JP7437648B2 - Molecular targets and their utilization for LATS2 mutant diseases - Google Patents

Description

Application of Article 30, Paragraph 2 of the Patent Act Implementation status published on the website (https://kaken.nii.ac.jp/ja/report/KAKENHI-PROJECT-17K18436/17K184362017hokoku/) on December 17, 2018 Published in report

Application of Article 30, Paragraph 2 of the Patent Act Presented at the 23rd Academic Meeting of the Japanese Society for Molecular Targeted Cancer Therapy held at the Osaka International Exchange Center on June 13, 2019

The present invention relates to molecular targets and their utilization for LATS2 mutation diseases.

The LATS2 gene is known as a gene that causes cancers such as malignant mesothelioma, prostate cancer, and non-small cell lung cancer. Inactivating mutations of the LATS2 gene are observed in about 25% of malignant mesotheliomas (Non-Patent Document 1). Many of the genetic mutations in malignant mesothelioma, including the LATS2 gene, are tumor suppressor gene mutations, making it difficult to conduct molecular targeted therapy for malignant mesothelioma that directly targets the causative gene.

On the other hand, in recent years, a new method of cancer treatment based on the concept of "synthetic lethality" has been proposed. "Synthetic lethality" is cell death that is first induced by suppressing the expression of two genes, and the development of molecular targeted drugs that specifically kill cancer cells even in cancers with inactivating mutations of genes. It becomes possible.
To date, searches have been made for genes that exhibit synthetic lethal phenotypes in relation to genes that cause malignant mesothelioma. For example, NF2 (Neurofibromatosis type 2) mutations, FAK (focal adhesion kinase) inhibitors, There are reports of BRCA1 associated protein 1) mutations and class 1 HDAC (Histone deacetylases) inhibitors (Non-patent Documents 2 and 3). However, a synthetic lethal partner gene that exhibits a synthetic lethal phenotype for the LATS2 gene has not been obtained.

H Murakami, T Mizuno, T Taniguchi, M Fujii, F Ishiguro, T Fukui, S Akatsuka, Y Horio, T Hida, Y Kondo, S Toyokuni, H Osada, and Y Sekido. “LATS2 Is a Tumor Suppressor Gene of Malignant Mesothelioma . Cancer Research”, 2011, 71(3):873-83 NR. Shah, I Tancioni, KK. Ward, C Lawson, XL. Chen, C Jean, FJ. Sulzmaier, S Uryu, NL.G. Miller, DC.Connolly, and DD. Schlaepfer. “Analyses of merlin/NF2 connection to FAK inhibitor responsiveness in serous ovarian cancer. Gynecologic oncology”, 2015, 134(1):104-111 JJ. Sacco, J Kenyani, Z Butt, R Carter, HY Chew, LP. Cheeseman, S Darling, M Denny, S Urbe, MJ. Clague, JM. Coulson. “Loss of the deubiquitylase BAP1 alters class I histone deacetylase expression and sensitivity of mesothelioma cells to HDAC inhibitors. Oncotraget”, 2015, 6(15):13757-13771

The objective of the present invention is to identify the LATS2 gene and a gene that exhibits a synthetic lethal phenotype, and to utilize this gene as a therapeutic target for LATS2 mutant diseases.

Using malignant mesothelioma as a model, the present inventor confirmed the lethality of each candidate gene using siRNA-based knockdown method and determined the synthetic lethal gene.As a result, LATS1/ It was confirmed that a synthetic lethal phenotype was induced by co-expressing SMG6, a type of mRNA endonuclease, with LATS2, and it was found that LATS2 and SMG6 are in a synthetic lethal relationship.

Based on this knowledge, the present invention provides the following [1] to [3].
[1] Detecting the presence or absence of an inactivating mutation in the LATS2 gene using biological samples derived from cancer patients, and selecting cancer patients who have this mutation as candidates for treatment with compounds that inhibit SMG6. A method for selecting patients for treatment with a compound that inhibits SMG6, including:
[2] A method for screening drugs for LATS2 mutation diseases, which includes evaluating a test compound using SMG6 inhibition as an index.
[3] A drug for LATS2 mutation disease containing a compound that inhibits SMG6 as an active ingredient.

