrrolidone K25 or polyvinylpyrrolidone K30, polyvinylpyrrolidone/vinyl acetate copolymer (S-630), polyethylene glycol (e.g., the polyethylene glycol can have a molecular weight of about 300 to about 6000, or about 3350 to about 4000, or about 7000 to about 5400), sodium carboxymethylcellulose, methylcellulose, polysorbate-80, a Sodium alginate, gums such as tragacanth and acacia, guar gum, xanthan, sugars, cellulosic materials such as sodium carboxymethylcellulose, methylcellulose, sodium carboxymethylcellulose, polysorbate-80, sodium alginate, polyethoxylated sorbitan monolaurate, polyethoxylated sorbitan monolaurate, povidone, carbomer, polyvinyl alcohol (PVA), alginates, chitosan and combinations thereof. Plasticizers such as cellulose or triethylcellulose may also be used as dispersing agents. Dispersing agents particularly useful in liposomal and self-emulsifying dispersions include dimyristoyl phosphatidylcholine, egg-derived natural phosphatidylcholine, egg-derived natural phosphatidylglycerol, cholesterol and isopropyl myristate.

Combinations of one or more erosion facilitators with one or more diffusion facilitators may also be used in the compositions.

The term "diluent" refers to a chemical used to dilute the compound of interest prior to delivery. Diluents may also be used to stabilize the compound, as they may provide a more stable environment. Salts dissolved in buffer solutions, which may also provide pH control or maintenance, are used as diluents in the art, including, but not limited to, phosphate buffered saline. In certain embodiments, diluents increase the volume of the composition to facilitate compression or generate sufficient volume for homogenous mixing for capsule filling. Such compounds include, for example: lactose, starch, mannitol, sorbitol, dextrose, microcrystalline cellulose, e.g., Avicel®; dibasic calcium phosphate, dicalcium phosphate dihydrate; tricalcium phosphate, calcium phosphate; anhydrous lactose, spray-dried lactose; pregelatinized starch, compressible sugars, e.g., Di-Pac® (Amstar); mannitol, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose acetate stearate, sucrose-based diluents, confectionery sugar; monobasic calcium sulfate monohydrate, calcium sulfate dihydrate; calcium lactate trihydrate, dextrates; hydrolyzed cereal solids, amylose; powdered cellulose, calcium carbonate; glycine, kaolin; mannitol, sodium chloride; inositol, bentonite, and the like.

"Bulking agents" include compounds such as lactose, calcium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, microcrystalline cellulose, cellulose powder, dextrose, dextrates, dextran, starch, pregelatinized starch, sucrose, xylitol, lactitol, mannitol, sorbitol, sodium chloride, polyethylene glycol, and the like.

"Lubricants" and "glidants" are compounds that prevent, reduce or inhibit adhesion or friction of materials. Exemplary lubricants include, for example, stearic acid, calcium hydroxide, talc, sodium stearyl fumarate, hydrocarbons such as mineral oils, or hydrogenated vegetable oils, such as hydrogenated soybean oil (Sterotex®), higher fatty acids and their alkali metal and alkaline earth metal salts, such as aluminum, calcium, magnesium, zinc, stearic acid, sodium stearate, glycerol, talc, wax, Stearowet®, boric acid, sodium benzoate, sodium acetate, sodium chloride, leucine, polyethylene glycol (e.g., PEG-4000) or methoxypolyethylene glycol, such as Carbowax®, sodium oleate, sodium benzoate, glyceryl behenate, polyethylene glycol, magnesium or sodium lauryl sulfate, colloidal silica, such as Syloid®, Cab-O-Sil®, starch, such as corn starch, silicone oil, surfactants, and the like.

"Plasticizers" are compounds used to soften microencapsulation materials or film coatings to make them less brittle. Suitable plasticizers include, for example, polyethylene glycol, PEG 300, PEG 400, PEG 600, PEG 1450, PEG 3350 and PEG 800, stearic acid, propylene glycol, oleic acid, triethylcellulose and triacetin. In some embodiments, plasticizers may also function as dispersing or wetting agents.

"Solubilizers" include, for example, compounds such as: triacetin, triethyl citrate, ethyl oleate, ethyl caprylate, sodium lauryl sulfate, sodium docusate, vitamin E TPGS, dimethylacetamide, N-methylpyrrolidone, N-hydroxyethylpyrrolidone, polyvinylpyrrolidone, hydroxypropyl methylcellulose, hydroxypropyl cyclodextrin, ethanol, n-butanol, isopropyl alcohol, cholesterol, bile salts, polyethylene glycol 200-600, glycofurol, transcutol, propylene glycol, and dimethyl isosorbide.

"Stabilizers" include compounds such as any antioxidants, buffers, acids, and preservatives.

"Suspending agents" include, for example, compounds such as: polyvinylpyrrolidone, e.g., polyvinylpyrrolidone K12, polyvinylpyrrolidone K17, polyvinylpyrrolidone K25 or polyvinylpyrrolidone K30, vinylpyrrolidone/vinyl acetate copolymer (S630), polyethylene glycol (e.g., the polyethylene glycol may have a molecular weight of about 300 to about 6000, or about 3350 to about 4000, or about 7000 to about 5400), sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, hydroxymethylcellulose acetate stearate, polysorbate-80, hydroxyethylcellulose, sodium alginate, gums such as gum tragacanth and gum acacia, guar gum, xanthan, e.g., xanthan gum, sugars, cellulosic substances such as sodium carboxymethylcellulose, methylcellulose, sodium carboxymethylcellulose, hydroxypropylmethylcellulose, hydroxyethylcellulose, polysorbate-80, sodium alginate, polyethoxylated sorbitan monolaurate, povidone, etc.

"Surfactants" include compounds such as sodium lauryl sulfate, sodium docusate, Tween 60 or 80, triacetin, Vitamin E TPGS, sorbitan monooleate, polyoxyethylene sorbitan monooleate, polysorbates, polaxomers, bile salts, glyceryl monostearate, copolymers of ethylene oxide and propylene oxide, such as Pluronic® (BASF), and the like. Some other surfactants include polyoxyethylene fatty acid glycerides, and vegetable oils, such as polyoxyethylene (60) hydrogenated castor oil, and polyoxyethylene alkyl ethers and alkyl phenyl ethers, such as Octoxynol 10, Octoxynol 40. In some embodiments, surfactants may be included to enhance physical stability or for other purposes.

"Viscosity enhancing agents" include, for example, methylcellulose, xanthan gum, carboxymethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, hydroxypropylmethylcellulose acetate stearate, hydroxypropylmethylcellulose phthalate, carbomer, polyvinyl alcohol, alginate, acacia, chitosan, and combinations thereof.

"Wetting agents" include compounds such as, for example, oleic acid, glyceryl monostearate, sorbitan monooleate, sorbitan monolaurate, triethanolamine oleate, polyoxyethylene sorbitan monooleate, polyoxyethylene sorbitan monolaurate, sodium docusate, sodium oleate, sodium lauryl sulfate, sodium docusate, triacetin, Tween 80, Vitamin E TPGS, ammonium salts, and the like.

Kits/Articles of Manufacture In some embodiments, the present specification discloses kits and articles of manufacture for use in one or more of the methods described herein. Such kits include carriers, packages, or containers (e.g., vials, tubes, etc.) that are compartmentalized to accommodate one or more containers, each of which contains one of the separate elements used in the methods described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. In one embodiment, the containers are formed from a variety of materials, such as glass or plastic.

The articles of manufacture provided herein contain packaging materials. Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, bags, containers, bottles, and any packaging suitable for the selected formulation and intended method of administration and treatment.

For example, the container may contain engineered cells expressing a polypeptide construct that selectively binds to the J-configuration of CD277, and may optionally further contain cytokines and/or chemotherapeutic agents and/or additional substances disclosed herein, such as intermediates of the mammalian mevalonate pathway, such as isopentenyl pyrophosphate (IPP), and intermediates of the microbial 2-C-methyl-D-erythitol 4-phosphate (MEP) pathway. Such kits may optionally include an identifying marking or label, or instructions for their use in the methods described herein.

The kit typically includes a label indicating the contents and/or instructions for use, as well as a package insert with instructions for use. A set of instructions is also typically included.

In some embodiments, the label is present on or affixed to the container. In one embodiment, the label is present on the container when the letters, numbers, or other symbols that make up the label are affixed, molded, or etched into the container itself, and the label is affixed to the container when it is present in a receptacle or carrier that houses the container, for example, as a package insert. In one embodiment, the label is used to indicate that the contents are to be used for a particular therapeutic application. The label also provides instructions for using the contents, for example, in the methods described herein.

Recognition Phenotype In certain embodiments provided herein, the polypeptide construct, the nucleotides encoding it and/or the engineered cells containing it can recognize a target cell (e.g., a tumor cell). In some embodiments, the engineered T cell can express a Vγ9Vδ2 TCR specific for a particular antigen (e.g., CD277) expressed on the surface of the target cell. Methods for identifying one or more T cells capable of recognizing a particular antigen on a target cell are described herein. A T cell or T cell population capable of recognizing a particular antigen can be identified by assaying for a recognition phenotype that results from a physical interaction between the T cell's TCR (e.g., Vγ9Vδ2 TCR) and a protein, antigen, ligand or cell surface molecule (e.g., CD277) expressed on the surface of the target cell. In some embodiments, the recognition phenotype can be a change in cellular state that occurs in the T cell as a result of recognition of the target cell by the Vγ9Vδ2 TCR. For example, the change in cellular state can include a change in the level of interferon (IFN) gamma production resulting from Vγ9Vδ2 TCR mediated activation of the T cell, which can be detected by methods known in the art (e.g., IFN-γ ELISPOT analysis). In other examples, the change in cellular state indicative of the recognition phenotype can involve molecular changes including qualitative or quantitative changes in gene expression (e.g., as determined by qRT-PCR or microarray analysis) and/or protein expression (e.g., as determined by Western blot or immunocytochemistry assays) resulting from Vγ9Vδ2 TCR mediated recognition of a target cell. In other embodiments, the recognition phenotype can include a physical manifestation of an interaction between the TCR of the T cell and a cell surface protein, ligand or antigen of the target cell. For example, the recognition phenotype can involve physical binding of the Vγ9Vδ2 TCR of the T cell to a cell surface protein, ligand or antigen of the target cell. In certain embodiments, the recognition phenotype involves the formation of a physical complex comprising a J configuration of the CD277 molecule on the surface of the target cell and a Vγ9Vδ2 TCR. Where the recognition phenotype involves the formation of a complex comprising a receptor and a ligand, the phenotype may be identified by known methods including immunoprecipitation, cell sorting or immunocytochemistry.

In the embodiments described herein, the recognition phenotype may vary between different subjects and/or between cells obtained from different subjects. For example, in some embodiments, target cells obtained from different subjects may vary in the degree to which the Vγ9Vδ2 TCR expressed in the engineered cells recognizes the target cells (e.g., via CD277 expressed on the surface of the target cells). Surface molecules of target cells obtained from some subjects may be recognized with high affinity by the Vγ9Vδ2 TCR expressed in the engineered cells. For target cells obtained from other subjects, surface molecules of the target cells may be recognized with low affinity or not recognized at all. Variation in recognition by the Vγ9Vδ2 TCR between target cells of different subjects is manifested in variation in the recognition phenotype expressed by those cells. For example, following exposure to T cells expressing the Vγ9Vδ2 TCR, target cells from different subjects may vary in the amount of IFN-γ production, gene or protein expression levels or patterns, and/or the degree of physical interaction between the Vγ9Vδ2 TCR of the T cells and cell surface proteins (e.g., CD277) of the target cells.

The polypeptide constructs described herein, the polynucleotides encoding them, and engineered cells containing them, when used to treat a subject in need thereof, may exhibit various therapeutic effects. The present specification discloses a method that includes stratifying a patient population (e.g., a cancer patient population) into multiple treatment groups based on the strength of individual phenotypes exhibited by the patient or the patient's cells. In some embodiments, the phenotype used to stratify the patient into treatment groups is a recognition phenotype. For example, a patient population may be stratified into several groups based on the presence, absence, or degree of a recognition phenotype in target cells obtained from the patient after exposure to T cells expressing Vγ9Vδ2 TCR, including the level of IFN-γ production or a quantitative or qualitative pattern of gene expression. In some embodiments, the phenotype used to stratify the patient into treatment groups is not a recognition phenotype based on the degree of recognition between T cells expressing Vγ9Vδ2 TCR and the target cells. Instead, the phenotype used as the basis for stratification may be a marker (i.e., a biomarker) present on the target cells prior to exposure to the T cells. For example, the presence or absence of a J configuration in cell surface expressed CD277 molecules can be a variable phenotype among target cells (e.g., tumor cells) of a patient and can therefore be used as a basis for separating or stratifying patients into different groups with different likelihoods of therapeutic success when administered the polypeptide constructs described herein.

In some embodiments, patients are stratified into at least two treatment groups, including a stratification group with a positive (good) treatment prognosis and a stratification group with a poor treatment prognosis. In some embodiments, patients classified into the positive treatment prognosis stratification group have target cells that exhibit a recognition phenotype, such as IFN-γ production, and a physical interaction between a Vγ9Vδ2 TCR and a CD277 molecule on the target cell (e.g., in the form of a complex that includes both the TCR and the CD277 molecule). In some embodiments, patients classified into the positive treatment prognosis stratification group have target cells that exhibit a CD277 cell surface molecule with a J configuration prior to contact with a Vγ9Vδ2 T cell. In some embodiments, patients classified into the positive treatment prognosis stratification group have target cells that lack or exhibit reduced expression of one or more recognition phenotypes (e.g., IFN-γ production), or target cells that do not exhibit a CD277 cell surface molecule with a J configuration.

Polymorphic Variation and Genetic Association The terms "nucleotide polymorphism", "genetic polymorphism" and "nucleotide sequence polymorphism" are used interchangeably herein to refer to variation in a nucleotide sequence at a particular location (i.e., "locus") of the genome in a single individual or between individuals. In some cases, a genetic polymorphism exists at a locus within the cells of an individual (i.e., the individual is heterozygous at a locus for a particular nucleotide sequence). In other cases, the nucleotide sequence at a particular locus of an individual is unchanged (i.e., the individual is homozygous for a nucleotide sequence at a particular locus), but the nucleotide sequence at the locus is polymorphic when compared to the DNA of a second individual. In some embodiments, a nucleotide polymorphism includes a variation at a single nucleotide at a locus. In such cases, a nucleotide polymorphism is referred to as a single nucleotide polymorphism or SNP. In other embodiments, a nucleotide polymorphism may include other types of DNA variations instead of or in addition to SNPs. As used herein, the term "polymorphism" contemplates any form of DNA variation, including single nucleotide polymorphisms, as well as structural variations, such as insertions, deletions, inversions and duplications.

In certain embodiments, a nucleotide polymorphism (e.g., a SNP) may be a functional mutation that causes phenotypic differences between cells, tissues, or organisms containing various forms of the polymorphism. For example, a SNP may be located within the open reading frame of a gene, thereby directly affecting the sequence of amino acids incorporated into the protein encoded by the gene. In other non-limiting examples, a polymorphism may cause phenotypic differences between individuals by altering the splicing of mRNA transcribed from a gene (e.g., if the SNP is located at a splice site), or by altering the level of expression of a gene (e.g., if the SNP is located within the promoter of a gene), or by affecting post-translational modification of a protein (e.g., if the SNP affects the expression or function of a factor that causes post-translational modification of another protein). In certain other embodiments, a nucleotide polymorphism may be a non-functional or neutral mutation that does not directly lead to phenotypic differences between individuals containing various forms of the polymorphism.

In certain embodiments, genetic polymorphisms (whether functional or non-functional) may be identified in association studies as being associated with a particular trait (e.g., a cellular, tissue, or organismal phenotype). As used herein, a "genetic association" is said to exist when one or more genotypes in a population of individuals or in a population of cells derived from different individuals occur together with the phenotypic trait more frequently than would be expected by chance. In some embodiments, the phenotypic trait may include a recognition phenotype that results from recognition of a target cell (e.g., a tumor cell) by a T cell expressing a Vγ9Vδ2 TCR. In some embodiments, the phenotypic trait may include the conformation of one or more cell surface molecules of the target cell. In some embodiments, the phenotypic trait may include the presence or absence of a J configuration in a cell surface CD277 molecule of the target cell. In some embodiments, the phenotypic trait may include the zygosity of a particular individual at a particular locus. In some embodiments, the phenotypic trait may include the activity of RhoB in a target cell (e.g., a tumor cell). As used herein, the term "activity" refers to the cellular function of a protein, such as RhoB. The activity of a protein is influenced by a number of cellular events and factors, including the nucleotide sequence of the gene encoding the protein (e.g., if the gene is mutated), the level and timing of transcription of the gene, the splicing pattern of the transcribed mRNA, the post-translational modification of the protein, the pattern of translocation of the protein or the mRNA encoding the protein in the cell, and the proper interaction of the protein with cellular factors that affect its function, for example, by changing its conformation and/or activity, or by placing the protein in the proper location in the cell (e.g., the cell surface) to express its function. Thus, a change in the activity of a protein (e.g., an increase or decrease in protein activity) contemplates any cellular mechanism that can result in a change in the function of the protein performed in the cell. For example, with respect to RhoB, in some embodiments, the activity can be changed by affecting the translocation of RhoB GTPase to the cell membrane of the cancer cell. In some embodiments, the activity may be altered by affecting whether RhoB GTPase is retained in the cell membrane of the cancer cell. In some embodiments, the activity may be altered by causing an increase or decrease in the translocation of RhoB GTPase from the nucleus of the cancer cell. In some embodiments, the activity may be altered by increasing or decreasing the expression of a gene or transcript encoding RhoB GTPase. In some embodiments, the activity may be altered by altering the modification of the transcript (e.g., alternative splicing). In some embodiments, the activity may be altered by increasing or decreasing the stability of RhoB GTPase in the cell. In some embodiments, the activity may be altered by increasing or decreasing the interaction of RhoB GTPase with a second protein (e.g., BNT3 protein). In some embodiments, the activity may be altered by activating or inactivating RhoB GTPase. In some embodiments, activity can be altered by increasing or decreasing the interaction of RhoB GTPase with small non-protein molecules (e.g., GTP).

In some embodiments, the presence or absence of one or more nucleotide sequence polymorphisms is used to stratify patients into treatment groups that may differ in their therapeutic response to treatment with a polypeptide construct disclosed herein. For example, the presence of a particular form of a SNP may be found to be associated with a phenotypic trait known to predict treatment success (e.g., the presence/absence of a J configuration or relatively high or low RhoB activity). Based on the identified genetic associations, patients who are candidates for receiving a particular treatment disclosed herein may be screened (i.e., genotyped) for the presence or absence of a polymorphism that correlates with the phenotypic trait. The screened patients may then be classified into multiple patient populations or groups based on the presence or absence of the polymorphism. Each patient population may represent a stratification group, which may represent the probability that a particular patient within the stratification group will respond with a positive or poor response to a particular therapeutic intervention (i.e., patients in different stratification groups are assigned different probabilities of responding positively to a treatment). As used herein, the term "positive" when used in reference to a treatment response or stratification group refers to a treatment outcome that achieves or partially achieves the purpose for which the treatment is applied. For example, in some embodiments, a positive patient response to a treatment involves the elimination of at least some cancer cells by exposure to a composition described herein. As used herein, a "positive" response is used in comparison to a "poor" response, which in some embodiments is a treatment response of a stratification group that is lower than the response of a second stratification group that exhibits a positive response. In some embodiments, patients can be stratified into at least two patient groups, where a first patient group is predicted to exhibit a positive response to the treatment (i.e., a positive treatment prognosis stratification group), while a second patient group is predicted to exhibit a relatively poor treatment response (i.e., a poor treatment prognosis stratification group).

It will be appreciated from the above that nucleotide sequence polymorphisms and/or certain phenotypic traits (e.g., J configuration of CD277, RhoB activity) of the patient's target cells may represent one or more biomarkers that predict or prognose the patient's therapeutic response to a treatment that includes administration of a composition disclosed herein. In some embodiments, patients may be stratified into different stratification groups based on the presence or absence of a biomarker in the patient's target cells. In some embodiments, the biomarker is a nucleotide sequence polymorphism (e.g., SNP) or an epigenetic modification, and patients with the nucleotide sequence polymorphism or epigenetic modification are stratified into a positive stratification group, while patients lacking the nucleotide sequence polymorphism or epigenetic modification are stratified into a poor stratification group. In some embodiments, the biomarker is a nucleotide sequence polymorphism (e.g., a SNP) or an epigenetic modification, and patients lacking the nucleotide sequence polymorphism or epigenetic modification are stratified into a positive stratification group, while patients with the nucleotide sequence polymorphism or epigenetic modification are stratified into a poor stratification group. In some embodiments, as described above, the biomarker is a recognition phenotype (e.g., production of IFN-γ) or target cell phenotype (e.g., the presence of a J configuration in the cell surface CD277 molecule) associated with a poor or positive therapeutic response. In some embodiments, one biomarker is used to stratify patients into different stratification groups. In other embodiments, multiple biomarkers are used to stratify patients. For example, a patient may be stratified into a positive stratification group if the patient's target cells exhibit both a particular nucleotide sequence polymorphism or epigenetic modification and a particular recognition phenotype or target cell phenotype.

The present disclosure contemplates the use of data collections that archive genomic information including nucleotide sequences, the presence and identity of polymorphisms, and zygosity at specific loci. One example of a data collection is the library of cell lines from the Centre d'Etude du Polymorphisms Huain (CEPH), which contains a large collection of Epstein-Barr Virus (EBV) transformed B-cell lines (EBV-LCL) from several pedigrees and genotyped for millions of SNPs. Another example of a data collection is the haplotype map produced by the International HapMap project. In some embodiments, the data collection may archive hypothetical or predicted genomic parameters. For example, hypothetical zygosity for candidate loci may be estimated using classical Mendelian inheritance patterns from within pedigrees.

Further disclosed herein are methods for identifying genetic and epigenetic mutations in target cells of a subject that predict or prognose an individual's treatment response. For example, target cells (e.g., tumor cells) of a patient can be screened as follows: The cells can be contacted with a composition comprising engineered cells (e.g., T cells) that express a T cell receptor, and then a recognition phenotype, such as a level of immune activation (e.g., IFN-γ level or activity) of the cells as a result of exposure to the composition, can be detected. Depending on the response of the target cells to exposure to the composition, the subject can be classified into a particular (e.g., positive) stratification group. For example, if exposure of the target cells to the composition induces immune activation in T cells, the patient can be classified into a positive stratification group. In some embodiments, the presence or absence of immune activation in the target cells can be associated with genetic and/or epigenetic mutations in the target cells. In some embodiments, genotypic or epigenetic information about the target cells is obtained (e.g., from a data collection) to associate a particular phenotypic trait (e.g., cognitive phenotype) of the target cells with a genetic or epigenetic variant. The present disclosure contemplates any method for identifying genetic or epigenetic variations in a target cell of a patient compared to cells of another patient to associate the genetic or epigenetic variations with a particular cognitive phenotype and/or predicted therapeutic response. For example, a genome-wide association study (GWAS) may be performed to determine whether a particular genetic variant (e.g., a SNP) is associated with a phenotypic trait (e.g., a cognitive phenotype) of the target cell. In other cases, epigenetic data (e.g., methylation state) of DNA from target cells of different subjects is compared to identify candidate epigenetic marks that may be associated with a cognitive phenotype and/or therapeutic response. In yet another example, zygosity at particular loci may be hypothesized using data from pedigrees to identify candidate loci that may be associated with a particular phenotypic trait.

In certain embodiments, predicted zygosity at multiple loci is correlated with SNP genotypes of CEPH individuals and can be calculated using software tools such as ssSNPer. Proxy SNPs within 500 kb of the SNPs generated by y ssSNPer can be collected by querying the SNP Annotation and Proxy Search (SNAP) tool, for example, using ^r2 = 0.8 as the threshold for linkage disequilibrium. eQTL analysis of the ssSNPer SNPs and their proxies can be performed using the Genevar (GENe Expression VARiation) tool.

SAPPHIRE
Disclosed herein is a method to identify genetic loci associated with receptor-mediated target cell recognition using a technology called SAPPHIRE (SNP-associated computational pathway hunt including shRNA evaluation). For example, differences in the genetic background of tumor cells can affect recognition of these cells by Vγ9Vδ2 TCR engineered T cells (e.g., cells described herein). In some embodiments, a library of cell lines may be used that contains a large collection of EBV-transformed B cell lines (EBV-LCL) derived from several pedigrees and genotyped for millions of SNPs (Dausset et al., Centre d'etude dupolymorphisme human (CEPH): collaborative genetic mapping of the human genome. Genomics. 1990; 6:575-7; INTERNATIONAL HAPMAP, C. The International HapMap Project. Nature. 2003; 426:789-96). The recognition phenotype of EBV-LCL by Vγ9Vδ2 TCR T cells may be assessed by IFNγ production. Either CD4 ⁺ or CD8 ⁺ Vγ9Vδ2 T cells may be used to reduce or enhance the effect of NK-like receptors on the phenotypic analysis. CD4 ⁺ T cells express low amounts of NK-like receptors to facilitate the analysis. The hypothetical zygosity for the candidate locus may be estimated using classical Mendelian inheritance patterns within the CEPH family trio, where the effect of the candidate allele on receptor-mediated recognition, e.g. Vγ9Vδ2 TCR-mediated recognition, may be assumed to be dominant. In one embodiment, the recognition phenotype of EBV-LCL by Vγ9Vδ2 TCR T cells assessed by IFNγ production may indicate an activated phenotype for a subset of EBV-LCL and a non-activated phenotype for another subset of EBV-LCL. The recognition phenotypes in combination with pedigree of the CEPH cell line may then be used to predict the zygosity of activated and non-activated EBV-LCL subsets. The hypothetical locus zygosity may then be correlated with available genotype information for SNPs in the study population, resulting in the identification of SNPs with genotypes that show a strong correlation to the predicted zygosity. "Strong correlation" herein may mean, in some embodiments, greater than 80%, greater than 85%, greater than 90%, greater than 95% or greater than 99%.

In some embodiments, the identified SNPs may be located on a chromosome proximal to a corresponding gene that may affect (e.g., by upregulating or downregulating the gene) immune activation of cells expressing a T cell receptor (e.g., Vγ9Vδ2 TCR T cells). In some embodiments, "proximal" means more than 10,000 bp, more than 50,000 bp, more than 100,000 bp, more than 200,000 bp, more than 300,000 bp, more than 500,000 bp, or more than 1 Mbp. In other embodiments, the identified SNPs may be located on a different chromosome than a corresponding gene that may affect (e.g., by upregulating or downregulating the gene) immune activation of cells expressing a T cell receptor (e.g., Vγ9Vδ2 TCR T cells).

The specification and examples illustrate embodiments of the invention in detail. It is to be understood that the invention is not limited to the specific embodiments described herein, and as such may vary. Those skilled in the art will recognize that there are numerous variations and modifications of the invention that are within the scope of the invention.

