JP7403590B2 - Ale beer and its manufacturing method - Google Patents

Description

The present invention relates to a method for improving the sulfite production ability of yeast, a method for improving the sulfite tolerance of yeast, a method for producing yeast with improved sulfite production ability, and a method for producing yeast with improved sulfite tolerance. The present invention also relates to a mutant polypeptide having the ability to excrete sulfite and a polynucleotide encoding the same. The present invention further relates to a method for evaluating the sulfite production ability or sulfite tolerance ability of yeast, a method for selecting yeast with a high sulfite production ability or sulfite tolerance ability, a yeast transformant, and a method for producing beer. The invention also relates to ale beer.

Beer, a brewed alcoholic beverage, contains various organic compounds such as proteins derived from raw materials and yeast, amino acids, and sugars. Sulfite produced by yeast has the effect of preventing non-enzymatic oxidative deterioration of organic compounds and the effect of suppressing the growth of other contaminants, and is an essential component for beer quality stability. In winemaking, it is permitted to add sulfite for the purpose of preventing oxidation, but in general beer, sulfite is not added, and the beer currently relies on sulfite derived from yeast. .

It is known that the sulfite excretion mechanism in yeast is carried out by a sulfite transporter called SSU1, which is a membrane protein encoded by the SSU1 gene (Non-Patent Document 1). Top-fermenting ale yeast (Saccharomyces cerevisiae) has the Sc-type SSU1 gene. On the other hand, bottom-fermenting lager yeast (Saccharomyces pastorianus) has, in addition to the Sc-type SSU1 gene, the Sb-type SSU1 gene, which is thought to be derived from Saccharomyces eubayanus. In general, lager yeast has a higher sulfite production ability than ale yeast, and previous studies have reported that Sb-type SSU1, which is unique to lager yeast, contributes to this high production ability (Patent Document 1 and Non-Patent Document 2). However, it is not clear why Sb type SSU1 has a high sulfite excretion ability.

Japanese Patent Application Publication No. 2004-283169

Avram, D. , and Bakalinsky, A. (1997) J. Bacteriology 179, 5971-5974. Tomoko Fujimura (2003) Biscience and Industry 61, 809-810.

In beer fermentation, sulfurous acid produced by yeast has an antioxidant effect and is known to play an important role in maintaining the quality of beer. If the sulfite-producing ability of yeast can be increased, it is thought that it will be possible to produce alcoholic beverages such as beer that have excellent flavor stability and a long shelf life.

An object of the present invention is to provide a method for improving the ability of yeast to produce sulfite. Another object of the present invention is to provide a mutant polypeptide with improved sulfite excretion ability and a polynucleotide encoding the same. A further object of the present invention is to provide a method for evaluating the sulfite-producing ability of yeast and a method for selecting yeast with a high sulfite-producing ability.

The present inventors modified the amino acid at the 19th position of the amino acid sequence shown in SEQ ID NO: 2 in the amino acid sequence of a yeast-derived polypeptide with sulfite excretion ability (also referred to as a sulfite transporter). The present invention has been found to be able to improve the sulfite excretion ability of the polypeptide. Furthermore, in the above polypeptide, in addition to the amino acid located at the position corresponding to the 19th position of the amino acid sequence shown in SEQ ID NO: 2, the amino acid located at the position corresponding to the 259th position of the amino acid sequence shown in SEQ ID NO: 2 and/or the 423 It has also been found that modifying the amino acid at the position corresponding to the position can further improve the sulfite excretion ability.

In a polypeptide having sulfite excretion ability (for example, SSU1), the amino acid located at the 19th position of the amino acid sequence shown in SEQ ID NO: 2 affects the sulfite excretion ability, so regarding naturally occurring genetic resources, Based on the amino acid sequence information at the above-mentioned positions of the polypeptide, yeast having a high ability to produce sulfite and yeast having a high ability to tolerate sulfite can be selected. By using yeast that has a high sulfite-producing ability, it is possible to produce, for example, beer with a high sulfite content and high antioxidant properties. On the other hand, sulfurous acid is known to cause odor derived from sulfur compounds. Information on the amino acids at the above positions of the polypeptide having the ability to excrete sulfite can also be used as a genetic index when selecting yeast with high or low ability to produce sulfite in order to control the amount of sulfite compounds.

The present invention includes the following method for improving the ability of yeast to produce sulfite.
[1] A method for improving the sulfite production ability of yeast, which comprises introducing mutations into yeast, wherein the mutations include introducing mutations into one or more of the following polypeptides (a) to (c) with SEQ ID NO. A mutation in which the amino acid at the position corresponding to the 19th methionine in the amino acid sequence shown in 2 is replaced with any nonpolar amino acid (X) selected from the group consisting of valine, alanine, isoleucine, glycine, and leucine. A method for improving the sulfite production ability of yeast.
(a) Polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 (b) Deletion and/or substitution of 1 to 9 amino acids in the region other than methionine at position 19 in the amino acid sequence shown in SEQ ID NO: 2 and/or a polypeptide consisting of an added amino acid sequence and having the ability to excrete sulfite. Polypeptide with excretion ability

[2] A method for improving the sulfite tolerance of yeast, which comprises introducing a mutation into yeast, wherein the mutation is in one or more polypeptides (a) to (c) above, A mutation in which the amino acid at the position corresponding to methionine at position 19 of the amino acid sequence shown in 2 is replaced with any nonpolar amino acid (X) selected from the group consisting of valine, alanine, isoleucine, glycine, and leucine. A method for improving sulfite tolerance in yeast.

[3] A method for producing yeast with improved sulfite-producing ability, the method comprising introducing mutations into yeast, wherein the mutations change the sequence in one or more of the polypeptides (a) to (c) above. A mutation in which the amino acid at the position corresponding to methionine at position 19 in the amino acid sequence shown in number 2 is replaced with any nonpolar amino acid (X) selected from the group consisting of valine, alanine, isoleucine, glycine, and leucine. A method for producing yeast with improved sulfite-producing ability, comprising:

[4] A method for producing yeast with improved sulfite tolerance, the method comprising introducing a mutation into yeast, wherein the mutation changes the sequence in one or more of the polypeptides (a) to (c) above. A mutation in which the amino acid at the position corresponding to methionine at position 19 in the amino acid sequence shown in number 2 is replaced with any nonpolar amino acid (X) selected from the group consisting of valine, alanine, isoleucine, glycine, and leucine. A method for producing yeast with improved sulfite tolerance, comprising:
[5] The above mutation is a mutation in which the amino acid at the position corresponding to leucine at position 259 of the amino acid sequence shown in SEQ ID NO: 2 is replaced with methionine in the above polypeptide, and/or a mutation corresponding to serine at position 423 The method according to any one of [1] to [4] above, further comprising a mutation in which the amino acid at the position is substituted with leucine.
[6] The method according to any one of [1] to [5] above, wherein the yeast into which the mutation has been introduced highly expresses the polypeptide into which the mutation has been introduced.
[7] The method according to any one of [1] to [6] above, wherein the yeast into which the mutation has been introduced has suppressed sulfite reduction.

[8] In the polypeptide according to any one of (a) to (c) above, the amino acid at the position corresponding to methionine at position 19 in the amino acid sequence shown in SEQ ID NO: 2 is valine, alanine, isoleucine, glycine, or A mutant polypeptide substituted with any nonpolar amino acid (X) selected from the group consisting of leucine (preferably excluding polypeptides consisting of the amino acid sequences shown in SEQ ID NOs: 37 to 46).
[9] In the polypeptide (a) or (b1) below, the mutant polypeptide is such that the amino acid at the position corresponding to the 19th methionine in the amino acid sequence shown in SEQ ID NO: 2 is the non-polar amino acid The mutant polypeptide according to [8] above, which is a mutant polypeptide substituted with (X).
(b1) The amino acid sequence shown in SEQ ID NO: 2 consists of an amino acid sequence in which 1 to 6 amino acids selected from the group consisting of the following (i) to (vi) are substituted with other amino acids, and Polypeptide having sulfite excretion ability (i) Alanine at position 52, (ii) Alanine at position 61, (iii) Asparagine at position 90, (iv) Alanine at position 122, (v) Proline at position 157, and (vi) Tyrosine at position 164 [10] In the polypeptide of (b) or (c) above, the amino acid at the position corresponding to methionine at position 19 of the amino acid sequence shown in SEQ ID NO: 2 is substituted with the above nonpolar amino acid (X). The mutant polypeptide is such that the amino acid at the position corresponding to leucine at position 259 of the amino acid sequence shown in SEQ ID NO: 2 is methionine, and/or the amino acid at the position corresponding to serine at position 423 is The mutant polypeptide according to [8] above, which is leucine.
[11] In the polypeptide of (a) or (b1), the amino acid at the position corresponding to the 19th methionine in the amino acid sequence shown in SEQ ID NO: 2 is the non-polar amino acid ( X), and the amino acid at the position corresponding to leucine at position 259 is substituted with methionine, and/or the amino acid at the position corresponding to serine at position 423 is substituted with leucine. The mutant polypeptide according to [10] above.
[12] A polynucleotide encoding the mutant polypeptide according to any one of [8] to [11] above.

[13] A method for evaluating the sulfite production ability or sulfite tolerance ability of yeast, which comprises detecting or measuring the expression of the mutant polypeptide according to any one of [8] to [11] above in the test yeast.
[14] A method for evaluating the sulfite production ability or sulfite tolerance ability of yeast, which comprises detecting or measuring the expression of the polynucleotide according to [12] above in a test yeast.
[15] A method for evaluating the sulfite production ability or sulfite tolerance ability of yeast using a primer or probe designed based on the base sequence of the polynucleotide described in [12] above.
[16] A method for selecting yeast with high sulfite production ability or sulfite tolerance ability, which comprises detecting or measuring the expression of the mutant polypeptide according to any one of [8] to [11] above in a test yeast. .
[17] A method for selecting yeast with high sulfite production ability or sulfite tolerance ability, which comprises detecting or measuring the expression of the polynucleotide according to [12] above in a test yeast.
[18] Select the test yeast in which the expression of the polynucleotide has been detected or the test yeast in which the expression level of the polynucleotide is higher than that of the reference yeast as the yeast with high sulfite production ability or sulfite tolerance ability [17] above A method for selecting yeast having a high sulfite production ability or sulfite tolerance ability as described in .
[19] A method for selecting yeast with high sulfite production ability or sulfite tolerance ability using a primer or probe designed based on the base sequence of the polynucleotide described in [12] above.