The present invention reveals SMG6 as a synthetic lethal target of LATS2. Treatments that inhibit SMG6 can specifically kill cancer cells that have inactivating mutations in the LATS2 gene, and are therefore expected to be highly effective treatments for LATS2 mutation diseases with few side effects.

The results of suppressing SMG6 expression in HOMC-D4-derived LATS1/2 knockdown cells, MeT-5A-derived LATS1 knockdown cells, and LATS2 knockdown cells and measuring cell survival rate by WST assay are shown. (a) HOMC-D4-derived LATS1/2 knockdown cells were reacted with TERT inhibitors (Trichostatin, Doxorubicin, BIBR1532), and the results of cell viability and LD50 by WST assay are shown. (b) MeT-5A-derived LATS1 knockout cells and LATS2 knockout cells were reacted with TERT inhibitors (Trichostatin, Doxorubicin), and the results of cell viability and LD50 by WST assay are shown. The results of suppressing SMG6 expression in LATS1/2 knockdown cells, staining the cells with TUNEL, and analyzing the cells using FACS are shown. (a) SMG6 expression was suppressed in HOMC-D4-derived LATS1/2 knockdown cells, MeT-5A-derived LATS1 knockdown cells, and LATS2 knockdown cells, and after fixing the cells with cold methanol on day 6, γH2A.X antibody, nuclear staining image shows. (b) Shows the results of a comparative analysis of the ratio of the number of positive γH2A.X to the total number of nuclei in the field of view.

As used herein, "LATS2 mutant disease" refers to a disease that has an inactivating mutation in the LATS2 gene, and includes, for example, malignant mesothelioma, prostate cancer, non-small cell lung cancer, and the like. Inactivating mutations of the LATS2 gene are caused by nonsense mutations, partial gene deletions, etc., but are not particularly limited herein as long as they inactivate the LATS2 gene.
"LATS2" is a serine threonine protein kinase that belongs to the LATS tumor suppressor family.

As used herein, "SMG6" refers to the SMG6 gene on chromosome 17, which encodes EST1A (ever-shorter telomeres 1A). SMG6 is expressed in organs throughout the body and has both the function of mRNA endonuclease to eliminate abnormal mRNA and the function of controlling telomere elongation by cooperating with TERT (telomere reverse transcriptase) (AS. Venteicher, EB. Abreu , Z Meng, KE. McCann, RM. Terns, TD. Veenstra, MP. Terns, SE. Artandi. “A Human Telomerase Holoenzyme Protein Required for Cajal Body Localization and Telomere Synthesis. Science”, 2009, 323(5914):644 -8, T Fatscher, V Boehm, NH. Gehring. “Mechanism, factors, and physiological role of nonsense-mediated mRNA decay. Cellular and Molecular Life Sciences”, 2015, 72(23):4523-44)

As used herein, "TERT" refers to telomere reverse transcriptase, which is an enzyme that increases the length of telomeres upon activation of TERT and, in turn, controls the aging and lifespan of somatic cells. Artificial inhibition of TERT is known to induce apoptosis accompanied by DNA damage (X Ling, W Yang, P Zou, G Zhang, Z Wang, X Zhang, H Chen, K Peng, F Han , J Liu, J Cao, L Ao. “TERT regulates telomere-related senescence and apoptosis through DNA damage response in male germ cells exposed to BPDE in vitro and to B[a]P in vivo. Environmental Pollution”, 2018, 235: 836-849)

As used herein, a "cancer patient" is a person who is suffering from cancer or is suspected of having cancer, and "cancer" refers to malignant tumors (malignant neoplasms) in general.

As used herein, a "biological sample" is a sample obtained from a human and for which genomic DNA can be used, such as tissue, whole blood, plasma, serum, lymphocytes, lymph fluid, platelets, mononuclear cells, granulocytes, Examples include saliva and urine.

