JP7440073B2 - Method for detecting viable bacteria and kit therefor - Google Patents

Description

Application of Article 30, Paragraph 2 of the Patent Act August 9, 2019 Announced on the bioRχiv website (https://www.biorxiv.org/content/10.1101/729616v2.full)

Application of Article 30, Paragraph 2 of the Patent Act Published on June 15, 2020, Scientific Reports (2020) 10:9588

The present invention relates to a method for detecting living bacteria and a kit therefor, and particularly to a method for detecting living bacteria using a rolling circle amplification method and a kit therefor.

Products and foods related to cell culture are tested for the presence or absence of contaminating bacteria using methods specified by the Japanese Pharmacopoeia and the industry, and if the number of viable bacteria is below the standard value, they are approved for shipment. It will be done. One of the methods is a colony formation method using a special medium, but it takes several days for colony formation, and one month for Mycobacterium tuberculosis. For this reason, gene amplification methods such as polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP), which can be used for same-day determination, have been proposed. Signals are also generated from the original DNA. Therefore, there is a need for a same-day determination method that can clearly distinguish between life and death.

A method of detecting RNA is known for determining whether bacteria are alive or dead. RNA is a molecule that is easily degraded, and RNA molecules released from dead bacteria or broken cells are rapidly degraded, so they are used as markers for determining life or death. On the other hand, RNA cannot be used as a direct template for PCR or LAMP. Therefore, it is essential to convert it into cDNA via reverse transcription (RT). In recent years, in the food industry mentioned above, RT-PCR has become the only official method for norovirus, but the reason for this is that no cultivation method for norovirus has been established so far, and the base sequence of norovirus is unique to DNA in nature. This is because it does not exist as such. However, since the RNA sequence of microorganisms is basically the same as the DNA sequence, and it is extremely difficult to completely remove DNA from an RNA solution, genetic testing such as RT-PCR is not recognized as an official method. Only in recent years has viability PCR (vPCR) been recognized in combination with quantitative PCR, according to the ``Method for testing bathtub water, etc. for Legionella bacteria in public baths'' (Yakusei Hyei No. 0919 No. 1). In the vPCR method, before DNA extraction, the DNA derived from dead bacteria is prevented from being used as a template for amplification using a chemical before the reaction, but it is important to take into account that DNA from living bacteria may also be inhibited in some cases. It recognized. However, as mentioned above, this method is not preferable for testing medical products, etc., which requires higher rigor, because it may inhibit the DNA of some viable bacteria and therefore may not be able to detect viable bacteria.

Amid the above-mentioned problems, the present inventors previously developed a method for directly detecting only RNA using RNase H assisted rolling circle amplification (RHa-RCA), which is based on the principle of recognizing RNA/DNA hybrid molecules by RNase H. We have invented an "RNA detection method" that can perform the following steps (see Patent Document 1 and Non-Patent Document 1). Specifically, this method uses a padlock-shaped DNA probe complementary to the target RNA, hybridizes the probe to the target RNA, circularizes the probe using DNA ligase, and then attaches the probe to the target using RNaseH. A nick is formed in RNA, and single-stranded DNA is amplified by rolling circle DNA amplification using the nicked target RNA as a primer and a circularized DNA probe as a template. This detects the presence or absence of RNA.

JP 2018-183065 Publication

Scientific Reports, 8, 7770.(2018)

Since the above method is a method for directly detecting RNA, we believe that performing this method inside the bacterial body, that is, in-situ, is suitable for application to a method for detecting bacteria in samples. It will be done. However, even if the number of bacteria present in a sample is minute, it is unclear whether it can be detected reliably, and there is a risk that a false negative result will be obtained. In addition, in such cases, it is possible to centrifuge the sample to concentrate the bacteria, but even if centrifugal recovery is used, it is not always possible to recover all viable bacteria in the sample. However, there is also the problem that it is not possible to evaluate the actual number of viable bacteria in the sample.