1A-1B show CEPH EBV-LCL lines used to identify loci associated with engineered cells expressing a given receptor (e.g., Vγ9Vδ2 TCR-mediated recognition). FIG. 1A shows the recognition phenotype indicating whether EBV-LCL lines were recognized (+) or not (−) by Vγ9Vδ2 TCR+ T cells in three independent experiments. FIG. 1B shows that the recognition phenotype of EBV-LCL was assessed by IFNγ-ELI spot assay (black bars: no activation; grey bars: activation), where EBV-LCL were used as targets for Vγ9Vδ2 TCR+ T cells in the presence of the ABP pamidronate. The figure shows the number of IFNγ spots for a representative experiment. 1A-1B show CEPH EBV-LCL lines used to identify loci associated with engineered cells expressing a given receptor (e.g., Vγ9Vδ2 TCR-mediated recognition). FIG. 1A shows the recognition phenotype indicating whether EBV-LCL lines were recognized (+) or not (−) by Vγ9Vδ2 TCR+ T cells in three independent experiments. FIG. 1B shows that the recognition phenotype of EBV-LCL was assessed by IFNγ-ELI spot assay (black bars: no activation; grey bars: activation), where EBV-LCL were used as targets for Vγ9Vδ2 TCR+ T cells in the presence of the ABP pamidronate. The figure shows the number of IFNγ spots for a representative experiment. Figures 2A-2C show SAPPHIRE ( S NP- Associated Com P Utatio nal Pathway Hunt Including sh R N A E evaluation) to identify loci associated with activation of a given receptor in a particular cell. Figure 2A shows that recognition of CEPH EBV-LCL lines by Vγ9Vδ2 TCR+ T cells provided a basis for estimating the hypothetical zygosity of candidate loci in each cell line (black: recognized; white: not recognized; square: male; circle: female; +/-: heterozygote; /-: homozygote negative; +/: undetermined). Two CEPH family members are shown as examples. For CEPH ID numbers of cell lines, see Figure 1A. Figure 2B shows that genetic association analysis revealed 17 SNPs whose genotypes correlated 100% (r ² =1) with the predicted zygosity of the cell lines. The location of the SNPs and the nearest neighboring genes are indicated. Vγ9Vδ2 TCR clone G115 or HLA-A*0201-restricted WT1 ₁₂₆ The effect of knockdown of candidate genes on the recognition of EBV-LCL 48 by T cells transduced with either the WT1 126 or ₁₃₄ specific aβ TCR is indicated by closed circles (significant effect on T cell activation) and open circles (no effect). To test recognition by WT1 aβ TCR+ T cells, the EBV-LCL 48 line was transduced with either the WT1 _{126 or 134} specific aβ TCR. ₁₃₄ peptides were added. Figure 2C shows the association of SNPs from the association study to candidate genes. The genetic region of SNPs flanking RhoB is shown as an example. Each bar represents one SNP and the ^r2 value represents the correlation between predicted zygosity and SNP genotype. Figures 2A-2C show SAPPHIRE ( S NP- Associated Com P Utatio nal Pathway Hunt Including sh R N A E evaluation) to identify loci associated with activation of a given receptor in a particular cell. Figure 2A shows that recognition of CEPH EBV-LCL lines by Vγ9Vδ2 TCR+ T cells provided a basis for estimating the hypothetical zygosity of candidate loci in each cell line (black: recognized; white: not recognized; square: male; circle: female; +/-: heterozygote; /-: homozygote negative; +/: undetermined). Two CEPH family members are shown as examples. For CEPH ID numbers of cell lines, see Figure 1A. Figure 2B shows that genetic association analysis revealed 17 SNPs whose genotypes correlated 100% (r ² =1) with the predicted zygosity of the cell lines. The location of the SNPs and the nearest neighboring genes are indicated. Vγ9Vδ2 TCR clone G115 or HLA-A*0201-restricted WT1 ₁₂₆ The effect of knockdown of candidate genes on the recognition of EBV-LCL 48 by T cells transduced with either the WT1 126 or ₁₃₄ specific aβ TCR is indicated by closed circles (significant effect on T cell activation) and open circles (no effect). To test recognition by WT1 aβ TCR+ T cells, the EBV-LCL 48 line was transduced with either the WT1 _{126 or 134} specific aβ TCR. ₁₃₄ peptides were added. Figure 2C shows the association of SNPs from the association study to candidate genes. The genetic region of SNPs flanking RhoB is shown as an example. Each bar represents one SNP and the ^r2 value represents the correlation between predicted zygosity and SNP genotype. Figures 2A-2C show SAPPHIRE ( S NP- Associated Com P Utatio nal Pathway Hunt Including sh R N A E evaluation) to identify loci associated with activation of a given receptor in a particular cell. Figure 2A shows that recognition of CEPH EBV-LCL lines by Vγ9Vδ2 TCR+ T cells provided a basis for estimating the hypothetical zygosity of candidate loci in each cell line (black: recognized; white: not recognized; square: male; circle: female; +/-: heterozygote; /-: homozygote negative; +/: undetermined). Two CEPH family members are shown as examples. For CEPH ID numbers of cell lines, see Figure 1A. Figure 2B shows that genetic association analysis revealed 17 SNPs whose genotypes correlated 100% (r ² =1) with the predicted zygosity of the cell lines. The location of the SNPs and the nearest neighboring genes are indicated. Vγ9Vδ2 TCR clone G115 or HLA-A*0201-restricted WT1 ₁₂₆ The effect of knockdown of candidate genes on the recognition of EBV-LCL 48 by T cells transduced with either the WT1 126 or ₁₃₄ specific aβ TCR is indicated by closed circles (significant effect on T cell activation) and open circles (no effect). To test recognition by WT1 aβ TCR+ T cells, the EBV-LCL 48 line was transduced with either the WT1 _{126 or 134} specific aβ TCR. ₁₃₄ peptides were added. Figure 2C shows the association of SNPs from the association study to candidate genes. The genetic region of SNPs flanking RhoB is shown as an example. Each bar represents one SNP and the ^r2 value represents the correlation between predicted zygosity and SNP genotype. Figure 3A shows that RhoB was knocked out in 293HEK cells using the CRISPR/Cas system, single cell clones were selected as stable full knockout phenotypes, and the effect of full knockout on recognition by Vγ9Vδ2 TCR+ T cells was assessed by measuring IFNγ (left panel). Guide RNAs targeting irrelevant sequences were used as controls. The level of knockout was determined using intracellular flow cytometry (right panel). Data represent the mean ± S.E.M of two independent experiments in duplicate samples, where statistical significance was analyzed using the Mann-Whitney test. Figure 3B shows that shRNAs targeting RhoB were introduced into Daudi cells by lentivirus, and the effect of RhoB knockdown on recognition of surface CD277-expressing cells by engineered cells expressing the polypeptide constructs described herein was assessed by measuring IFNγ (left panel). Data represent the mean ± S.E.M of three independent experiments on duplicate samples, where statistical significance was analyzed using the Mann-Whitney test. A vector encoding an irrelevant shRNA was used as a negative control. Knockdown levels of RhoB were determined by intracellular flow cytometry (right panel). Figure 3C shows the knockout of RhoA, B and C using the CRISPR/Cas system in 293 HEK cells. Guide RNAs targeting irrelevant sequences were used as controls. Knockout levels were determined using qPCR. The figure shows a representative experiment. Figure 3D shows the measurement of RhoB protein levels by Western blot analysis in the recognizing (i.e., recognized) EBV-LCL lines 48 and 91 and the non-recognizing (i.e., unrecognized) lines 22 and 93. β-Tubulin was used as a loading control. The figure shows a representative experiment. Figure 3E shows that RhoB protein levels were measured by intracellular flow cytometry analysis in the recognizer EBV-LCL lines 6, 12, 48, 69, 70 and 99 and the non-recognizers 22, 83, 93 and 37. Data represent the mean ± S.E.M of at least three independent experiments. Figure 3F shows that Rho suppression in 293HEK cells after C3 transferase treatment was measured using G-Lisa. The figure shows a representative experiment of the relative suppression of RhoA activity compared to untreated samples. Figure 3A shows that RhoB was knocked out in 293HEK cells using the CRISPR/Cas system, single cell clones were selected as stable full knockout phenotypes, and the effect of full knockout on recognition by Vγ9Vδ2 TCR+ T cells was assessed by measuring IFNγ (left panel). Guide RNAs targeting irrelevant sequences were used as controls. The level of knockout was determined using intracellular flow cytometry (right panel). Data represent the mean ± S.E.M of two independent experiments in duplicate samples, where statistical significance was analyzed using the Mann-Whitney test. Figure 3B shows that shRNAs targeting RhoB were introduced into Daudi cells by lentivirus, and the effect of RhoB knockdown on recognition of surface CD277-expressing cells by engineered cells expressing the polypeptide constructs described herein was assessed by measuring IFNγ (left panel). Data represent the mean ± S.E.M of three independent experiments on duplicate samples, where statistical significance was analyzed using the Mann-Whitney test. A vector encoding an irrelevant shRNA was used as a negative control. Knockdown levels of RhoB were determined by intracellular flow cytometry (right panel). Figure 3C shows the knockout of RhoA, B and C using the CRISPR/Cas system in 293 HEK cells. Guide RNAs targeting irrelevant sequences were used as controls. Knockout levels were determined using qPCR. The figure shows a representative experiment. Figure 3D shows the measurement of RhoB protein levels by Western blot analysis in the recognizing (i.e., recognized) EBV-LCL lines 48 and 91 and the non-recognizing (i.e., unrecognized) lines 22 and 93. β-Tubulin was used as a loading control. The figure shows a representative experiment. Figure 3E shows that RhoB protein levels were measured by intracellular flow cytometry analysis in the recognizer EBV-LCL lines 6, 12, 48, 69, 70 and 99 and the non-recognizers 22, 83, 93 and 37. Data represent the mean ± S.E.M of at least three independent experiments. Figure 3F shows that Rho suppression in 293HEK cells after C3 transferase treatment was measured using G-Lisa. The figure shows a representative experiment of the relative suppression of RhoA activity compared to untreated samples. Figure 3A shows that RhoB was knocked out in 293HEK cells using the CRISPR/Cas system, single cell clones were selected as stable full knockout phenotypes, and the effect of full knockout on recognition by Vγ9Vδ2 TCR+ T cells was assessed by measuring IFNγ (left panel). Guide RNAs targeting irrelevant sequences were used as controls. The level of knockout was determined using intracellular flow cytometry (right panel). Data represent the mean ± S.E.M of two independent experiments in duplicate samples, where statistical significance was analyzed using the Mann-Whitney test. Figure 3B shows that shRNAs targeting RhoB were introduced into Daudi cells by lentivirus, and the effect of RhoB knockdown on recognition of surface CD277-expressing cells by engineered cells expressing the polypeptide constructs described herein was assessed by measuring IFNγ (left panel). Data represent the mean ± S.E.M of three independent experiments on duplicate samples, where statistical significance was analyzed using the Mann-Whitney test. A vector encoding an irrelevant shRNA was used as a negative control. Knockdown levels of RhoB were determined by intracellular flow cytometry (right panel). Figure 3C shows the knockout of RhoA, B and C using the CRISPR/Cas system in 293 HEK cells. Guide RNAs targeting irrelevant sequences were used as controls. Knockout levels were determined using qPCR. The figure shows a representative experiment. Figure 3D shows the measurement of RhoB protein levels by Western blot analysis in the recognizing (i.e., recognized) EBV-LCL lines 48 and 91 and the non-recognizing (i.e., unrecognized) lines 22 and 93. β-Tubulin was used as a loading control. The figure shows a representative experiment. Figure 3E shows that RhoB protein levels were measured by intracellular flow cytometry analysis in the recognizer EBV-LCL lines 6, 12, 48, 69, 70 and 99 and the non-recognizers 22, 83, 93 and 37. Data represent the mean ± S.E.M of at least three independent experiments. Figure 3F shows that Rho suppression in 293HEK cells after C3 transferase treatment was measured using G-Lisa. The figure shows a representative experiment of the relative suppression of RhoA activity compared to untreated samples. Figure 3A shows that RhoB was knocked out in 293HEK cells using the CRISPR/Cas system, single cell clones were selected as stable full knockout phenotypes, and the effect of full knockout on recognition by Vγ9Vδ2 TCR+ T cells was assessed by measuring IFNγ (left panel). Guide RNAs targeting irrelevant sequences were used as controls. The level of knockout was determined using intracellular flow cytometry (right panel). Data represent the mean ± S.E.M of two independent experiments in duplicate samples, where statistical significance was analyzed using the Mann-Whitney test. Figure 3B shows that shRNAs targeting RhoB were introduced into Daudi cells by lentivirus, and the effect of RhoB knockdown on recognition of surface CD277-expressing cells by engineered cells expressing the polypeptide constructs described herein was assessed by measuring IFNγ (left panel). Data represent the mean ± S.E.M of three independent experiments on duplicate samples, where statistical significance was analyzed using the Mann-Whitney test. A vector encoding an irrelevant shRNA was used as a negative control. Knockdown levels of RhoB were determined by intracellular flow cytometry (right panel). Figure 3C shows the knockout of RhoA, B and C using the CRISPR/Cas system in 293 HEK cells. Guide RNAs targeting irrelevant sequences were used as controls. Knockout levels were determined using qPCR. The figure shows a representative experiment. Figure 3D shows the measurement of RhoB protein levels by Western blot analysis in the recognizing (i.e., recognized) EBV-LCL lines 48 and 91 and the non-recognizing (i.e., unrecognized) lines 22 and 93. β-Tubulin was used as a loading control. The figure shows a representative experiment. Figure 3E shows that RhoB protein levels were measured by intracellular flow cytometry analysis in the recognizer EBV-LCL lines 6, 12, 48, 69, 70 and 99 and the non-recognizers 22, 83, 93 and 37. Data represent the mean ± S.E.M of at least three independent experiments. Figure 3F shows that Rho suppression in 293HEK cells after C3 transferase treatment was measured using G-Lisa. The figure shows a representative experiment of the relative suppression of RhoA activity compared to untreated samples. Figure 3A shows that RhoB was knocked out in 293HEK cells using the CRISPR/Cas system, single cell clones were selected as stable full knockout phenotypes, and the effect of full knockout on recognition by Vγ9Vδ2 TCR+ T cells was assessed by measuring IFNγ (left panel). Guide RNAs targeting irrelevant sequences were used as controls. The level of knockout was determined using intracellular flow cytometry (right panel). Data represent the mean ± S.E.M of two independent experiments in duplicate samples, where statistical significance was analyzed using the Mann-Whitney test. Figure 3B shows that shRNAs targeting RhoB were introduced into Daudi cells by lentivirus, and the effect of RhoB knockdown on recognition of surface CD277-expressing cells by engineered cells expressing the polypeptide constructs described herein was assessed by measuring IFNγ (left panel). Data represent the mean ± S.E.M of three independent experiments on duplicate samples, where statistical significance was analyzed using the Mann-Whitney test. A vector encoding an irrelevant shRNA was used as a negative control. Knockdown levels of RhoB were determined by intracellular flow cytometry (right panel). Figure 3C shows the knockout of RhoA, B and C using the CRISPR/Cas system in 293 HEK cells. Guide RNAs targeting irrelevant sequences were used as controls. Knockout levels were determined using qPCR. The figure shows a representative experiment. Figure 3D shows the measurement of RhoB protein levels by Western blot analysis in the recognizing (i.e., recognized) EBV-LCL lines 48 and 91 and the non-recognizing (i.e., unrecognized) lines 22 and 93. β-Tubulin was used as a loading control. The figure shows a representative experiment. Figure 3E shows that RhoB protein levels were measured by intracellular flow cytometry analysis in the recognizer EBV-LCL lines 6, 12, 48, 69, 70 and 99 and the non-recognizers 22, 83, 93 and 37. Data represent the mean ± S.E.M of at least three independent experiments. Figure 3F shows that Rho suppression in 293HEK cells after C3 transferase treatment was measured using G-Lisa. The figure shows a representative experiment of the relative suppression of RhoA activity compared to untreated samples. Figure 3A shows that RhoB was knocked out in 293HEK cells using the CRISPR/Cas system, single cell clones were selected as stable full knockout phenotypes, and the effect of full knockout on recognition by Vγ9Vδ2 TCR+ T cells was assessed by measuring IFNγ (left panel). Guide RNAs targeting irrelevant sequences were used as controls. The level of knockout was determined using intracellular flow cytometry (right panel). Data represent the mean ± S.E.M of two independent experiments in duplicate samples, where statistical significance was analyzed using the Mann-Whitney test. Figure 3B shows that shRNAs targeting RhoB were introduced into Daudi cells by lentivirus, and the effect of RhoB knockdown on recognition of surface CD277-expressing cells by engineered cells expressing the polypeptide constructs described herein was assessed by measuring IFNγ (left panel). Data represent the mean ± S.E.M of three independent experiments on duplicate samples, where statistical significance was analyzed using the Mann-Whitney test. A vector encoding an irrelevant shRNA was used as a negative control. Knockdown levels of RhoB were determined by intracellular flow cytometry (right panel). Figure 3C shows the knockout of RhoA, B and C using the CRISPR/Cas system in 293 HEK cells. Guide RNAs targeting irrelevant sequences were used as controls. Knockout levels were determined using qPCR. The figure shows a representative experiment. Figure 3D shows the measurement of RhoB protein levels by Western blot analysis in the recognizing (i.e., recognized) EBV-LCL lines 48 and 91 and the non-recognizing (i.e., unrecognized) lines 22 and 93. β-Tubulin was used as a loading control. The figure shows a representative experiment. Figure 3E shows that RhoB protein levels were measured by intracellular flow cytometry analysis in the recognizer EBV-LCL lines 6, 12, 48, 69, 70 and 99 and the non-recognizers 22, 83, 93 and 37. Data represent the mean ± S.E.M of at least three independent experiments. Figure 3F shows that Rho suppression in 293HEK cells after C3 transferase treatment was measured using G-Lisa. The figure shows a representative experiment of the relative suppression of RhoA activity compared to untreated samples. Figures 4A-4E show that RhoB activity correlates with target cell recognition by engineered cells expressing the polypeptide constructs described herein, based on binding of the polypeptide constructs to the J-configuration of CD277. Figure 4A shows that the CRISPR/Cas system was used to partially knock out RhoB in the renal carcinoma cell line MZ1851RC. MZ1851RC cells were treated with either pamidronate or the HLA-A ^* 0201 restricted WT1 _{I 26 +134} peptide, and the effect on target cell recognition by engineered cells expressing the polypeptide constructs described herein and WT1 o43TCR+ T cells, respectively, was determined by measuring IFNγ production. Guide RNA targeting an irrelevant sequence was used as a control for knockout, while tumor cells loaded with intermediate or irrelevant peptides were used as controls for T cell stimulation. Data represent the mean ± S.E.M of three independent experiments in duplicate samples. The level of knockout was determined by intracellular flow cytometry. Figure 4B shows the effect of knockout of RhoA, B and C in 293HEK cells on recognition by engineered cells expressing the polypeptide constructs described herein was assessed by measuring IFNγ production. Guide RNAs targeting irrelevant sequences were used as controls. The figure shows IFNγ production normalized to irrelevant knockout samples of three independent experiments in duplicate samples. Figure 4C shows RNA expression of RhoB was measured by qPCR in either non-recognizing (black bars) or recognizing (white bars) EBV-LCL and tumor cell lines. Data are representative of two replicate experiments. Figure 4D shows that non-recognizing EBV-LCL line 93 or recognizer EBV-LCL 48 were pretreated with either calpeptin or C3 transferase in combination with pamidronate or IPP and the effect on stimulation of Vγ9Vδ2 TCR+ T cells was assessed by measuring IFNγ. The effect of Rho-modulating compounds on recognition of WT1 _{I 26+134} peptide-loaded EBV-LCL48 cells by WT1 aβTCR+ T cells was measured in parallel. Data represent the mean −1 (4 S.E.M.) of at least three independent experiments. FIG. 4E shows that HEK293 cells were transfected with dominant-negative RhoB (RhoB-DN), constitutively active RhoB (RhoB-CA) or wild-type RhoB (RhoB-WT) and the effect of the active mutants on target cell recognition by Vγ9Vδ2 TCR+ T cells in the presence of pamidronate was determined by measuring IFNγ. The figure shows IFNγ production normalized to wild-type RhoB samples from three independent experiments. The significance of the data was analyzed by Mann-Whitney test for FIG. 4A, B and D and by Knisltal-Wallis test and Dunn's multiple comparison test for FIG. 4E. Figures 4A-4E show that RhoB activity correlates with target cell recognition by engineered cells expressing the polypeptide constructs described herein, based on binding of the polypeptide constructs to the J-configuration of CD277. Figure 4A shows that the CRISPR/Cas system was used to partially knock out RhoB in the renal carcinoma cell line MZ1851RC. MZ1851RC cells were treated with either pamidronate or the HLA-A ^* 0201 restricted WT1 _{I 26 +134} peptide, and the effect on target cell recognition by engineered cells expressing the polypeptide constructs described herein and WT1 o43TCR+ T cells, respectively, was determined by measuring IFNγ production. Guide RNA targeting an irrelevant sequence was used as a control for knockout, while tumor cells loaded with intermediate or irrelevant peptides were used as controls for T cell stimulation. Data represent the mean ± S.E.M of three independent experiments in duplicate samples. The level of knockout was determined by intracellular flow cytometry. Figure 4B shows the effect of knockout of RhoA, B and C in 293HEK cells on recognition by engineered cells expressing the polypeptide constructs described herein was assessed by measuring IFNγ production. Guide RNAs targeting irrelevant sequences were used as controls. The figure shows IFNγ production normalized to irrelevant knockout samples of three independent experiments in duplicate samples. Figure 4C shows RNA expression of RhoB was measured by qPCR in either non-recognizing (black bars) or recognizing (white bars) EBV-LCL and tumor cell lines. Data are representative of two replicate experiments. Figure 4D shows that non-recognizing EBV-LCL line 93 or recognizer EBV-LCL 48 were pretreated with either calpeptin or C3 transferase in combination with pamidronate or IPP and the effect on stimulation of Vγ9Vδ2 TCR+ T cells was assessed by measuring IFNγ. The effect of Rho-modulating compounds on recognition of WT1 _{I 26+134} peptide-loaded EBV-LCL48 cells by WT1 aβTCR+ T cells was measured in parallel. Data represent the mean −1 (4 S.E.M.) of at least three independent experiments. FIG. 4E shows that HEK293 cells were transfected with dominant-negative RhoB (RhoB-DN), constitutively active RhoB (RhoB-CA) or wild-type RhoB (RhoB-WT) and the effect of the active mutants on target cell recognition by Vγ9Vδ2 TCR+ T cells in the presence of pamidronate was determined by measuring IFNγ. The figure shows IFNγ production normalized to wild-type RhoB samples from three independent experiments. The significance of the data was analyzed by Mann-Whitney test for FIG. 4A, B and D and by Knisltal-Wallis test and Dunn's multiple comparison test for FIG. 4E. Figures 4A-4E show that RhoB activity correlates with target cell recognition by engineered cells expressing the polypeptide constructs described herein, based on binding of the polypeptide constructs to the J-configuration of CD277. Figure 4A shows that the CRISPR/Cas system was used to partially knock out RhoB in the renal carcinoma cell line MZ1851RC. MZ1851RC cells were treated with either pamidronate or the HLA-A ^* 0201 restricted WT1 _{I 26 +134} peptide, and the effect on target cell recognition by engineered cells expressing the polypeptide constructs described herein and WT1 o43TCR+ T cells, respectively, was determined by measuring IFNγ production. Guide RNA targeting an irrelevant sequence was used as a control for knockout, while tumor cells loaded with intermediate or irrelevant peptides were used as controls for T cell stimulation. Data represent the mean ± S.E.M of three independent experiments in duplicate samples. The level of knockout was determined by intracellular flow cytometry. Figure 4B shows the effect of knockout of RhoA, B and C in 293HEK cells on recognition by engineered cells expressing the polypeptide constructs described herein was assessed by measuring IFNγ production. Guide RNAs targeting irrelevant sequences were used as controls. The figure shows IFNγ production normalized to irrelevant knockout samples of three independent experiments in duplicate samples. Figure 4C shows RNA expression of RhoB was measured by qPCR in either non-recognizing (black bars) or recognizing (white bars) EBV-LCL and tumor cell lines. Data are representative of two replicate experiments. Figure 4D shows that non-recognizing EBV-LCL line 93 or recognizer EBV-LCL 48 were pretreated with either calpeptin or C3 transferase in combination with pamidronate or IPP and the effect on stimulation of Vγ9Vδ2 TCR+ T cells was assessed by measuring IFNγ. The effect of Rho-modulating compounds on recognition of WT1 _{I 26+134} peptide-loaded EBV-LCL48 cells by WT1 aβTCR+ T cells was measured in parallel. Data represent the mean −1 (4 S.E.M.) of at least three independent experiments. FIG. 4E shows that HEK293 cells were transfected with dominant-negative RhoB (RhoB-DN), constitutively active RhoB (RhoB-CA) or wild-type RhoB (RhoB-WT) and the effect of the active mutants on target cell recognition by Vγ9Vδ2 TCR+ T cells in the presence of pamidronate was determined by measuring IFNγ. The figure shows IFNγ production normalized to wild-type RhoB samples from three independent experiments. The significance of the data was analyzed by Mann-Whitney test for FIG. 4A, B and D and by Knisltal-Wallis test and Dunn's multiple comparison test for FIG. 4E. Figures 4A-4E show that RhoB activity correlates with target cell recognition by engineered cells expressing the polypeptide constructs described herein, based on binding of the polypeptide constructs to the J-configuration of CD277. Figure 4A shows that the CRISPR/Cas system was used to partially knock out RhoB in the renal carcinoma cell line MZ1851RC. MZ1851RC cells were treated with either pamidronate or the HLA-A ^* 0201 restricted WT1 _{I 26 +134} peptide, and the effect on target cell recognition by engineered cells expressing the polypeptide constructs described herein and WT1 o43TCR+ T cells, respectively, was determined by measuring IFNγ production. Guide RNA targeting an irrelevant sequence was used as a control for knockout, while tumor cells loaded with intermediate or irrelevant peptides were used as controls for T cell stimulation. Data represent the mean ± S.E.M of three independent experiments in duplicate samples. The level of knockout was determined by intracellular flow cytometry. Figure 4B shows the effect of knockout of RhoA, B and C in 293HEK cells on recognition by engineered cells expressing the polypeptide constructs described herein was assessed by measuring IFNγ production. Guide RNAs targeting irrelevant sequences were used as controls. The figure shows IFNγ production normalized to irrelevant knockout samples of three independent experiments in duplicate samples. Figure 4C shows RNA expression of RhoB was measured by qPCR in either non-recognizing (black bars) or recognizing (white bars) EBV-LCL and tumor cell lines. Data are representative of two replicate experiments. Figure 4D shows that non-recognizing EBV-LCL line 93 or recognizer EBV-LCL 48 were pretreated with either calpeptin or C3 transferase in combination with pamidronate or IPP and the effect on stimulation of Vγ9Vδ2 TCR+ T cells was assessed by measuring IFNγ. The effect of Rho-modulating compounds on recognition of WT1 _{I 26+134} peptide-loaded EBV-LCL48 cells by WT1 aβTCR+ T cells was measured in parallel. Data represent the mean-1 (4 SEM) of at least three independent experiments. FIG. 4E shows that HEK293 cells were transfected with dominant-negative RhoB (RhoB-DN), constitutively active RhoB (RhoB-CA) or wild-type RhoB (RhoB-WT) and the effect of the active mutants on target cell recognition by Vγ9Vδ2 TCR+ T cells in the presence of pamidronate was determined by measuring IFNγ. The figure shows IFNγ production normalized to wild-type RhoB samples from three independent experiments. The significance of the data was analyzed by Mann-Whitney test for FIG. 4A, B and D and by Knisltal-Wallis test and Dunn's multiple comparison test for FIG. 4E. Figures 4A-4E show that RhoB activity correlates with target cell recognition by engineered cells expressing the polypeptide constructs described herein, based on binding of the polypeptide constructs to the J-configuration of CD277. Figure 4A shows that the CRISPR/Cas system was used to partially knock out RhoB in the renal carcinoma cell line MZ1851RC. MZ1851RC cells were treated with either pamidronate or the HLA-A ^* 0201 restricted WT1 _{I 26 +134} peptide, and the effect on target cell recognition by engineered cells expressing the polypeptide constructs described herein and WT1 o43TCR+ T cells, respectively, was determined by measuring IFNγ production. Guide RNA targeting an irrelevant sequence was used as a control for knockout, while tumor cells loaded with intermediate or irrelevant peptides were used as controls for T cell stimulation. Data represent the mean ± S.E.M of three independent experiments in duplicate samples. The level of knockout was determined by intracellular flow cytometry. Figure 4B shows the effect of knockout of RhoA, B and C in 293HEK cells on recognition by engineered cells expressing the polypeptide constructs described herein was assessed by measuring IFNγ production. Guide RNAs targeting irrelevant sequences were used as controls. The figure shows IFNγ production normalized to irrelevant knockout samples of three independent experiments in duplicate samples. Figure 4C shows RNA expression of RhoB was measured by qPCR in either non-recognizing (black bars) or recognizing (white bars) EBV-LCL and tumor cell lines. Data are representative of two replicate experiments. Figure 4D shows that non-recognizing EBV-LCL line 93 or recognizer EBV-LCL 48 were pretreated with either calpeptin or C3 transferase in combination with pamidronate or IPP and the effect on stimulation of Vγ9Vδ2 TCR+ T cells was assessed by measuring IFNγ. The effect of Rho-modulating compounds on recognition of WT1 _{I 26+134} peptide-loaded EBV-LCL48 cells by WT1 aβTCR+ T cells was measured in parallel. Data represent the mean −1 (4 S.E.M.) of at least three independent experiments. FIG. 4E shows that HEK293 cells were transfected with dominant-negative RhoB (RhoB-DN), constitutively active RhoB (RhoB-CA) or wild-type RhoB (RhoB-WT) and the effect of the active mutants on target cell recognition by Vγ9Vδ2 TCR+ T cells in the presence of pamidronate was determined by measuring IFNγ. The figure shows IFNγ production normalized to wild-type RhoB samples from three independent experiments. The significance of the data was analyzed by Mann-Whitney test for FIG. 4A, B and D and by Knisltal-Wallis test and Dunn's multiple comparison test for FIG. 4E. Figure 5 shows that the intracellular distribution of RhoB correlates with the recognition of the J-configuration of CD277 in target cells by engineered cells expressing the polypeptide constructs described herein. Figure 5A shows that non-recognizing healthy T cells, leukemia cell lines ML-1 and EBV-LCL 93 cells, and recognizing leukemia cell line K562, colon cancer cell line SW480, EBV-LCL 48 and EBV-LCL 70 cells were treated with pamidronate and loaded onto poly-L-lysine coated coverslips. Adherent cells were fixed, permeabilized and stained using a RhoB specific antibody followed by staining with an Alexa Fluor 488 conjugated secondary antibody. RhoB distribution was then analyzed by confocal microscopy. Representative images are shown (white: RhoB, dark: nuclei [DAPI]). Figure 5B shows that T cells from healthy donors, EBV-LCL lines 93, 48 and 70, tumor cell lines ML-1, K562, SW480, Raji, primary AML blasts AML2913, AML2907, AML2889, AML2905, and mouse and human DCs were treated with pamidronate and analyzed for intracellular distribution of RhoB by confocal microscopy. Open bars represent target cells with a non-activated phenotype, while closed bars indicate target cells that can activate engineered cells expressing the polypeptide constructs described herein. The ratio of RhoB signals between nuclear and extranuclear compartments was measured using ImageJ image analysis software. Graphs show the average ratio + S.E.M. of at least 10 different cells. Statistical significance compared to PBLs was determined using Kruskal-Wallis and Dunn's multiple comparison tests. Figure 5C shows intracellular RhoB distribution. FIG. 5D shows the nuclear/nuclear RhoB signal ratio, where ABP pamidronate and soluble IPP sensitization of the recognized ABP/IPP-sensitive EBV-LCL 48 was analyzed as in A and B. The graph shows the average ratio + S.E.M. of at least 10 different cells. Statistical significance compared to untreated EBV-LCL 48 was determined using the Mann-Whitney test. FIG. 5E shows that the intracellular RhoB distribution was determined in monocyte-derived human dendritic cells from two different donors in the presence or absence of ABP pamidronate. Bone marrow-derived mouse dendritic cells (>95% CD11c+) were treated with ABP pamidronate and used for intracellular labeling of RhoB. The graph shows the average ratio + S.E.M. of at least 10 different cells. Statistical significance compared to LPS-treated human DC was determined by using the Mann-Whitney test. Figure 5F shows that CD34+ CD38- leukemic stem cells were sorted from four patients, one with recognized leukemic blasts (AML 2889, AML 1665, AML 2575) and one with unrecognized leukemic blasts (AML 2907), and the ratio of extranuclear to nuclear RhoB signals was measured. The graph shows the average ratio + S.E.M of at least 10 different cells. Statistical significance compared to CD34+ CD38- healthy stem cells was determined using the Mann-Whitney test. Figure 5 shows that the intracellular distribution of RhoB correlates with the recognition of the J configuration of CD277 in target cells by engineered cells expressing the polypeptide constructs described herein. Figure 5A shows that non-recognizing healthy T cells, leukemia cell lines ML-1 and EBV-LCL 93 cells, and recognizing leukemia cell line K562, colon cancer cell line SW480, EBV-LCL 48 and EBV-LCL 70 cells were treated with pamidronate and loaded onto poly-L-lysine coated coverslips. Adherent cells were fixed, permeabilized and stained using a RhoB specific antibody followed by staining with an Alexa Fluor 488 conjugated secondary antibody. RhoB distribution was then analyzed by confocal microscopy. Representative images are shown (white: RhoB, dark: nuclei [DAPI]). Figure 5B shows that T cells from healthy donors, EBV-LCL lines 93, 48 and 70, tumor cell lines ML-1, K562, SW480, Raji, primary AML blasts AML2913, AML2907, AML2889, AML2905, and mouse and human DCs were treated with pamidronate and analyzed for intracellular distribution of RhoB by confocal microscopy. Open bars represent target cells with a non-activated phenotype, while closed bars indicate target cells that can activate engineered cells expressing the polypeptide constructs described herein. The ratio of RhoB signals between nuclear and extranuclear compartments was measured using ImageJ image analysis software. Graphs show the average ratio + S.E.M. of at least 10 different cells. Statistical significance compared to PBLs was determined using Kruskal-Wallis and Dunn's multiple comparison tests. Figure 5C shows intracellular RhoB distribution. FIG. 5D shows the nuclear/nuclear RhoB signal ratio, where ABP pamidronate and soluble IPP sensitization of the recognized ABP/IPP-sensitive EBV-LCL 48 was analyzed as in A and B. The graph shows the average ratio + S.E.M. of at least 10 different cells. Statistical significance compared to untreated EBV-LCL 48 was determined using the Mann-Whitney test. FIG. 5E shows that the intracellular RhoB distribution was determined in monocyte-derived human dendritic cells from two different donors in the presence or absence of ABP pamidronate. Bone marrow-derived mouse dendritic cells (>95% CD11c+) were treated with ABP pamidronate and used for intracellular labeling of RhoB. The graph shows the average ratio + S.E.M. of at least 10 different cells. Statistical significance compared to LPS-treated human DC was determined by using the Mann-Whitney test. Figure 5F shows that CD34+ CD38- leukemic stem cells were sorted from four patients, one with recognized leukemic blasts (AML 2889, AML 1665, AML 2575) and one with unrecognized leukemic blasts (AML 2907), and the ratio of extranuclear to nuclear RhoB signals was measured. The graph shows the average ratio + S.E.M of at least 10 different cells. Statistical significance compared to CD34+ CD38- healthy stem cells was determined using the Mann-Whitney test. Figure 5 shows that the intracellular distribution of RhoB correlates with the recognition of the J configuration of CD277 in target cells by engineered cells expressing the polypeptide constructs described herein. Figure 5A shows that non-recognizing healthy T cells, leukemia cell lines ML-1 and EBV-LCL 93 cells, and recognizing leukemia cell line K562, colon cancer cell line SW480, EBV-LCL 48 and EBV-LCL 70 cells were treated with pamidronate and loaded onto poly-L-lysine coated coverslips. Adherent cells were fixed, permeabilized and stained using a RhoB specific antibody followed by staining with an Alexa Fluor 488 conjugated secondary antibody. RhoB distribution was then analyzed by confocal microscopy. Representative images are shown (white: RhoB, dark: nuclei [DAPI]). Figure 5B shows that T cells from healthy donors, EBV-LCL lines 93, 48 and 70, tumor cell lines ML-1, K562, SW480, Raji, primary AML blasts AML2913, AML2907, AML2889, AML2905, and mouse and human DCs were treated with pamidronate and analyzed for intracellular distribution of RhoB by confocal microscopy. Open bars represent target cells with a non-activated phenotype, while closed bars indicate target cells that can activate engineered cells expressing the polypeptide constructs described herein. The ratio of RhoB signals between nuclear and extranuclear compartments was measured using ImageJ image analysis software. Graphs show the average ratio + S.E.M. of at least 10 different cells. Statistical significance compared to PBLs was determined using Kruskal-Wallis and Dunn's multiple comparison tests. Figure 5C shows intracellular RhoB distribution. FIG. 5D shows the nuclear/nuclear RhoB signal ratio, where ABP pamidronate and soluble IPP sensitization of the recognized ABP/IPP-sensitive EBV-LCL 48 was analyzed as in A and B. The graph shows the average ratio + S.E.M. of at least 10 different cells. Statistical significance compared to untreated EBV-LCL 48 was determined using the Mann-Whitney test. FIG. 5E shows that the intracellular RhoB distribution was determined in monocyte-derived human dendritic cells from two different donors in the presence or absence of ABP pamidronate. Bone marrow-derived mouse dendritic cells (>95% CD11c+) were treated with ABP pamidronate and used for intracellular labeling of RhoB. The graph shows the average ratio + S.E.M. of at least 10 different cells. Statistical significance compared to LPS-treated human DC was determined by using the Mann-Whitney test. Figure 5F shows that CD34+ CD38- leukemic stem cells were sorted from four patients, one with recognized leukemic blasts (AML 2889, AML 1665, AML 2575) and one with unrecognized leukemic blasts (AML 2907), and the ratio of extranuclear to nuclear RhoB signals was measured. The graph shows the average ratio + S.E.M of at least 10 different cells. Statistical significance compared to CD34+ CD38- healthy stem cells was determined using the Mann-Whitney test. Figure 5 shows that the intracellular distribution of RhoB correlates with the recognition of the J configuration of CD277 in target cells by engineered cells expressing the polypeptide constructs described herein. Figure 5A shows that non-recognizing healthy T cells, leukemia cell lines ML-1 and EBV-LCL 93 cells, and recognizing leukemia cell line K562, colon cancer cell line SW480, EBV-LCL 48 and EBV-LCL 70 cells were treated with pamidronate and loaded onto poly-L-lysine coated coverslips. Adherent cells were fixed, permeabilized and stained using a RhoB specific antibody followed by staining with an Alexa Fluor 488 conjugated secondary antibody. RhoB distribution was then analyzed by confocal microscopy. Representative images are shown (white: RhoB, dark: nuclei [DAPI]). Figure 5B shows that T cells from healthy donors, EBV-LCL lines 93, 48 and 70, tumor cell lines ML-1, K562, SW480, Raji, primary AML blasts AML2913, AML2907, AML2889, AML2905, and mouse and human DCs were treated with pamidronate and analyzed for intracellular distribution of RhoB by confocal microscopy. Open bars represent target cells with a non-activated phenotype, while closed bars indicate target cells that can activate engineered cells expressing the polypeptide constructs described herein. The ratio of RhoB signals between nuclear and extranuclear compartments was measured using ImageJ image analysis software. Graphs show the average ratio + S.E.M. of at least 10 different cells. Statistical significance compared to PBLs was determined using Kruskal-Wallis and Dunn's multiple comparison tests. Figure 5C shows intracellular RhoB distribution. FIG. 5D shows the nuclear/nuclear RhoB signal ratio, where ABP pamidronate and soluble IPP sensitization of the recognized ABP/IPP-sensitive EBV-LCL 48 was analyzed as in A and B. The graph shows the average ratio + S.E.M. of at least 10 different cells. Statistical significance compared to untreated EBV-LCL 48 was determined using the Mann-Whitney test. FIG. 5E shows that the intracellular RhoB distribution was determined in monocyte-derived human dendritic cells from two different donors in the presence or absence of ABP pamidronate. Bone marrow-derived mouse dendritic cells (>95% CD11c+) were treated with ABP pamidronate and used for intracellular labeling of RhoB. The graph shows the average ratio + S.E.M. of at least 10 different cells. Statistical significance compared to LPS-treated human DC was determined by using the Mann-Whitney test. Figure 5F shows that CD34+ CD38- leukemic stem cells were sorted from four patients, one with recognized leukemic blasts (AML 2889, AML 1665, AML 2575) and one with unrecognized leukemic blasts (AML 2907), and the ratio of extranuclear to nuclear RhoB signals was measured. The graph shows the average ratio + S.E.M of at least 10 different cells. Statistical significance compared to CD34+ CD38- healthy stem cells was determined using the Mann-Whitney test. Figure 5 shows that the intracellular distribution of RhoB correlates with the recognition of the J configuration of CD277 in target cells by engineered cells expressing the polypeptide constructs described herein. Figure 5A shows that non-recognizing healthy T cells, leukemia cell lines ML-1 and EBV-LCL 93 cells, and recognizing leukemia cell line K562, colon cancer cell line SW480, EBV-LCL 48 and EBV-LCL 70 cells were treated with pamidronate and loaded onto poly-L-lysine coated coverslips. Adherent cells were fixed, permeabilized and stained using a RhoB specific antibody followed by staining with an Alexa Fluor 488 conjugated secondary antibody. RhoB distribution was then analyzed by confocal microscopy. Representative images are shown (white: RhoB, dark: nuclei [DAPI]). Figure 5B shows that T cells from healthy donors, EBV-LCL lines 93, 48 and 70, tumor cell lines ML-1, K562, SW480, Raji, primary AML blasts AML2913, AML2907, AML2889, AML2905, and mouse and human DCs were treated with pamidronate and analyzed for intracellular distribution of RhoB by confocal microscopy. Open bars represent target cells with a non-activated phenotype, while closed bars indicate target cells that can activate engineered cells expressing the polypeptide constructs described herein. The ratio of RhoB signals between nuclear and extranuclear compartments was measured using ImageJ image analysis software. Graphs show the average ratio + S.E.M. of at least 10 different cells. Statistical significance compared to PBLs was determined using Kruskal-Wallis and Dunn's multiple comparison tests. Figure 5C shows intracellular RhoB distribution. FIG. 5D shows the nuclear/nuclear RhoB signal ratio, where ABP pamidronate and soluble IPP sensitization of the recognized ABP/IPP-sensitive EBV-LCL 48 was analyzed as in A and B. The graph shows the average ratio + S.E.M. of at least 10 different cells. Statistical significance compared to untreated EBV-LCL 48 was determined using the Mann-Whitney test. FIG. 5E shows that the intracellular RhoB distribution was