[20] A yeast transformant into which a polynucleotide encoding a mutant polypeptide or a polynucleotide containing a portion thereof has been introduced, wherein the mutant polypeptide is any one of (a) to (c) above. In the polypeptide described in , the amino acid at the position corresponding to methionine at position 19 of the amino acid sequence shown in SEQ ID NO: 2 is any nonpolar amino acid selected from the group consisting of valine, alanine, isoleucine, glycine, and leucine. (X), and a part of the polynucleotide encoding the mutant polypeptide is located at a position corresponding to position 19 of SEQ ID NO: 2 in the mutant polypeptide. A yeast transformant, which is a polynucleotide comprising a base sequence encoding the above-mentioned nonpolar amino acid (X).
[21] A mutation in which the amino acid at the position corresponding to the 19th methionine in the amino acid sequence shown in SEQ ID NO: 2 is substituted with the non-polar amino acid (X) in the polypeptide (b) or (c) above. In the type polypeptide, the amino acid at the position corresponding to leucine at position 259 of the amino acid sequence shown in SEQ ID NO: 2 is methionine, and/or the amino acid at the position corresponding to serine at position 423 is leucine. The yeast transformant according to [20] above.
[22] The yeast transformant according to [20] or [21] above, which highly expresses the mutant polypeptide.
[23] The yeast transformant according to any one of [20] to [22] above, in which sulfite reduction is suppressed.

[24] A method for producing beer comprising a step of fermenting wort with yeast containing a mutant polypeptide or a polynucleotide encoding the same, wherein the mutant polypeptide is In any one of the polypeptides, the amino acid at the position corresponding to methionine at position 19 of the amino acid sequence shown in SEQ ID NO: 2 is any non-alcoholic acid selected from the group consisting of valine, alanine, isoleucine, glycine, and leucine. A method for producing beer, which is a mutant polypeptide substituted with a polar amino acid (X).
[25] The method for producing beer according to [24] above, wherein the yeast is a top-fermenting yeast.
[26] A mutation in which the amino acid at the position corresponding to methionine at position 19 in the amino acid sequence shown in SEQ ID NO: 2 is substituted with the non-polar amino acid (X) in the polypeptide of (b) or (c) above. In the type polypeptide, the amino acid at the position corresponding to leucine at position 259 of the amino acid sequence shown in SEQ ID NO: 2 is methionine, and/or the amino acid at the position corresponding to serine at position 423 is leucine. The method for producing beer according to [24] or [25] above.
[27] The method for producing beer according to any one of [24] to [26] above, wherein the yeast highly expresses the mutant polypeptide.
[28] The method for producing beer according to any one of [24] to [27] above, wherein the yeast has suppressed sulfite reduction.
[29] Ale beer containing 1 ppm or more of sulfite.
[30] Beer containing 1 ppm or more of sulfites and labeled as "ale".

According to the present invention, the ability of yeast to produce sulfite can be improved. According to the present invention, the sulfite tolerance ability of yeast can be improved. Further, according to the present invention, it is possible to provide a mutant polypeptide with improved sulfite excretion ability and a polynucleotide encoding the same. Furthermore, according to the present invention, the sulfite production ability and sulfite tolerance ability of yeast can be evaluated, and yeast with high sulfite production ability and yeast with high sulfite tolerance ability can be selected. By using the yeast with high sulfite-producing ability provided by the present invention in the production of alcoholic beverages, the sulfite content in the product can be increased. This makes it possible to produce alcoholic beverages such as beer that have excellent flavor stability.

Figure 1 shows the amino acid sequence (upper row) of SbSSU1 of Saccharomyces pastorianus WEIHENSTEPHAN 34/70 strain (WH34/70 strain) and S28 of Saccharomyces cerevisiae S28. Amino acid sequence of ScSSU1 of 8C strain (lower row) and FIG. FIG. 2 is a graph showing the evaluation results of the sulfite production ability of transformants into which DNA encoding ScSSU1 or its mutants was introduced, and transformants into which DNA encoding SbSSU1 or its mutants was introduced. FIG. 3 is a photograph showing the evaluation results of the sulfite tolerance ability of a transformant into which DNA encoding ScSSU1 or its mutant was introduced, and a transformant into which DNA encoding SbSSU1 or its mutant was introduced. FIG. 4 is a graph showing the evaluation results of the sulfite production ability of transformants into which DNA encoding ScSSU1, its mutant, or SbSSU1 was introduced. FIG. 5 is a graph showing the evaluation results of the sulfite-producing ability of Saccharomyces cerevisiae EO001 strain, WH34/70 strain, and Saccharomyces pastorianus EOY005 strain (EOY005 strain). FIG. 6 is a photograph showing the evaluation results of the sulfite tolerance ability of the WH34/70 strain and the EOY005 strain. FIG. 7 is a diagram showing a sequence alignment between the amino acid sequence of SbSSU1 of the EOY005 strain (upper row) and the amino acid sequence of SbSSU1 of the WH34/70 strain (lower row). FIG. 8 is a graph showing the evaluation results of the sulfite production ability of transformants into which DNA encoding ScSSU1, SbSSU1 or a mutant thereof was introduced. FIG. 9 is a photograph showing the evaluation results of the sulfite tolerance ability of transformants into which DNA encoding ScSSU1, SbSSU1 or a mutant thereof was introduced. FIG. 10 is a graph showing the results of expression analysis of the ScSSU1 gene by qPCR.

<Mutant polypeptide and polynucleotide encoding it>
The mutant polypeptide of the present invention is a polypeptide according to any one of the following (a) to (c), in which the amino acid at the position corresponding to methionine at position 19 of the amino acid sequence shown in SEQ ID NO: 2 is valine, A mutant polypeptide substituted with any nonpolar amino acid (X) selected from the group consisting of alanine, isoleucine, glycine, and leucine.
(a) Polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 (b) Deletion and/or substitution of 1 to 9 amino acids in the region other than methionine at position 19 in the amino acid sequence shown in SEQ ID NO: 2 and/or a polypeptide consisting of an added amino acid sequence and having the ability to excrete sulfite. Polypeptides with Excretion Ability In the present specification, amino acid numbers are from the N-terminus.

As used herein, the amino acid (amino acid residue) at the position corresponding to the 19th methionine (methionine residue) in the amino acid sequence shown in SEQ ID NO: 2 refers to the amino acid sequence (primary structure) of the polypeptide to be compared. means the amino acid at the position corresponding to the 19th position in the amino acid sequence of SEQ ID NO: 2 when an alignment is performed based on the homology of the amino acid sequence with the amino acid sequence of SEQ ID NO: 2 (reference amino acid sequence). Therefore, the amino acid located at the position corresponding to the 19th methionine in the amino acid sequence shown in SEQ ID NO: 2 is the 19th methionine in SEQ ID NO: 2, but is an amino acid with a different amino acid sequence from the amino acid sequence shown in SEQ ID NO: 2. In polypeptides, it may not be the 19th position. The same applies to amino acids at positions corresponding to amino acids other than the 19th amino acid in the amino acid sequence shown in SEQ ID NO: 2 (for example, leucine at position 259 and serine at position 423 in the amino acid sequence shown in SEQ ID NO: 2).
In this specification, the position corresponding to the 19th methionine in the amino acid sequence shown in SEQ ID NO: 2 is also referred to as "the position corresponding to the 19th position of SEQ ID NO: 2." Similarly, the position corresponding to leucine at position 259 and the position corresponding to serine at position 423 of the amino acid sequence shown in SEQ ID NO: 2 in the amino acid sequence are respectively referred to as "position corresponding to position 259 of SEQ ID NO: 2" and "position corresponding to position 259 of SEQ ID NO: 2". It is also referred to as "the position corresponding to the 423rd position of number 2".

It is easy to identify the amino acid at the 19th position of SEQ ID NO: 2 in any polypeptide such as (a) to (c) above.
The amino acid at the 19th position of SEQ ID NO: 2 can be identified using, for example, a known sequence comparison program such as ClustalW. ClustalW can generally use default parameters. ClustalW can be used from websites such as the Data Bank of Japan (DDBJ) and the European Bioinformatics Institute (EBI). Alignment based on amino acid sequence homology can be performed by inputting the amino acid sequences of two polypeptides to be compared and running the program. Here, by inputting the amino acid sequence of SEQ ID NO: 2 as one of the two polypeptides, it is possible to determine which position in the polypeptide of SEQ ID NO: 2 the residue at a specific position of any polypeptide corresponds to. Can be easily identified. The same applies to the position corresponding to position 259 and position corresponding to position 423 of SEQ ID NO: 2 in any polypeptide.

The polypeptides (a) to (c) above are polypeptides (proteins) having the ability to excrete sulfite, and can also be referred to as sulfite transporters. In this specification, the polypeptides (a) to (c) above are also referred to as non-mutated polypeptides.

As shown in the Examples below, in SbSSU1 (polypeptide having sulfite excretion ability encoded by the Sb type SSU1 gene) derived from Saccharomyces pastorianus and held by Saccharomyces pastorianus, It was found that the valine residue located at the 19th position greatly contributes to the high sulfite excretion ability. In the amino acid sequence of SEQ ID NO: 2, a mutation (M19V) in which methionine at position 19 is replaced with valine is introduced, and the mutant polypeptide has a higher sulfite excretion ability than before the mutation (polypeptide of SEQ ID NO: 2). It was found that the sulfite production ability and sulfite tolerance ability (sulfite tolerance) of the yeast expressing the mutant polypeptide were improved (enhanced). Furthermore, even in a mutant polypeptide in which a mutation (M19A, M19I, M19G, or M19L) that replaces methionine at position 19 with alanine, isoleucine, glycine, or leucine in the amino acid sequence of SEQ ID NO. It was found that the sulfite excretion ability was improved compared to polypeptide No. 2), and the sulfite production ability and sulfite tolerance ability of yeast expressing the mutant polypeptide were improved.