The present invention has been made in view of the above problem, and its purpose is to detect viable bacteria in a sample with high accuracy and sensitivity without failing to recover viable bacteria in a given product (sample). The purpose is to do so.

In order to achieve the above object, the method for detecting viable bacteria according to the present invention uses the RHa-RCA method to detect viable bacteria in the sample with high precision after ultrafiltration of the sample. Enables detection with high sensitivity.

Specifically, the method for detecting viable bacteria according to the present invention includes a concentration step of concentrating the viable bacteria in the sample by filtering the sample using an ultrafiltration membrane; A target RNA possessed by a living bacterium trapped by a filtration membrane and a padlock-type DNA probe having a complementary nucleic acid sequence to the target RNA are hybridized within the bacterial body of the bacterium, and the target RNA is used as a primer to generate the DNA. an amplification step in which single-stranded DNA is amplified in the bacterial cells by the RNase H assisted rolling circle amplification (RHa-RCA) method using the probe as a template; and a labeled probe is added to the single-stranded DNA amplified in the amplification step. It is characterized by comprising a labeling step of hybridizing within the bacterial body, and a detection step of detecting the single-stranded DNA labeled by the labeling step.

According to the method for detecting living bacteria according to the present invention, by performing the RHa-RCA method inside the cells of bacteria in a sample, it is determined whether single-stranded DNA is amplified using the target RNA of living bacteria as a template. , it is possible to determine the presence or absence of bacteria in a sample. That is, since the RNA inside the bacterial body is directly detected as a target, the presence or absence of bacteria in the sample can be determined with high accuracy. Furthermore, in the present invention, before performing the RHa-RCA method, the viable bacteria in the sample are concentrated using an ultrafiltration membrane, so that the viable bacteria in the sample can be concentrated without failing to recover the viable bacteria in the sample. Detection of viable bacteria can be performed with high sensitivity.

In the method for detecting living bacteria according to the present invention, it is preferable to perform a cell permeabilization treatment on the living bacteria trapped by the ultrafiltration membrane before the amplification step.

In this way, the steps after the amplification step can be efficiently performed within the bacterial cells.

In the method for detecting viable bacteria according to the present invention, the labeled probe may be labeled with a fluorescent labeling reagent, biotin, or an enzyme.

In the method for detecting living bacteria according to the present invention, the labeled probe is preferably a fluorescent probe, and the single-stranded DNA is preferably detected by a fluorescent in situ hybridization (Fish) method.

In this way, single-stranded DNA amplified in bacteria can be easily detected.

In the method for detecting viable bacteria according to the present invention, the ultrafiltration membrane is preferably an ultrafiltration membrane that traps substances with a molecular weight of 100 kDa or more.

In this way, it is possible to efficiently concentrate only the bacteria in the sample, and when the steps after the concentration step are performed on an ultrafiltration membrane, the single-stranded DNA amplified by RHa-RCA far exceeds 100 kDa. Since it has a molecular weight, it is trapped and remains on the membrane, while unreacted DNA probes and labeled probes, which have a molecular weight of less than 100 kDa, pass through the ultrafiltration membrane and do not remain on the membrane. Therefore, undesired background can be suppressed in the detection step, and desired labeled single-stranded DNA can be detected with higher sensitivity.

In the method for detecting living bacteria according to the present invention, it is preferable that the amplification step, the labeling step, and the detection step are all performed on the ultrafiltration membrane.

In this way, all the steps after ultrafiltration of the sample can be performed on the ultrafiltration membrane, which simplifies the operation of each step, which is desirable in the detection step as described above. It is possible to suppress unnecessary background and detect the desired labeled single-stranded DNA with higher sensitivity.

The kit for carrying out the method for detecting living bacteria according to the present invention includes the ultrafiltration membrane, a padlock-type DNA probe having a nucleic acid sequence complementary to the target RNA, and a kit for carrying out the RHa-RCA method. It is characterized by comprising an enzyme and a labeling probe for labeling the single-stranded DNA.