determined in monocyte-derived human dendritic cells from two different donors in the presence or absence of ABP pamidronate. Bone marrow-derived mouse dendritic cells (>95% CD11c+) were treated with ABP pamidronate and used for intracellular labeling of RhoB. The graph shows the average ratio + S.E.M. of at least 10 different cells. Statistical significance compared to LPS-treated human DC was determined by using the Mann-Whitney test. Figure 5F shows that CD34+ CD38- leukemic stem cells were sorted from four patients, one with recognized leukemic blasts (AML 2889, AML 1665, AML 2575) and one with unrecognized leukemic blasts (AML 2907), and the ratio of extranuclear to nuclear RhoB signals was measured. The graph shows the average ratio + S.E.M of at least 10 different cells. Statistical significance compared to CD34+ CD38- healthy stem cells was determined using the Mann-Whitney test. Figure 5 shows that the intracellular distribution of RhoB correlates with the recognition of the J configuration of CD277 in target cells by engineered cells expressing the polypeptide constructs described herein. Figure 5A shows that non-recognizing healthy T cells, leukemia cell lines ML-1 and EBV-LCL 93 cells, and recognizing leukemia cell line K562, colon cancer cell line SW480, EBV-LCL 48 and EBV-LCL 70 cells were treated with pamidronate and loaded onto poly-L-lysine coated coverslips. Adherent cells were fixed, permeabilized and stained using a RhoB specific antibody followed by staining with an Alexa Fluor 488 conjugated secondary antibody. RhoB distribution was then analyzed by confocal microscopy. Representative images are shown (white: RhoB, dark: nuclei [DAPI]). Figure 5B shows that T cells from healthy donors, EBV-LCL lines 93, 48 and 70, tumor cell lines ML-1, K562, SW480, Raji, primary AML blasts AML2913, AML2907, AML2889, AML2905, and mouse and human DCs were treated with pamidronate and analyzed for intracellular distribution of RhoB by confocal microscopy. Open bars represent target cells with a non-activated phenotype, while closed bars indicate target cells that can activate engineered cells expressing the polypeptide constructs described herein. The ratio of RhoB signals between nuclear and extranuclear compartments was measured using ImageJ image analysis software. Graphs show the average ratio + S.E.M. of at least 10 different cells. Statistical significance compared to PBLs was determined using Kruskal-Wallis and Dunn's multiple comparison tests. Figure 5C shows intracellular RhoB distribution. FIG. 5D shows the nuclear/nuclear RhoB signal ratio, where ABP pamidronate and soluble IPP sensitization of the recognized ABP/IPP-sensitive EBV-LCL 48 was analyzed as in A and B. The graph shows the average ratio + S.E.M. of at least 10 different cells. Statistical significance compared to untreated EBV-LCL 48 was determined using the Mann-Whitney test. FIG. 5E shows that the intracellular RhoB distribution was determined in monocyte-derived human dendritic cells from two different donors in the presence or absence of ABP pamidronate. Bone marrow-derived mouse dendritic cells (>95% CD11c+) were treated with ABP pamidronate and used for intracellular labeling of RhoB. The graph shows the average ratio + S.E.M. of at least 10 different cells. Statistical significance compared to LPS-treated human DC was determined by using the Mann-Whitney test. Figure 5F shows that CD34+ CD38- leukemic stem cells were sorted from four patients, one with recognized leukemic blasts (AML 2889, AML 1665, AML 2575) and one with unrecognized leukemic blasts (AML 2907), and the ratio of extranuclear to nuclear RhoB signals was measured. The graph shows the average ratio + S.E.M of at least 10 different cells. Statistical significance compared to CD34+ CD38- healthy stem cells was determined using the Mann-Whitney test. Figure 6A shows representative images of the intracellular distribution of RhoB in cognizant and non-cognizant primary AML samples. Figure 6B shows the intracellular RhoA distribution in the presence or absence of ABP pamidronate measured by confocal microscopy in EBV-LCL48. Figure 6C shows the intracellular RhoB distribution in the presence or absence of ABP pamidronate determined in monocyte-derived human dendritic cells from two different donors. Mouse bone marrow-derived dendritic cells (>95% CD11c+) were treated with ABP pamidronate and used for intracellular labeling of RhoB. Figure 6D shows the correlation of intracellular RhoB distribution with the Vγ9Vδ2 TCR T cell activation capacity of tumor target cells. The nuclear:nuclear RhoB intensity ratio in tumor cells was plotted against the number of IFNg spots when the same tumor cells were co-cultured with engineered cells expressing the polypeptide constructs described herein. Figure 6A shows representative images of the intracellular distribution of RhoB in cognizant and non-cognizant primary AML samples. Figure 6B shows the intracellular RhoA distribution in the presence or absence of ABP pamidronate measured by confocal microscopy in EBV-LCL48. Figure 6C shows the intracellular RhoB distribution in the presence or absence of ABP pamidronate determined in monocyte-derived human dendritic cells from two different donors. Mouse bone marrow-derived dendritic cells (>95% CD11c+) were treated with ABP pamidronate and used for intracellular labeling of RhoB. Figure 6D shows the correlation of intracellular RhoB distribution with the Vγ9Vδ2 TCR T cell activation capacity of tumor target cells. The nuclear:nuclear RhoB intensity ratio in tumor cells was plotted against the number of IFNg spots when the same tumor cells were co-cultured with engineered cells expressing the polypeptide constructs described herein. Figure 6A shows representative images of the intracellular distribution of RhoB in cognizant and non-cognizant primary AML samples. Figure 6B shows the intracellular RhoA distribution in the presence or absence of ABP pamidronate measured by confocal microscopy in EBV-LCL48. Figure 6C shows the intracellular RhoB distribution in the presence or absence of ABP pamidronate determined in monocyte-derived human dendritic cells from two different donors. Mouse bone marrow-derived dendritic cells (>95% CD11c+) were treated with ABP pamidronate and used for intracellular labeling of RhoB. Figure 6D shows the correlation of intracellular RhoB distribution with the Vγ9Vδ2 TCR T cell activation capacity of tumor target cells. The nuclear:nuclear RhoB intensity ratio in tumor cells was plotted against the number of IFNg spots when the same tumor cells were co-cultured with engineered cells expressing the polypeptide constructs described herein. Figure 6A shows representative images of the intracellular distribution of RhoB in cognizant and non-cognizant primary AML samples. Figure 6B shows the intracellular RhoA distribution in the presence or absence of ABP pamidronate measured by confocal microscopy in EBV-LCL48. Figure 6C shows the intracellular RhoB distribution in the presence or absence of ABP pamidronate determined in monocyte-derived human dendritic cells from two different donors. Mouse bone marrow-derived dendritic cells (>95% CD11c+) were treated with ABP pamidronate and used for intracellular labeling of RhoB. Figure 6D shows the correlation of intracellular RhoB distribution with the Vγ9Vδ2 TCR T cell activation capacity of tumor target cells. The nuclear:nuclear RhoB intensity ratio in tumor cells was plotted against the number of IFNg spots when the same tumor cells were co-cultured with engineered cells expressing the polypeptide constructs described herein. Figures 7A-7B show that RhoB activity regulates CD277 membrane mobility and its association with the actin cytoskeleton, thereby regulating the formation of J configurations of CD277. Figure 7A shows that HEK 293 cells were transfected with a CD277-emGFP fusion construct and treated with medium, the ABP zoledronate, or calpeptin. Zoledronate treatment was also applied in HEK 293 CD277-emGFP ⁺ cells in which RhoB was knocked out by CRISPR/Cas, or in cells that were also treated with C3-transferase. The figures show the percentage of CD277 fixed fraction at the time of treatment (+). Symbols represent single cell measurements from two experiments. Figure 7B shows that HEK 293 cells were pretreated with pamidronate or with calpeptin and BTN3 molecules and stained for filamentous actin (F-actin) using fluorescently labeled anti-CD277 antibody and fluorescent phalloidin, respectively. Colocalization of CD277 with F-actin was then assessed by determining the localization correlation of both signals. Symbols represent single cell measurements from one experiment. Center lines and error bars represent the mean and SEM, and p values indicate significance analyzed using the Mann-Whitney test. Figures 7A-7B show that RhoB activity regulates CD277 membrane mobility and its association with the actin cytoskeleton, thereby regulating the formation of J configurations of CD277. Figure 7A shows that HEK 293 cells were transfected with a CD277-emGFP fusion construct and treated with medium, the ABP zoledronate, or calpeptin. Zoledronate treatment was also applied in HEK 293 CD277-emGFP ⁺ cells in which RhoB was knocked out by CRISPR/Cas, or in cells that were also treated with C3-transferase. The figures show the percentage of CD277 fixed fraction at the time of treatment (+). Symbols represent single cell measurements from two experiments. Figure 7B shows that HEK 293 cells were pretreated with pamidronate or with calpeptin and BTN3 molecules and stained for filamentous actin (F-actin) using fluorescently labeled anti-CD277 antibody and fluorescent phalloidin, respectively. Colocalization of CD277 with F-actin was then assessed by determining the localization correlation of both signals. Symbols represent single cell measurements from one experiment. Center lines and error bars represent the mean and SEM, and p values indicate significance analyzed using the Mann-Whitney test. Figures 8A-8E show that RhoB interacts with CD277 molecules to form a J-configuration of CD277, which dissociates after phosphoantigen processing. Figure 8A shows that EBV-LCL 48 cells were treated with either medium or the ABP pamidronate, loaded onto poly-L-lysine-coated coverslips, and permeabilized. The interaction of RhoB with CD277 was then assessed by Duolink PLA using anti-RhoB and anti-CD277 antibodies. Duolink PLA in the absence of antibodies against RhoB and BTN3 was used as a negative control (red: PLA signal; blue: nuclei [DAPI]; dotted line: cell membrane). Figures are representative of two independent experiments. Figure 8B shows that HEK 293 cells were treated with either medium or pamidronate, co-stained with equal amounts of anti-CD277-PE (donor) and anti-CD277-DyLight 680 (acceptor) antibodies, and FRET efficiency in the cells was measured as described in Materials and Methods. Data shown are the mean S.E.M of three independent experiments in triplicate samples, where statistical significance was analyzed using the Mann-Whitney test. Figure 8C shows that HEK 293 cells were pretreated with either medium or pamidronate, trypsinized, permeabilized, and stained with anti-RhoB-Alexa Fluor 488 (FRET donor) and anti-CD277-DyLight 680 (FRET acceptor) antibodies. FRET efficiency was then measured by flow cytometry as described in Materials and Methods. Data show the mean + S.E.M of three independent experiments in triplicate samples, where statistical significance was analyzed using the Mann-Whitney test. Figure 8D shows the concentration-dependent binding of full-length CD277 intracellular domain (BFI) to Rho GTPase in the presence or absence of the phosphoantigen cHDMAPP. Binding of BFI to Rho GTPase was measured using biolayer interferometry (BM) in the absence of cHDMAPP (left panel) or in the presence of cHDMAPP (1:1) (right panel). Concentrations of CD277 BFI shown in the top panel are 6.25, 12.5, 25, 50, and 100 μM, shown in grey. Kinetic fitting curves are shown in black. In the lower panel, the concentrations of CD277 BFI shown are 3.75, 7.5, 15, 30 and 60 μM, shown in grey. Kinetic fitting curves are shown in black. FIG. 8E shows the same experimental setup, but in this case with recombinant CD277 B30.2 domain lacking the N-terminal region linkage to the transmembrane domain. In the left panel, the interaction was measured in the absence of cHDMAPP. The concentrations of BTN3A1 B30.2 shown were 12.5, 25, 50, 100 and 200 μM, shown in grey. Kinetic fitting curves are shown in black. In the lower panel, the interaction was measured in the presence of cHDMAPP (1:1). The concentrations of B30.2 domain shown are 3.75, 7.5, 15, 30 and 60 μM, shown in grey. Figures 8A-8E show that RhoB interacts with CD277 molecules to form a J-configuration of CD277, which dissociates after phosphoantigen processing. Figure 8A shows that EBV-LCL 48 cells were treated with either medium or the ABP pamidronate, loaded onto poly-L-lysine-coated coverslips, and permeabilized. The interaction of RhoB with CD277 was then assessed by Duolink PLA using anti-RhoB and anti-CD277 antibodies. Duolink PLA in the absence of antibodies against RhoB and BTN3 was used as a negative control (red: PLA signal; blue: nuclei [DAPI]; dotted line: cell membrane). Figures are representative of two independent experiments. Figure 8B shows that HEK 293 cells were treated with either medium or pamidronate, co-stained with equal amounts of anti-CD277-PE (donor) and anti-CD277-DyLight 680 (acceptor) antibodies, and FRET efficiency in the cells was measured as described in Materials and Methods. Data shown are the mean S.E.M of three independent experiments in triplicate samples, where statistical significance was analyzed using the Mann-Whitney test. Figure 8C shows that HEK 293 cells were pretreated with either medium or pamidronate, trypsinized, permeabilized, and stained with anti-RhoB-Alexa Fluor 488 (FRET donor) and anti-CD277-DyLight 680 (FRET acceptor) antibodies. FRET efficiency was then measured by flow cytometry as described in Materials and Methods. Data show the mean + S.E.M of three independent experiments in triplicate samples, where statistical significance was analyzed using the Mann-Whitney test. Figure 8D shows the concentration-dependent binding of full-length CD277 intracellular domain (BFI) to Rho GTPase in the presence or absence of the phosphoantigen cHDMAPP. Binding of BFI to Rho GTPase was measured using biolayer interferometry (BM) in the absence of cHDMAPP (left panel) or in the presence of cHDMAPP (1:1) (right panel). Concentrations of CD277 BFI shown in the top panel are 6.25, 12.5, 25, 50, and 100 μM, shown in grey. Kinetic fitting curves are shown in black. In the lower panel, the concentrations of CD277 BFI shown are 3.75, 7.5, 15, 30 and 60 μM, shown in grey. Kinetic fitting curves are shown in black. FIG. 8E shows the same experimental setup, but in this case with recombinant CD277 B30.2 domain lacking the N-terminal region linkage to the transmembrane domain. In the left panel, the interaction was measured in the absence of cHDMAPP. The concentrations of BTN3A1 B30.2 shown were 12.5, 25, 50, 100 and 200 μM, shown in grey. Kinetic fitting curves are shown in black. In the lower panel, the interaction was measured in the presence of cHDMAPP (1:1). The concentrations of B30.2 domain shown are 3.75, 7.5, 15, 30 and 60 μM, shown in grey. Figures 8A-8E show that RhoB interacts with CD277 molecules to form a J-configuration of CD277, which dissociates after phosphoantigen processing. Figure 8A shows that EBV-LCL 48 cells were treated with either medium or the ABP pamidronate, loaded onto poly-L-lysine-coated coverslips, and permeabilized. The interaction of RhoB with CD277 was then assessed by Duolink PLA using anti-RhoB and anti-CD277 antibodies. Duolink PLA in the absence of antibodies against RhoB and BTN3 was used as a negative control (red: PLA signal; blue: nuclei [DAPI]; dotted line: cell membrane). Figures are representative of two independent experiments. Figure 8B shows that HEK 293 cells were treated with either medium or pamidronate, co-stained with equal amounts of anti-CD277-PE (donor) and anti-CD277-DyLight 680 (acceptor) antibodies, and FRET efficiency in the cells was measured as described in Materials and Methods. Data shown are the mean S.E.M of three independent experiments in triplicate samples, where statistical significance was analyzed using the Mann-Whitney test. Figure 8C shows that HEK 293 cells were pretreated with either medium or pamidronate, trypsinized, permeabilized, and stained with anti-RhoB-Alexa Fluor 488 (FRET donor) and anti-CD277-DyLight 680 (FRET acceptor) antibodies. FRET efficiency was then measured by flow cytometry as described in Materials and Methods. Data show the mean + S.E.M of three independent experiments in triplicate samples, where statistical significance was analyzed using the Mann-Whitney test. Figure 8D shows the concentration-dependent binding of full-length CD277 intracellular domain (BFI) to Rho GTPase in the presence or absence of the phosphoantigen cHDMAPP. Binding of BFI to Rho GTPase was measured using biolayer interferometry (BM) in the absence of cHDMAPP (left panel) or in the presence of cHDMAPP (1:1) (right panel). Concentrations of CD277 BFI shown in the top panel are 6.25, 12.5, 25, 50, and 100 μM, shown in grey. Kinetic fitting curves are shown in black. In the lower panel, the concentrations of CD277 BFI shown are 3.75, 7.5, 15, 30 and 60 μM, shown in grey. Kinetic fitting curves are shown in black. FIG. 8E shows the same experimental setup, but in this case with recombinant CD277 B30.2 domain lacking the N-terminal region linkage to the transmembrane domain. In the left panel, the interaction was measured in the absence of cHDMAPP. The concentrations of BTN3A1 B30.2 shown were 12.5, 25, 50, 100 and 200 μM, shown in grey. Kinetic fitting curves are shown in black. In the lower panel, the interaction was measured in the presence of cHDMAPP (1:1). The concentrations of B30.2 domain shown are 3.75, 7.5, 15, 30 and 60 μM, shown in grey. Figures 8A-8E show that RhoB interacts with CD277 molecules to form a J-configuration of CD277, which dissociates after phosphoantigen processing. Figure 8A shows that EBV-LCL 48 cells were treated with either medium or the ABP pamidronate, loaded onto poly-L-lysine-coated coverslips, and permeabilized. The interaction of RhoB with CD277 was then assessed by Duolink PLA using anti-RhoB and anti-CD277 antibodies. Duolink PLA in the absence of antibodies against RhoB and BTN3 was used as a negative control (red: PLA signal; blue: nuclei [DAPI]; dotted line: cell membrane). Figures are representative of two independent experiments. Figure 8B shows that HEK 293 cells were treated with either medium or pamidronate, co-stained with equal amounts of anti-CD277-PE (donor) and anti-CD277-DyLight 680 (acceptor) antibodies, and FRET efficiency in the cells was measured as described in Materials and Methods. Data shown are the mean S.E.M of three independent experiments in triplicate samples, where statistical significance was analyzed using the Mann-Whitney test. Figure 8C shows that HEK 293 cells were pretreated with either medium or pamidronate, trypsinized, permeabilized, and stained with anti-RhoB-Alexa Fluor 488 (FRET donor) and anti-CD277-DyLight 680 (FRET acceptor) antibodies. FRET efficiency was then measured by flow cytometry as described in Materials and Methods. Data show the mean + S.E.M of three independent experiments in triplicate samples, where statistical significance was analyzed using the Mann-Whitney test. Figure 8D shows the concentration-dependent binding of full-length CD277 intracellular domain (BFI) to Rho GTPase in the presence or absence of the phosphoantigen cHDMAPP. Binding of BFI to Rho GTPase was measured using biolayer interferometry (BM) in the absence of cHDMAPP (left panel) or in the presence of cHDMAPP (1:1) (right panel). Concentrations of CD277 BFI shown in the top panel are 6.25, 12.5, 25, 50, and 100 μM, shown in grey. Kinetic fitting curves are shown in black. In the lower panel, the concentrations of CD277 BFI shown are 3.75, 7.5, 15, 30 and 60 μM, shown in grey. Kinetic fitting curves are shown in black. FIG. 8E shows the same experimental setup, but in this case with recombinant CD277 B30.2 domain lacking the N-terminal region linkage to the transmembrane domain. In the left panel, the interaction was measured in the absence of cHDMAPP. The concentrations of BTN3A1 B30.2 shown were 12.5, 25, 50, 100 and 200 μM, shown in grey. Kinetic fitting curves are shown in black. In the lower panel, the interaction was measured in the presence of cHDMAPP (1:1). The concentrations of B30.2 domain shown are 3.75, 7.5, 15, 30 and 60 μM, shown in grey. Figures 8A-8E show that RhoB interacts with CD277 molecules to form a J-configuration of CD277, which dissociates after phosphoantigen processing. Figure 8A shows that EBV-LCL 48 cells were treated with either medium or the ABP pamidronate, loaded onto poly-L-lysine-coated coverslips, and permeabilized. The interaction of RhoB with CD277 was then assessed by Duolink PLA using anti-RhoB and anti-CD277 antibodies. Duolink PLA in the absence of antibodies against RhoB and BTN3 was used as a negative control (red: PLA signal; blue: nuclei [DAPI]; dotted line: cell membrane). Figures are representative of two independent experiments. Figure 8B shows that HEK 293 cells were treated with either medium or pamidronate, co-stained with equal amounts of anti-CD277-PE (donor) and anti-CD277-DyLight 680 (acceptor) antibodies, and FRET efficiency in the cells was measured as described in Materials and Methods. Data shown are the mean S.E.M of three independent experiments in triplicate samples, where statistical significance was analyzed using the Mann-Whitney test. Figure 8C shows that HEK 293 cells were pretreated with either medium or pamidronate, trypsinized, permeabilized, and stained with anti-RhoB-Alexa Fluor 488 (FRET donor) and anti-CD277-DyLight 680 (FRET acceptor) antibodies. FRET efficiency was then measured by flow cytometry as described in Materials and Methods. Data show the mean + S.E.M of three independent experiments in triplicate samples, where statistical significance was analyzed using the Mann-Whitney test. Figure 8D shows the concentration-dependent binding of full-length CD277 intracellular domain (BFI) to Rho GTPase in the presence or absence of the phosphoantigen cHDMAPP. Binding of BFI to Rho GTPase was measured using biolayer interferometry (BM) in the absence of cHDMAPP (left panel) or in the presence of cHDMAPP (1:1) (right panel). Concentrations of CD277 BFI shown in the top panel are 6.25, 12.5, 25, 50, and 100 μM, shown in grey. Kinetic fitting curves are shown in black. In the lower panel, the concentrations of CD277 BFI shown are 3.75, 7.5, 15, 30 and 60 μM, shown in grey. Kinetic fitting curves are shown in black. FIG. 8E shows the same experimental setup, but in this case with recombinant CD277 B30.2 domain lacking the N-terminal region linkage to the transmembrane domain. In the left panel, the interaction was measured in the absence of cHDMAPP. The concentrations of BTN3A1 B30.2 shown were 12.5, 25, 50, 100 and 200 μM, shown in grey. Kinetic fitting curves are shown in black. In the lower panel, the interaction was measured in the presence of cHDMAPP (1:1). The concentrations of B30.2 domain shown are 3.75, 7.5, 15, 30 and 60 μM, shown in grey. Figure 9A: Gel filtration profile of RhoB GTPase expressed in E. coli. The peak from 17.8 ml to 19.2 ml contained purified RhoB GTPase monomer. Figure 9B shows an SDS-PAGE showing the fractions containing RhoB GTPase collected from the gel filtration experiment (17.5-19.5 ml, 0.5 ml/fraction). Figure 9C shows the concentration-dependent binding of full-length CD277 intracellular domain (BFI) to Rho GTPase in the presence or absence of the phosphoantigen IPP (top panel). Binding of BFI to Rho GTPase was measured using biolayer interferometry (BLI) in the absence of IPP (left panel) or in the presence of IPP (1:1) (right panel). The concentrations of CD277 BFI shown are 3.75, 7.5, 15, 30 and 60 μM, shown in grey. The same experimental setup was used, but with recombinant CD277 B30.2 domain lacking the N-terminal region linkage to the transmembrane domain (lower panel). In the left panel, the interaction was measured in the absence of IPP. The concentrations of CD277 B30.2 shown were 3.75, 7.5, 15, 30 and 60 μM, shown in grey. In the right panel, the interaction was measured in the presence of IPP (1:1). Figure 9A: Gel filtration profile of RhoB GTPase expressed in E. coli. The peak from 17.8 ml to 19.2 ml contained purified RhoB GTPase monomer. Figure 9B shows an SDS-PAGE showing the fractions containing RhoB GTPase collected from the gel filtration experiment (17.5-19.5 ml, 0.5 ml/fraction). Figure 9C shows the concentration-dependent binding of full-length CD277 intracellular domain (BFI) to Rho GTPase in the presence or absence of the phosphoantigen IPP (top panel). Binding of BFI to Rho GTPase was measured using biolayer interferometry (BLI) in the absence of IPP (left panel) or in the presence of IPP (1:1) (right panel). The concentrations of CD277 BFI shown are 3.75, 7.5, 15, 30 and 60 μM, shown in grey. The same experimental setup was used, but with recombinant CD277 B30.2 domain lacking the N-terminal region linkage to the transmembrane domain (lower panel). In the left panel, the interaction was measured in the absence of IPP. The concentrations of CD277 B30.2 shown were 3.75, 7.5, 15, 30 and 60 μM, shown in grey. In the right panel, the interaction was measured in the presence of IPP (1:1). Figure 9A: Gel filtration profile of RhoB GTPase expressed in E. coli. The peak from 17.8 ml to 19.2 ml contained purified RhoB GTPase monomer. Figure 9B shows an SDS-PAGE showing the fractions containing RhoB GTPase collected from the gel filtration experiment (17.5-19.5 ml, 0.5 ml/fraction). Figure 9C shows the concentration-dependent binding of full-length CD277 intracellular domain (BFI) to Rho GTPase in the presence or absence of the phosphoantigen IPP (top panel). Binding of BFI to Rho GTPase was measured using biolayer interferometry (BLI) in the absence of IPP (left panel) or in the presence of IPP (1:1) (right panel). The concentrations of CD277 BFI shown are 3.75, 7.5, 15, 30 and 60 μM, shown in grey. The same experimental setup was used, but with recombinant CD277 B30.2 domain lacking the N-terminal region linkage to the transmembrane domain (lower panel). In the left panel, the interaction was measured in the absence of IPP. The concentrations of CD277 B30.2 shown were 3.75, 7.5, 15, 30 and 60 μM, shown in grey. In the right panel, the interaction was measured in the presence of IPP (1:1). Figure 10 shows that accumulation of intracellular phosphoantigen induces an extracellular conformational change of CD277, leading to the formation of a J configuration of CD277. HEK 293 cells were pretreated with medium, C3 transferase and/or pamidronate, then the surface membrane of the cells was stained with fluorescent lipid conjugate BODIPY FL (FRET donor), and BTN3 molecules were labeled with mouse anti-CD277 mAb from clone 20.1 or clone 103.2, then stained with secondary Alexa Fluor 594-conjugated Fab fragment (GaM) (FRET acceptor). FRET efficiency was measured by flow cytometry. Data represent the mean ± S.E.M of at least three independent experiments in triplicate samples. Statistical significance of the data was analyzed by Mann-Whitney test. Figure 10 shows that accumulation of intracellular phosphoantigen induces an extracellular conformational change of CD277, resulting in the formation of a J configuration of CD277. HEK 293 cells were pretreated with medium, C3 transferase and/or pamidronate, then the surface membrane of the cells was stained with fluorescent lipid conjugate BODIPY FL (FRET donor), and BTN3 molecules were labeled with mouse anti-CD277 mAb from clone 20.1 or clone 103.2, then stained with secondary Alexa Fluor 594-conjugated Fab fragment (GaM) (FRET acceptor). FRET efficiency was measured by flow cytometry. Data represent the mean ± S.E.M of at least three independent experiments in triplicate samples. Statistical significance of the data was analyzed by Mann-Whitney test. FIG. 11 shows a model of the two-component mechanism in tumor cells that results in the recognition of the J-configuration of CD277 by engineered cells expressing the polypeptide construct TCR described herein. Non-activated phase: no accumulation of phosphoantigen (pAg, yellow star), which maintains GDP-bound RhoB (red circle + GDP) from the extranuclear region. Activated phase component I: accumulation of phosphoantigen is followed by more GTP-bound RhoB formation (red circle + GTP). GTP-bound RhoB undergoes intracellular recompartmentation (black arrow) and accumulates in the extranuclear region, promoting spatial redistribution of CD277 by promoting cytoskeletal capture (lines extending from the membrane) at the plasma membrane that binds to the B30.2 domain-proximal linking region (CR) of CD277 (blue hexagon). Activation step component II: GTP-bound RhoB dissociates (black arrow) and pAg binds to the B30.2 domain of CD277, which induces a conformational change in the extracellular region (ER) of CD277 resulting in binding of the polypeptide constructs described herein. Figures 12A-B show RhoB distribution in various cell types and its changes upon cellular stress. In Figure 12A, EBV-LCL line 93, CLM cell line K562, and healthy donor-derived CD3+ T cells, CD19+ B cells, and CD14+ cells freshly isolated from peripheral blood were incubated with 100 μM pamidronate and then analyzed for intracellular distribution of RhoB by confocal microscopy. The ratio of RhoB signal detected outside and inside the nuclear region is shown. In Figure 12B, cells irradiated with 3500 cGy and pretreated with 100 μM pamidronate were then analyzed for intracellular RhoB as in Figure 12A. The ratio indicates the change in RhoB distribution compared to non-irradiated cells. FIG. 13A shows anti-tumor reactivity of isolated clones by IFNγ production. T cells were co-incubated overnight with the target cell line Daudi at an E:T ratio of 1:1. Stimulation assays were performed in the absence (top plot) and presence (bottom plot) of 100 μM PAM. Bar graphs are representative of one or two (where error bars are present) experiments. Error bars represent SEM of two biological duplicate experiments. Arrows indicate clones with known TCR sequences. FIG. 13B shows a scatter plot of IFNγ production for Daudi versus HEK293FT cell lines in the absence or presence of 100 μM PAM. FIG. 13C shows a stimulation assay using HEK293FT cells as targets. FIG. 13A shows anti-tumor reactivity of isolated clones by IFNγ production. T cells were co-incubated overnight with the target cell line Daudi at an E:T ratio of 1:1. Stimulation assays were performed in the absence (top plot) and presence (bottom plot) of 100 μM PAM. Bar graphs are representative of one or two (where error bars are present) experiments. Error bars represent SEM of two biological duplicate experiments. Arrows indicate clones with known TCR sequences. FIG. 13B shows a scatter plot of IFNγ production for Daudi versus HEK293FT cell lines in the absence or presence of 100 μM PAM. FIG. 13C shows a stimulation assay using HEK293FT cells as targets. FIG. 13A shows anti-tumor reactivity of isolated clones by IFNγ production. T cells were co-incubated overnight with the target cell line Daudi at an E:T ratio of 1:1. Stimulation assays were performed in the absence (top plot) and presence (bottom plot) of 100 μM PAM. Bar graphs are representative of one or two (where error bars are present) experiments. Error bars represent SEM of two biological duplicate experiments. Arrows indicate clones with known TCR sequences. FIG. 13B shows a scatter plot of IFNγ production for Daudi versus HEK293FT cell lines in the absence or presence of 100 μM PAM. FIG. 13C shows a stimulation assay using HEK293FT cells as targets. Figure 14A shows the complete TRDV repertoire of donor C. Percentages indicate clonotype prevalence. Sequences with a frequency of 1 read/clonotype are excluded from the analysis. Figure 14B shows the MFI of γδ TCR expression of selected TCRs (n=7) along with that of a control TCR after transfer into PBMCs and selection procedure. Figure 14C shows the functional avidity of selected TCRs in TEG form along with that of a control TCR against the cell line Daudi. TEGs are plotted based on comparable γδ TCR expression. Figure 14A shows the complete TRDV repertoire of donor C. Percentages indicate clonotype prevalence. Sequences with a frequency of 1 read/clonotype are excluded from the analysis. Figure 14B shows the MFI of γδ TCR expression of selected TCRs (n=7) along with that of a control TCR after transfer into PBMCs and selection procedure. Figure 14C shows the functional avidity of selected TCRs in TEG form along with that of a control TCR against the cell line Daudi. TEGs are plotted based on comparable γδ TCR expression. Figure 14A shows the complete TRDV repertoire of donor C. Percentages indicate clonotype prevalence. Sequences with a frequency of 1 read/clonotype are excluded from the analysis. Figure 14B shows the MFI of γδ TCR expression of selected TCRs (n=7) along with that of a control TCR after transfer into PBMCs and selection procedure. Figure 14C shows the functional avidity of selected TCRs in TEG form along with that of a control TCR against the cell line Daudi. TEGs are plotted based on comparable γδ TCR expression. Figure 15A shows staining of Daudi cells using TCR tetramers. 1 ^* 10 ^Λ 5 (1x10 ⁵ ) Daudi cells (n=4) were stained with 100 nM SA-PE tetramers (biotin control or containing γδ TCR LM1 or CL5) for 30 min at room temperature and then stained with fixable viability dyes. Cells were incubated with 100 μM pamidronate (+PAM condition) for 2 h prior to staining. Stained cells were analyzed on a BD FACSCanto II (BD Bioscience). Figure 15B shows staining of Daudi cells using TCR dextramers. 1 ^* 10 ^Λ 5 Daudi cells (n=4) were stained with 100 nM SA-PE dextramer and analyzed as in FIG. 15A. FIG. 15C shows staining of Daudi cells using YG beads. 7.5 ^* 10 ^Λ 4 cells (n=3) were stained with 0.33 mg/ml YG beads (with or without γδ TCR LM1, CTE-CL3 or CTE-CL5 bound) and analyzed as in FIG. 15A. FIG. 15D shows staining of Daudi cells using YG beads. Binding competition assay using two anti-CD277 monoclonal antibodies (20.1 and 103.2). 7.5 10 ⁴ Daudi cells (n=2) were preincubated with the antibodies and incubated with CL5 beads for 30 min at room temperature. All analyses of FACS data were performed on a BD FACS Diva and graphs were generated in Graphpad Prism. Figure 15A shows staining of Daudi cells using TCR tetramers. 1 ^* 10 ^Λ 5 (1x10 ⁵ ) Daudi cells (n=4) were stained with 100 nM SA-PE tetramers (biotin control or containing γδ TCR LM1 or CL5) for 30 min at room temperature and then stained with fixable viability dyes. Cells were incubated with 100 μM pamidronate (+PAM condition) for 2 h prior to staining. Stained cells were analyzed on a BD FACSCanto II (BD Bioscience). Figure 15B shows staining of Daudi cells using TCR dextramers. 1 ^* 10 ^Λ 5 Daudi cells (n=4) were stained with 100 nM SA-PE dextramer and analyzed as in FIG. 15A. FIG. 15C shows staining of Daudi cells using YG beads. 7.5 ^* 10 ^Λ 4 cells (n=3) were stained with 0.33 mg/ml YG beads (with or without γδ TCR LM1, CTE-CL3 or CTE-CL5 bound) and analyzed as in FIG. 15A. FIG. 15D shows staining of Daudi cells using YG beads. Binding competition assay using two anti-CD277 monoclonal antibodies (20.1 and 103.2). 7.5 10 ⁴ Daudi cells (n=2) were preincubated with the antibodies and incubated with CL5 beads for 30 min at room temperature. All analyses of FACS data were performed on a BD FACS Diva and graphs were generated in Graphpad Prism. Figure 15A shows staining of Daudi cells using TCR tetramers. 1 ^* 10 ^Λ 5 (1x10 ⁵ ) Daudi cells (n=4) were stained with 100 nM SA-PE tetramers (biotin control or containing γδ TCR LM1 or CL5) for 30 min at room temperature and then stained with fixable viability dyes. Cells were incubated with 100 μM pamidronate (+PAM condition) for 2 h before staining. Stained cells were analyzed on a BD FACSCanto II (BD Bioscience). Figure 15B shows staining of Daudi cells using TCR dextramers. 1 ^* 10 ^Λ 5 Daudi cells (n=4) were stained with 100 nM SA-PE dextramer and analyzed as in FIG. 15A. FIG. 15C shows staining of Daudi cells using YG beads. 7.5 ^* 10 ^Λ 4 cells (n=3) were stained with 0.33 mg/ml YG beads (with or without binding to γδ TCR LM1, CTE-CL3 or CTE-CL5) and analyzed as in FIG. 15A. FIG. 15D shows staining of Daudi cells using YG beads. Binding competition assay using two anti-CD277 monoclonal antibodies (20.1 and 103.2). 7.5 10 ⁴ Daudi cells (n=2) were preincubated with the antibodies and incubated with CL5 beads for 30 min at room temperature. All analyses of FACS data were performed on a BD FACS Diva and graphs were generated in Graphpad Prism. Figure 15A shows staining of Daudi cells using TCR tetramers. 1 ^* 10 ^Λ 5 (1x10 ⁵ ) Daudi cells (n=4) were stained with 100 nM SA-PE tetramers (biotin control or containing γδ TCR LM1 or CL5) for 30 min at room temperature and then stained with fixable viability dyes. Cells were incubated with 100 μM pamidronate (+PAM condition) for 2 h prior to staining. Stained cells were analyzed on a BD FACSCanto II (BD Bioscience). Figure 15B shows staining of Daudi cells using TCR dextramers. 1 ^* 10 ^Λ 5 Daudi cells (n=4) were stained with 100 nM SA-PE dextramer and analyzed as in FIG. 15A. FIG. 15C shows staining of Daudi cells using YG beads. 7.5 ^* 10 ^Λ 4 cells (n=3) were stained with 0.33 mg/ml YG beads (with or without γδ TCR LM1, CTE-CL3 or CTE-CL5 bound) and analyzed as in FIG. 15A. FIG. 15D shows staining of Daudi cells using YG beads. Binding competition assay using two anti-CD277 monoclonal antibodies (20.1 and 103.2). 7.5 10 ⁴ Daudi cells (n=2) were preincubated with the antibodies and incubated with CL5 beads for 30 min at room temperature. All analyses of FACS data were performed on a BD FACS Diva and graphs were generated in Graphpad Prism. Figure 16 shows that TEGs expressing either non-functional TCR LM1, medium affinity CTE-CL3 or high affinity CTE-CL5 were co-incubated with HEK293FT cells, which were pre-incubated with 100 μM pamidronate or medium. Co-incubation was performed for up to 120 min, after which unbound cells were washed off. Samples were immunostained with anti-CD3e antibody and DAPI and used for confocal microscopy analysis. Images were quantified for the number of DAPI+ cells (total cells) and CD3 positive cells (TEGs). The percentages are shown. Analysis was performed on at least 10 independent images, and significance was determined by non-parametric ANOVA. Results show individual measurements with mean and SD values. FIG. 17A shows the immune synapse and quantification method. FIG. 17B shows that enrichment of TCR at the IS was measured by calculating the ratio of TCR signal intensity inside vs. outside the synaptic area. Analysis was performed on at least seven independent images, and significance was determined by non-parametric ANOVA. Results show individual measurements including mean and SD values. FIG. 17C and FIG. 17D show that cluster-sized target HEK-293FT tumor cells were treated with 100 μM pamidronate or medium and immunostained with CD277-AF647. Samples were then used for analysis by super-resolution microscopy. Images were analyzed with the cluster algorithm DBSCAN. FIG. 17E shows the cluster compactness of the immune synapse. FIG. 17F shows the number of clusters per ROI. FIG. 17A shows the immune synapse and quantification method. FIG. 17B shows that enrichment of TCR at the IS was measured by calculating the ratio of TCR signal intensity inside vs. outside the synaptic area. Analysis was performed on at least seven independent images, and significance was determined by non-parametric ANOVA. Results show individual measurements including mean and SD values. FIG. 17C and FIG. 17D show that cluster-sized target HEK-293FT tumor cells were treated with 100 μM pamidronate or medium and immunostained with CD277-AF647. Samples were then used for analysis by super-resolution microscopy. Images were analyzed with the cluster algorithm DBSCAN. FIG. 17E shows the cluster compactness of the immune synapse. FIG. 17F shows the number of clusters per ROI. FIG. 17A shows the immune synapse and quantification method. FIG. 17B shows that enrichment of TCR at the IS was measured by calculating the ratio of TCR signal intensity inside vs. outside the synaptic area. Analysis was performed on at least seven independent images, and significance was determined by non-parametric ANOVA. Results show individual measurements including mean and SD values. FIG. 17C and FIG. 17D show that cluster-sized target HEK-293FT tumor cells were treated with 100 μM pamidronate or medium and immunostained with CD277-AF647. Samples were then used for analysis by super-resolution microscopy. Images were analyzed with the cluster algorithm DBSCAN. FIG. 17E shows the cluster compactness of the immune synapse. FIG. 17F shows the number of clusters per ROI. FIG. 17A shows the immune synapse and quantification method. FIG. 17B shows that enrichment of TCR at the IS was measured by calculating the ratio of TCR signal intensity inside vs. outside the synaptic area. Analysis was performed on at least seven independent images, and significance was determined by non-parametric ANOVA. Results show individual measurements with mean and SD values. FIG. 17C and FIG. 17D show that cluster-sized target HEK-293FT tumor cells were treated with 100 μM pamidronate or medium and immunostained with CD277-AF647. Samples were then used for analysis by super-resolution microscopy. Images were analyzed with the cluster algorithm DBSCAN. FIG. 17E shows the cluster compactness of the immune synapse. FIG. 17F shows the number of clusters per ROI. FIG. 17A shows the immune synapse and quantification method. FIG. 17B shows that enrichment of TCR at the IS was measured by calculating the ratio of TCR signal intensity inside vs. outside the synaptic area. Analysis was performed on at least seven independent images, and significance was determined by non-parametric ANOVA. Results show individual measurements with mean and SD values. FIG. 17C and FIG. 17D show that cluster-sized target HEK-293FT tumor cells were treated with 100 μM pamidronate or medium and immunostained with CD277-AF647. Samples were then used for analysis by super-resolution microscopy. Images were analyzed with the cluster algorithm DBSCAN. FIG. 17E shows the cluster compactness of the immune synapse. FIG. 17F shows the number of clusters per ROI. FIG. 17A shows the immune synapse and quantification method. FIG. 17B shows that enrichment of TCR at the IS was measured by calculating the ratio of TCR signal intensity inside vs. outside the synaptic area. Analysis was performed on at least seven independent images, and significance was determined by non-parametric ANOVA. Results show individual measurements including mean and SD values. FIG. 17C and FIG. 17D show that cluster-sized target HEK-293FT tumor cells were treated with 100 μM pamidronate or medium and immunostained with CD277-AF647. Samples were then used for analysis by super-resolution microscopy. Images were analyzed with the cluster algorithm DBSCAN. FIG. 17E shows the cluster compactness of the immune synapse. FIG. 17F shows the number of clusters per ROI. FIG. 18A shows staining of ML1 cells using TCR tetramers. 1 ^* 10 ^Λ Five ML1 cells (n=4) were stained with 100 nM SA-PE tetramers (biotin control or containing γδ TCRs "LM1" or "CL5") for 30 min at room temperature and then stained with fixable viability dyes. Stained cells were analyzed on a BD FACSCanto II (BD Bioscience). FIG. 18B shows staining of ML1 cells using dextramers. 1 ^* 10 ^Λ Five ML1 cells (n=4) were stained with 100 nM SA-PE dextramers. FIG. 18C and FIG. 18D show staining of ML1 cells using YG beads. 7.5 ^* 10 ^Λ Four ML1 cells (n=3) were stained with 0.33 mg/ml YG beads (bound or not bound to γδ TCR “LM1”, “CTE-CL3” or “CTE-CL5”). FIG. 18A shows staining of ML1 cells using TCR tetramers. 1 ^* 10 ^Λ Five ML1 cells (n=4) were stained with 100 nM SA-PE tetramers (biotin control or containing γδ TCR "LM1" or "CL5") for 30 min at room temperature and then stained with fixable viability dyes. Stained cells were analyzed on a BD FACSCanto II (BD Bioscience). FIG. 18B shows staining of ML1 cells using dextramers. 1 ^* 10 ^Λ Five ML1 cells (n=4) were stained with 100 nM SA-PE dextramers. FIG. 18C and FIG. 18D show staining of ML1 cells using YG beads. 7.5 ^* 10 ^Λ Four ML1 cells (n=3) were stained with 0.33 mg/ml YG beads (bound or not bound to γδ TCR “LM1”, “CTE-CL3” or “CTE-CL5”). FIG. 18A shows staining of ML1 cells using TCR tetramers. 1 ^* 10 ^Λ Five ML1 cells (n=4) were stained with 100 nM SA-PE tetramers (biotin control or containing γδ TCRs "LM1" or "CL5") for 30 min at room temperature and then stained with fixable viability dyes. Stained cells were analyzed on a BD FACSCanto II (BD Bioscience). FIG. 18B shows staining of ML1 cells using dextramers. 1 ^* 10 ^Λ Five ML1 cells (n=4) were stained with 100 nM SA-PE dextramers. FIG. 18C and FIG. 18D show staining of ML1 cells using YG beads. 7.5 ^* 10 ^Λ Four ML1 cells (n=3) were stained with 0.33 mg/ml YG beads (bound or not bound to γδ TCR “LM1”, “CTE-CL3” or “CTE-CL5”). FIG. 18A shows staining of ML1 cells using TCR tetramers. 1 ^* 10 ^Λ Five ML1 cells (n=4) were stained with 100 nM SA-PE tetramers (biotin control or containing γδ TCRs "LM1" or "CL5") for 30 min at room temperature and then stained with fixable viability dyes. Stained cells were analyzed on a BD FACSCanto II (BD Bioscience). FIG. 18B shows staining of ML1 cells using dextramers. 1 ^* 10 ^Λ Five ML1 cells (n=4) were stained with 100 nM SA-PE dextramers. FIG. 18C and FIG. 18D show staining of ML1 cells using YG beads. 7.5 ^* 10 ^Λ Four ML1 cells (n=3) were stained with 0.33 mg/ml YG beads (bound or not bound to γδ TCR “LM1”, “CTE-CL3” or “CTE-CL5”). FIG. 19 shows representative flow cytometry dot plots of Daudi and ML1 cells stained with sTCR-conjugated beads.