The mutant polypeptide of the present invention is the polypeptide (non-mutant polypeptide) according to any one of (a) to (c) above, in which the amino acid at the 19th position of SEQ ID NO: 2 is valine. , alanine, isoleucine, glycine, and leucine. In the present invention, the nonpolar amino acids (X) are valine, alanine, isoleucine, glycine, and leucine, and preferably valine, alanine, isoleucine, and glycine from the viewpoint of increasing the sulfite excretion ability of the mutant polypeptide. Among them, valine, alanine, and isoleucine are more preferable, and valine is more preferable. The mutant polypeptide of the present invention is an amino acid sequence in which the amino acid at the 19th position of SEQ ID NO: 2 is substituted with valine in the polypeptide according to any one of (a) to (c) above. A polypeptide consisting of is particularly preferred. In the mutant polypeptide of the present invention, since the amino acid at the position corresponding to the 19th position of SEQ ID NO: 2 is a non-polar amino acid (X), the amino acid at the position is a non-polar amino acid (X). It has a higher sulfite excretion ability than a non-substituted polypeptide (non-mutated polypeptide). The mutant polypeptide of the present invention has the ability to excrete sulfite and can also be referred to as a mutant sulfite transporter.

As used herein, the sulfite excretion ability of a polypeptide is a function of excreting sulfite from cells (preferably yeast cells) to the outside of cells, and can also be referred to as sulfite transporter activity. The ability of a polypeptide to excrete sulfite can be determined by, for example, comparing the sulfite production ability of yeast into which a polynucleotide encoding the polypeptide has been introduced and expressed, and yeast to which the polynucleotide has not been introduced (control). This can be confirmed by When a polypeptide has the ability to excrete sulfite, yeast expressing the polypeptide has an improved ability to produce sulfite compared to a control yeast. The ability of yeast to produce sulfite can be evaluated by culturing yeast and measuring the sulfite concentration in the medium. The sulfite concentration in the medium is determined, for example, by J. W. Buechsenstein, C. S. Ough Am J Enol Vitic. It can be measured by the method described in January 1978 29: 161-164. The sulfite concentration can also be measured using a commercially available sulfite measurement kit (eg, F-Kit Sulfite (JK International Co., Ltd.)).

The amino acid sequence shown in SEQ ID NO: 2 is an example of the amino acid sequence of ScSSU1 (polypeptide having sulfite excretion ability encoded by the Sc-type SSU1 gene) derived from Saccharomyces cerevisiae. The polypeptide (b) and/or (c) above may be, for example, a variant of the naturally occurring polypeptide of SEQ ID NO: 2 (the polypeptide (a) above). The polypeptide (b) and/or (c) may be one that can be obtained artificially using techniques such as known site-directed mutagenesis methods.

In the present specification, deletion and/or substitution and/or addition of 1 to 9 amino acids in an amino acid sequence means that 1 to 9 amino acids are deleted and/or substituted and/or added at any position in the same sequence and in the 1 to 9 amino acid sequence. It means that there is a deletion and/or substitution and/or addition of five amino acids (amino acid residues), and two or more of deletions, substitutions, and additions may occur simultaneously.
The polypeptide (b) above preferably has 1 to 8 (more preferably 1 to 7, 1 The sequence consists of a sequence in which ~6, 1-5, or 1-4, more preferably 1-3, 1-2, or 1) amino acids are deleted and/or substituted and/or added.

As the polypeptide of (b) above, for example, in the amino acid sequence shown in (b1) SEQ ID NO: 2, 1 to 6 amino acids selected from the group consisting of the following (i) to (vi) are other amino acids. Preferably, the polypeptide consists of an amino acid sequence substituted with , and has the ability to excrete sulfite.
(i) Alanine at position 52, (ii) Alanine at position 61, (iii) Asparagine at position 90, (iv) Alanine at position 122, (v) Proline at position 157, and (vi) Tyrosine at position 164.

Other amino acids to which the amino acids (i) to (vi) above are substituted are not particularly limited. As an example of the amino acid sequence of the polypeptide (b1), in the amino acid sequence shown in SEQ ID NO: 2, (i-1) substitution of alanine at position 52 with threonine (A52T), (ii-1) alanine at position 61 (A61T), (iii-1) Substitution of asparagine at position 90 with serine (N90S), (iv-1) Substitution of alanine at position 122 with serine (A122S), (v-1) 1 selected from the group consisting of (i-1) to (vi-1) of substitution of proline at position 157 with serine (P157S) and (vi-1) substitution of tyrosine at position 164 with histidine (Y164H) Amino acid sequences with ˜6 substitutions are mentioned.

Examples of preferred embodiments of the polypeptide (b1) include the following polypeptides (b1-1) and (b1-2).
(b1-1) In the amino acid sequence shown in SEQ ID NO: 2, alanine at position 52 is threonine, asparagine at position 90 is serine, alanine at position 122 is serine, proline at position 157 is serine, and position 164 is A polypeptide consisting of an amino acid sequence in which tyrosine is replaced with histidine (a polypeptide consisting of an amino acid sequence having the amino acid substitutions A52T, N90S, A122S, P157S, and Y164H in the amino acid sequence shown in SEQ ID NO: 2)
(b1-2) In the amino acid sequence shown in SEQ ID NO: 2, the 52nd alanine is threonine, the 61st alanine is threonine, the 90th asparagine is serine, the 122nd alanine is serine, and the 157th alanine is serine. A polypeptide consisting of an amino acid sequence in which proline is replaced with serine and tyrosine at position 164 is replaced with histidine (in the amino acid sequence shown in SEQ ID NO: 2, the amino acid substitutions are A52T, A61T, N90S, A122S, P157S, and Y164H) polypeptide consisting of an amino acid sequence)
The amino acid sequences (b1-1) and (b1-2) are those of ScSSU1 derived from Saccharomyces cerevisiae.

In the amino acid sequence having 90% or more identity to the amino acid sequence shown in SEQ ID NO: 2 in (c) above, the identity (sequence identity) is preferably 92% or more, more preferably 95% or more, More preferably, it is 96% or more, even more preferably 97% or more, particularly preferably 98% or more, and most preferably 99% or more.
In the polypeptide (c) above, the amino acid located at the 19th position of SEQ ID NO: 2 in its amino acid sequence is preferably an amino acid other than the non-polar amino acid (X), and is an amino acid other than valine. is more preferable. In one aspect, the amino acid sequence of the polypeptide (c) above has 90% or more identity to the amino acid sequence of SEQ ID NO: 2, and corresponds to the 19th amino acid sequence of SEQ ID NO: 2. Preferably, the amino acid sequence is methionine.

Sequence identity of amino acid sequences and base sequences can be determined using the algorithm BLAST (Basic Local Alignment Search Tool) by Carlin and Arthur (Proc. Natl. Acad. Sci. USA 872264-2268, 1990; Proc Natl. Acad. Sci. USA) 90:5873, (1993). When using BLAST, the default parameters for each program can be used.

In one embodiment, the mutant polypeptide of the present invention is, for example, (a) a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, or (b1) the amino acid sequence shown in SEQ ID NO: 2, in which the above (i) to ( vi) in a polypeptide consisting of an amino acid sequence in which 1 to 6 amino acids selected from the group consisting of Preferred are mutant polypeptides in which a certain amino acid is replaced with a nonpolar amino acid (X) (preferably valine). In the polypeptide (a) or (b1) above, a mutant polypeptide consisting of an amino acid sequence in which the amino acid at the 19th position of SEQ ID NO: 2 is substituted with a nonpolar amino acid (X) is Preferable from the viewpoint of improving discharge ability.
In one embodiment, the mutant polypeptide of the present invention is preferably not a polypeptide consisting of the amino acid sequences shown in SEQ ID NOs: 37-46. It is also preferable that the mutant polypeptide of the present invention is not the following polypeptide in which glutamine at position 251 and/or arginine at position 291 in the amino acid sequence shown in SEQ ID NO: 39 is substituted with another amino acid.
A polypeptide consisting of an amino acid sequence in which the 251st glutamine in the amino acid sequence shown in SEQ ID NO: 39 is replaced with any amino acid other than glutamine; In the amino acid sequence shown in SEQ ID NO: 39, the 291st arginine is Polypeptide consisting of an amino acid sequence substituted with any amino acid; In the amino acid sequence shown in SEQ ID NO: 39, glutamine at position 251 is substituted with any amino acid other than glutamine, and arginine at position 291 is replaced with any amino acid other than arginine. A polypeptide consisting of an amino acid sequence substituted with

For example, in the polypeptide (a) above, a mutant polypeptide in which the amino acid at the 19th position of SEQ ID NO: 2 is substituted with a nonpolar amino acid (X) has the amino acid sequence shown in SEQ ID NO: 2. It can also be expressed as a mutant polypeptide consisting of an amino acid sequence in which the 19th methionine is replaced with a nonpolar amino acid (X).
In the polypeptide (b) above, a mutant polypeptide in which the amino acid at the position corresponding to the 19th position of SEQ ID NO: 2 is substituted with valine is a mutant polypeptide in which the methionine at the 19th position of the amino acid sequence shown in SEQ ID NO: 2 is substituted with valine. Consists of an amino acid sequence in which 1 to 9 amino acids are deleted and/or substituted and/or added in a region other than the 19th position in the amino acid sequence substituted with a polar amino acid (X), and has sulfite excretion ability. It can also be expressed as a mutant polypeptide having the following.
In the polypeptide (c) above, the mutant polypeptide in which the amino acid at the position corresponding to the 19th position of SEQ ID NO: 2 is substituted with valine has 90% or more of the amino acid sequence shown in SEQ ID NO: 2. It consists of an amino acid sequence in which the amino acid at the position corresponding to methionine at position 19 of the amino acid sequence shown in SEQ ID NO: 2 is replaced with a non-polar amino acid (X), and has the ability to excrete sulfite. It can also be expressed as a mutant polypeptide having the following.