(Method of selecting treatment candidates)
The method for selecting patients for treatment with the compound that inhibits SMG6 of the present invention involves detecting the presence or absence of an inactivating mutation in the LATS2 gene using a biological sample derived from a cancer patient, and identifying cancer patients who have the mutation. , selecting patients as candidates for treatment with a compound that inhibits SMG6.
If an inactivating mutation in the LATS2 gene is detected, cancer patients with the mutation can be judged to be responsive to treatment with compounds that inhibit SMG6, and patients who are candidates for treatment with compounds that inhibit SMG6 can be judged to be responsive to treatment with compounds that inhibit SMG6. If selected as such, it is expected that the therapeutic results will improve due to the synthetic lethal effect of LATS2 and SMG6.
Inactivating mutations in the LATS2 gene are observed in malignant mesothelioma, prostate cancer, and non-small cell lung cancer, so cancer patients are patients with malignant mesothelioma, prostate cancer, and non-small cell lung cancer. It is preferable that

Detection of inactivating mutations in the LATS2 gene is not particularly limited, and known methods capable of detecting mutations may be used, such as direct sequencing, RT-PCR, PCR-RFLP, PCR-SSCP, Invader method, TaqMan Genotyping. This can be carried out by methods such as microarray method, microarray method, and next generation sequencing method.

The compound that inhibits SMG6 may be a naturally occurring substance, a substance artificially synthesized by a chemical or biological method, or a composition or a mixture. It may also be a compound identified by the screening method described below.
As used herein, inhibition of SMG6 includes both inhibition of SMG6 activity and inhibition of SMG6 expression. Regarding the relationship between LATS2 and SMG6, inhibition of SMG6 is preferable because analysis using active mutants of SMG6 suggested that mutations in the nuclease activity of SMG6 are required to exhibit synthetic lethality with LATS2. is an inhibition of the nuclease activity of SMG6. The nuclease activity of SMG6 can be examined by reacting RNA of known concentration with a sample for 1 hour at 37°C, and comparing the RNA RIN values (RNA integrity numbers) using a Bioanalyzer.

(Drug screening method)
The method of screening for drugs for LATS2 mutation diseases of the present invention is a method that includes evaluating a test compound using SMG6 inhibition as an indicator.
The test compound is not particularly limited, and may be a naturally occurring substance, a substance artificially synthesized by chemical or biological methods, or a composition or mixture. good.
Inhibition of SMG6, which serves as an evaluation index, may be inhibition of SMG6 activity or expression of SMG6, as described above.

Screening can be carried out, for example, by causing a test compound to act on the SMG6 nuclease activity detection system, detecting SMG6 nuclease activity, and evaluating the test compound that reduces SMG6 nuclease activity as a drug for LATS2 mutant disease. It can be carried out. Evaluation of the test compound may be performed, for example, by comparing a group to which the test compound has been added and a group to which the test compound has not been added or a group to which a control substance has been added.

In addition, screening includes, for example, contacting SMG6-expressing cells with a test compound, detecting the activity or expression of SMG6 in the cells, and based on the result of the detection, selecting a test compound that inhibits the activity or expression of SMG6. This can be done by evaluating it as a drug for LATS2 mutant diseases. Evaluation of the test compound may be performed, for example, before and after addition of the test compound, or by comparing a group to which the test compound has been added and a group to which no test compound has been added or a group to which a control substance has been added.

Here, examples of SMG6-expressing cells include cells that naturally have the SMG6 gene and have the ability to express it, and cells that have been exogenously introduced to be able to express the SMG6 gene. These may be cells collected from a living body, cells contained in tissues or organs collected from a living body, or cultured cells. Preferably, cells are derived from humans.
Cells capable of exogenously expressing the SMG6 gene can be obtained using known techniques, for example, by introducing an expression vector incorporating the SMG6 gene into any mammalian cell and transforming the cell. can.
Examples of contacting the test compound to SMG6-expressing cells include addition of the test compound to the cell culture medium or direct addition to the cells (eg, dropping, coating, spraying, spraying, patching, etc.). The amount of contact with the test compound and the conditions may be set as appropriate.

When detecting the activity or expression of SMG6 at the mRNA level, it can be performed, for example, by Northern blotting, RT-PCR, real-time RT-PCR, RNase protection assay, or the like.
When detecting SMG6 protein expression, for example, SDS-PAGE, chromatography, immunoassay (e.g., immunohistochemistry, ELISA, Western blot, immunoprecipitation, etc.), colorimetry, mass spectrometry, etc. It can be carried out.
When detecting the activity of the promoter of the SMG6 gene, it can be carried out by fluorescence/optical measurement of promoter activity or transcriptional activity (reporter assay) using a reporter gene.
When detecting the activity of SMG6 protein, it can be carried out by measuring the amount of binding substrate bound to SMG6 protein.