According to the kit according to the present invention, the method for detecting viable bacteria according to the present invention can be easily carried out, and the presence or absence of viable bacteria in a sample can be detected with high accuracy and sensitivity as described above. .

According to the method for detecting viable bacteria and the kit therefor according to the present invention, the presence or absence of viable bacteria in a sample can be detected with high accuracy and sensitivity without failing to recover viable bacteria in the sample.

FIG. 2 is a schematic diagram for explaining a method for detecting living bacteria according to an embodiment of the present invention. FIG. 2 is a schematic diagram for explaining the RHa-RCA method in one embodiment of the present invention. 3 is a photograph showing the results of a detection step in a method for detecting living bacteria according to an example.

EMBODIMENT OF THE INVENTION Hereinafter, the form for implementing this invention is demonstrated based on drawing. The following description of preferred embodiments is merely exemplary in nature and is not intended to limit the invention, its application, or its uses.

One embodiment of the present invention is a method for detecting viable bacteria, and as shown in FIG. 1, the method detects viable bacteria in a sample by filtering the sample using an ultrafiltration membrane. a concentration step of concentrating the target RNA of the living bacteria trapped by the ultrafiltration membrane, and a padlock-type DNA probe having a nucleic acid sequence complementary to the target RNA, hybridizing within the bacterial body; an amplification step in which single-stranded DNA is amplified within the bacterial cell by RHa-RCA method using the target RNA as a primer and the DNA probe as a template; and a labeled probe is applied to the single-stranded DNA amplified in the amplification step within the bacterial cell. The method includes a labeling step for hybridization and a detection step for detecting single-stranded DNA labeled by the labeling step.

In the present embodiment, the sample is a target to be evaluated for the presence of viable bacteria, and is, for example, a product related to cell culture such as a cell culture medium as shown in FIG. 1, food, or the like.

In this embodiment, the living bacteria are living bacteria, and the species thereof is not particularly limited, and examples include Gram-negative bacteria such as Escherichia coli (E. coli) and Gram-positive bacteria such as Brevibacillus. It may be.

In this embodiment, ultrafiltration is a process in which a target is filtered through an ultrafiltration membrane. However, it is preferable that the nominal molecular weight cutoff (NMWL) is about 100 kDa. Such an ultrafiltration membrane is not limited to the following, but for example, a cup-shaped ultrafiltration membrane, a 96-well format ultrafiltration membrane, etc. are suitably used, and specifically, for example, Amicon Ultra 0. A 5 mL centrifugal filter (Merck) or the like can be used. By employing such an ultrafiltration membrane, it traps bacteria and single-stranded DNA that will be amplified in later steps, while allowing unreacted probes used in later steps to pass through. I can do it. Subsequent amplification, labeling, and detection steps can then be performed on the ultrafiltration membrane, allowing the amplified single-stranded DNA to be trapped on the membrane as described above, while allowing unreacted probe to pass through. Therefore, the background when detecting single-stranded DNA on the membrane can be reduced.

In this embodiment, the RHa-RCA method is a rolling circle DNA amplification method using RNaseH, and its details are as described in Patent Document 1 mentioned above. Specifically, as shown in FIG. 2, the RHa-RCA method includes a hybridization step S1 in which a target RNA 101 and a padlock-shaped DNA probe 102 complementary to the internal sequence of the target RNA 101 are hybridized; A circularization step S2 in which the hybridized DNA probe 102 is circularized by a DNA binding enzyme (DNA ligase) 103, and after circularizing the DNA probe 102, ribonuclease H (RNase H) 104 is added to the hybridized target RNA 101. A nick formation step S3 in which a nick is formed using a nicked target RNA, and a rolling circle type process using a DNA synthesizing enzyme (DNA polymerase) 105 using a nicked target RNA as a primer 101A and a circularized DNA probe 102 as a template. It includes an amplification step S4 in which single-stranded DNA 106 is amplified by a DNA amplification method.