From the viewpoint of improving sulfite excretion ability, the mutant polypeptide of the present invention has a methionine in which the amino acid at the position corresponding to leucine at position 259 in the amino acid sequence shown in SEQ ID NO: 2 is methionine, and/or Preferably, the amino acid located at the position corresponding to serine at position 423 in the amino acid sequence shown is leucine. More preferably, the amino acid at the 259th position in the amino acid sequence shown in SEQ ID NO: 2 is methionine, and the amino acid at the 423rd position in the amino acid sequence shown in SEQ ID NO: 2 is leucine. be.
As such a mutant polypeptide, in the polypeptide (b) or (c) above, the amino acid at the position corresponding to the 19th methionine in the amino acid sequence shown in SEQ ID NO: 2 is a non-polar amino acid (X). As a substituted mutant polypeptide, the amino acid at the position corresponding to leucine at position 259 is methionine, and/or the amino acid at the position corresponding to serine at position 423 is leucine. can be mentioned.
The above-mentioned mutant polypeptide is the non-mutant polypeptide according to any one of (a) to (c) above, in which the amino acid at the position corresponding to position 19 of SEQ ID NO: 2 is substituted with a non-polar amino acid (X), It can also be described as a mutant polypeptide in which the amino acid at the position corresponding to leucine at position 259 is replaced with methionine, and/or the amino acid at the position corresponding to serine at position 423 is replaced by leucine. .
As shown in the Examples below, in SbSSU1, valine at the position corresponding to position 19 of SEQ ID NO: 2 contributes to high sulfite excretion ability, but valine at the position corresponding to position 259 of SEQ ID NO: 2 contributes to high sulfite excretion ability. When the certain amino acid is methionine and/or the amino acid at the position corresponding to the 423rd serine is leucine, the sulfite excretion ability is further improved.
From the viewpoint of improving sulfite excretion ability, it is preferable that the amino acid at the position corresponding to the 259th position of the amino acid sequence shown in SEQ ID NO: 2 is methionine, and the amino acid at the position corresponding to the 259th position is preferably methionine. It is more preferable that the amino acid that is methionine and is located at the position corresponding to serine 423 is leucine.

In one embodiment, from the viewpoint of improving sulfite excretion ability, the mutant polypeptide of the present invention corresponds to the 19th methionine of the amino acid sequence shown in SEQ ID NO: 2 in the polypeptide (a) or (b1) above. The amino acid at the position corresponding to position 259 is substituted with a nonpolar amino acid (X), and the amino acid at the position corresponding to leucine at position 259 is replaced with methionine, and/or the amino acid at the position corresponding to position 423 is replaced with methionine. Also preferred are variant polypeptides in which leucine is substituted. Preferred embodiments of the polypeptide (b1) are as described above.

The mutant polypeptide of the present invention can be produced, for example, by known genetic engineering techniques or synthetic techniques. For example, in a production method using genetic engineering techniques, host cells transformed with an expression vector containing DNA encoding the amino acid sequence of a mutant polypeptide are cultured, and the target polypeptide is collected from the culture. The mutant polypeptide of the present invention can be obtained by this method. Extraction and purification of mutant polypeptides from transformed cells and the like, or production of synthetic polypeptides, may be performed according to methods known per se. Moreover, the mutant polypeptide of the present invention is produced by modifying the above-mentioned non-mutant polypeptide and substituting the amino acid at the position corresponding to position 19 of SEQ ID NO: 2 with a non-polar amino acid (X). be able to. From the viewpoint of improving sulfite excretion ability, when the amino acid corresponding to position 259 of SEQ ID NO: 2 of the non-mutated polypeptide is an amino acid other than methionine, it is preferable that the amino acid is further substituted with methionine. When the amino acid corresponding to position 423 of SEQ ID NO: 2 of the non-mutated polypeptide is an amino acid other than leucine, it is preferable to substitute the amino acid with leucine. Such amino acid substitutions can be performed by known site-directed mutagenesis methods. The mutant polypeptide of the present invention can also be isolated from yeast obtained by the method described below for producing yeast with high sulfite-producing ability by introducing mutations into yeast.

Polynucleotides encoding mutant polypeptides of the invention are also encompassed by the invention. As used herein, polynucleotide means DNA or RNA. The polynucleotide is preferably DNA. The polynucleotide encoding the mutant polypeptide of the present invention (hereinafter also simply referred to as the polynucleotide of the present invention) may be a polynucleotide encoding only the mutant polypeptide, and may encode an untranslated region and a signal peptide. It may also include an area where A polynucleotide encoding a mutant polypeptide of the invention may be a cDNA. The polynucleotide encoding the mutant polypeptide of the present invention can also be referred to as a mutant sulfite transporter gene.

The polynucleotide of the present invention can be obtained by known genetic engineering techniques or known synthetic techniques. The base sequence of the polynucleotide of the present invention can be designed, for example, by substituting corresponding codons based on the amino acid sequence of the mutant polypeptide.

The polynucleotide of the present invention is located, for example, at a position corresponding to position 19 of SEQ ID NO: 2 in the base sequence of the polynucleotide encoding the non-mutant polypeptide (hereinafter also referred to as non-mutant polynucleotide). It can also be prepared by introducing a mutation in which a base sequence encoding an amino acid is substituted with a base sequence encoding a nonpolar amino acid (X).
The non-mutated polynucleotide may be any polynucleotide encoding any of the polypeptides (a) to (c) above. Specifically, the non-mutated polynucleotide is a polynucleotide encoding the amino acid sequence shown in SEQ ID NO: 2; A polynucleotide consisting of an amino acid sequence with deletions, substitutions, and/or additions and encoding a polypeptide having sulfite excretion ability; 90% or more identical to the amino acid sequence shown in SEQ ID NO: 2 Examples include polynucleotides that encode polypeptides that are composed of amino acid sequences that have a sulfite excretion ability and have the ability to excrete sulfite.

The base sequence shown in SEQ ID NO: 1 is the base sequence of a polynucleotide encoding the amino acid sequence shown in SEQ ID NO: 2 in (a) above. For example, as a base sequence of a polynucleotide encoding a mutant polypeptide in which the amino acid at the position corresponding to position 19 of SEQ ID NO: 2 in the polypeptide (a) is substituted with valine, the base shown in SEQ ID NO: 1 is used. In the sequence, the base sequence encoding methionine at position 19 (atg at positions 55 to 57) of the amino acid sequence of SEQ ID NO: 2 was replaced with the base sequence encoding valine after substitution (gtc, gta, gtg, or gtt). Examples include base sequences.
By expressing the polynucleotide of the present invention having such a base sequence, the above-mentioned mutant polypeptide of the present invention can be obtained. The method of introducing a desired mutation into a non-mutated polynucleotide is not particularly limited, and any site-specific mutagenesis method, for example, mutation introduction by PCR such as inverse PCR method, etc. can be used.

Non-mutated polynucleotides can be obtained, for example, from yeast by known methods. For example, in the case of a polynucleotide encoding the non-mutated polypeptide of SEQ ID NO: 2, genomic DNA is extracted from yeast and the target base is extracted by PCR using primers designed based on the nucleotide sequence of SEQ ID NO: 1. A polynucleotide encoding the amino acid sequence shown in SEQ ID NO: 2 can be obtained by amplifying a polynucleotide having the sequence and further purifying the amplified polynucleotide. In addition, a non-mutated polynucleotide can be designed, for example, by substituting a corresponding codon based on the amino acid sequence of a non-mutated polypeptide.

The polynucleotide encoding the mutant polypeptide of the present invention can be used, for example, for producing a vector or yeast transformant that expresses the mutant polypeptide of the present invention, for modifying the sulfite-producing ability or sulfite-tolerance ability of yeast, It can be suitably used for evaluation of sulfite production ability or sulfite tolerance ability, selection of yeast with high sulfite production ability or sulfite tolerance ability, etc.

<Method for improving sulfite excretion ability of a polypeptide having sulfite excretion ability>
For any of the polypeptides (a) to (c) above, the amino acid at the position corresponding to the 19th position of SEQ ID NO: 2 in the amino acid sequence is selected from the group consisting of valine, alanine, isoleucine, glycine, and leucine. By introducing a mutation that substitutes any selected nonpolar amino acid (X), the sulfite excretion ability of the polypeptide can be improved compared to before introducing the mutation. Such a method is also part of the present invention. Such a mutation involves changing the amino acid at the position corresponding to position 19 of SEQ ID NO: 2 to a non-polar amino acid (X) in a polynucleotide encoding any of the polypeptides (a) to (c) above. This can be done by introducing a mutation that causes a substitution. Preferred embodiments of the nonpolar amino acid (X) are as described above, and valine is particularly preferred. In the above-mentioned non-mutated polypeptide, a mutation in which the amino acid at the position corresponding to position 19 of SEQ ID NO: 2 is replaced with a non-polar amino acid (X) is also referred to as a 19X mutation. From the perspective of improving sulfite excretion ability, in any of the polypeptides (a) to (c) above, in addition to the 19X mutation, the amino acid at the position corresponding to position 259 of the amino acid sequence shown in SEQ ID NO: 2, It is preferable to introduce a mutation that substitutes methionine and/or a mutation that substitutes leucine for the amino acid at the position corresponding to position 423. In the above-mentioned non-mutated polypeptide, the mutation in which the amino acid at the position corresponding to position 259 of SEQ ID NO: 2 is replaced with methionine is also referred to as the 259M mutation. In the non-mutant polypeptides (a) to (c) above, the mutation in which the amino acid at the position corresponding to position 423 of SEQ ID NO: 2 is replaced with leucine is also referred to as the 423L mutation. When the amino acid at the position corresponding to position 259 of SEQ ID NO: 2 in the polypeptides (a) to (c) is an amino acid other than methionine, it is preferable to introduce the 259M mutation. When the amino acid at the position corresponding to position 423 of SEQ ID NO: 2 in the polypeptides (a) to (c) is an amino acid other than leucine, it is preferable to introduce the 423L mutation.