Thus, test compounds that inhibit SMG6 can be evaluated as drugs for LATS2 mutant diseases and used for the treatment of LATS2 mutant diseases. A test compound that inhibits SMG6 can serve as a molecular targeting drug that specifically kills cancer cells with inactivating mutations in the LATS2 gene, due to the synthetic lethal effect of LATS2 and SMG6.

(Drug for LATS2 mutation disease)
The drug for LATS2 mutation disease contains a compound that inhibits SMG6 as an active ingredient, and the compound may be a known compound or a compound identified by the above screening method. As described above, inhibition of SMG6 may be inhibition of SMG6 activity or expression of SMG6.
The form of the drug for LATS2 mutation disease is arbitrary, for example, oral administration in the form of tablets, capsules, granules, powders, troches, syrups, etc.; injections, suppositories, inhalants, transdermal absorption drugs, etc. , parenteral administration using external preparations, etc., and any of them may be used.
In addition to the compound that inhibits SMG6, the drug includes excipients, binders, disintegrants, lubricants, solvents, solubilizing agents, suspending agents, isotonic agents, pH regulators/buffers, Pharmaceutically acceptable carriers such as preservatives, antioxidants, coloring agents, flavoring/fragrant agents, and stabilizers can be appropriately blended and used.
When administering a drug to a living body, the dose and usage may vary depending on the condition, weight, sex, age, or other factors of the subject.

Next, the present invention will be explained in more detail with reference to Examples.

Example 1 Induction of synthetic lethal phenotype by suppressing co-expression of LATS2 and SMG6
1. Cell
In order to suppress the expression of LATS1 and LATS2, a cell line derived from human normal mesothelium (HOMC-D4, T Kakiuchi, T Takahara, Y Kasugai, K Arita, N Yoshida, K Karube, M Suguro, K Matsuo, H Nakanishi, T Kiyono, S Nakamura, H Osada, Y Sekido, M Seto and S Tsuzuki. “Modeling mesothelioma utilizing human mesothelial cells reveals involvement of phospholipase-C beta 4 in YAP-active mesothelioma cell proliferation”, 2016, Carcinogenesis, 37(11): 1098-1109), shRNA was introduced into cells using lentivirus. The shRNA (shNT) used was SIGMA (MISSION pLKO.1-puro Non-Mammalian shRNA (SHC002)), and shLATS1/2 was pLKO.1 puro containing shRNA with the sequence listed in Table 1 below. be.

2. LATS1 and 2 expression suppressed cell line
As a method for introducing shRNA into HOMC-D4 cells, we created lentivirus encapsulated with shRNA (lenti-shRNA) using a lentivirus vector system for 293T cells. Specifically, 293T cells were seeded at 6 × 10 ⁴ cells/cm ² in Dulbecco's modified Eagle's medium: DMEM (Wako: catalog number 04429-675) and Fetal Bovine Serum: FBS (GIBCO: catalog number 10270). ) was added to the cells at a concentration of 10% (hereinafter referred to as 10% FBS-DMEM), and cultured in 10% FBS-DMEM for 24 hours. 8 μg/ml psPAX2, 2.8 μg/ml pMD2.G, and 10 μg/ml shRNA were mixed in 270 μl OPTIMEM (1). PEI-Max was mixed with 270 μg/ml OPTIMEM at a concentration of 2 mg/ml (2). (1) was added to (2) above, mixed by inversion, and then allowed to stand at room temperature for 20 minutes to obtain a lentivirus introduction mixture. The 10% FBS-DMEM was completely removed, OPTIMEM was added at a concentration of 0.08 ml/cm ² , the lentivirus introduction mixture was added, and the mixture was cultured at 37°C for 4 hours. After culturing, the medium was replaced with 10% FBS-DMEM and cultured at 37°C for 48 hours. After 48 hours, the culture solution was collected and passed through 0.22 μm MillEX-GV (Millipore: catalog number SLGV033RS) to obtain lentiviruses (lenti-shNT, lenti-shLATS1/2). HOMC-D4 was infected with lenti-shNT and lenti-shLATS1/2, and LATS1/2 was knocked down (KD: Knock down). Thereafter, cells were selected with puromycin and blasticidin at 16 μg/ml to establish non-single stable cell lines (NT cells, LATS1/2 KD cells).