EXAMPLES These examples are provided for illustrative purposes only and are not intended to limit the scope of the claims contained in this application.

Example 1. Identification of loci associated with Vγ9Vδ2 TCR-mediated target cell recognition by SAPPHIRE (SNP-Associated computational Pathway Hunt Including shRNA Evaluation) Differences in the genetic background of tumor cells affect the recognition of these cells by Vγ9Vδ2 TCR engineered T cells (e.g., those described herein). Therefore, a library of cell lines from the Centre d'Etude du Polymorphisme Humane (CEPH) was used, which contains a large collection of EBV-transformed B cell lines (EBV-LCL) derived from several pedigrees (Dausset et al., 1990) and genotyped for millions of SNPs (International HapMap, 2003). CD4+ αβ T cells engineered to express one defined Vγ9Vδ2 TCR were used in functional screening to exclude variability in recognition due to diverse γδ TCR repertoires and different expression of NK receptors. Recognition phenotype of EBV-LCL by Vγ9Vδ2 TCR T cells was assessed by IFNγ production, which showed an activated phenotype of 33 EBV-LCLs, whereas 7 were inactive (Figures 1A and 1B). Zygosity analysis showed that EBV-LCLs with an inactive phenotype were more potent than those with an activated phenotype as analyzed by SAPPHIRE. Hypothetical zygosity for the candidate loci was estimated using classical Mendelian inheritance patterns within CEPH family trios, where the effect of the candidate allele on Vγ9Vδ2 TCR-mediated recognition was assumed to be dominant. The resulting recognition phenotype combined with the pedigree of the CEPH cell lineages allowed accurate prediction of the zygosity of the candidate loci in 12 CEPH individuals, avoiding the need to screen a large number of LCL lines (Figure 2A). The hypothetical locus zygosity was then correlated with the available genotype information of the SNPs in the study population to identify 17 SNPs with genotypes perfectly (100%) correlated with the predicted zygosity (Figure 2B). Since none of these 17 SNPs, nor their proxy SNPs in high linkage disequilibrium ( ^r2 >0.8), directly influenced the gene by causing changes in the protein-coding sequence, it was presumed that the identified SNPs do not play a direct role but may represent surrogate markers for genetic regions associated with susceptibility to Vγ9Vδ2 TCR+ T cell recognition. The genomic neighborhood of these 17 SNPs was also queried for neighboring candidate genes (Figure 2C).