<Yeast transformant>
The yeast transformant of the present invention has a methionine at position 19 of the amino acid sequence shown in SEQ ID NO: 2 in the above-mentioned mutant polypeptide of the present invention (the polypeptide according to any one of (a) to (c) above). A polynucleotide encoding a mutant polypeptide (in which the amino acid at the position corresponding to This is a yeast transformant into which a polynucleotide containing a portion of the polynucleotide has been introduced. In the yeast transformant of the present invention, a part of the polynucleotide encoding the mutant polypeptide (hereinafter also referred to as partial polynucleotide) corresponds to position 19 of SEQ ID NO: 2 in the mutant polypeptide. It is a polynucleotide containing a base sequence encoding the above-mentioned nonpolar amino acid (X) at the position. The non-polar amino acid (X) and its preferred embodiments are the same as above.
Such a yeast transformant is produced by introducing a polynucleotide containing the above-described polynucleotide of the present invention or a portion thereof into yeast. The number of polynucleotides to be introduced may be one, or two or more.

The partial polynucleotide includes a base sequence encoding a nonpolar amino acid (X) located at a position corresponding to position 19 of SEQ ID NO: 2 in the mutant polypeptide. The above-mentioned partial polynucleotide is a polynucleotide consisting of a partial sequence of the base sequence (base sequence encoding a mutant polypeptide) of the polynucleotide of the present invention. When the partial polynucleotide of the present invention is introduced into yeast expressing one or more of the non-mutant polypeptides (a) to (c), the non-mutant polynucleotide 19 of SEQ ID NO: 2 Any mutation may be used as long as it can produce a mutation (19X mutation) in which the amino acid at the position corresponding to the th position is replaced with a nonpolar amino acid (X). Such partial polynucleotides include, for example, the mutation to be introduced (the base sequence encoding the non-polar amino acid (X) at the position corresponding to position 19 of SEQ ID NO: 2 in the mutant polypeptide, and its upstream region). A polynucleotide having a length that allows homologous recombination to occur in the region encoding any of the polypeptides (a) to (c) in the yeast genome and a base sequence homologous to the region in the downstream region is preferred. Such a partial polynucleotide includes a base sequence encoding a nonpolar amino acid (X) (preferably valine) located at a position corresponding to position 19 of SEQ ID NO: 2 in the mutant polypeptide, and its upstream region. A polynucleotide having a base sequence of 15 to 50 bases (more preferably 17 to 30 bases, still more preferably 18 to 25 bases) in the upper and downstream regions is preferable.Such a polynucleotide can be prepared using known genetic engineering techniques or It can be obtained by known synthesis techniques.

In one aspect, when the yeast transformant of the present invention is introduced into yeast expressing one or more non-mutated polypeptides (a) to (c) above, in the non-mutated polypeptide, It is preferable to further include a polynucleotide capable of causing a mutation (259M mutation) in which the amino acid at the position corresponding to position 259 of SEQ ID NO: 2 is replaced with methionine. When the non-mutant polypeptide possessed by yeast has an amino acid other than methionine in the position corresponding to position 259 of SEQ ID NO: 2, it is preferable to include such a polynucleotide. Such polynucleotides include, for example, polynucleotides that include a part of the polynucleotide encoding the mutant polypeptide described above, and which include the amino acid located at the position corresponding to position 259 of SEQ ID NO: 2 in the mutant polypeptide. A polynucleotide having a base sequence encoding methionine and a base sequence of 15 to 50 bases (more preferably 17 to 30 bases, still more preferably 18 to 25 bases) in its upstream and downstream regions is preferred.

Furthermore, when the yeast transformant of the present invention is introduced into yeast expressing one or more of the non-mutant polypeptides (a) to (c), the non-mutant polypeptide has SEQ ID NO. It is also preferable to further include a polynucleotide capable of causing a mutation (423L mutation) in which the amino acid at the 423rd position of No. 2 is replaced with leucine. In the non-mutated polypeptide possessed by yeast, when the amino acid at the position corresponding to position 423 of SEQ ID NO: 2 is an amino acid other than leucine, it is preferable to include such a polynucleotide. Such polynucleotides include, for example, polynucleotides that include a part of the polynucleotide encoding the above mutant polypeptide, and which include the amino acid located at the position corresponding to position 423 of SEQ ID NO: 2 in the mutant polypeptide. A polynucleotide having a base sequence encoding leucine, and a base sequence of 15 to 50 bases (more preferably 17 to 30 bases, still more preferably 18 to 25 bases) in its upstream and downstream regions is preferred.

A polynucleotide comprising a polynucleotide encoding a mutant polypeptide of the present invention or a portion thereof may be a polynucleotide consisting of the polynucleotide of the present invention or a portion thereof. In addition, it may also contain other sequences, marker gene sequences, etc. that regulate the expression of polynucleotides introduced into yeast, which will be described later. The polynucleotide of the present invention or a polynucleotide containing a portion thereof can be directly introduced into yeast. Furthermore, the polynucleotide of the present invention or a portion thereof may be introduced into yeast using a vector (expression vector) into which the polynucleotide has been inserted. A vector containing the polynucleotide of the present invention or a portion thereof is suitably used for producing yeast transformants.

The vector into which the polynucleotide of the present invention or a part thereof is inserted is not particularly limited as long as it is a vector capable of expressing the introduced gene in yeast. For example, a multicopy plasmid (YEp type), a single copy plasmid (YCp Both YIp type) and chromosomal DNA integration type plasmids (YIp type) are available. For example, YEp type vectors include YEp51 (J.R. Broach et al., Experimental Manipulation of Gene Expression, Academic Press, New York, 83, 1983), and YCp type vectors include YEp51 (J.R. Broach et al., Experimental Manipulation of Gene Expression, Academic Press, New York, 83, 1983). Cp50 (M.D.Rose et al. YIp vectors include YIp5 (K. Struhl et al., Proc. Natl. Acad. Sci. USP, 76, 1035, 1979). These plasmids are commercially available and can be easily obtained. The vectors used in Examples can also be used.

The vector only needs to contain the polynucleotide of the present invention or a portion thereof so that it can be expressed in the host (yeast) into which it is introduced, and other configurations are not particularly limited. The vector may have other sequences that regulate the expression of the polynucleotide introduced into yeast, such as promoters, operators, enhancers, silencers, ribosome binding sequences, terminators, and the like. Furthermore, it may have a marker gene (selection marker) sequence for selecting a host into which the polynucleotide has been introduced. The promoter and terminator for constitutively expressing yeast genes from the early stage of fermentation are preferably those that function in yeast and are independent of the sulfite concentration in the fermentation liquid, but they may be used in any combination. For example, as a promoter, the promoter of glyceraldehyde 3-phosphate dehydrogenase (TDH3) gene, the promoter of phosphoglycerate kinase (PGK1) gene, etc. can be used. These promoters are known and easily available.

The method for introducing the polynucleotide or vector described above into host yeast for transformation may be carried out according to known methods. For example, an electroporation method, a spheroplast method, a lithium acetate method, a CRISPR-Cas method (eg, Woo et al., Nature Biotechnology 33, 1162-1164 (2015)), etc. can be used.
More specifically, for example, the host yeast is cultured in a standard yeast nutrient medium (for example, YEPD medium “Genetic Engineering, vol. 1, Plenum Press, New York, 117 (1979)”) with an OD600 nm value of 1 to 6. Cultivate it so that it becomes. The cultured yeast is collected by centrifugation, washed and pretreated with alkali metal ions, preferably lithium ions, at a concentration of about 1-2M. The cells are allowed to stand at about 30° C. for about 60 minutes, and then are allowed to stand at about 30° C. for about 60 minutes together with the polynucleotide (preferably DNA) or vector (about 1 to 20 μg) to be introduced. Polyethylene glycol (preferably about 4,000 Dalton polyethylene glycol) is added to a final concentration of about 20-50%. After standing at about 30°C for about 30 minutes, the cells are heat-treated at about 42°C for about 5 minutes. Preferably, the cell suspension is washed with standard yeast nutrient medium, placed in a predetermined amount of fresh standard yeast nutrient medium, and allowed to stand at about 30° C. for about 60 minutes. Thereafter, transformants are obtained by planting on a standard agar medium containing an antibiotic or the like used as a selection marker if necessary.
For other general cloning techniques, see "Molecular Cloning 3rd Edition", "Methods in Yeast Genitics, Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY)” etc.

As selection markers used during transformation, since auxotrophic markers are not available for brewer's yeast, G418 resistance gene (G418r), copper resistance gene (CUP1) "M. Marin et al., Proc. Natl. .Acad.Sci.USA, 81, p337, 1984", cerulenin resistance gene (fas2m, PDR4) ("Junji Inokoshi et al., Biochemistry, 64, p660, 1992", "M. Hussain et al., Gene, 101 , p149, 1991''), etc. are available.

When introducing the polynucleotide of the present invention or a portion thereof into a host yeast, the yeast used as the host is preferably a yeast that can be used for brewing. Examples of yeast that can be used for brewing include yeast for brewing beer, wine, sake, and the like. Any yeast widely used as brewer's yeast may be mentioned, such as yeast of the genus Saccharomyces. The yeast is preferably brewer's yeast, and more preferably Saccharomyces cerevisiae or Saccharomyces pastorianus. For example, brewer's yeast such as Saccharomyces cerevisiae NBRC1951, NBRC1952, NBRC1953, NBRC1954 and Saccharomyces pastorianus WH34/70 are suitable. Can be used. Among beer yeasts, top-fermenting yeasts are preferred. Examples of top-fermenting yeast include Saccharomyces cerevisiae. Top-fermenting yeast usually has a lower sulfite-producing ability than Saccharomyces pastorianus, but its sulfite-producing ability can be improved by introducing the above polynucleotide. Furthermore, whiskey yeast (for example, Saccharomyces cerevisiae NCYC90, etc.), wine yeast (for example, Japan Association for Wine No. 1, No. 3, No. 4, etc.), sake yeast (for example, Japan Association Yeast for Sake No. 7, No. 9, etc.) can be used as a host as well.