For the padlock-type DNA probe, for example, an oligonucleotide synthesized by a DNA synthesizer can be used. Any DNA probe can be used as long as it has a sequence complementary to the internal sequence of the target RNA and can hybridize with the target RNA. In this embodiment, the internal sequence of the target RNA is a sequence that does not include the 3' end of the target RNA. The entire sequence of the DNA probe may be complementary to the target RNA, or only a portion thereof may be complementary to the target RNA. The size of the DNA probe is not particularly limited, but is preferably about 30 bp to 20 kb, more preferably about 50 bp to 2000 bp. For hybridization between the padlock-shaped DNA probe and the target RNA, optimal conditions may be set as appropriate, taking into consideration the combination of the target RNA and probe DNA.

Circularization of a DNA probe (RNA-splinted padlock probe) hybridized with target RNA can be performed using a DNA binding enzyme (DNA ligase). Specifically, this can be performed using T4 DNA ligase or SplintR ligase.

After circularizing the DNA probe, a nick is formed in the hybridized portion of the target RNA using RNaseH. As a result, a 3' end is formed in the portion of the target RNA that hybridizes with the DNA probe. From the viewpoint of forming a nick in the hybridized target RNA, the concentration of RNaseH is preferably 0.003 units (U) or more, more preferably 0.03 U or more, so that complete degradation of the hybridized target RNA is possible. From the viewpoint of preventing this from occurring, it is preferably 3 U or less, more preferably 0.3 U or less.

Single-stranded DNA is amplified (extended) from the nick portion (3' end) by rolling circle DNA amplification method. In the rolling circle DNA amplification method, single-stranded DNA is elongated using target RNA that has been nicked after hybridization as a primer and a circularized DNA probe as a template. In the elongation of single-stranded DNA, it is preferable to use a strand displacement type DNA synthase having DNA strand displacement activity. "Strand displacement activity" means that during the process of DNA replication, when double-stranded DNA has already been formed in the elongation direction, the complementary strand is peeled off from the 5' side and the template becomes single-stranded. It refers to the activity of synthesizing a new complementary strand to a single-stranded template. By using a strand-displacing DNA synthase, a high-molecular-weight single-stranded DNA in which complementary strands of a circularized DNA probe serving as a template are repeatedly linked in series can be obtained.

Strand-displacing DNA synthases are not particularly limited, but include, for example, phi29 DNA polymerase (New England BioLabs, etc.), Klenow fragment (Takara Bio, etc.), Bst DNA polymerase (New England BioLabs, etc.), BcaBEST DNA polymerase ( (Takara Bio Inc.), PyroPhageTM 3173 DNA polymerase (Lucigen Inc.), etc. can be used. Among them, phi29 DNA polymerase is preferable because it can perform the reaction at room temperature or about room temperature and has a high DNA synthesis rate.

The amount (concentration) of the strand-displacing DNA synthase used in the amplification of single-stranded DNA is preferably optimized depending on the type of enzyme used. For example, in the case of phi29 DNA polymerase, the final concentration can be preferably about 0.025 ng/μL to 1 μg/μL, more preferably about 5 ng/μL to 20 ng/μL.

For amplification of single-stranded DNA, the reaction temperature is set according to the usual procedure based on the optimal temperature of the enzyme and the denaturation temperature (temperature range in which the primer binds (anneals)/dissociates to the template DNA) based on the primer chain length. I can do it. For example, the reaction temperature can be a constant room temperature. "Normal temperature" in the present disclosure means 25°C to 65°C. Specifically, when using phi29 DNA polymerase as the strand displacement type DNA synthase, the reaction temperature is preferably 25°C to 42°C. Further, when carrying out using a thermostable enzyme, the reaction temperature is preferably 55°C to 65°C. When using a thermostable enzyme, the length of the portion complementary to the target RNA in the circular DNA probe strand is preferably about 30 oligonucleotides or more.