3. siRNA gene transfer
In order to suppress the expression of SMG6, the siRNA shown in Table 2 below was introduced into the cells using Lipofectamine.

The siRNAs used (siSMG6-1: GCCAGUGAUACAGCGAAUU, siSMG6-2: ACACCAACGGCUUCAUUGA, siNegative Control: CGUACGCGGAAUACUUCGA) were produced using Nippon Gene's siRNA synthesis service. The prepared siRNA was mixed with 4% OPTIMEM, 1.34% RNAiMax (Invitrogen: catalog number 13778030), and 2 nM siRNA immediately before cell introduction, and incubated at room temperature for 15 minutes. Thereafter, RPMI (Wako: catalog number 189-02025) with FBS added to 10% (hereinafter referred to as 10% FBS-RPMI) was added to prepare a mixture for knockdown. As a knockdown pretreatment, the established NT cells, LATS1/2 KD cells, MeT-5A WT cells, LATS1 KO cells, and LATS2 KO cells were each cultured in a cell culture plate (5 × 10 ³ cells/cm ² /well) ( The cells were seeded in 96-well Corning catalog number: 3598, 6-well VioLAMO: catalog number 2-8588-01) and cultured in 10% FBS-RPMI for 24 hours. Thereafter, 10% FBS-RPMI was completely removed, a knockdown mixture was added to the bottom area of the well at a concentration of 0.13 ml/cm ² , and cultured for 72 hours.

The LATS1 or LATS2 target sequence (LATS1; AGCAAGAAAAGTAGATACTA (SEQ ID NO: 7), LATS2; AGGAAACTGGACTAACAATG (SEQ ID NO: 8)) was introduced into the BbsI site of the knockout plasmid (pX330, Addgene #42230). The knockout plasmid prepared in MeT-5A was transfected using Thermo Fisher's Lipofectamine 2000, and incubated in a CO ₂ incubator. After 48 hours, the cells were seeded in a 96-well plate at 1 cell/well, and scaled up sequentially to obtain a single clone.

Four. TERT inhibitor administration
To inhibit TERT, trichostatin (SantaCruz: catalog number sc-3511), doxorubicin (SantaCruz: catalog number sc-200923), and BIBR1532 (SantaCruz: catalog number sc-203843) were directly added to cells and reacted. Each TERT inhibitor was serially diluted to 50 μM, 10 μM, 5 μM, 1 μM, 500 nM, 100 nM, 50 nM, 10 nM, 5 nM, and 1 nM using 10% FBS-RPMI as a solvent. Culture established NT cells, LATS1/2 KD cells, MeT-5A WT cells, LATS1 KO cells, and LATS2 KO cells at 1 × 10 ⁴ cells/cm ² /well each in a cell culture plate (96-well Corning catalog number: 3598) and cultured in 10% FBS-RPMI for 24 hours. After culturing, 10% FBS-RPMI was completely removed, 100 μl of each diluted TERT inhibitor was added to each well, and cultured for 72 hours.

5. Measurement of Cell Viability In the knockdown-treated cells, 72 hours after the knockdown treatment, the knockdown mixture in the 96-well plate was replaced with 100 μl of 10% FBS-RPMI, and the cells were further cultured at 37°C for 72 hours. After culturing, completely remove 10% FBS-RPMI, add Cell Counting Kit-8 (Dojindo Laboratories: catalog number CK04) to 10% FBS-RPMI to a concentration of 10%, and add 100 μl to each well. Culture was performed at 37°C for 1 hour. After culturing, measurements were performed using SPECTRA Max (Molecular Devices) at a wavelength of 450 nm-ref.630 nm. In cells treated with TERT inhibitor, cell viability was measured in the same manner 72 hours after treatment with the inhibitor. Each knockdown group and inhibitor-treated group were normalized based on the absorbance in the untreated group, and comparative studies were performed.

6. Calculation of half-lethal dose
After the TERT inhibitor was serially diluted and reacted with cells, the cell survival rate was measured and the lethal dose (LD50: 50%) was calculated from the obtained survival rate. Using Image J's analysis algorithm, we calculated the coefficients of the sigmoid curve below. LD50 was calculated from the obtained sigmoid function.