To test the relevance of these genes for Vγ9Vδ2 TCR+ T cell-mediated target recognition, we knocked down all 17 SNP-flanking genes in the Vγ9Vδ2 TCR+ T cell-activated EBV-LCL line 48. We then assessed the effect of knockdown on Vγ9Vδ2 TCR+ T cell activation by measuring IFNγ production. IFNγ production was reduced by knockdown of three genes (RAB4A, RHOB, and UBE3C) (Figure 2B). To confirm that the potential knockdown effect was on genes that selectively affect Vγ9Vδ2 TCR-dependent activation, we loaded Wilms tumor 1 (WT1) peptide into those three knockdown mutants of EBV-LCL line 48 and tested recognition with T cells engineered to express the cognate WT1-specific αβ TCR (Kuban et al., 2007). Selective knockdown of the small GTPase RhoB significantly affected activation of Vγ9Vδ2 TCR but not aβTCR engineered T cells (Figure 2B). Similar data were observed after partial knockdown of RhoB in the prototypic Vγ9Vδ2 T cell target cell line Daudi (Figure 3B) and after CRISPR/Cas-mediated partial RhoB knockout in the renal carcinoma cell line MZ1851RC (Figure 4A). Interestingly, even complete knockout of RhoB in 293 HEK cells only resulted in partial abolition of target cell-mediated Vγ9Vδ2 TCR T cell activation (Figure 3A). Moreover, knockout of RhoA or RhoC genes in 293 HEK cells did not significantly affect their ability to activate Vγ9Vδ2 TCR+ T cells (Figures 4B and 3C), highlighting that RhoB, in a nonredundant role, regulates tumor cell recognition by certain Vγ9Vδ2 TCs.

Example 2. Recognition of the J-configuration of CD277 on target cells by the polypeptide constructs described herein is dependent on Rho GTPase activity The effect of RhoB GTPase activity on the activation of Vγ9Vδ2 TCR+ T cells was assessed by pre-heating various tumor cell lines in the presence of the Rho GTPase activator calpeptin or the inhibitor C3 transferase. Pre-treatment with calpeptin significantly sensitized EBV-LCL 93 cells for recognition by Vγ9Vδ2 TCR+ T cells, whereas, conversely, inhibition of Rho GTPase with C3 transferase markedly reduced activation of Vγ9Vδ2 TCR+ T cells by LCL 48 cells (Figure 4D). Modulation of Rho GTPase activity did not affect recognition of WT1 peptide-loaded EBV-LCL 48 cells by WT1aβ TCR-transduced T cells. To confirm that RhoB enzymatic activity regulates tumor cell recognition by Vγ9Vδ2 TCR+ T cells, we transfected HEK 293 cells with wild-type or dominant-negative forms (RhoB-DN), corresponding to the GDP-bound state, or with a constitutively active form (RhoB-CA), corresponding to the GTP-bound form of RhoB (Kamon et al., 2006), and used them as targets for Vγ9Vδ2 TCR+ T cells (Figure 4E). HEK cells overexpressing the RhoB-CA mutant were able to induce significantly stronger Vγ9Vδ2 TCR-specific responses than cells expressing wild-type RhoB, whereas RhoB-DN transfected HEK cells showed a significantly reduced ability to stimulate Vγ9Vδ2 TCR+ T cells compared to cells expressing wild-type RhoB. These results suggest that modulation of the biochemical activity of RhoB GTPase in cancer cells may be useful for the recognition of those cancer cells by engineered cells expressing polypeptides that selectively bind to the J configuration or J confirmation of CD277, e.g., Vγ9Vδ2 TCR+ cells.

Example 3. Recognition of the J-configuration of CD277 on target cells is dependent on the intracellular distribution of RhoB RhoB was selectively excluded from nuclear regions in cells that could activate Vγ9Vδ2 TCR+ T cells (Figures 5A, 5B, 6A and 6D). Relocalization of RhoB from the nucleus or from the nuclear membrane to extranuclear sites was induced in cell lines by ABP and by the soluble phosphoantigen IPP (Figures 5C and 5D), highlighting that this process is dependent on the accumulation of intracellular phosphoantigens. The uniform intracellular distribution of other GTPases such as RhoA was not altered upon ABP treatment (Figure 6B). This supports the observation that knockdown of RhoA did not affect Vγ9Vδ2 TCR-mediated recognition (Figure 4B). RhoB was excluded from the nucleus in human but not mouse dendritic cells selectively treated with ABP. This occurred despite the RhoB protein sequence being identical in both species (Figures 5E and 6C). To test whether RhoB redistribution also occurs in leukemic cancer stem cells upon ABP treatment, leukemic blasts, cancer stem cells and healthy stem cells were sorted from the very same donors based on flow markers and the distribution of RhoB was quantified. Indeed, in primary blasts from acute myeloid leukemia patient donors, RhoB localization correlated with recognition by Vγ9Vδ2 TCR engineered T cells, including leukemic stem cells (Figures 5B and 6A), but not in healthy stem cells from the same donors (Figure 5F). Taken together, these results suggest that modulation of the subcellular distribution of the small GTPase RhoB in tumor cells (e.g., exclusion of RhoB from the nucleus) enhances their susceptibility to targeting by Vγ9Vδ2 TCR+ T cells.

Example 4. RhoB regulates CD277 membrane mobility and formation of CD277 J configuration on cancer cells The effects of ABPs and RhoB, key players in cytoskeleton reorganization and formation of actin stress fibers, on CD277 mobility were examined. Treatment of 293 HEK cells with the ABP zoledronate resulted in a decrease in CD277 membrane mobility. Notably, treatment with calpeptin induced CD277 immobilization to a level similar to that of ABP treatment alone, while C3 transferase counteracted this ABP effect (Figure 7A). This suggests that Rho GTPase activity may act on CD277 membrane immobilization upstream of the mevalonate pathway. Selective depletion of RhoB by CRISPR/Cas suppressed ABP-induced immobilization of CD277 to levels similar to medium controls, suggesting that ABP-mediated changes in CD277 mobility were dependent on RhoB.

Next, to assess the role of RhoB-induced cytoskeletal reorganization in mediating the observed CD277 mobility changes and J-arrangement formation, the relationship of CD277 molecules to F-actin was examined by tantalization experiments. HEK 293 cells were stained with fluorescently labeled anti-CD277 and phalloidin, and the tantalization coefficients were determined in response to treatment with ABP and calpeptin. In cells in culture, a variable but substantial colocalization of CD277 with F-actin was observed, which was significantly reduced by ABP treatment (Figure 7B). Remarkably, and similar to its effect on CD277 membrane mobility, calpeptin reduced the tantalization between CD277 and F-actin to a level comparable to that observed with ABP treatment. This decrease suggests that both phosphoantigen accumulation and Rho activation induce the formation of cytoskeleton-enclosed membrane domains where CD277 molecules can be captured and immobilized to form the J-configuration of CD277. Importantly, C3-transferase prevents ABP-induced CD277-actin detachment, again indicating the critical involvement of active Rho in this process. Taken together, these data suggest that regulation of CD277 membrane mobility by cytoskeleton reorganization and formation of the J-configuration of CD277 contributes to target recognition by engineered cells expressing polypeptides that specifically bind to the J-configuration, such as Vγ9Vδ2 TCR+ T cells.

Example 5. RhoB interacts with CD277 homodimers in cancer cells recognized by the polypeptide constructs described herein, e.g., Vγ9Vδ2 TCR Given the strong requirement for RhbB activity in membrane anchoring of CD277 to form a J configuration, we tested whether the regulation of CD277 involves a direct interaction with RhoB. Using an in situ/proximity ligation assay (PLA), we observed that RhoB and CD277 were in close proximity in recognized EBV-LCL cells only when pretreated with ABP (Figure 8A, Figure 5A). Importantly, PLA signals were typically excluded from the nuclear region and distributed near the plasma membrane. This is in line with our data that RhoB is involved in Vγ9Vδ2 TCR+ T cell recognition by regulating the formation of the J configuration of expressed CD277.

To determine whether CD277 exists as a homodimer when expressed in a cellular context and to study the RhoB-CD277 interaction at even higher resolution, we investigated the proximity interaction using fluorescence resonance energy transfer (FRET). Flow cytometric FRET measurements were performed in ABP-sensitive HEK 293 cells by overexpressing FRET-compatible fusion proteins or by labeling endogenous proteins with antibodies conjugated to FRET-compatible fluorochromes. These experiments showed that CD277 molecules are expressed as homodimers on the cell surface of cancer cells (Figure 8B), but pairing of CD277 molecules was insensitive to ABP-induced phosphoantigen accumulation. Proximity binding of RhoB to CD277 was undetectable in ABP-untreated HEK cells but was significantly increased after cells were treated with ABP (Figure 8C). Biolayer interferometry (BLI) was used to formally define possible docking sites for RhoB on the intracellular domain of CD277. RhoB binding was detected with recombinant full-length BTN3A1 intracellular domain (BFI) (Fig. 8D; left panel and Table 1), but was significantly reduced when recombinant CD277 B30.2 domain lacking the N-terminal region linked to the transmembrane domain was used (Fig. 8E; left panel). These data indicate a critical role for the membrane-proximal region of the CD277 intracellular domain in binding to RhoB GTPase. Interestingly, RhoB binding to BFI was almost completely abolished in the presence of the soluble phosphoantigen cHDMAPP (Fig. 8D; right panel). In the same experiment, when the more physiologically relevant but much lower affinity pAg IPP was applied, BLI failed to resolve pAg-induced dissociation of RhoB from BFI (Fig. 9C). This is likely due to technical limitations of the assay. In summary, these data indicate that methods and compositions designed to promote close interaction of RhoB with CD277 molecules at the surface membrane promote the formation of the J configuration and its recognition by the Vγ9Vδ2 TCR.

Example 6. Phosphoantigen accumulation is associated with a conformational change from CD277 dimer to J configuration To investigate the conformational change of CD277 to the J configuration in response to increasing phosphoantigen levels, surface membranes of unstimulated or ABP-stimulated HEK293 cells were labeled with a fluorescent lipid conjugate BODIPY FL (donor) and then stained with acceptor dye-conjugated BTN3-specific antibodies on ice to prevent conformational changes that may be caused by these antibodies under physiological conditions. In the absence of ABP stimulation, strong FRET efficiency between the stained membrane and both antibodies was observed (Figure 10B), suggesting that the CD277 Ig-V domain is in close proximity to the cell membrane. Remarkably, however, treatment of cells with ABP led to a significant decrease in the FRET signal (Figure 10B), indicating that intracellular phosphoantigen accumulation is associated with a conformational change of the BTN3 molecule. This change involves a significant detachment of the Ig-V domain from the cell membrane. Importantly, Rho inhibitor C3-transferase treatment of cells (Figure 3F) does not prevent the ABP-driven conformational change of CD277 homodimers (Figure 10B), indicating that this conformational change is independent of RhoB enzymatic activity. These data indicate that methods and compositions that promote CD277 dimerization act as or contribute to the molecular signature recognized by the Vγ9Vδ2 TCR, i.e., the J-configuration of CD277.

Figure 11 shows a model of Vγ9Vδ2 TCR T cell activation based on the data presented herein. In the non-activation stage, there is no accumulation of phosphoantigen (pAg, yellow star) that retains GDP-bound RhoB (circle + GDP) from the extranuclear region. In the activation stage component I, accumulation of phosphoantigen is followed by more GTP-bound RhoB formation (circle + GTP). GTP-bound RhoB undergoes intracellular recompartmentation (black arrow) and accumulates in the extranuclear region, promoting spatial redistribution of CD277 to a J configuration by promoting cytoskeletal capture (lines extending from the membrane) at the plasma membrane that binds to the B30.2 domain-proximal linking region (CR) of CD277 (blue hexagon). In activation step component II, GTP-bound RhoB dissociates (black arrow), and pAg binds to the B30.2 domain of CD277, which induces a conformational change in the extracellular region (ER) of CD277, leading to the formation of a J configuration of CD277, resulting in the activation of Vγ9Vδ2 TCR T cells.

Example 7. The identified SNPs predict recognition not only of LCL lines, but also of other tumor cell lines, including solid tumor cell lines.

The positive predictive value of SNPs A/G or G/G is stronger than the negative predictive value of A/A and is dependent on the affinity of the TCR (see Table 2). In Table 2, clone 5 encodes a γ9δ2 TCR with higher affinity than the γ9δ2 TCR encoded by clone 115 (Marcu-Mallna et al., "Redirecting αβ T cells against cancer cells by transfer of a broadly tumor-reactive γδ T-cell receptor," Blood, 118:50-59 (2011)). Thus, based on this data, the higher the TCR affinity, the more likely it is to be associated with a higher TCR affinity.
1) The positive predictive value is better (i.e., the included patients are more likely to be responders).

2) The negative predictive value is poor (i.e., responder patients may be excluded).

For the data in Table 2, the genotypes of the different tumor cells were evaluated by sequencing. Tumor cell recognition was evaluated by IFNα-ELIspot assay or ELISA, where the indicated tumor cell lines were used as targets for Vγ9Vδ2 TCR+ T cells expressing G115 or clone 5 chains. 0 indicates no recognition; 1 indicates significant recognition. False negative and true positive recognition for the indicated SNPs are calculated.

These data indicate that RhoB is a key regulator of tumor cell recognition by T cells engineered to express a defined γδ TCR (i.e., "TEG cells"), and that enhancing the affinity of the γ9δ2 TCR can partially overcome this mechanism. Furthermore, stresses such as irradiation do not induce the mechanism (relocation of RhoB to the plasma membrane) nor the recognition (see FIG. 12).

Example 8. SNPs Located Outside of Rho-GTPase Can Affect Rho-GTPase In some cases, a given SNP located within a gene of interest has a direct effect on the expression or function of the protein encoded by the gene. However, in some cases, the identified SNP does not map directly within these regions and splice variants may not be detected.

One hypothesis is that SNPs located outside Rho-GTPase may affect its activity. The database used in the SAPPHIRE strategy may not be complete and therefore may not cover all SNPs. To further identify genetic variants that correlate with the marker SNP genotypes, extended genome sequencing is performed, focusing mainly on the promoter region of Rho-GTPase. Although the Rho-GTPase promoter region differs between mice and humans, the sequence of Rho-GTPase itself is identical. This observation could potentially explain why γδ2 T cells are not observed in mice. In addition, the recently released SAPPHIRE next generation database is used, which allows for more significant SNP analysis to detect SNPs located within the genomic region of Rho-GTPase. An improved 2.0 version of SAPPHIRE will be developed by including proxy SNPs (i.e., SNPs in high LD with SNP hits; www.broadinstitute.org/mpg/snap/ldsearch.php ) and predicting the function of (proxy) SNPs (e.g., missense, promoter, regulatory regions, etc.; e.g., http://fastsnp.ibms.sinica.edu.tw/ ). SNPs are also correlated with differential gene expression using expression quantitative trait loci (eQTL) analysis ( http://www.sanger.ac.uk/resources/software/genevar/ ), and common cellular processes or pathways among candidate genes are inferred by NCBI Gene Ontology (GO) terms. In particular, genes encoding Rho-regulatory proteins are targeted, including about 130 genes belonging to the GEF (guanine nucleotide exchange factor), GAP (GTPase activating protein) and GDI (guanine nucleotide exchange inhibitor) molecular families. Thus, genes are frequently located in the same chromosomal regions as Rho-GTPases and are therefore also close to the marker SNPs. Such genes are subject to further computational and sequence analysis.

Predicted outcome: For example, SNPs in the promoter region or regulatory genes of Rho-GTPase associated with the marker SNP may be identified. Follow-up studies may include promoter studies to obtain functional data on differential regulation of Rho-GTPase by the given SNP, or overexpression or inhibition studies of regulatory proteins of Rho-GTPase.

Example 9. Experimental Procedures Cells and Reagents Cells and Reagents The CEPH EBV-LCL line (CEU population panel) was a kind gift from Tuna Mutis (UMC Utrecht, The Netherlands). Daudi, K562, SW480, HEK293, HEK293FT and Phoenix-Ampho cell lines were obtained from ATCC. LCL-TM (another EBV-LCL line than the CEPH panel) was kindly provided by Phil Greenberg (Seattle, USA). MZ1851RC was kindly provided by Barbara Seliger (University of Halle, Germany). Hek293, Phoenix-Ampho, SW480, MZ1851RC cells were cultured in DMEM supplemented with 1% Pen/Strep (Invitrogen) and 10% FCS (Bodinco), all other cell lines were cultured in RPMI containing 1% Pen/Strep and 10% FCS. Fresh primary PBMCs were isolated by Ficoll-Paque (GE Healthcare) from buffy coats provided by Sanquin Blood Bank (Amsterdam, The Netherlands). Frozen primary acute myeloid leukemia (AML) samples were kindly provided by Matthias Theobald (Mainz, Germany) and collected in compliance with GCP and Helsinki regulations.