In the RNA detection method of this embodiment, since single-stranded DNA can be amplified at a constant temperature, there is no need to use a thermal cycler.

In amplifying single-stranded DNA, a reaction solution containing buffer components, magnesium salts, potassium salts, ammonium salts, and deoxynucleoside triphosphates (dNTPs) can be used. The buffer component is not particularly limited, but for example, Tris-hydrochloric acid or Tris-acetic acid can be suitably used. Although there are no particular limitations on the magnesium salt, for example, magnesium chloride, magnesium sulfate, or magnesium acetate can be suitably used. In the case of magnesium chloride, the concentration is preferably about 5mM to 20mM, more preferably about 10mM. Furthermore, the potassium salt is not particularly limited, but for example, potassium chloride, potassium glutamate, or potassium acetate can be suitably used. In the case of potassium chloride, the concentration is preferably about 5mM to 50mM, more preferably about 20mM. Further, the ammonium salt is not particularly limited, but for example, ammonium sulfate or ammonium acetate can be suitably used. The concentration is preferably about 5mM to 60mM, more preferably about 40mM. The concentration of the dNTP mixture (dATP, dCTP, dGTP, dTTP) serving as a substrate for DNA amplification is preferably about 0.5 mM to 2 mM, more preferably about 1 mM. In addition, additives may be added to the reaction solution for the purpose of stabilizing the elongation reaction. For example, dithiothreitol (DTT) can be added, preferably at about 0.5mM to 5mM, more preferably about 1mM. Furthermore, synthesis efficiency can be increased by adding pyrophosphatase to remove pyrophosphate, which is an inhibitor of the DNA synthesis reaction and is produced as a byproduct during long-term reactions. It is preferable to add about 0.02 U/reaction of pyrophosphatase.

In this embodiment, the above RHa-RCA method is performed inside the bacterial cells, that is, in situ. For this reason, it is preferable to perform cell permeabilization treatment on the bacteria in advance. Cell permeation treatment is not particularly limited as long as the materials such as probes used in each step can easily permeate into the bacterial cells, and can be performed by immobilization treatment and permeation treatment that are commonly used in this technical field. They can be used in combination, for example, fixation using paraformaldehyde followed by permeabilization using lysozyme.

Furthermore, in this embodiment, the RHa-RCA method described above is preferably performed on an ultrafiltration membrane that has undergone a concentration step. In this way, as described above, each step can be easily performed and unreacted probes can be passed through, thereby reducing the background when detecting single-stranded DNA on the membrane. .

After single-stranded DNA is amplified by the above RHa-RCA method, the single-stranded DNA is labeled in a labeling step so that the amplified single-stranded DNA can be detected. In this embodiment, a fluorescence in situ hybridization (Fish) method is utilized. Specifically, the amplified single-stranded DNA is labeled using a fluorescent labeling reagent that specifically binds to the amplified single-stranded DNA (for example, SYBR Green II (Invitrogen), Alexa568 (Thermo Fisher Scientific), etc.). Label. More specifically, the single-stranded DNA is labeled by hybridizing a fluorescently labeled oligonucleotide having a complementary sequence to the single-stranded DNA to the amplified single-stranded DNA. be able to. Thereafter, in a detection step, the fluorescently labeled single-stranded DNA is detected using, for example, a fluorescence microscope. In addition, in this embodiment, an example in which a fluorescent probe is used in the labeling step has been described, but it is of course possible to use other labeling means. For example, labeling means using biotin or an enzyme such as peroxidase or luciferase may be used. You can also do it.

If fluorescently labeled single-stranded DNA is not detected in the detection step, it can be evaluated that there is no target RNA in the sample, that is, there are no viable bacteria; If detected, it can be evaluated that viable bacteria are present in the sample. As described above, by using the method according to the present embodiment, the presence or absence of viable bacteria in a sample can be easily evaluated with high accuracy and sensitivity without failing to recover viable bacteria in the sample.