The yeast transformant of the present invention preferably produces the mutant polypeptide of the present invention by introducing a polynucleotide containing the polynucleotide of the present invention or a portion thereof. Such a yeast transformant can also be referred to as a yeast in which the expression of the mutant polypeptide of the present invention is enhanced by introduction of the polynucleotide described above.
For example, by culturing a yeast transformant into which a vector containing the polynucleotide of the present invention has been introduced in a medium in which yeast can grow, the polynucleotide of the present invention on the vector is expressed, and the mutant polynucleotide of the present invention is expressed. Peptides are produced. Further, in one embodiment, when the polynucleotide of the present invention or a portion thereof is introduced into yeast, the introduced polynucleotide and the polypeptide encoding any of the polypeptides (a) to (c) above in the genome of the yeast. Homologous recombination occurs between the regions. As a result, a mutation (19X mutation) is introduced in which the amino acid at the position corresponding to position 19 of SEQ ID NO: 2 in one or more of the polypeptides (a) to (c) above is replaced with a nonpolar amino acid (X). , yeast transformants with improved sulfite production ability, and yeast transformants with improved sulfite tolerance ability can be obtained. From the viewpoint of improving sulfite production ability and sulfite tolerance ability, in one embodiment, in addition to the above mutations, a 259M mutation and/or a 423L mutation is introduced in one or more of the polypeptides (a) to (c) above. It is preferable.
As described above, the mutant polypeptide of the present invention has a higher sulfite excretion ability than the non-mutant polypeptide. Therefore, a yeast transformant that produces the mutant polypeptide and contains the polypeptide usually has improved sulfite production ability and sulfite tolerance ability compared to the yeast (parent strain) before transformation. When such yeast transformants are used to produce alcoholic beverages, the sulfite concentration in the culture increases, making it possible to produce products with excellent flavor stability and the like.

From the viewpoint of improving the ability to produce sulfite, the yeast transformant of the present invention is preferably one that highly expresses the above-mentioned mutant polypeptide. Such yeast transformants include, for example, yeast transformants that have a promoter that highly expresses the mutant polypeptide (also referred to as a high expression promoter), a transcription factor that promotes the expression of the mutant polypeptide (hereinafter simply referred to as a promoter), Examples include yeast transformants with high activity of a transcription factor (referred to as a transcription factor), yeast transformants with high translation efficiency of polynucleotides encoding mutant polypeptides, and the like. The high-expression promoter may be any promoter that functions in yeast, and includes, for example, the TDH3 promoter. For example, a yeast transformant that highly expresses the mutant polypeptide can be obtained by introducing into yeast a vector in which a polynucleotide encoding the mutant polypeptide is placed downstream of a high-expression promoter. Examples of yeast transformants with high transcription factor activity include yeast transformants having highly active transcription factors with high transcription promoting activity. Examples of transcription factors include the FZF1 protein encoded by the FZF1 gene (Avram D, et al. (1999) Yeast 15(6):473-80). For example, when the activity of FZF1 protein is high in a yeast transformant, a mutant polypeptide is highly expressed. Examples of yeast transformants with high activity of FZF1 protein include transformants with highly active FZF1 protein that has higher transcriptional promotion activity than wild-type FZF1 protein. As an example of a highly active FZF1 protein, a mutant FZF1 protein (FZF1-C162Y) has a sequence (SEQ ID NO: 66) in which the 162nd cysteine in the wild-type FZF1 protein amino acid sequence (SEQ ID NO: 64) is replaced with tyrosine. can be mentioned.

From the viewpoint of improving the ability to produce sulfite, the yeast transformant of the present invention preferably has suppressed reduction of sulfite. When the reduction of sulfite is suppressed, the amount of sulfite, which is a substrate for the mutant polypeptide, increases in yeast cells, leading to an improvement in the ability to produce sulfite. Suppression of sulfite reduction in yeast can be performed by known methods. For example, the expression of polypeptides involved in the sulfite reduction pathway can be suppressed. Examples of polypeptides involved in the sulfite reduction pathway include the polypeptide encoded by MET5 and the polypeptide encoded by MET10, which are involved in the methionine synthesis pathway (Masselot M and De Robichon-Szulmajster H (1975) Mol Gen Genet 139(2):121-32). Suppression of the expression of such a polypeptide can be performed by suppressing the expression of a gene encoding the polypeptide using a known method. Examples of yeast transformants in which sulfite reduction is suppressed include yeast transformants in which the expression of polypeptides involved in the sulfite reduction pathway is suppressed (preferably partially suppressed). .
The yeast transformant of the present invention may be obtained using yeast having the above-mentioned highly expressed transcription factor, yeast in which sulfite reduction is suppressed, etc. as a host. Further, the yeast transformant may be obtained by introducing into yeast a mutation that causes high expression of the above-mentioned mutant polypeptide and/or a mutation that suppresses reduction of sulfite.

<Method for improving sulfite production ability of yeast and method for improving sulfite tolerance ability of yeast>
The method of improving the sulfite production ability of yeast (hereinafter also simply referred to as the method for improving sulfite production ability) and the method of improving the sulfite tolerance ability of yeast (hereinafter also simply referred to as the method for improving sulfite tolerance ability) of the present invention involves mutation in yeast. Including introducing.
In the method for improving sulfite production ability and the method for improving sulfite tolerance ability of the present invention, the above mutation is an amino acid shown in SEQ ID NO: 2 in one or more of the polypeptides (a) to (c) (non-mutated polypeptide). Contains a mutation (19X mutation) in which the amino acid at the position corresponding to methionine at position 19 of the sequence is replaced with any nonpolar amino acid (X) selected from the group consisting of valine, alanine, isoleucine, glycine, and leucine. .
The non-mutated polypeptides (a) to (c), the nonpolar amino acids (X), and preferred embodiments thereof are as described above. The polypeptide to be mutated may be one of (a) to (c), or two or more. When the above mutation is introduced into yeast, the mutant polypeptide of the present invention is produced in the yeast. A mutant polypeptide usually has a higher sulfite excretion ability than a non-mutant polypeptide before mutation is introduced. Therefore, the yeast into which the above mutation has been introduced has improved (higher) sulfite production ability compared to before the mutation was introduced. Furthermore, the yeast into which the above mutation has been introduced has improved (higher) sulfite tolerance ability compared to before the mutation was introduced. By introducing the above mutations into yeast, it is possible to produce yeast with improved sulfite production ability or yeast with improved sulfite tolerance ability compared to before introduction of the mutation. From the viewpoint of improving sulfite production ability or sulfite tolerance ability, it is preferable that the above mutations further include a 259M mutation and/or a 423L mutation. That is, it is preferable to further introduce the 259M mutation and/or the 423L mutation into the above polypeptide. From the viewpoint of improving sulfite production ability or sulfite tolerance ability, it is more preferable to introduce the 259M mutation, and it is even more preferable to introduce the 259M mutation and the 423L mutation. In the non-mutated polypeptide, when the amino acid at position 259 of SEQ ID NO: 2 is an amino acid other than methionine, it is preferable to introduce the 259M mutation. In the non-mutated polypeptide, when the amino acid at position 423 of SEQ ID NO: 2 is an amino acid other than leucine, it is preferable to introduce the 423L mutation.

The yeast into which mutations are introduced is not particularly limited, and brewer's yeast and the like used as hosts when obtaining the above-mentioned yeast transformants are preferably used. The yeast is preferably brewer's yeast, more preferably top-fermenting yeast. By introducing the above mutations, the sulfite production ability and sulfite tolerance ability of top-fermenting yeast can be effectively improved. Therefore, the method of the present invention is suitably used for improving the sulfite production ability of top fermenting yeast or improving the sulfite tolerance ability of top fermenting yeast. In one embodiment, the yeast into which mutations are introduced is preferably a yeast containing one or more of the polypeptides (a) to (c) above, more preferably a brewer's yeast containing the polypeptide, and even more preferably a top-fermenting yeast.

The method for introducing a mutation is not particularly limited as long as it can produce a polypeptide into which the mutation has been introduced (the above-mentioned mutant polypeptide of the present invention) in yeast.
For example, the mutation may be introduced into a polynucleotide encoding any of the polypeptides (a) to (c) above by introducing a non-polar amino acid (X) at the position corresponding to the 19th position of SEQ ID NO: 2. This can be done by introducing a mutation that causes a substitution. Preferably, the above-mentioned polynucleotide contains a mutation that causes a substitution of methionine for the amino acid at position 259 of SEQ ID NO: 2, and/or a mutation that causes a substitution of leucine for the amino acid at position 423 of SEQ ID NO: 2. Introducing further mutations that cause the substitution of . For example, known genetic engineering techniques can be appropriately used to introduce such mutations. Furthermore, for the introduction of mutations, a method of subjecting yeast to mutation treatment, a method of inducing natural mutations in yeast, etc. can be used.

Genetic engineering techniques for introducing mutations are not particularly limited. Examples include the method of introducing a polynucleotide containing the above-described polynucleotide of the present invention (polynucleotide encoding a mutant polypeptide) or a portion thereof (the above-mentioned partial polynucleotide), the CRISPR/Cas9 system, and the like. The CRISPR/Cas9 system can introduce mutations at specific sites.
The introduction of the above mutation is preferably carried out, for example, by introducing the above-described polynucleotide of the present invention or a polynucleotide containing a portion thereof into yeast. The number of polynucleotides to be introduced may be one, or two or more.
In one embodiment, when the polynucleotide of the present invention or a portion thereof is introduced into yeast, the introduced polynucleotide and the region encoding the polypeptide of any one of (a) to (c) above in the yeast genome Homologous recombination occurs between them, and a mutation (19X mutation) can be introduced in which the amino acid at the position corresponding to position 19 of SEQ ID NO: 2 of the polypeptide is replaced with a nonpolar amino acid (X). The 259M mutation and 423L mutation can also be introduced in a similar manner. Introducing the above mutation also includes introducing the polynucleotide of the present invention into yeast and expressing a mutant polypeptide encoded by the polynucleotide.
The above mutation can be introduced into yeast by introducing the polynucleotide of the present invention or a polynucleotide containing a portion thereof into yeast directly or by inserting it into the above-mentioned vector and transforming the yeast. The polynucleotides and vectors to be introduced into yeast, the methods for their introduction, etc. are the same as those used for producing the yeast transformants described above.
As a method for introducing the above mutation using a part of the polynucleotide of the present invention, the CRISPR/Cas9 system etc. can also be used. The polynucleotide of the present invention used for introducing mutations and a portion thereof can be obtained by methods such as the above-mentioned PCR-based mutation introduction method.