The following reagents were used: pamidronate (Calbiochem), zoledronic acid monohydrate (zolidronate, Sigma-Aldrich), isopentenyl pyrophosphate (IPP) (Sigma-Aldrich), calpeptin (Rho activator II CN03, Cytoskeleton Inc), C3 transferase (Rho inhibitor I CT04, Cytoskeleton Inc), farnesyltransferase inhibitor (FTI) (Sigma-Aldrich) and geranylgeranyltransferase inhibitor (GGTI) (Sigma-Aldrich).

Flow Cytometry Antibodies used for flow cytometry included: pan-γδTCR-PE (clone IMMU510, Beckman Coulter), CD4-FITC (eBioscience), CD8-APC (BD), unconjugated rabbit polyclonal RhoB (Abcam), goat anti-rabbit Alexa Fluor 488 (Jackson ImmunoResearch). Mouse a-CD277 mAb (clone #20.1 and 103.2) was kindly provided by D. Oliver (INSERM U891, Marseille, France). Samples were processed on FACSCalibur and FACSCanto-II flow cytometers (BD) and analyzed with FACSDiva software (BD). Primary leukemic stem cells and healthy progenitor cells were sorted according to phenotypic markers as previously described (Terwijn et al., 2014).

Cells were sorted using FACS Aria SORP with red, blue and violet solid-state lasers (BD Biosciences). Cells were kept on ice during the entire procedure. Cells were labeled with Anti-CD45RA Alexa Fluor 700, Anti-CD38APC, Anti-CD34 Horizon BV421, Anti-CD45 Horizon V500 (all BD Biosciences, San Jose, CA, USA). CD34+ CD38- stem cells were sorted based on CD45RA expression. CD45RA positive cells are neoplastic and CD45RA negative cells are normal hematopoietic stem cells. CD34+ CD38+ progenitor cells were further sorted.

Retroviral Transduction of TCR Retroviral Transduction of TCR: The Vγ9Vδ2-TCR clone G115 (Allison et al., 2001) and the HLA-A ^* 0201-restricted WT1126-134-specific αβ TCR (Kuball et al., 2007) were introduced into αβ T cells as described (Marcu-Malina et al., 2011, Stanislawski et al., 2001). Briefly, Phoenix-Ampho packaging cells were transfected with pBullet retroviral constructs containing gag-pol (pHIT60), env (pCOLT-GALV), and TCRγ/β chain-IRES-neimycin or TCRδ/α chain-IRES-puromycin using Fugene6 (Promega). PBMCs preactivated with αCD3 (30 ng/ml) (clone OKT3, Janssen-Cilag) and IL-2 (50 U/ml) were transduced twice with viral supernatants within 48 h in the presence of 50 U/ml IL-2 and 4 μg/ml polybrene (Sigma-Aldrich). Transduced T cells were expanded by stimulation with αCD3/CD28 Dynabeads (0.5×106 beads/106 cells) (Invitrogen) and IL-2 (50 U/ml) and selected with 800 μg/ml Geneticin (Gibco) and 5 μg/ml Puromycin (Sigma-Aldrich) for 1 week. CD4+ TCR-transduced T cells were isolated by MACS sorting using CD4 microbeads (Miltenyi Biotec).

After transduction, transduced T cells were stimulated biweekly with 1 μg/ml PHA-L (Sigma-Aldrich), 50 U/ml IL-2 (Novartis Pharma), 5 ng/ml IL-15 (R&D Systems) and irradiated allogeneic PBMC, Daudi and LCL-TM cells. Fresh IL-2 was added twice weekly. Transgenic TCR expression and purity of the CD4+ population were routinely assessed by flow cytometry.

Functional T cell assays IFNγ ELISPOT was performed as previously described (Scheper et al., 2013; Marcu-Malina et al., 2011). Briefly, 15,000 Vγ9Vδ2 TCR-transduced or mock-transduced T cells and 50,000 target cells (ratio 0.3:1) were co-cultured for 24 h in nitrocellulose-bottom 96-well plates (Millipore) pre-coated with anti-IFNγ antibody (clone 1-D1K) (Mabtech). Plates were washed and incubated with a secondary biotinylated anti-IFNγ antibody (clone 7-B6-1) (Mabtech) followed by streptavidin-HRP (Mabtech). IFNγ spots were visualized with TMB substrate (Sanquin) and the number of spots was quantified using ELISPOT analysis software (Aelvis).

Alternatively, Vγ9Vδ2 TCR-transduced T cells and target cells were co-cultured as described above in round-bottom 96-well plates and IFNγ levels in the supernatants were measured by ELISA. Where indicated, target cells were pretreated with pamidronate (100 μM), IPP (15 μM), FTI (10 μM), GGTI (50 μM), calpeptin (2 μg/ml) or C3 transferase (20 μg/ml) prior to co-incubation. To test stimulation of WT1αβ TCR-transduced T cells, 10 μM WT1 _126-134 peptide was added to the HLA-A2+ cell lines EBV-LCL48 and MZ1851RC.

Zygosity/SNP correlation analysis Recognition of CEPH EBV-LCL lines [pretreated with either medium, pamidronate (100 μM) or IPP (15 μM)] by Vγ9Vδ2 TCR-transduced CD4+ T cells was determined by ELISPOT. Mock-transduced T cells were included as effector controls. Any EBV-LCL lines that induced IFNγ production by mock-transduced cells were excluded from the analysis. Recognition of EBV-LCL lines by Vγ9Vδ2 TCR+ T cells in a single assay was defined as at least a two-fold increase in IFNγ spots compared to that occurring in the response of healthy control target cells, regardless of EBV-LCL pretreatment (i.e. medium, pamidronate or IPP). An EBV-LCL line was defined as activated if it was recognized in at least three of five independent experiments. Classical Mendelian inheritance patterns within CEPH families were used to estimate hypothetical zygosity for the candidate locus, where the effect of the candidate allele on Vγ9Vδ2 TCR-mediated recognition was assumed to be dominant. Correlations of estimated zygosity with Hapmap SNP genotypes of CEPH individuals were then calculated using the software tool ssSNPer, as previously described (Spaapen et al., 2008). Proxy SNPs within 500 kb of the SNPs generated by ssSNPer were collected by querying the SNP Annotation and Proxy Search (SNAP) tool (Johnson et al., 2008), using ^r2 = 0.8 as the threshold for linkage disequilibrium. eQTL analysis of ssSNPer SNPs and their proxies was performed using the Genevar (GENe Expression VARiation) tool ( Yang et al., 2010 ).

shRNA and CRISPR/Cas Genome Editing HEK293FT cells were transfected using Fugene 6 (Promega) with lentiviral constructs (Sigma-Aldrich) containing shRNA with lentiviral helper constructs VSVG and pspax2 for candidate genes of interest. EBV-LCL 48 cells were transfected with viral supernatants 4 days prior to functional T cell assays. Knockdown of targeted genes was confirmed using real-time Q-PCR or, in the case of RhoB, by flow cytometry.

The CRISPR/Cas9 system (van de Weijer et al., 2014) was used to knock out RHOA, RHOB or RHOC from MZ1851RC cells. For this purpose, a lentiviral CRISPR/Cas9 vector (Ref Weijer et al.) was used that co-expresses S. pyogenes Cas9, PuroR, and a human U6 promoter driving the expression of an anti-RHOA guide RNA (gRNA). Gene-specific regions of the gRNA sequence were designed by the Zhang lab's CRISPR design tool (http://crispr.mit.edu/). The sequences were GAACTATGTGGCAGATATCG (RHOA) (SEQ ID NO: 2), GTGGTGGGCGACGGCGCGTG (RHOB) (SEQ ID NO: 3), and GAAAGAAGCTGGTGATCGT (RHOC) (SEQ ID NO: 4). As a control gRNA, the eGFP gene containing GTGAACCGCATCGAGCTGAA (SEQ ID NO: 5) was targeted.

Lentivirus was generated using standard third generation packaging vectors in 293T cells. MZ1851RC cells were transduced with the indicated CRISPR/Cas9 lentiviruses and cells were selected with 2 μg ml-1 puromycin. Efficiency of RhoB knockout was assessed using flow cytometry.

Western blot analysis EBV-LCL lines 22, 48, 91 and 93 were treated with pamidronate overnight and lysed with lysis buffer containing NP-40. Lysates were centrifuged to remove cell debris and supernatants were separated by SDS-PAGE. Protein contents were transferred to PVDF membranes (Millipore), blocked for 1 h in blocking buffer (5% milk) and incubated overnight with rabbit polyclonal antibodies against RhoB (LifeSpan Biosciences) or β-tubulin (clone DM1A) (Sigma). Blots were then incubated with HRP-conjugated secondary antibodies and bands were visualized using Pierce ECL substrate (Thermo Scientific).

Confocal microscopy and data analysis. For intracellular immunostaining of RhoB, cells were treated with pamidronate overnight (where indicated) and attached onto poly-L-lysine precoated coverslips (Sigma-Aldrich). Cells were then permeabilized with permeabilization solution 2 (BD), blocked with blocking serum (50% pooled normal human serum in PBS), stained with rabbit polyclonal anti-RhoB antibody (AbCam), and then stained with secondary goat anti-rabbit IgG Alexa Fluor 488-conjugated antibody (Jackson ImmunoResearch). Cells were washed with blocking serum, fixed with 4% paraformaldehyde, stained with DAPI (where indicated), and mounted on microscope slides using Mowiol. Images were acquired using a Zeiss confocal laser scanning microscope LSM 700. The ratio of nuclear to extranuclear signals of RhoB was determined using Volocity software (PerkinElmer) or Image J software, where DAPI staining was used to label nuclei when available.

To determine the colocalization of BTN3 molecules with the actin cytoskeleton, HEK293 cells were grown on poly-L-lysine-coated coverslips and pretreated with either calpeptin (2 μg/ml) or C3 transferase (20 μg/ml), after which samples were treated with pamidronate. Samples were fixed, permeabilized, and stained for BTN3 and F-actin with DyLight 680-conjugated BTN3 antibody (clone BT3.1, Novus Biologicals) and fluorescein-conjugated phalloidin (Sigma), respectively. The correlation coefficient between BTN3 and F-actin signals was determined as a measure of colocalization using Volocity software.

FRAP microscopy FRAP analysis was performed as previously described (Harly et al., 2012, Sandstrom et al., 2014). Briefly, HEK293FT cells expressing EmGFP-fused CD277 were placed on m-slides (Ibidi) and analyzed using a Nikon A1 RS confocal microscope (60x NA 1.40 oil immersion objective). Selected rectangular areas were photobleached for 500 ms using full laser intensity (>90% fluorescence loss). Images were collected every 5 s using low laser intensity before (30 s) and after (120 s) bleaching. Images were analyzed using Metamorph 7.5 (Molecular Devices, Universal Imaging) and NIS (Nikon) imaging software. The resulting curves were fitted using a one-phase exponential equation.

Flow Cytometry FRET
To examine the association (binding) of RhoB with BTN3 molecules, cells were permeabilized using permeabilization solution 2 (BD), then blocked with PBS containing 50% human serum, and labeled with rabbit polyclonal anti-RhoB antibody (Abeam). After washing with PBS, samples were labeled with Alexa594-conjugated goat anti-rabbit IgG (acceptor) (Jackson ImmunoResearch) and CD277-PE (donor) (BT3.1, Biollegend), respectively. Donor fluorescence was measured using a FACS Canto-II flow cytometer (BD), where donor fluorescence of dual-labeled samples was compared to that of samples labeled with donor antibody only. FRET efficiency was calculated from the slight decrease in donor fluorescence in the presence of acceptor.

To determine homodimerization of CD277 molecules, cells were co-stained with equal amounts of PE-conjugated anti-CD277 (donor) and Dylight680-conjugated anti-CD277 (acceptor) and samples were measured using a FACS Canto-II flow cytometer (BD). FRET efficiency was calculated using the formula by Sebestyen et al. (Sebestyen et al., 2002), where donor fluorescence was excited at 488 nm and detected at 576 ± 26 nm, acceptor fluorescence was excited at 635 nm and detected at 780 ± 60 nm, while FRET intensity was excited at 488 nm and detected at 780 ± 60 nm. Correction factors for the spectral overlap between the different fluorescence channels were obtained from data measured on unlabeled and single-labeled cells.

Conformational changes of BTN3 molecules were determined as described (Gaspar et al., 2001). Cells were labeled with 5 μg/ml BODIPY-FL DPHE (donor) (Life Technologies) for 10 min on ice, then at 37°C for 10 min, and then washed extensively with ice-cold PBS. Cells were then labeled with mouse anti-CD277 mAbs (either clone #20.1 or #103.2) and Alexa594-conjugated goat anti-mouse Fab fragments (Jackson ImmunoResearch). After washing, cells were resuspended in ice-cold PBS and immediately measured using a FACS Canto-II flow cytometer (BD). FRET efficiency was calculated from the small decrease in donor fluorescence in the presence of the acceptor.

Proximity ligation assay HEK 293FT cells were grown on poly-L-lysine-coated coverslips and pretreated with 100 μM pamidronate overnight, then fixed and permeabilized with permeabilization buffer 2 (BD) for 15 min. Cells were then washed three times with PBS and blocked in PBS containing 50% human serum for 30 min at 22°C. After blocking, cells were incubated with rabbit anti-RhoB (AbCam) and mouse anti-CD277 (Novus Biologicals) in PBS containing 50% human serum for 60 min at 22°C. Cells were washed three times with PBST (0.05% Tween) and incubated with secondary mouse PLUS and rabbit MINUS antibodies for 1.5 h at 37°C in the dark. After washing the cells three times in PBST, the probes were detected with an in situ PLA detection kit (Abnova). The cells were analyzed with a 63x objective on a Zeiss LSM 710 fluorescence microscope.

In Vitro Protein Expression and Purification Full length RhoB protein was cloned into a PET 28A vector containing a C-terminal 6-His tag (SEQ ID NO: 6) followed by a thrombin cleavage site using restriction enzyme sites Ndel and XhoI (5' primer: CGCCATATGATGGCGCCATCCG (SEQ ID NO: 7); 3' primer: CGCCTCGAGTTAGCAGCAGTTGATGCAGC (SEQ ID NO: 8)). The C-terminal CKVL (SEQ ID NO: 9) motif of RhoB was deleted to prevent inappropriate prenylation in Escherichia coli. The construct was expressed in BL21 strain E. coli. Cells were grown in Terific Broth (TB) at 37°C to an OD600 of 0.6 and then transferred to room temperature (25°C). After a 15 min recovery, cells were induced with 1 ml of 1 M isopropyl β-D-1-thiogalactopyranoside (IPTG) per liter of culture for 12-16 h. Protein was collected and purified using Ni-NTA (Qiagen) IMAC chromatography in 20 mM Tris pH 8.0, 400 mM NaCl, 20 mM imidazole, ₅ mM MgCl2, and 4 mM 2-mercaptoethanol (BME), first washed with 1 mM ATP supplemented in said buffer to dissociate potential chaperones from RhoB, then with ATP-free buffer, and finally eluted with 20 mM Tris pH 8.0, 400 mM NaCl, 250 mM imidazole, ₅ mM MgCl2, and 4 mM BME. The eluted fractions were desalted into 10 mM Hepes 7.2, 150 mM NaCl, 0.02% azide, 5 mM _MgCl2 and 4 mM BME using an Econo-Pac 10DG column (Biorad). The protein was further purified by gel filtration on a Superdex 200 column (GE Healthcare) in 10 mM Hepes pH 7.2, 150 mM NaCl, 0.02% azide, ₅ mM MgCl2 and 4 mM BME. Protein concentration was determined both by the BCA test and by measuring the A280 signal using an ND-1000 spectrophotometer (NanoDrop Technologies, Inc.) using theoretical extinction coefficients. The BTN3A1 B30.2 domain was expressed and purified as previously described (Sandstrom et al., 2014). The BTN3A1 full-length intracellular domain was cloned into pET28a containing a 3C protease site followed by a carboxyl-terminal 6HIS tag (SEQ ID NO:6) using NcoI and XhoI (5' primer: GCGCCATGGGGCAACAGCAGGAGGAAAAA (SEQ ID NO:10); 3' primer: CGCTCGAGGGGCCCCTGGAACAGAACTTCCAGACCACCAGACGCTGGACAAATAGTC (SEQ ID NO:11)). The construct was expressed in BL21 strain E. coli. Cells were grown in Lysogeny Broth (LB) at 37°C to an OD600 of 0.6 and induced with 1 ml of 1M IPTG per liter of culture for 4 hours at room temperature. Protein was harvested and purified using Ni-NTA (Qiagen) IMAC chromatography in 20 mM Tris pH 8.0, 400 mM NaCl, 20 mM imidazole, 4 mM BME, eluted with 20 mM Tris pH 8.0, 400 mM NaCl, 250 mM imidazole, 4 mM BME and desalted into 10 mM Hepes pH 7.2, 150 mM NaCl, 0.02% azide, 4 mM BME using an Econo-Pac 10DG column (Biorad). The protein was cleaved overnight using 3C protease at 4° C. Protein concentration was measured as described above (Fig. S4A and S4B).

Biolayer Interferometry (BLI)
The interaction between RhoB and the BTN3A1 full-length intracellular domain (BFI) or the BTN3A1 B30.2 domain was measured using Biolayer Interferometry (BLItz, ForteBio). The BLI buffer used for baseline equilibration and dissociation steps was prepared using 10 mM Hepes pH 7.2, 150 mM NaCl, 0.02% azide, 5 mM MgCl ₂ , 4 mM BME. RhoB at a concentration of 2 mg/ml was immobilized on a Ni-NTA biosensor hydrated with BLI buffer using a basic kinetic method with the following parameters: 30 s for baseline, 300 s for association, and 300 s for dissociation. The RhoB-positioned biosensor was then blocked with 1 mg/ml BSA and equilibrated with BLI buffer using a similar method with the following parameters: 30 s for baseline, 120 s for association, and 120 s for dissociation. The buffer run was used as a reference for subsequent experiments. The interaction of RhoB with various concentrations of BFI (6.25, 12.5, 25, 50, and 100 μM) or B30.2 domain (12.5, 25, 50, 100, and 200 μM) was measured using the same method as above. The interaction of RhoB with various concentrations of BFI (3.75, 7.5, 15, 30 and 60 μM) or B30.2 domain (3.75, 7.5, 15, 30 and 60 μM) in the presence of (2E)-1-hydroxy-2-methylpent-2-enyl-pyrophosphonate (cHDAMPP) was also measured using the same method as described above. The ratio of cHDAMPP to BFI or B30.2 domain was maintained at 1:1 in these measurements. The rate and association constants for the binding interactions were analyzed by Biaevolution (Biacore Life Sciences). Data were truncated to 180 s and _k and _k were fitted simultaneously using 1:1 binding with a drifting baseline model.

G-LISA Assay RhoA activity was assayed using the G-LISA RhoA Activation Assay Biochem kit (catalog no. BK124; Cytoskeleton, Inc., Denver, CO, USA) according to the manufacturer's instructions. Briefly, cells were lysed in ice-cold lysis buffer containing a protease inhibitor cocktail, followed by centrifugation at 10,000×g for 1 min at 4° C. The supernatant was collected and protein concentration was measured using Precision Red Advanced Protein Assay Reagent, and finally equilibrated to 1.0 mg/ml with ice-cold lysis buffer. The equilibrated protein extract was transferred to Rho-GTP-binding protein pre-coated plates. The plates were placed on an orbital microplate shaker at 0.72×g for 30 min at 4° C. and then incubated with monoclonal mouse anti-human anti-RhoA primary antibody (catalog no. GL01A; 1:250; Cytoskeleton, Inc.) and then with polyclonal goat anti-mouse horseradish-conjugated secondary antibody (catalog no. GL02; 1:62.5; Cytoskeleton, Inc.) for 45 min each at room temperature on an orbital microplate shaker (SSM1; Bibby Scientific Limited Group) at 0.72×g. The plates were then incubated with HRP detection reagent for 15 min at 37° C. After addition of HRP stop buffer, the absorbance was read at 490 nm using a microplate reader.

Statistical analysis All experiments were independently repeated at least three times unless otherwise indicated. All data are presented as mean ± SEM. Statistical significance was analyzed by Mann-Whitney or Kruskal-Wallis test and Dunn's multiple comparison test.

While preferred embodiments of the present disclosure have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are described by way of example only. Accordingly, numerous variations, changes and substitutions will occur to those skilled in the art without departing from the present disclosure. It should be understood that various alternatives to the embodiments described herein or combinations of one or more of the embodiments or aspects described herein may be used in practicing the present disclosure. The following claims define the scope of the disclosure, and it is intended that methods and structures within the scope of these claims and their equivalents be covered thereby.

Example 10: Experimental Methods Cell Lines The cell lines Daudi, LCL-TM, ML-1, JurMA and Jurkat-76 were cultured in RPMI (Gibco) supplemented with 10% FCS and 1% pen/strep (Gibco). HEK293FT cell lines were cultured in DMEM (Gibco) supplemented with 10% FCS and 1% pen/strep. Human primary T cell clones were cultured in RPMI supplemented with 10% pooled human serum and 1% pen/strep. Human bulk primary T cells used for retroviral transduction were cultured in RPMI supplemented with 2.5% pooled human serum and 1% pen/strep. All human primary T cells were cultured following a 2 week rapid expansion protocol [REP; containing irradiated feeder cells (Daudi, LCL-TM and allogeneic PBMC)+PHA+IL-15+IL-2].

Generation, expansion and functional testing of γ9δ2 T cell clones PBMCs were stained with a monoclonal antibody against Vδ2 (Vδ2-FITC clone B6) (mAb). The mAb positive fraction was sorted in bulk, expanded on REPs and then cloned by limiting dilution (donor A) or single cell sorted using FACS sorting involving collection of single cells in 96-well plates (donors B, C). All FACS sorting was performed on an ARIAII (BD). 8-12 rounds of expansion were performed on REPs before functional testing. As soon as cells had expanded to sufficient numbers, functional testing was performed. 5*10 ^Λ 4 T cells were incubated overnight with target cells at an E:T ratio of 1:1 in DMEM supplemented with 10% FCS and 1% pen/strep in the presence or absence of 100 μM pamidronate disodium salt (Calbiochem Cat#506600), and the following day, supernatants were collected and IFNy concentrations were measured using ELISA (eBioscience Ready-Set-Go! ELISA kit, Invitrogen Cat#88731688).

TCR Sequencing and Vector Creation RNA was isolated from primary T cell clones using the Qiagen RNeasy Minikit according to the manufacturer's instructions. cDNA was synthesized using a specific primer in the 3' constant region (TRDCRev TTCACCAGACAAGCGACA (SEQ ID NO: 12)) using Superscript® II reverse transcriptase (Thermofisher). cDNA was purified using NucleoSpin Gel and PCR Clean-UP (Machery-Nagel). The cDNA was amplified in a PCR amplification using the same reverse primer in the constant region (TRDCRev TTCACCAGACAAGCGACA (SEQ ID NO: 12)) and a specific V52 forward primer (TRDV2Fw TCTCTTCTGGGCAGGAGTC (SEQ ID NO: 13)) using Q5® High Fidelity DNA Polymerase (New England Biolabs) in a T100 Thermal Cycler (Biorad) and the following cycling parameters:

TCR gamma and delta chains were sequenced using primers specific for variable and constant gene segments [TRDV2Fw TCTCTTCTGGGCAGGAGTC (SEQ ID NO: 13), TRDCRev TTCACCAGACAAGCGACA (SEQ ID NO: 12), TRGV9Fw TCCTTGGGGCTCTGTGTGT (SEQ ID NO: 14), TRGCRev GGGGAAACATCTGCATCA (SEQ ID NO: 15)]. Sanger sequencing was performed at Macrogen.

The TCRδ and TCRγ chains of a selection of identified γδ T-cell clones were reconstituted in a retroviral expression vector using overlap extension PCR to introduce new CDR3 sequences. Briefly, a set of primers was generated based on the invariant sequences flanking the CDR3 region of the codon-optimized constructs encoding either the γ or δ chain of G115, and the primers were extended with clone-specific nucleotides. A 15-20 bp extension within the overhang was designed to be the reverse complement to the paired primer (see Table 3).

In PCR "R1", the V-(D)-J portion (variable domain and part of the CDR3 region) was amplified using forward primers [G115δFwd: CTGCCATGGAGCGGATCAGC (SEQ ID NO: 70), G115γFwd: GCCATGGTGTCCCTGCTG (SEQ ID NO: 71); NcoI restriction site is shown in italics] that contain restriction sites and bind to template strands delta and gamma TCRG115 cloned into the retroviral pBullet vector, and clone-specific reverse primer Rev R1 (Table 3). Similarly, the (D)-J-C portion of the TCR chain was amplified in PCR "R2" using a fixed reverse primer [G115δRev: ATGCGGATCCTCACAGG (SEQ ID NO: 72), G115γRev: TAGTGGATCCTCAGCTCTTCTC (SEQ ID NO: 73); BamHI restriction site is shown in italics] and clone-specific forward primer Fwd R2. After gel-based size selection and purification using NucleoSpin Gel and PCR Clean-UP kits (Machery-Nagel), two of the PCR products (R1 and R2) were fused and amplified in PCR "R3" using primer pairs G115δFwd/G115δRev and G115γFwd/G115γRev to obtain a TCR chain containing a clone-specific CDR3 region. All reactions were performed using Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific) in a T100 thermal cycler (Biorad) and the following parameters: for R1-R2: 120 s at 98°C, 30 cycles of 20 s at 98°C, 20 s at 59°C, and 25 s at 72°C, followed by 600 s at 72°C; for R3: 120 s at 98°C, 30 cycles of 20 s at 98°C, 20 s at 56°C, and 40 s at 72°C, followed by 600 s at 72°C.

After another gel-based size selection step, the newly synthesized TCR chains were purified and cloned into the retroviral pBullet vector using the NcoI and BamHI cloning sites. The TCRδ gene was cloned into pBullet-IRES-puromycin and the TCRγ gene was cloned into pBullet-IRES-neo. Sequence identity was confirmed by Sanger sequencing (Macrogen).

Retroviral transduction of plasmids The vector pairs containing the TCR chains of interest were introduced into primary human T cells. Functional testing of the TCR in TEG form was performed in the same way as for the primary clones.

High-throughput sequencing of the TCR δ chain RNA was isolated using the Qiagen RNeasy Microkit according to the manufacturer's instructions. cDNA was synthesized using a specific primer in the 3' constant region (TRDCRev TTCACCAGACAAGCGACA (SEQ ID NO: 12)) using Superscript® II reverse transcriptase (Thermofisher). cDNA was purified using NucleoSpin Gel and PCR Clean-UP (Machery-Nagel). The cDNA was amplified in a PCR amplification using the same reverse primer in the constant region (TRDCRev TTCACCAGACAAGCGACA (SEQ ID NO: 12)) and a specific V52 forward primer (TRDV2Fw TCTCTTCTGGGCAGGAGTC (SEQ ID NO: 13)) using Q5® High Fidelity DNA polymerase (New England Biolabs) in a T100 thermal cycler (Biorad) and the following cycling parameters: 92°C for 300 sec, 30 cycles of 92°C for 30 sec, 63°C for 30 sec and 72°C for 45 sec, followed by 72°C for 420 sec. After purification with NucleoSpin Gel and PCR Clean-UP, library preparation for HTS was performed using the HTSgo-LibrX kit with HTSgo-IndX index from Gendx according to the manufacturer's recommendations. Sample cleanup was performed using HighPrep PCR beads from GC Biotech. High-throughput sequencing was performed on an Illumina MiSeq System 500 (2x250bp) (Illumina). TCR sequence alignment, assembly and clonotype extraction were performed using the MiXCR (version v2.1.1) program. An in-house R script was used for TCRδ repertoire analysis and data was filtered to exclude clonotypes with a frequency of 1 read/clonotype.