Another embodiment of the present invention is a kit for performing the above-mentioned method for detecting viable bacteria, the kit comprising: an ultrafiltration membrane; a padlock-type DNA probe having a nucleic acid sequence complementary to a target RNA; It is equipped with an enzyme for performing the RHa-RCA method and a labeled probe for labeling single-stranded DNA.

In this embodiment, the specific descriptions of the ultrafiltration membrane, the padlock-type DNA probe, the enzyme for performing the RHa-RCA method, and the labeling probe for labeling single-stranded DNA are the same as those described above. Therefore, it is omitted.

According to the kit according to the present embodiment, since it is equipped with the materials for carrying out the method for detecting living bacteria according to the present invention, it is possible to easily carry out the above method and detect living bacteria in a sample as described above. The presence or absence of viable bacteria in a sample can be evaluated with high precision and sensitivity without failing to recover any bacteria.

Examples are shown below to explain in detail the method for detecting living bacteria according to the present invention. In this example, E. E. coli was detected using the above method for detecting viable bacteria according to the present invention.

(concentration step)
First, E. A medium containing E. coli was prepared, and the medium was added to an ultrafiltration membrane, Amicon Ultra 0.5 mL centrifugal filter (NMWL: 100 kDa, Merck). Thereafter, 4% paraformaldehyde was added and centrifugation was performed at 14,000×g and 25° C. for 5 minutes. The filtrate was removed, and 4% paraformaldehyde was added onto the filter again, suspended by vortexing, and allowed to stand for 15 minutes (fixing treatment). Thereafter, centrifugation was performed again under the above conditions to remove the filtrate. Thereafter, 70% ethanol was added and centrifugation was performed under the above conditions to remove the filtrate, 70% ethanol was added again, the suspension was suspended by vortexing, and the mixture was allowed to stand for 60 minutes. Thereafter, centrifugation was performed again under the above conditions to remove the filtrate, and then 25 μg/mL of lysozyme was added and centrifugation was performed under the above conditions. After removing the filtrate, 25 μg/mL of lysozyme was added again, suspended by vortexing, and allowed to stand for 10 minutes (cell permeabilization). Thereafter, the filtrate was removed by centrifugation under the above conditions.

(amplification step)
After the concentration step, 100 μl of a solution containing 100 pmol of padlock probe in a buffer containing 20 mM Tris acetate (pH 7.5), 10 mM magnesium acetate, and 50 mM potassium glutamate was added on the filter. The sequence of the padlock-type probe is as follows.
AGCCCTCAGGCATGGTTCCTTTTACGACCTCCAATGCTGCTGCTGTACTACTCTTCTGCGCTCCTGGATGT (SEQ ID NO: 1)

Thereafter, the padlock-shaped DNA probe was hybridized to the target RNA inside the bacterial cells by incubating at 95°C for 1 minute, cooling gently at 30°C for 30 minutes or more, and then incubating at 30°C for 10 minutes. . This was followed by 50 μl of the ligation mixture (20 mM Tris acetate (pH 7.5), 10 mM magnesium acetate, 1.2 mM ATP, 50 mM potassium glutamate, 10 mM dithiothreitol and 25 units of SplintR ligase (New England BioLads). The padlock-shaped DNA probe was circularized by adding 100% chloride (Company) and incubating at 37°C for 10 minutes.

Next, 20mM Tris acetate (pH 7.5), 10mM magnesium acetate, 80mM ammonium sulfate, 10mM potassium glutamate, 2.0mM deoxynucleoside triphosphates (dNTPs), 0.004 units of pyrophosphatase (New England BioLads), 100 μl of a reaction mixture containing 0.06 units of RNase H (Bio Academia), and 500 ng of DNA-free phi29 DNA polymerase (Kanto Kagaku) were mixed with 150 μl of a mixture containing the circularized DNA probe. . After mixing, single-stranded DNA amplification reaction was performed by incubating at 30°C for 2 hours. Thereafter, the enzyme was inactivated by incubating at 65° C. for 10 minutes.