7. Apoptosis detection
72 hours after the knockdown treatment of NT cells and LATS1/2 KD cells, cell suspensions were collected using trypsin/EDTA. After measuring the number of cells using a hematology plate, cell fixation and membrane permeabilization were performed using BD Cytofix/Cytoperm ^TM Fixation/Permeabilization Solution Kit (BD: catalog number BDB554714). Thereafter, TUNEL staining was performed using TUNEL Assay Kit - BrdU-Red (Abcam: catalog number ab66110). After staining, it was measured using LSRFORTESSA (BD) and analyzed using Flowjo.

8. DNA damage detection
72 hours after knockdown treatment, NT cells, LATS1/2 KD cells, MeT-5A WT cells, LATS1 KO cells, and LATS2 KO cells were immersed in cold methanol and fixed at -20°C for 10 minutes. After washing once with PBS, it was reacted with PBS containing 1% BSA for 1 hour at room temperature. Thereafter, it was immersed in mouse anti-human γH2AX antibody (Millipore: catalog number 05-636, 5 μg/ml) and reacted at 4° C. for 18 hours. After washing three times with PBS, it was immersed in Alexa488-labeled anti-mouse antibody (Thermo Fisher: catalog number A32723, 5 μg/ml) and reacted at room temperature for 1 hour. After washing three times with PBS, nuclear staining was performed by reacting with DAPI (4',6-diamidino-2-phenylindole, BIO-RAD: catalog number 133061-2, 1 μ/ml) for 15 minutes. After washing three times with PBS, the cells were mounted in Fluorescence Mounting Medium (Dako: catalog number s3023). After staining, it was observed using LSM800 (Carl Zeiss).

9.Statistical analysis
A Student's t test was performed to compare the survival rates between the two groups of NT cells and LATS1/2 KD cells. The survival rates among the three groups of MeT-5A WT cells, LATS1 KO cells, and LATS2 KO cells were compared using the Steel-Dwass test.
The results are shown in Figure 1.

Ten. Results As shown in Figure 1, a significant decrease in viable cells was observed in LATS1/2 KD cells by suppressing SMG6 expression. In addition, a significant decrease in linear loss cells was observed only in LATS2 KO cells, confirming that co-expression suppression of LATS2 and SMG6 induces a synthetic lethal phenotype.

As shown in Figure 2, as a result of reacting with TERT inhibitor, which is a downstream candidate of SMG6, and examining the LD50 for inducing cell death, lower doses of TERT were detected in LATS1/2 KD cells and LATS2 KO cells compared to normal cells. Induction of cell death by the inhibitor was confirmed.

As shown in FIG. 3, TUNEL-positive cells were detected in the stable cell line derived from HOMC-D4 due to suppression of SMG6 expression. In addition, as a result of quantitative evaluation, the group in which SMG6 expression was suppressed in LATS1/2 KD cells was significantly more TUNEL positive than the group in which SMG6 expression was suppressed in NT cells and the group in which LATS1/2 KD cells were treated with Negaive Control. An increase in the number of cells was observed. These results confirmed that the synthetic lethal phenotype caused by suppression of co-expression of LATS2 and SMG6 was induced by apoptosis.

As shown in FIG. 4, an increase in the number of positive γH2A.X staining was observed in LATS1/2 KD cells due to suppression of SMG6 expression. These results suggest that the synthetic lethal phenotype caused by co-inhibition of LATS2 and SMG6 expression is caused by apoptosis associated with DNA damage.

Claims (4)

A method for detecting inactivating mutations in the LATS2 gene in cancer cells derived from cancer patients in order to examine the therapeutic responsiveness of compounds that inhibit S MG6. 2. The method according to claim 1, wherein the cancer patient is a patient with malignant mesothelioma, prostate cancer, or non-small cell lung cancer. A method for screening drugs for LATS2 mutant diseases such as malignant mesothelioma, prostate cancer, or non-small cell lung cancer, the method comprising evaluating a test compound using SMG6 inhibition as an index. A drug for LATS2 mutant disease, which is malignant mesothelioma, prostate cancer or non-small cell lung cancer, which contains a compound that inhibits SMG6 as an active ingredient.