Cloning, expression and purification of soluble TCRs The extracellular domains of the TCR chains were amplified from synthetic DNA encoding the full-length TCR. The domain boundaries were based on those previously published for Vγ9Vδ2 TCR G115. The TCR δ chain was ligated into a modified pBullet vector containing a μ-phosphatase signal peptide at the 5′ end of the construct and a fos zipper at the 3′ end. The TCR γ chain was ligated into a modified pBullet vector containing a μ-phosphatase signal peptide at the 5′ end and a 3′jun zipper followed by a biotin acceptor peptide and a polyhistidine tag. Synthetic DNA encoding the bacterial biotin ligase BirA was also ligated into the pBullet vector containing the signal peptide. Expression of soluble γδ TCR was performed in Freestyle 293-F cells (ThermoFisher). Briefly, plasmids containing TCRδ, TCRγ and BirA were mixed in a 45:45:10 ratio and combined with polyethyleneimine (PEI) in a 2:3 ratio and incubated at room temperature for 15 min. The DNA:PEI mixture was added to cells at a concentration of 1-1.5 μg plasmid/10Λ6 cells and after 6 h the medium was supplemented with Pen/Strep (Gibco) and 100 μM biotin. Five days after transfection, the medium was harvested, supplemented with phosphate buffer (pH 7.5) and NaCl to final concentrations of 20 mM and 300 mM, respectively, and loaded onto a 1 ml HisTrap Excel column (GE Healthcare). Soluble TCR was washed and eluted from the column using a multi-step gradient of increasing concentrations of imidazole. The eluted soluble TCR was loaded onto a 1 ml HiTrapQ column (GE Healthcare) in 20 mM Tris (pH 8.2) and 20 mM NaCl. A linear gradient was used to elute the soluble TCR. Fractions containing soluble TCR were pooled and concentrated. Tetramers and dextramers were prepared. Briefly, tetramers were prepared from monomers by adding 1 equivalent of SA-PE (1 μM) to 6 equivalents of sTCR (6 μM) in 4 steps over 20 min. Dextramers were prepared by preincubating SA-PE and sTCR at a 1:3 molar ratio for 15 min, followed by the addition of biotinylated dextran (molecular weight 500 kDa; NanoCS) to the resulting trimer at a molar ratio of 1:8 (dextran:SA-PE). For bead preparation, the biotinylated soluble TCR was mixed in excess with streptavidin-conjugated fluorescent yellow-green microspheres (6 μm; Polysciences, Inc.) to ensure 10 μg sTCR/mg microspheres of fully coated beads.

sTCR multimer cell binding assay For tetramer and dextramer staining, 1.0 ^* 10Λ5 cells were incubated with 30 μl of tetramer or dextramer solution (100 nM for SA-PE) for 30 min at room temperature. For bead staining, 7.5* ¹⁰⁴ cells were incubated with 20 μl of sTCR-YG beads (0.33 mg/ml beads) for 30 h. Cells were then stained with the fixable viability dye eFluor780 (eBiosciences) for an additional 30 min. For inhibition assays using anti-CD277 antibodies 20.1 or 103.2 (kind gift from Daniel Olive, Marseille, France), Daudi cells were preincubated with the antibody for 15 min at room temperature before the addition of sTCR-YG beads. The mixture was fixed for 15 min by adding 40 μl of 2% formaldehyde. Samples were washed once with 1% formaldehyde and analyzed on a BD FACSCanto II (BD).

γδ TCR Enrichment and Conjugation to Synapses HEK293FT cells were seeded in μ-slide poly-L-lysine precoated chambers (Ibidi) and allowed to attach overnight. The next day, cells were treated with 100 μM PAM for 1 h at 37°C. TEG was added onto HEK293FT cells and incubated for 30-120 min at 37°C. After coincubation, chambers were immediately placed on ice and fixed with 4% PFA for 30 min. Samples were blocked with 1% BSA/FCS, labeled with 2 μg/mL CD3ε-AlexaFluor 647 (BD Biosciences) for 2 h at room temperature, and finally fixed with 1% PFA+DAPI. Samples were imaged on a Zeiss LSM-710 and analyzed with Volocity software (PerkinElmer). To quantify the number of HEK293FT and TEG cell conjugates, the ratio of CD3ε positive to DAPI positive was calculated on the captured images.To analyze the enrichment of gamma delta TCR to the immunological synapse, the ratio of CD3ε signal enrichment inside the contact area of target and effector cells to outside the contact area was calculated on 63x magnification images.

Super-resolution imaging HEK293FT cells were plated in 8-well Lab-Tek chambers, allowed to attach, and treated with 100 μM pamidronate overnight. For super-resolution imaging, cells were labeled with AF647-CD277 at room temperature. After labeling, cells were washed with PBS and fixed with 4% PFA and 0.2% glutaraldehyde for 1-2 hours. Prior to super-resolution imaging, 200 μL of fresh SRB (super-resolution buffer: 50 mM Tris, 10 mM NaCl, 10% glucose, 168.8 U/mL glucose oxidase, 1404 U/mL catalase, 10 mM cysteamine hydrochloride, pH 8.0) was added to the wells. dSTORM imaging was performed using an inverted microscope (IX71; Olympus America) equipped with an oil immersion 1.45-NA total internal reflection fluorescence objective (U-APO 150x; Olympus America). A 637 nm diode laser (HL63133DG; Thorlabs) was used for AF647 excitation. A quad-band dichroic and emission filter set (LF405/488/561/635-A; Semrock) was used for sample illumination and emission. A custom two-channel splitter with a 585 nm dichroic (Semrock) and additional emission filters (692/40 nm and 600/37) was used to separate the emission light into different quadrants of an AndorIxon 897 electron-multiplying charge-coupled device (EM CCD) camera (Andor Technologies, South Windsor, CT). The sample chamber of an inverted microscope (IX71; Olympus America, Center Valley, PA) was mounted on a three-dimensional piezo stage (Nano-LPS; Mad City Labs, Madison, WI) with a resolution of 0.2 nm along the x, y and z axes. A custom stage stabilization routine was used to correct for sample drift throughout the imaging procedure. Images were acquired at 57 frames/sec in TIRF, with 10,000-20,000 frames collected for each image reconstruction.

Super-resolution image reconstruction and data analysis. dSTORM images were analyzed and reconstructed with custom MATLAB functions as previously described (Smith et al., 2010, Nat Methods; Huang et al., 2011, Biomed Opt Express). For each image frame, subregions were selected based on local intensity maxima. Each subregion was then fitted to a pixelated Gaussian intensity distribution using a maximum likelihood estimator. Fit results were rejected based on fit accuracy and log-likelihood ratios estimated using Cramer-Rao lower bounds for each parameter as well as intensity and background cutoffs. Analysis of dSTORM CD277 cluster data was performed using the density-based DBSCAN algorithm as part of the package Local Clustering Tools (http://stmc.health.unm.edu). The parameters chosen were a maximum distance between adjacent cluster points of epsilon = 50 nm, and a minimum cluster size of 6 observations. Cluster boundaries were generated with the MATLAB "boundary" function using a default methodology that generates a contour midway between the convex hull and the most dense surface surrounding the points. Cluster areas within these boundaries were then converted to the radius of a circle of equivalent area for more intuitive interpretation. Regions of interest (ROIs) of size 2 μm x 2 μm were selected from the set of images where equivalent radius statistics were collected for each ROI.

Example 11: Functional profiling of γ9δ2 T cells To more broadly evaluate the impact of individual γ9δ2 TCRs on the functional activity of individual γ92δ T cell clones, γδ T cell clones were isolated by limiting dilution or FACS sorting. In vitro antitumor activity was determined by IFNγ production against the tumor cell line Daudi. Considerable antitumor functional heterogeneity was observed among γ9δ2 T cell clones (N=57) isolated from four healthy donors, with approximately 60% of the clones being reactive against the tumor cell line Daudi when a cutoff of 30 pg/ml was chosen for reliable measurement of IFNy concentration (Figure 13A). Bisphosphonates such as pamidronate (PAM) may enhance the activity of γ9δ2 T cells by induction of CD277J, which is promoted by RhoB and sensed by γ9δ2 TCR. In the presence of 100 μM PAM, the reactivity of the examined γ9δ2 T cell clones was enhanced on average 10-fold (range 0,7-37,3; median 8,1), with more than 95% of the clones showing reactivity above the threshold when PAM was added ( FIG. 13A ). To assess whether the activity profile observed exclusively for Daudi cells or was also valid for other targets, the cell line HEK293FT, an additional well-characterized γδ T cell target, was co-incubated with the isolated γδ T cell clones. The HEK293FT cell line induces much lower cytokine secretion in the absence of PAM, with only about 30% of the γ9δ2 T cell clones resulting in the secretion of IFNy above the cutoff. However, in the presence of PAM, the reactivity of individual clones was comparable to their reactivity to Daudi, as evidenced by the strong correlation of IFNγ secretion when the exact same clones were tested against Daudi or HEK293FT (Spearman's r=0.893, p<0.0001 (n=54), Figures 13B and 13C).

Example 12: Clonal frequency of γ9δ2 T cells To further study the role of γ9δ2 TCR in the in vitro antitumor activity of individual γ9δ2 T cell clones, 20 of the 57 clones were selected for γ9δ2 TCR sequencing. These clones encompassed the full range of clonal activity, as shown in Figure 13A. Several clonal pairs (B2 and B5, C4 and C14, C7 and C11) were found to express the same TCR, ultimately resulting in a total of 17 unique clonotypes. Within individual clonotypes, all δ chains were unique, although there was some overlap in the γ chains, both intra- and inter-donor, with respect to CDR3 region sequences (Figure 14A).

High-throughput sequencing (HTS) of the complete γ9δ2 TCR repertoire of the same donor used for single-cell sorting was performed. As shown by the example of donor C, the frequency (prevalence) of certain clonotypes in the donor's repertoire did not correlate with the functional activity of the respective clone against Daudi or HEK293FT. The highest frequency clone C6 belongs to one of the most reactive γ9δ2 T cell clones isolated from this donor, whereas the other three high frequency clonotypes (C2, C4, C11) showed a lower range of reactivity (Figure 14B), but we cannot exclude that the indicated δ chains show higher activity when combined with other γ chains. Conversely, the highly active γ9δ2 T cell clones from donor A were not frequent in the original donor. Thus, the clonal frequency did not correlate with the functional activity of individual γ9δ2 T cells.

Example 13: Functional activity of parental γ9δ2 T cells A selection of sequenced γ and δ TCR genes were synthesized, cloned into retroviral pBullet vectors, and expressed in primary αβ T cells to allow analysis of individual γδ TCRs in the absence of other co-receptors in γδ T cells. First, we assessed whether mutations in the CDR3 region affect TCR surface expression. As shown in FIG. 14C, all TEGs generated expressed similar levels of γδ TCR, as exemplified by TCR clones A1-A6 and in clone 13 (C113), G115, clone 3 (C13), and clone 5 (C15). As shown in FIG. 14D, substantial differences in activity could be observed between TEGs engineered to contain weak TCRs (e.g., artificially designed CTE-C13) and TEGs engineered to contain strong TCRs (CTE-C15). Similarly, γ9δ2 TCRs from the natural repertoire differed substantially in their ability to induce IFNγ secretion in the TEG format. However, functional activity did not correlate with that of the parental clones, as shown by the highly reactive clones A4, A5 and C113, whose TCRs were not fully activated in the TEG format ( FIG. 14D ). This suggests that other factors, such as additional co-receptors or epigenetic regulation, contribute to the functional response of γ9δ2 T cell clones.

Example 14: γ9δ2 TCR target interaction Tetramers and dextramers were designed containing the γ9 and δ2 TCR chains of γδ TCR clone 5 and the non-functional length mutant LM1. Consistent with the low affinity interaction of γ9δ2 TCR with its ligand used to sense the CD277J configuration, neither the γ9δ2 TCR tetramer nor the dextramer bound to the classical target Daudi (FIG. 15A and FIG. 15B). Next, the number of γδ TCRs on the multimer was increased to obtain higher interaction avidity. The extracellular domain of the non-functional length mutant LM1, as well as the γδ TCR CTE-C13 and CTE-C15, which in the TEG form provide low and high functional avidity, were coupled to streptavidin-conjugated yellow-green fluorescent beads (herein referred to as YG beads). This allowed at least 10 ⁴ γδ TCRs to be attached to the surface of the YG beads. YG beads expressing γ9δ2 TCR were used to stain the known negative target cell line ML1 and the positive target cell line Daudi. No YG bead binding to ML1 cells could be observed in any of the cases of TCR-coated beads (FIGS. 19A-19D). On the other hand, the amount of YG bead binding to Daudi cells was dependent on the TCR used to coat the beads (FIGS. 15C and 20). LM1, a non-functional γ9δ2 TCR, showed almost no binding to Daudi cells, just like the low-avidity (in TEG form) TCR CTE-C13. The high functional avidity γ9δ2 TCR, CTE-Cl5, showed significantly higher binding to Daudi cells, indicating that the functional avidity of γ9δ2 TCR is indeed related to γ9δ2 TCR ligand affinity. Beads bound to γδ TCR clone 5 showed the same staining pattern as CTE-CL5 beads (Figure 19D). Interestingly, YG beads bound only to a fraction of tumor cells (Figure 20). This likely reflects technical limitations of the bead-to-cell ratio rather than heterogeneity of the ligand within the target population itself. γ9δ2 TCR senses the CD277J configuration.

Binding of CTE-Cl5 YG beads to Daudi cells allowed us to assess whether CD277J interacts directly with the γ9δ2 TCR. CTE-Cl5 YG beads were incubated with Daudi cells in the presence of two commonly used monoclonal antibodies against CD277, namely 20.1 and 103.2. Binding of CTE-Cl5 YG beads to Daudi was inhibited by both monoclonal antibodies, indicating that CD277 interacts directly with the Vγ9Vδ2 TCR (Figure 15D). We also determined whether static YG beads could sense CD277J induced by PAM. Addition of PAM did not change the strength of binding of TCR-YG-beads to Daudi cells (Figure 15C). This indicates that static TCR-YG-beads can capture γ9δ2 TCRs of various affinities to CD277, but cannot fully mimic the mode of action of γ9δ2 TCR expressed in the cell membrane.

Example 15: Dynamic interactions of γ9δ2 TCR with its counterparts To further evaluate whether the different functional avidity of γ9δ2 TCR when expressed in TEG form is modulated by its ability to mediate TEG binding to tumor cell targets, a more dynamic model was utilized. Therefore, Jurma cells expressing comparable levels of the different γδ TCRs were incubated with HEK293FT tumor cells. The use of adherent HEK293FT cells allowed the disposal of TEG not bound to tumor cells within 120 min after incubation by washing, followed by staining with DAPI and anti-CD3 antibodies. The number of tumor cell-T cell conjugates was evaluated. In contrast to YG bead staining, in the absence of PAM, not only did conjugation correlate with the affinity of the γ9δ2 TCR used, but PAM treatment increased the number of conjugates, especially in the case of low affinity γ9δ2 TCRs, and surprisingly also in the case of the non-functional mutant LM1 (Figure 16). This finding suggests that physical binding of different γ9δ2 TCRs to certain proteins expressed on tumor cells promotes sequential conjugation of T cells expressing γ9δ2 TCR with tumor cells. However, conjugation may be independent of the CDR3 region of γ9δ2 TCR. Thus, PAM may induce conjugation that is dependent on γ9δ2 TCR but independent of CDR3, but this is insufficient to fully activate T cells. Additional steps must be involved to induce full T cell activation.

An additional step reported to be essential for the activation of T cells expressing γ9δ2 TCR could be CD277J positioning at the plasma membrane of tumor cells. To investigate whether CD277J is also associated with increased clustering of γ9δ2 TCR on the side of T cells and whether such a process is dependent on the CDR3 region of γ9δ2 TCR, spatial changes at the plasma membrane in the context of different γδ TCR affinities were analyzed. Confocal imaging of late immunological synapses formed between Jurma T cells engineered to express non-functional TCR LM1, low affinity CTE-Cl3 and high affinity CTE-Cl5 were determined. The amount of γδ TCR accumulated at the contact area between tumor target and T cell compared to T cell membrane areas distant from the immunological synapse is shown in Figures 17A and 17B. Synaptic enrichment of γδ TCR was significantly higher for CTE-C15 (at low phosphoantigen levels) when compared with CTE-C13 and LM1 TCR on PAM-untreated tumor cells (FIG. 17B). Although T cells expressing the inactive TCR LM1 showed significant tumor cell binding (FIG. 16), LM1 TCR did not recruit to the immunological synapse even at high phosphoantigen levels when tumor cells were pretreated with PAM (FIG. 17B). PAM pretreatment did not affect recruitment of the high affinity CTE-C15 TCR to the immune synapse. However, it significantly increased accumulation of the low affinity CTE-C13 TCR in the synapse. This suggests that the CDR3 region of the γ9δ2 TCR does not affect the proximity of tumor cells to T cells, whereas it is useful for supporting the recruitment of the lower affinity γ9δ2 TCR to the synapse. This finding suggests that the affinity of the γ9δ2 TCR determines its recruitment to the immunological synapse, and that complete synapse formation can be further enhanced by PAM.