After the inactivation treatment, centrifugation treatment was performed, washing was performed with PBS, and centrifugation treatment was performed again to remove the filtrate. By this operation, unreacted probes will pass through the filter and be included in the filtrate.

(sign step)
After the above washing, Alexa-labeled oligonucleotides were added onto the filters and hybridized for 3 hours at 37°C. The oligonucleotide is labeled with Alexa568 on the 5' side, and the sequence of the oligonucleotide is CCTCAATGCTGCTGCTGTACTAC (SEQ ID NO: 2). Thereafter, centrifugation was performed, washing was performed with PBS, and centrifugation was performed again to remove the filtrate. By this operation, unreacted probes will pass through the filter and be included in the filtrate.

(Detection step)
After the above labeling step, observation was performed using a fluorescence microscope (Nikon ECLIPSE E600) equipped with a phase contrast objective lens (CFI PlanApo DM 100× (Nikon)) and an ORCA-Flash 4.0 V3 camera (Hamamatsu Photonics). The results are shown in FIG. In FIG. 3, for convenience, white arrows are attached to some of the locations where particularly strong red fluorescence was observed, but red fluorescence was also observed in many locations that overlapped with bacteria other than the locations indicated by the white arrows. Therefore, it was found that by using the method according to the present invention, single-stranded DNA can be normally amplified in bacterial cells containing target RNA.

As described above, according to the method for detecting living bacteria according to the present invention, since the RNA inside the bacterial body is detected directly as a target, the presence or absence of bacteria in the sample can be determined with high accuracy, and the RHa-RCA method Since viable bacteria in the sample are concentrated by using an ultrafiltration membrane on the sample before performing this method, viable bacteria in the sample can be detected with high sensitivity.

Claims (6)

A method for detecting viable bacteria in a sample, the method comprising:
a concentration step of concentrating the viable bacteria in the sample by filtering the sample using an ultrafiltration membrane;
A target RNA possessed by a living bacterium trapped by the ultrafiltration membrane and a padlock-type DNA probe having a complementary nucleic acid sequence to the target RNA are hybridized within the body of the bacterium, and the target RNA is used as a primer. , an amplification step of amplifying single-stranded DNA within the bacterial cells by the RNase assisted rolling circle amplification (RHa-RCA) method using the DNA probe as a template;
a labeling step of hybridizing a labeled probe within the bacterial cells to the single-stranded DNA amplified in the amplification step;
a detection step of detecting the single-stranded DNA labeled in the labeling step ,
The amplification step, the labeling step, and the detection step are all performed on the ultrafiltration membrane,
A method for detecting viable bacteria , characterized in that the ultrafiltration membrane is a centrifugal filter . 2. The method for detecting viable bacteria according to claim 1, wherein, before the amplification step, the surviving bacteria trapped by the ultrafiltration membrane are subjected to cell permeabilization treatment. 3. The method for detecting living bacteria according to claim 1, wherein the labeled probe is labeled with a fluorescent labeling reagent, biotin, or an enzyme. 4. The method for detecting living bacteria according to claim 3, wherein the labeled probe is a fluorescent probe, and the single-stranded DNA is detected by a fluorescent in situ hybridization method. The method for detecting viable bacteria according to any one of claims 1 to 4, wherein the ultrafiltration membrane is an ultrafiltration membrane that traps substances with a molecular weight of 100 kDa or more. A kit for carrying out the method for detecting viable bacteria according to any one of claims 1 to 5 , comprising:
The ultrafiltration membrane;
a padlock-shaped DNA probe having a nucleic acid sequence complementary to the target RNA;
an enzyme for performing the RHa-RCA method;
A kit comprising a labeling probe for labeling the single-stranded DNA.