Mutation treatment is carried out by physical methods such as ultraviolet irradiation, high energy beam irradiation such as radiation (gamma rays, etc.); EMS (ethyl methanesulfonate), nitrous acid (Applied Microbiology Revised Edition, co-edited by Murai and Arai Any method may be used, such as a chemical method using a chemical treatment such as Baifukan), N-methyl-N-nitrosoguanidine, or sodium azide.
Examples of methods for inducing natural mutations include a method of inducing mutations by culturing yeast in a medium with a high sulfite concentration (for example, sulfite concentration of 0.5 to 5 mM).

After introducing the above-mentioned mutation into yeast (for example, after introducing the above-mentioned polynucleotide, after mutation treatment, or after inducing mutation), it is preferable to select yeast into which the mutation has been introduced. The selection method is not particularly limited, and for example, yeast into which a mutation has been introduced can be selected by culturing in a selection medium (eg, 0.5 to 5 mM). In one embodiment, yeast that can grow on the above selection medium can be selected as yeast into which a mutation has been introduced.

The introduction of the above mutation into yeast can be confirmed by, for example, PCR method. For example, by extracting genomic DNA from yeast and using primers or probes designed based on the base sequence of the polynucleotide encoding the mutant polypeptide of the present invention, the mutant polypeptide of the present invention is encoded in the yeast genome. The presence or absence of a polynucleotide or a sequence specific to the polynucleotide (preferably a sequence containing a base sequence encoding the amino acid located at the 19th position of SEQ ID NO: 2) is examined. In addition to the above-mentioned specific sequences, in addition to the sequence encoding the amino acid at position 19 of SEQ ID NO: 2, the sequence encoding the amino acid at position 259 and/or 423 of SEQ ID NO: 2 It is also preferable to check for the presence of a sequence containing a base sequence encoding an amino acid at a certain position. Yeast in which the presence of the polynucleotide of the present invention or a sequence specific to the polynucleotide has been confirmed has the above mutation introduced therein, and has improved sulfite production ability and sulfite tolerance ability. A known method can be used to confirm the presence of a polynucleotide containing a desired base sequence using primers or probes. As such a method, the method described in the yeast evaluation method described below can be used. Yeast into which mutations have been introduced can be suitably used as yeast with improved sulfite production ability or yeast with improved sulfite tolerance ability.

Since the ability to produce sulfite and the ability to tolerate sulfite are improved, the yeast into which the mutation has been introduced is preferably one that highly expresses the mutant polypeptide. Further, it is preferable that the yeast into which the above mutation is introduced has suppressed sulfite reduction. In yeast in which sulfite reduction is suppressed, the amount of sulfite, which is a substrate for the mutant polypeptide, increases in the yeast cells, resulting in improved sulfite production ability.
Examples of yeast that highly express the mutant polypeptide include yeast that has a high expression promoter as the promoter of the mutant polypeptide described above, yeast that has high transcription factor activity, and the like. Examples of yeast in which sulfite reduction is suppressed include yeast in which the expression of polypeptides involved in the sulfite reduction pathway described above is suppressed.
In the present invention, yeast that highly expresses the mutant polypeptide or yeast in which sulfite reduction is suppressed may be used as the yeast into which the mutation is introduced. Alternatively, the mutant polypeptide may be highly expressed by introducing into yeast a mutation that causes the mutant polypeptide to be highly expressed. A mutation that suppresses sulfite reduction may be introduced into yeast.

Examples of methods for introducing a mutation that causes high expression of the mutant polypeptide include methods such as introducing the above-mentioned high expression promoter into yeast and introducing a mutation that increases the activity of a transcription factor. Examples of methods for increasing the activity of transcription factors in yeast include methods such as introducing highly active transcription factors. Examples of methods for introducing mutations that suppress sulfite reduction include methods of suppressing the expression of polypeptides involved in the sulfite reduction pathway described above. These mutations can be introduced by known methods. For example, the expression of a polypeptide involved in the sulfite reduction pathway can be suppressed by suppressing the expression of a gene encoding the polypeptide. Examples of the highly expressed promoter, transcription factor, highly active transcription factor, and polypeptide involved in the sulfite reduction pathway include those mentioned above.

<Method for producing yeast with improved sulfite production ability and method for producing yeast with improved sulfite tolerance>
The method of producing yeast with improved sulfite production ability and the method of producing yeast with improved sulfite tolerance of the present invention includes introducing mutations into yeast. The method of producing yeast with improved sulfite production ability and the method of producing yeast with improved sulfite tolerance of the present invention are also collectively referred to as the method of producing yeast of the present invention.
The above-mentioned mutation in the yeast production method of the present invention is carried out at the 19th methionine of the amino acid sequence shown in SEQ ID NO: 2 in one or more of the polypeptides (a) to (c) described above (non-mutated polypeptide). It includes a mutation (19X mutation) in which the amino acid at the corresponding position is replaced with any nonpolar amino acid (X) selected from the group consisting of valine, alanine, isoleucine, glycine, and leucine. The polypeptide to be mutated may be one of (a) to (c), or two or more. The non-mutated polypeptide, the non-polar amino acid (X) and preferred embodiments thereof are as described above. The mutations introduced into yeast and their preferred embodiments are the same as the mutations introduced into yeast and their preferred embodiments in the method for improving the sulfite production ability of yeast described above. From the viewpoint of improving sulfite production ability or sulfite tolerance ability, it is preferable that the above mutations further include a 259M mutation and/or a 423L mutation. The method for introducing mutations into yeast is the same as the method for introducing mutations in the method for improving sulfite production ability of yeast described above. The yeast into which mutations are introduced can be the same as those mentioned above, and is preferably a top-fermenting yeast.
Since the ability to produce sulfite and the ability to tolerate sulfite are improved, the yeast into which the mutation has been introduced is preferably one that highly expresses the mutant polypeptide. Further, it is preferable that the yeast into which the above mutation is introduced has suppressed sulfite reduction.

In the method for producing yeast of the present invention, similarly to the method for improving sulfite production ability described above, it is preferable to introduce a mutation and then select yeast into which the mutation has been introduced.
By introducing the above mutation into yeast, it is possible to produce yeast with improved (higher) sulfite production ability compared to before the mutation was introduced. Yeast with improved sulfite production ability has improved sulfite excretion ability compared to before mutation introduction, and therefore has improved sulfite tolerance.

<Method for producing alcoholic beverages>
A yeast containing the mutant polypeptide of the present invention or a polynucleotide encoding it and suitable for brewing alcoholic beverages is preferably used for producing alcoholic beverages. By using such yeast in the production of alcoholic beverages, it is possible to increase the sulfite content in desired alcoholic beverages. The mutant polypeptide and the polynucleotide encoding it, as well as preferred embodiments thereof, are the same as described above. The yeast containing the mutant polypeptide of the present invention or the polynucleotide encoding the same can be used, for example, against yeast (preferably yeast suitable for brewing alcoholic beverages) with one or more of the polypeptides (a) to (c) above. In the peptide, the amino acid at the position corresponding to the 19th methionine of the amino acid sequence shown in SEQ ID NO: 2 is replaced with any nonpolar amino acid (X) selected from the group consisting of valine, alanine, isoleucine, glycine, and leucine. It can be obtained by introducing a mutation that replaces . In a preferred embodiment, a 259M mutation and/or a 423L mutation is further introduced into the polypeptide.
When the yeast into which the above mutation has been introduced (for example, the yeast obtained by the yeast production method of the present invention described above) is used in the production of alcoholic beverages, the sulfite content can be increased in the desired alcoholic beverage. Yeast evaluated to have a high sulfite-producing ability by the yeast evaluation method described below, and yeast selected by the yeast selection method with a high sulfite-producing ability or sulfite tolerance ability described below, can also be suitably used in the production of alcoholic beverages. Can be done. Alcoholic beverages are not particularly limited, but include, for example, beer, wine, whiskey, sake, etc., with beer being preferred. When producing these alcoholic beverages, each type can be produced by a known method, except that the yeast obtained in the present invention is used instead of the yeast before mutation introduction. According to the present invention, alcoholic beverages with a high sulfite content and excellent flavor stability can be produced using existing raw materials, facilities, and the like.
Furthermore, when the yeast is a yeast that highly expresses the mutant polypeptide and/or has suppressed sulfite reduction, the sulfite production ability becomes higher as described above. Therefore, when such yeast is used in the production of alcoholic beverages, it becomes possible to further increase the sulfite content of the alcoholic beverage. The yeast that highly expresses the mutant polypeptide and the yeast that suppresses sulfite reduction are the same as those described above.

The present invention also includes a method for producing beer that includes a step of fermenting wort with yeast containing the above-described mutant polypeptide of the present invention or a polynucleotide encoding the same. By using such yeast, the sulfite content in beer can be increased. The yeast may be any yeast that can be used for beer production, including the above-mentioned brewer's yeast, preferably top-fermenting yeast. The yeast containing the mutant polypeptide of the present invention or the polynucleotide encoding it may be the yeast transformant of the present invention described above.
In one embodiment, when beer is produced by top fermentation using a top-fermenting yeast containing the mutant polypeptide of the present invention or a polynucleotide encoding it, ale beer (top-fermenting beer) with a high sulfite content is produced. is possible. In one aspect of the present invention, for example, it is possible to produce ale beer containing 1 ppm or more (preferably 2 ppm or more, more preferably 2.5 ppm or more) of sulfite derived from yeast. Ale beer refers to beer produced by top fermentation using top fermenting yeast. The temperature for top fermentation is usually 10°C or higher, preferably 15-30°C, more preferably 18-25°C.
In the present invention, the sulfite content of beer refers to the total amount of sulfites (total value of free and bound sulfites) converted to the amount of SO ₂ measured by the Rankine method (aeration-oxidation method). In the present invention, ppm is ppm (w/v).