Finally, to understand whether the enhanced recruitment of low affinity CTE-Cl3 TCRs at synapses was the result of alterations in CD277 clustering by PAM treatment, we performed direct stochastic optical reconstruction microscopy (dSTORM), a localization-based super-resolution imaging technique that provides a resolution of approximately 20 nm. BTN3A molecules were labeled with AF647-CD277 antibody and super-resolution images were acquired at the basement membrane of HEK293FT cells. To quantify the images, we used the density-based spatial clustering application (DBSCAN). DBSCAN classifies localizations into clusters based on their relative local spatial density. Individual clusters were identified and the distribution of clusters across the various conditions was compared. Treatment with PAM did not dramatically change the size, density or number of localization clusters (Figure 17C, D, E and F). Results were similar when using Getis-G or Hierarchal clustering methods. Selection of the maximum distance between adjacent cluster points to an epsilon of 30, 40 or 50 nm gave similar BTN3A nanoclustering results.
In one aspect, the present invention provides the following.
[Item 1]
A pharmaceutical composition comprising a polypeptide construct that selectively binds to the J configuration of CD277 on a target cell, said polypeptide construct being expressed in the cell.
[Item 2]
2. The pharmaceutical composition according to item 1, wherein the polypeptide construct binds with high selectivity to the J configuration of CD277 compared to CD277 molecules that are not in said J configuration.
[Item 3]
2. The pharmaceutical composition according to item 1, wherein the target cell is a cancer cell.
[Item 4]
2. The pharmaceutical composition according to item 1, wherein the target cell is a leukemia cell.
[Item 5]
2. The pharmaceutical composition according to claim 1, wherein the polypeptide construct comprises at least one of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence.
[Item 6]
2. The pharmaceutical composition according to claim 1, wherein the polypeptide construct comprises at least one variant or fragment of a gamma- or delta-TCR polypeptide sequence.
[Item 7]
6. The pharmaceutical composition of claim 5, wherein the γ-TCR polypeptide sequence is a γ9-TCR polypeptide sequence or a fragment thereof.
[Item 8]
6. The pharmaceutical composition of claim 5, wherein the δ-TCR polypeptide sequence is a δ2-TCR polypeptide sequence or a fragment thereof.
[Item 9]
2. The pharmaceutical composition of item 1, wherein CD277 exists as a dimer.
[Item 10]
A method for treating cancer in a subject comprising administering to the subject an effective amount of a pharmaceutical composition comprising a polypeptide construct that selectively binds to CD277 on cancer cells, wherein the CD277 molecule is in J configuration, and the polypeptide construct may optionally be expressed in the cells.
[Item 11]
A method for removing cancer cells in a subject in need of such removal, comprising administering to the subject an effective amount of a pharmaceutical composition comprising a polypeptide construct that selectively binds to CD277 on cancer cells when CD277 is in the J configuration, or an effective amount of engineered cells that express said polypeptide construct.
[Item 12]
12. The method of item 10 or 11, wherein the polypeptide construct recognizes the J configuration of CD277 with high selectivity compared to CD277 molecules not in said J configuration.
[Item 13]
12. The method of item 10 or 11, wherein the formation of the J configuration requires at least an interaction between RhoB and CD277 and/or compartmentalization of CD277.
[Item 14]
14. The method of claim 13, wherein the formation of the J configuration requires interaction of an intracellular phosphoantigen with CD277 following interaction of RhoB with CD277.
[Item 15]
12. The method of claim 10 or 11, wherein the polypeptide construct comprises at least one of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence.
[Item 16]
12. The method of claim 10 or 11, wherein the polypeptide construct comprises at least one variant or fragment of a gamma-TCR or delta-TCR polypeptide sequence.
[Item 17]
12. The method of item 10 or 11, comprising administering a substance that enhances translocation of RhoB GTPase to the cell membrane of the cancer cell.
[Item 18]
The method of claim 10 or 11, wherein the method comprises administering a substance that modulates RhoB GTPase, the substance targeting at least one of a GTPase activating protein (GAP), a guanine nucleotide exchange factor (GEF), and a guanine nucleotide dissociation inhibitor (GDI).
[Item 19]
12. The method of item 10 or 11, further comprising determining the subject's genotype for a mutation that correlates with RhoB GTPase expression or activity.
[Item 20]
The method according to claim 10 or 11, further comprising determining the genotype of a gene selected from genes encoding a protein selected from a GTPase activating protein (GAP), a guanine nucleotide exchange factor (GEF) and a guanine nucleotide dissociation inhibitor (GDI), wherein the protein regulates RhoB GTPase.
a) providing immune cells expressing a small amount of an additional (intrinsic) co-receptor;
b) providing a nucleic acid sequence encoding a γ9-T cell receptor chain and a nucleic acid sequence encoding a δ2-T cell receptor chain, wherein the γ9-T cell receptor chain and the δ2-T cell receptor chain selectively bind to CD277 when CD277 is in a J configuration;
c) introducing the nucleic acid sequence of step b) into a T cell to obtain an engineered cell containing a γ9δ2 T cell receptor comprising the γ9-T cell receptor chain of step b) and the δ2-T cell receptor chain of step b);
A method for manipulating a cell, comprising:
[Item 22]
a) contacting a cell expressing a T cell receptor with a target cell;
b) detecting the level of immune activation of cells expressing the T cell receptor;
c) i) those with a genetic or epigenetic mutation if immune activation is below a threshold level; or
ii) those without genetic or epigenetic mutations when immune activation is above a threshold level
One of the ways to do this is to identify target cells,
d) if immune activation is below a threshold level, comparing the target cell genotype with a control genotype to identify genetic or epigenetic alterations.
A method for screening target cells for genetic or epigenetic mutations that result in lack of T cell receptor recognition, comprising:
[Item 23]
23. The method of item 22, wherein the target cell is a cancer cell.
[Item 24]
23. The method of claim 22, wherein the T cell receptor is a Vγ9Vδ2 T cell receptor.
[Item 25]
23. The method of claim 22, wherein detecting the level of immune activation comprises quantifying production of at least one cytokine by cells expressing a T cell receptor.
[Item 26]
23. The method of claim 22, wherein the cytokine is at least one of interferon-γ and TNFα.
[Item 27]
23. The method of item 22, wherein the genetic or epigenetic variation is a single nucleotide polymorphism.
[Item 28]
23. The method of claim 22, wherein the zygosity of the target cell correlates with the presence of said genetic or epigenetic mutation or the absence of said genetic or epigenetic mutation.
[Item 29]
23. The method of item 22, further comprising the step of identifying genes proximal to the genetic or epigenetic mutation.
[Item 30]
30. The method of item 29, wherein the gene is located within about 300,000 base pairs of a genetic or epigenetic mutation.
[Item 31]
30. The method of item 29, further comprising the step of modulating expression of the gene and evaluating the effect of the modulation on the amount of immune activation of T cell receptor expressing cells.
[Item 32]
30. The method of item 28, wherein said modulation comprises knocking out a gene.
[Item 33]
23. The method of claim 22, wherein the T cell receptor expressing cells are at least one of αβ T cells or γδ T cells.
[Item 34]
23. The method of claim 22, wherein the control genotype is the genotype of a control cell, wherein the control cell, upon contact with the T cell receptor expressing cell, causes immune activation of the T cell receptor expressing cell.
[Item 35]
23. The method of claim 22, wherein immune activation of T cell receptor expressing cells is characterized by at least a two-fold increase in cytokine production or a similar functional readout.
[Item 36]
23. The method of claim 22, wherein immune activation of T cell receptor expressing cells is characterized by at least a 10-fold increase in cytokine production or a similar functional readout.
[Item 37]
38. The method of claim 22, wherein immune activation of T cell receptor expressing cells is characterized by at least a 100-fold increase in cytokine production or a similar functional readout.
23. The method of claim 22, wherein said contacting comprises adding the T cell receptor expressing cells and the control cells to the same container.
[Item 39]
23. The method of claim 22, wherein said contacting comprises adding the T cell receptor expressing cells and the control cells to the same container.
[Item 40]
23. The method of claim 22, wherein the target cell is a B-cell leukemia cell line.
[Item 41]
23. The method of item 22, wherein the target cell is an Epstein-Barr virus transformed cell.
[Item 42]
23. The method of claim 22, wherein the genetic mutation is located in a gene that encodes a protein that regulates Rho GTPase.
[Item 43]
43. The method of item 42, wherein the protein is a GTPase activating protein or a guanine nucleotide exchange factor.
[Item 44]
23. The method of claim 22, wherein the genetic mutation results in reduced or inhibited interaction of CD277 with RhoB GTPase.
[Item 45]
a) screening a subject for a mutation in a gene encoding a protein, where the protein post-translationally regulates Rho GTPase in a target cell of the subject;
b) if the mutation does not reduce or inhibit the formation of a J configuration in CD277, treating the subject with a Vγ9Vδ2 TCR+ T cell-mediated therapy.
The method includes:
[Item 46]
46. The method of item 45, wherein the target cell is a cancer cell.
[Item 47]
46. The method of item 45, wherein the target cell is a leukemia cell.
[Item 48]
46. The method of item 45, wherein the protein is a GTPase activating protein or a guanine nucleotide exchange factor.
[Item 49]
46. The method of item 45, wherein screening comprises determining the genotype of the gene or a portion thereof.
[Item 50]
46. The method of item 45, wherein screening comprises a method selected from nucleic acid amplification, sequencing and oligonucleotide probe hybridization.
[Item 51]
a) administering to a subject an agent that enhances the activity of RhoB GTPase in cancer cells of the subject; and
b) administering T cells expressing Vγ9Vδ2 T cell receptors
20. A method for removing cancer cells in a subject in need of such removal, comprising:
[Item 52]
52. The method of claim 51, wherein the agent enhances translocation of RhoB GTPase to the cell membrane of the cancer cell.
[Item 53]
52. The method of claim 51, wherein the agent maintains RhoB GTPase in the cell membrane of the cancer cell.
[Item 54]
52. The method of claim 51, wherein the agent enhances translocation of RhoB GTPase from the nucleus of the cancer cell.
[Item 55]
52. The method of claim 51, wherein the agent enhances expression of a gene or transcript encoding a RhoB GTPase.
[Item 56]
52. The method of claim 51, wherein the agent enhances the stability of RhoB GTPase.
[Item 57]
52. The method of claim 51, wherein the agent enhances the interaction of RhoB GTPase with CD277.
[Item 58]
52. The method of claim 51, wherein the agent activates RhoB GTPase.
[Item 59]
52. The method of claim 51, wherein the agent enhances the interaction of RhoB GTPase with GTP.
[Item 60]
52. The method of claim 51, wherein the agent reduces the interaction of RhoB GTPase with GDP.
[Item 61]
52. The method of claim 51, wherein the agent increases the amount of GTP in the cancer cell.
[Item 62]
52. The method of claim 51, wherein the agent increases the availability of GTP in the cancer cell.
[Item 63]
52. The method of claim 51, wherein the agent is attached to a moiety that binds to a cell surface molecule on cancer cells, thereby targeting the agent to the cancer cells.
[Item 64]
64. The method of claim 63, wherein the moiety comprises a small molecule compound.
[Item 65]
64. The method of claim 63, wherein the moiety comprises a peptide.
[Item 66]
64. The method of claim 63, wherein the moiety comprises an antibody or antigen-binding fragment.
[Item 67]
52. The method of claim 51, wherein the agent increases the amount of intracellular phosphoantigen in cancer cells.
[Item 68]
52. The method of claim 51, comprising administering an additional agent that increases the amount of intracellular phosphoantigen in the cancer cell.
[Item 69]
69. The method of claim 68, wherein said additional agent is a mevalonate pathway inhibitor.
[Item 70]
70. The method of claim 69, wherein the mevalonate pathway inhibitor is an aminobisphosphonate.
[Item 71]
71. The method of claim 70, wherein the aminobisphosphonate is at least one of pamidronate and zoledronate.
[Item 72]
72. The method of claim 71, wherein the subject has at least one of a solid cancer and leukemia.
[Item 73]
73. The method of item 72, wherein the leukemia is acute myeloid leukemia.
[Item 74]
52. The method of claim 51, wherein the subject has a mutation in a gene that results in decreased expression or activity of RhoB GTPase.
[Item 75]
20. A method of ablating cancer cells in a subject in need thereof comprising administering to the subject an agent that enhances the activity of RhoB GTPase in the cancer cells of the subject.
[Item 76]
76. The method of item 75, comprising administering T cells to a subject.
[Item 77]
77. The method of paragraph 76, wherein the T cell expresses a Vγ9Vδ2 T cell receptor.
[Item 78]
77. The method of paragraph 76, wherein the T cells are engineered or genetically modified to express a Vγ9Vδ2 T cell receptor.
[Item 79]
77. The method of paragraph 76, wherein the T cells have been engineered or genetically modified to overexpress a Vγ9Vδ2 T cell receptor.
[Item 80]
52. The method of claim 51, further comprising administering a formulation of a cytokine.
[Item 81]
a) identifying a cell that induces a phenotype in a target cell that includes activation of a receptor;
b) determining the zygosity of cells exhibiting said phenotype;
c) obtaining genotypic information for the cells, wherein the genotypic information defines a genotype at each of a plurality of loci for a variety of cells;
d) correlating the identified cellular zygosity with the genotype at one of multiple loci across those cells to identify the activated locus.
A method for identifying a genetic locus associated with receptor activation in a target cell, comprising:
[Item 82]
82. The method of paragraph 81, wherein the genotype information defines a single nucleotide polymorphism at each of the plurality of loci.
[Item 83]
84. The method of claim 81, wherein the receptor is a Vγ9Vδ2 T cell receptor or a fragment thereof.
82. The method of claim 81, wherein the target cell is a cancer cell.
[Item 85]
82. The method of claim 81, wherein the target cell is a leukemia cell.
[Item 86]
82. The method of item 81, wherein the phenotype is production of IFNγ.
[Item 87]
82. The method of item 81, wherein the gene is located proximal to at least one of said multiple loci.
[Item 88]
82. The method of item 81, wherein activation of the receptor involves a polypeptide construct of the target cell that selectively binds to the J configuration of CD277 on cells of the cell type.
[Item 89]
82. The method of item 81, wherein the J configuration is correlated with an activated locus.
[Item 90]
a) obtaining target cells from a subject;
b) contacting said target cells with at least one modified effector cell expressing an exogenous polypeptide construct;
c) detecting the level of immune activation of the modified effector cells expressing the polypeptide construct;
d) identifying the target cell as having a nucleotide sequence polymorphism if said immune activation exceeds a threshold level.
The method includes:
[Item 91]
91. The method of item 90, wherein one or more of the target cells is a cancer cell.
[Item 92]
91. The method of claim 90, wherein the exogenous polypeptide construct comprises a Vγ9Vδ2 T cell receptor or a fragment thereof.
[Item 93]
91. The method of claim 90, wherein said detecting the level of immune activation comprises quantifying the production of at least one cytokine by modified effector cells expressing the exogenous polypeptide construct.
[Item 94]
94. The method of item 93, wherein the cytokine is interferon-γ.
[Item 95]
91. The method of item 90, wherein the nucleotide sequence polymorphism is a single nucleotide polymorphism.
[Item 96]
91. The method of item 90, further comprising identifying the proximal gene of the nucleotide sequence polymorphism.
[Item 97]
91. The method of item 90, wherein the gene is located within about 300,000 base pairs of the nucleotide sequence polymorphism.
[Item 98]
91. The method of claim 90, further comprising treating the subject with an effective amount of the exogenous polypeptide construct.
[Item 99]
91. The method of claim 90, wherein the modified effector cell expressing the polypeptide construct is a T cell.
[Item 100]
The method of item 90, wherein contacting a target cell with at least one modified effector cell expressing an exogenous polypeptide construct comprises contacting a CD277 molecule on at least one surface of the target cell with the exogenous polypeptide construct.
[Item 101]
91. The method of item 90, wherein the exogenous polypeptide construct selectively binds to the J configuration of the CD277 molecule.
[Item 102]
a) obtaining target cells expressing CD277 from a subject;
b) contacting the target cell with a cell expressing an exogenous polypeptide construct that selectively binds to the J configuration of the CD277 molecule;
c) detecting the recognition of the J configuration of the CD277 molecule by said polypeptide construct.
[Item 103]
103. The method of claim 102, wherein one or more of the target cells is a cancer cell.
[Item 104]
The method of claim 102, wherein the polypeptide construct comprises a Vγ9Vδ2 T cell receptor or a fragment thereof.
[Item 105]
103. The method of claim 102, wherein detecting recognition of the J configuration of the CD277 molecule comprises quantifying production of at least one cytokine by cells expressing the polypeptide construct.
[Item 106]
106. The method of claim 105, wherein the cytokine is interferon-γ.
[Item 107]
The method of claim 102, comprising administering to a subject an effective amount of the polypeptide construct.
103. The method of claim 102, wherein the cell expressing the polypeptide construct is a T cell.
[Item 109]
a) identifying a target cell from a patient as having a nucleotide sequence polymorphism associated with RhoB activity;
b) predicting subjects that will show a positive therapeutic response based on said identification of target cells as having a nucleotide sequence polymorphism.
20. A method for predicting a positive therapeutic response in a subject to treatment with a polypeptide construct capable of recognizing CD277 or an engineered cell expressing said polypeptide construct, comprising:
[Item 110]
110. The method of item 109, wherein the polypeptide construct recognizes the J configuration of CD277.
[Item 111]
110. The method of claim 109, further comprising administering the polypeptide construct to a subject.
[Item 112]
110. The method of claim 109, wherein one or more of the target cells is a cancer cell.
[Item 113]
110. The method of claim 109, wherein the nucleotide sequence polymorphism is a single nucleotide polymorphism.
[Item 114]
110. The method of claim 109, wherein the activity of RhoB is increased compared to the activity of RhoB in a subject lacking the nucleotide sequence polymorphism.
[Item 115]
110. The method of claim 109, further comprising predicting poor therapeutic response in the second subject based on identifying the target cells of the second subject as lacking the nucleotide sequence polymorphism.
[Item 116]
a) obtaining a first set of cells expressing CD277 molecules from a first subject;
b) i) higher RhoB activity compared to a second set of target cells obtained from a second subject; and
ii) Nucleotide sequence polymorphisms associated with high RhoB activity
identifying a first set of cells as having at least one of:
c) administering to the first subject a polypeptide construct having selective affinity for the CD277 arrangement on the first set of cells compared to the CD277 arrangement on the second set of cells, or engineered cells expressing said polypeptide construct.
[Item 117]
117. The method of paragraph 116, wherein one or more of the cells of the first group are cancer cells.
[Item 118]
117. The method of paragraph 116, wherein one or more of the cells of the first group are leukemia cells.
[Item 119]
117. The method of item 116, wherein the CD277 configuration on the first set of cells is a J configuration.
[Item 120]
117. The method of item 116, wherein the nucleotide sequence polymorphism is a single nucleotide polymorphism.
[Item 121]
a) obtaining target cells expressing CD277 molecules from a subject;
b) identifying the J configuration of the CD277 molecule expressed in the target cell;
c) predicting subjects that will show a positive therapeutic response based on said identification of the J configuration of the CD277 molecule.
23. A method for predicting a positive therapeutic response in a subject to treatment with a polypeptide construct capable of recognizing a CS277 molecule or an engineered cell expressing said polypeptide construct, comprising:
[Item 122]
122. The method of claim 121, further comprising administering the polypeptide construct to a subject.
[Item 123]
122. The method of claim 121, further comprising predicting poor response to therapy in the second subject based on identifying CD277 molecules in target cells of the second subject as lacking a J configuration.
[Item 124]
122. The method of claim 121, wherein one or more of the target cells is a cancer cell.
[Item 125]
122. The method of claim 121, further comprising identifying a nucleotide sequence polymorphism associated with the activity of RhoB in the target cell.
[Item 126]
126. The method of claim 125, wherein the activity of RhoB is increased compared to the activity of RhoB in a subject lacking the nucleotide sequence polymorphism.
[Item 127]
127. The method of claim 125 or 126, wherein the nucleotide sequence polymorphism is a single nucleotide polymorphism.
[Item 128]
127. The method of item 125 or 126, wherein the prediction is based on both the identification of the J configuration of the CD277 molecule and the identification of a nucleotide sequence polymorphism.
[Item 129]
A method for treating cancer in a subject having cancer cells that are CD277 positive, comprising administering to the subject an effective amount of a pharmaceutical composition comprising a pharma- ceutically acceptable substance that selectively binds to the J configuration of CD277 on the cancer cells.
[Item 130]
130. The method of item 129, wherein the pharma- ceutically acceptable substance comprises a polypeptide construct that selectively binds to the J configuration of CD277 on said cancer cells.
[Item 131]
131. The method of claim 130, wherein the polypeptide construct comprises at least one of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence.
[Item 132]
131. The method of claim 130, wherein the polypeptide construct comprises at least one variant or fragment of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence.
[Item 133]
133. The method of claim 132, wherein the γ-TCR polypeptide sequence is a γ9-TCR polypeptide sequence or a fragment thereof.
[Item 134]
133. The method of item 132, wherein the δ-TCR polypeptide sequence is a δ2-TCR polypeptide sequence or a fragment thereof.
[Item 135]
The method of item 129, wherein the pharma- ceutically acceptable substance binds to the J configuration of CD277 with high selectivity compared to CD277 molecules that are not in the J configuration.
[Item 136]
130. The method of item 129, wherein the target cell is a cancer cell.
[Item 137]
130. The method of item 129, wherein the target cell is a leukemia cell.
[Item 138]
The method of item 129, wherein CD277 exists as a dimer.
[Item 139]
a. a formulation of a polypeptide construct that selectively binds to CD277 on a cancer cell, or a formulation of a cell expressing a polypeptide construct that selectively binds to CD277 on a cancer cell, and b. i. a formulation of a substance that enhances the activity of RhoB GTPase in a cancer cell;
ii. At least one of a formulation of a substance that enhances the activity of a phosphoantigen in cancer cells.
23. A pharmaceutical composition comprising:
[Item 140]
140. The pharmaceutical composition according to item 139, wherein the pharmaceutical composition comprises a dosage form of a substance that enhances the activity of RhoB GTPase and a dosage form of a substance that enhances the activity of a phosphoantigen.
[Item 141]
140. The pharmaceutical composition of claim 139, wherein the pharmaceutical composition comprises a dosage form of an agent that enhances the activity of RhoB GTPase and a dosage form of an agent that enhances the activity of a phosphoantigen, wherein the agent that enhances the activity of a phosphoantigen is administered before, simultaneously with, or after the agent that enhances the activity of RhoB GTPase.
[Item 142]
140. The pharmaceutical composition of item 139, wherein the agent that enhances the activity of RhoB GTPase enhances the translocation of RhoB GTPase to the cell membrane of the cancer cell, retains RhoB GTPase in the cell membrane of the cancer cell, enhances the translocation of RhoB GTPase from the nucleus of the cancer cell, enhances the expression of a gene or transcript encoding RhoB GTPase, enhances the stability of RhoB GTPase, enhances the interaction of RhoB GTPase with CD277, activates RhoB GTPase, enhances the interaction of RhoB GTPase with GTP, reduces the interaction of RhoB GTPase with GDP, increases the amount of GTP in the cancer cell, increases the availability of GTP in the cancer cell, or any combination thereof.
[Item 143]
140. The pharmaceutical composition of item 139, wherein CD277 is in the J configuration.
[Item 144]
140. The pharmaceutical composition of claim 139, wherein the polypeptide construct comprises at least one of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence.
[Item 145]
140. The pharmaceutical composition of claim 139, wherein the polypeptide construct comprises at least one variant or fragment of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence.
[Item 146]
140. The pharmaceutical composition of claim 139, wherein the polypeptide construct comprises at least one variant or fragment of a γ-TCR polypeptide sequence or a δ-TCR polypeptide sequence, wherein the γ-TCR polypeptide sequence is a γ9-TCR polypeptide sequence or a fragment thereof.
[Item 147]
140. The pharmaceutical composition according to item 139, wherein the polypeptide construct comprises at least one variant or fragment of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence, the delta-TCR polypeptide sequence being a delta2-TCR polypeptide sequence or a fragment thereof.
[Item 148]
140. The pharmaceutical composition of item 139, wherein the pharmaceutical composition is administered to a subject having at least one of a solid cancer and leukemia.
[Item 149]
140. The pharmaceutical composition of claim 139, wherein the pharmaceutical composition is administered to a subject with acute myeloid leukemia.
[Item 150]
140. The pharmaceutical composition of item 139, wherein the pharmaceutical composition is administered to a subject, and the subject comprises a mutation in a gene that correlates with RhoB GTPase expression or activity.
[Item 151]
140. The pharmaceutical composition of item 139, wherein the pharmaceutical composition is administered to a subject, and the subject comprises a mutation in a gene that correlates with decreased expression or activity of RhoB GTPase.
[Item 152]
140. The pharmaceutical composition of item 139, wherein the pharmaceutical composition is administered to a subject, and the subject comprises a mutation in a gene that correlates with reduced or inhibited interaction of CD277 with RhoB GTPase.
[Item 153]
140. The pharmaceutical composition according to item 139, wherein the substance that enhances the activity of RhoB GTPase functions by indirectly or directly binding to RhoB GTPase.
[Item 154]
140. The pharmaceutical composition according to item 139, wherein the substance that enhances the activity of a phosphoantigen functions by indirectly or directly binding to RhoB GTPase.
[Item 155]
140. The pharmaceutical composition of claim 139, wherein the formulation of the polypeptide construct comprises a sequence comprising at least 60% identity to a sequence of Table 3 or Table 4.
[Item 156]
140. The pharmaceutical composition of claim 139, wherein the agent that enhances the activity of a phosphoantigen is a mevalonate pathway inhibitor.
[Item 157]
140. The pharmaceutical composition of claim 139, wherein the agent that enhances the activity of a phosphoantigen is an aminobisphosphonate.
[Item 158]
140. The pharmaceutical composition of claim 139, wherein the substance that enhances the activity of a phosphoantigen is at least one of pamidronate and zoledronate.
[Item 159]
140. The pharmaceutical composition according to item 139, wherein the agent that enhances the activity of RhoB GTPase enhances the translocation of RhoB GTPase to the cell membrane of the cancer cell, retains RhoB GTPase in the cell membrane of the cancer cell, enhances the translocation of RhoB GTPase from the nucleus of the cancer cell, enhances the expression of a gene or transcript encoding RhoB GTPase in the cancer cell, enhances the stability of RhoB GTPase in the cancer cell, enhances the interaction of RhoB GTPase with CD277 in the cancer cell, activates RhoB GTPase in the cancer cell, enhances the interaction of RhoB GTPase with GTP in the cancer cell, reduces the interaction of RhoB GTPase with GDP in the cancer cell, increases the amount of GTP in the cancer cell, increases the availability of GTP in the cancer cell, or any combination thereof.
[Item 160]
160. A method of treatment comprising administering to a subject in need of treatment a pharmaceutical composition according to any one of items 139 to 159.
[Item 161]
The method of treatment of item 160, wherein the subject comprises a mutation in a gene that correlates with reduced or inhibited interaction of CD277 with RhoB GTPase.
[Item 162]
161. The method of claim 160, wherein the subject has at least one of a solid cancer and leukemia.
[Item 163]
A method of treatment comprising administering to a subject in need of treatment a pharmaceutical composition comprising a substance selected from the group consisting of substances that enhance the activity of RhoB GTPase in cancer cells of the subject, or a pharmaceutical composition comprising a polypeptide construct that selectively binds to CD277 on cancer cells.
[Item 164]
167. The method of claim 166, further comprising administering to the subject in need of treatment an agent that enhances the activity of the phosphoantigen in cancer cells of the subject in need of treatment.
[Item 165]
a. a formulation of a polypeptide construct that selectively binds to CD277 on a cancer cell or a formulation of a cell that expresses a polypeptide construct that selectively binds to CD277 on a cancer cell; and
b. i. a formulation of a substance that enhances the activity of RhoB GTPase in cancer cells;
ii. At least one of a formulation of a substance that enhances the activity of a phosphoantigen in cancer cells.
to a subject in need of treatment.
[Item 166]
166. The method of claim 165, wherein the treatment comprises administering a dosage form of a substance that enhances the activity of RhoB GTPase and a dosage form of a substance that enhances the activity of a phosphoantigen.
[Item 167]
166. The method of item 165, wherein the substance that enhances the activity of RhoB GTPase is a mevalonate pathway inhibitor.
[Item 168]
166. The method of item 165, wherein the agent that enhances the activity of RhoB GTPase is a mevalonate pathway inhibitor that is an aminobisphosphonate.
[Item 169]
166. The method of item 165, wherein the substance that enhances the activity of RhoB GTPase is a mevalonate pathway inhibitor which is at least one of pamidronate and zoledronate.
[Item 170]
166. The method of claim 165, wherein the polypeptide construct comprises at least one variant or fragment of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence.
[Item 171]
166. The method of claim 165, wherein the polypeptide construct comprises at least one variant or fragment of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence, and the gamma-TCR polypeptide sequence is a gamma9-TCR polypeptide sequence or a fragment thereof.
[Item 172]
166. The method of claim 165, wherein the polypeptide construct comprises at least one variant or fragment of a gamma-TCR polypeptide sequence or a delta-TCR polypeptide sequence, and the delta-TCR polypeptide sequence is a delta2-TCR polypeptide sequence or a fragment thereof.
[Item 173]
166. The method of item 165, wherein the cell is an αβ T cell.
[Item 174]
166. The method of paragraph 165, wherein the agent that enhances the activity of a phosphoantigen functions by indirectly or directly binding to the phosphoantigen.
[Item 175]
166. The method of claim 165, further comprising administering a formulation comprising a cytokine.
[Item 176]
166. The method of claim 165, wherein the formulation of the polypeptide construct comprises a sequence comprising at least 60% identity to a sequence of Table 3 or Table 4.
[Item 177]
1. A method of treatment comprising administering to a subject in need of treatment a pharmaceutical composition comprising an agent that enhances the activity of RhoB GTPase in cancer cells of the subject and a pharmaceutical composition comprising cells expressing a Vγ9Vδ2 T cell receptor, wherein T cells isolated from the subject secrete at least one-fold less of a small protein compared to comparable T cells isolated from a comparable subject that has not received said treatment.
[Item 178]
178. The method of item 177, wherein the small protein is a cytokine.
[Item 179]
The method according to item 177, wherein the small protein is a cytokine, IFNγ.
178. The method of claim 177, wherein T cells isolated from the subject secrete at least 5 times the small protein compared to comparable T cells isolated from a comparable subject not receiving the treatment.
[Item 181]
178. The method of claim 177, wherein T cells isolated from the subject secrete at least 10-fold more of the small protein compared to comparable T cells isolated from a comparable subject that has not received the treatment.
[Item 182]
A method of treatment comprising administering to a subject in need of treatment a formulation of a substance that enhances the activity of RhoB GTPase in cancer cells and a formulation of a substance that enhances the activity of a phosphoantigen in cancer cells.
[Item 183]
186. The method of item 185, wherein the agent that enhances the activity of RhoB GTPase is a mevalonate pathway inhibitor.
[Item 184]
186. The method of claim 185, wherein the agent that enhances the activity of RhoB GTPase is a mevalonate pathway inhibitor that is an aminobisphosphonate.
[Item 185]
186. The method of item 185, wherein the substance that enhances the activity of RhoB GTPase is a mevalonate pathway inhibitor that is at least one of pamidronate and zoledronate.
[Item 186]
186. The method of paragraph 185, wherein the agent that enhances the activity of a phosphoantigen functions by indirectly or directly binding to the phosphoantigen.
[Item 187]
183. The method of claim 182, further comprising administering a dosage form of a polypeptide construct that selectively binds to CD277 on cancer cells, or a dosage form of cells expressing a polypeptide construct that selectively binds to CD277 on cancer cells.

Claims (19)

A pharmaceutical composition for use in the treatment of infection or cancer comprising a polypeptide construct that selectively binds to the J configuration of CD277 on a target cell, said polypeptide construct comprising a γ9δ2 T cell receptor, said γ9δ2 T cell receptor being
(A) a γ9 subunit comprising at least 13 consecutive amino acid residues forming a γ9-CDR3 region having at least 85% sequence identity to the full-length sequence of any of SEQ ID NOs: 74-84,
(i) the first and last amino acid residues of the γ9-CDR3 region are cysteine (C) and phenylalanine (F), respectively;
(ii) a γ9 subunit, in which either the sixth or eighth residue of the γ9-CDR3 region is a valine (V), or the sixth and seventh residues of the γ9-CDR3 region are alanine (A) and glycine (G), respectively; and
(B) a δ2 subunit comprising at least 14 consecutive amino acid residues forming a δ2-CDR3 region having at least 85% sequence identity to the full-length sequence of any of SEQ ID NOs: 86-101,
(i) the first and last amino acid residues of the δ2-CDR3 region are cysteine (C) and phenylalanine (F), respectively;
(ii) a δ2 subunit, wherein the eighth residue of the δ2-CDR3 region is selected from leucine (L), proline (P), histidine (H), aspartic acid (D), alanine (A), glycine (G) and serine (S).
13. A pharmaceutical composition comprising : The pharmaceutical composition for use according to claim 1, wherein CD277 exists as a dimer. The pharmaceutical composition for use according to claim 1, wherein the polypeptide construct binds with high selectivity to the J configuration of CD277 compared to CD277 molecules not in said J configuration. The pharmaceutical composition for use according to claim 1, wherein the cancer is leukemia or a solid cancer. The pharmaceutical composition for use according to any one of claims 1 to 4, wherein the subject has CD277-positive cancer cells. The pharmaceutical composition for use according to any one of claims 1 to 5, further comprising administering a dosage form of a substance that enhances the activity of RhoB GTPase in cancer cells and a substance that enhances the activity of a phosphoantigen in cancer cells, wherein these substances are mevalonate pathway inhibitors that are aminobisphosphonates. The pharmaceutical composition for use according to claim 6, wherein the formation of the J configuration requires at least an interaction between RhoB and CD277 and/or compartmentalization of CD277. The pharmaceutical composition for use according to claim 7, wherein the formation of the J configuration requires interaction between an intracellular phosphoantigen and CD277 after interaction between RhoB and CD277. The pharmaceutical composition for use according to any one of claims 1 to 8, wherein said polypeptide construct is expressed in an engineered cell. The pharmaceutical composition for use according to claim 9, wherein the engineered cells are immune effector cells differentiated from stem cells or induced pluripotent stem cells. The pharmaceutical composition for use according to claim 9 or 10, wherein the engineered cells are engineered T cells or engineered natural killer cells. The pharmaceutical composition for use according to claim 11 , wherein the engineered T cells are engineered αβ T cells. The engineered T cells are ⁺ αβT cells or CD8 ⁺ The pharmaceutical composition for use according to claim 11, which is an αβ T cell. The pharmaceutical composition for use according to any one of claims 1 to 8, wherein the polypeptide construct is soluble and the polypeptide construct also binds to and activates cytotoxic T cells to be cytotoxic against target cells. The pharmaceutical composition for use according to any one of claims 1 to 14, wherein said γ9δ2 T cell receptor comprises a γ9-CDR3 region represented by any of SEQ ID NOs: 74 to 84, and a δ2-CDR3 region represented by any of SEQ ID NOs: 86 to 101. 1. A method for predicting a positive therapeutic response in a subject to treatment with a polypeptide construct capable of recognizing CD277, or treatment with engineered cells expressing said polypeptide construct, comprising:
the polypeptide construct comprises a γ9δ2 T cell receptor,
The method comprises the following steps a) and b):
a) identifying target cells of a patient as having a nucleotide sequence polymorphism associated with activity of RhoB; and b) predicting subjects who will exhibit a positive therapeutic response based on said identification of target cells as having a nucleotide sequence polymorphism,
The method further comprises predicting poor therapeutic response in a second subject based on identifying target cells of the second subject as lacking the nucleotide sequence polymorphism. The method of claim 16 , wherein the polypeptide construct recognizes the J configuration of CD277. The method of claim 16 , wherein one or more of the target cells is a cancer cell. 17. The method of claim 16 , wherein the activity of RhoB is increased compared to the activity of RhoB in a subject lacking the nucleotide sequence polymorphism.

Images