<Ale beer>
Ale beer containing 1 ppm or more of sulfite is also part of the present invention. Beer containing 1 ppm or more of sulfite and labeled as "ale" is also part of the present invention. Beer labeled with "ale" is usually ale beer. Ale beer containing 1 ppm or more of sulfites can be produced, for example, by using top-fermenting yeast containing the above-described mutant polypeptide of the present invention or a polynucleotide encoding it in the production of ale beer.

Ale beer containing 1 ppm or more of sulfite has a higher sulfite content than conventional ale beer, and has the effects of excellent flavor stability and long quality retention period. From the viewpoint of improving flavor stability and quality retention period, the sulfite content of ale beer is preferably 2 ppm or more, more preferably 2.5 ppm or more, and even more preferably 3 ppm or more. From the viewpoint of beer flavor, the sulfite content of ale beer is preferably 20 ppm or less, more preferably 15 ppm or less.

<Yeast evaluation method and selection method>
The present invention also includes a method for evaluating the sulfite production ability or sulfite tolerance ability of yeast (also simply referred to as an evaluation method). The present invention also includes a method for selecting yeast with a high sulfite production ability or sulfite tolerance ability (also simply referred to as a yeast selection method).
In one embodiment, the yeast evaluation method and yeast selection method of the present invention include detecting or measuring the expression of the mutant polypeptide of the present invention in a test yeast. Since the mutant polypeptide of the present invention has a higher sulfite excretion ability than the non-mutant polypeptide, yeast in which expression of the mutant polypeptide is detected has a higher sulfite production ability than yeast in which expression of the mutant polypeptide is not detected. It can be said that it has high sulfite tolerance. Furthermore, it can be said that yeast that expresses a large amount of the mutant polypeptide have a higher ability to produce sulfite and to tolerate sulfite than yeast that express a smaller amount of the mutant polypeptide. Expression of a mutant polypeptide can be detected or measured, for example, by detecting or measuring the expression of a polynucleotide encoding the mutant polypeptide.

In the present invention, the sulfite production ability and sulfite excretion ability of the yeast can be evaluated by detecting or measuring the expression of a polynucleotide encoding the mutant polypeptide of the present invention in the test yeast. The present invention also includes a method for evaluating the sulfite production ability or sulfite excretion ability of yeast, which includes detecting or measuring the expression of the polynucleotide of the present invention in such test yeast.
The expression of the polynucleotide can be detected or measured, for example, by detecting or quantifying the mRNA of the polynucleotide in the test yeast. Detection or quantification of mRNA can be performed by known techniques, such as Northern hybridization or quantitative RT-PCR. For example, a test yeast in which expression of a polynucleotide encoding a mutant polypeptide of the present invention is detected can be evaluated as having a higher sulfite-producing ability than a yeast in which the polynucleotide is not detected. Furthermore, the test yeast in which the expression of the polynucleotide is detected can be evaluated as having a higher ability to tolerate sulfite than yeast in which the polynucleotide is not detected. On the other hand, a test yeast in which the expression of the polynucleotide is not detected can be evaluated to have a lower sulfite-producing ability than a yeast in which the polynucleotide is detected. A yeast that has been evaluated to have a low sulfite production ability can also be evaluated to have a low sulfite tolerance ability. In one embodiment, detection or measurement of polynucleotide expression is preferably performed by measuring the expression level of the polynucleotide or the polypeptide encoded by the polynucleotide. Yeast that has been evaluated to have a high sulfite-producing ability is suitably used, for example, in the above-mentioned brewing of alcoholic beverages.

Further, by detecting or measuring the expression of a polynucleotide encoding a mutant polypeptide of the present invention in a test yeast, a yeast having a high sulfite production ability or a high sulfite tolerance ability can be selected. The present invention also includes a method for selecting yeast with high sulfite production ability or sulfite tolerance ability, which includes detecting or measuring the expression of the polynucleotide of the present invention in such test yeast. In one embodiment, the test yeast in which the expression of the polynucleotide is detected can be selected as a yeast with a high sulfite production ability or a yeast with a high sulfite tolerance ability. In another embodiment, a desired yeast can be selected by measuring the expression level of the polynucleotide in the reference yeast and the test yeast, and comparing the expression levels of the polynucleotide in the reference yeast and the test yeast. . For example, the expression level of the above-mentioned polynucleotide in the test yeast and the reference yeast is measured, and the test yeast with a higher expression level of the polynucleotide than the reference yeast is selected as a yeast with a high sulfite production ability or a yeast with a high sulfite tolerance ability. You can also.

The test yeast or reference yeast is a wild-type yeast, the above-mentioned yeast transformant of the present invention, yeast subjected to mutation treatment, naturally mutated yeast, or a mutation obtained by the above-mentioned yeast production method of the present invention. It may be any type of yeast or the like into which the yeast has been introduced. The yeast is preferably any yeast that can be used for brewing as described above, including yeasts of the genus Saccharomyces, and brewer's yeast is preferably used. Among these, top-fermenting yeast is preferred. The reference yeast and the test yeast may be selected in any combination from the above yeasts.

One embodiment of the method for detecting or measuring the expression of the polynucleotide of the present invention includes a method for detecting the polynucleotide or its specific sequence. Detection of the polynucleotide of the present invention or its specific sequence can be performed using primers or probes designed based on the base sequence of the polynucleotide of the present invention.
The present invention uses primers or probes designed based on the nucleotide sequence of the polynucleotide encoding the mutant polypeptide of the present invention (polynucleotide of the present invention) described above to improve the ability of yeast to produce sulfite or tolerate sulfite. It also includes methods of evaluation. The present invention also includes a method of selecting yeast with high sulfite production ability or sulfite tolerance ability using primers or probes designed based on the base sequence of the polynucleotide of the present invention.

General evaluation methods using primers or probes are known and are described, for example, in WO01/040514, JP-A-8-205900, and the like. An example of this evaluation method will be briefly described below.
First, genomic DNA of the yeast to be tested is prepared. Any known method can be used for the preparation, such as the Hereford method or the potassium acetate method (for example, Methods in Yeast Genetics, Cold Spring Harbor Laboratory Press, p130 (1990)). Targeting the obtained genomic DNA, primers or probes designed based on the base sequence (preferably the ORF sequence) of the polynucleotide of the present invention are used to inject the polynucleotide into the genome of the test yeast or specific to the polynucleotide. Check whether an array exists.
Primers or probes can be designed using known techniques.
As a sequence specific to the polynucleotide of the present invention, it encodes a partial sequence containing an amino acid (the above-mentioned nonpolar amino acid (X), preferably valine) located at the position corresponding to the 19th position of SEQ ID NO: 2 in the mutant polypeptide. Examples include base sequences. The test yeast in which the polynucleotide of the present invention or its specific sequence has been detected is evaluated to have high sulfite production ability and sulfite tolerance ability. Such a test yeast can be selected as a yeast with a high ability to produce sulfite or a yeast with a high ability to tolerate sulfite. From the viewpoint of selecting yeast with higher sulfite production ability and sulfite tolerance ability, in addition to the above base sequence, encodes a partial sequence containing the amino acid at the position corresponding to position 259 of SEQ ID NO: 2 in the mutant polypeptide. It is also preferable to detect a base sequence and/or a base sequence encoding a partial sequence containing the amino acid at position 423 of SEQ ID NO:2. The amino acid located at the 19th position of SEQ ID NO: 2 is a nonpolar amino acid (X) (preferably valine), and the amino acid located at the 259th position of SEQ ID NO: 2 is methionine and/or the 423rd position. When the amino acid at the position corresponding to is leucine, the yeast can be evaluated as having higher sulfite production ability and sulfite tolerance ability.

Detection of the polynucleotide of the present invention or its specific sequence can be performed using known techniques. For example, a polynucleotide containing part or all of a specific sequence or a polynucleotide containing a complementary base sequence to that base sequence is used as one primer, and the other primer is a polynucleotide containing a base sequence upstream or downstream of this sequence. Yeast nucleic acid is amplified by the PCR method using a polynucleotide containing part or all of the sequence, or a polynucleotide containing a complementary base sequence to the base sequence, and the presence or absence of the amplified product and the presence or absence of the amplified product are determined. Measuring molecular weight, etc. The number of bases in the polynucleotide used in the primer is preferably 10 or more bases, more preferably 15 to 25 bases. Further, the number of bases in the sandwiched portion is preferably 300 to 2000 bases. Furthermore, it is preferable that the sandwiched portion includes a base sequence encoding an amino acid located at the 19th position of SEQ ID NO:2. The reaction conditions of the PCR method are not particularly limited, but for example, conditions such as denaturation temperature: 90 to 95 °C, annealing temperature: 40 to 60 °C, extension temperature: 60 to 75 °C, number of cycles: 10 times or more may be used. Can be done. The resulting reaction products are separated by electrophoresis using an agarose gel or the like, and the molecular weights of the amplified products can be measured. By this method, the sulfite production ability and sulfite tolerance ability of the yeast can be predicted and/or evaluated depending on whether the molecular weight of the amplified product is large enough to include the DNA molecule of the specific portion. Furthermore, by analyzing the base sequence of the amplified product, it is possible to more accurately predict and/or evaluate the above performance.

The yeast with high sulfite-producing ability selected in the yeast selection method of the present invention is suitably used, for example, in brewing the above-mentioned alcoholic beverages. The selected yeast having a high ability to produce sulfite can also be selected as a yeast having a high ability to tolerate sulfite. Yeast with high sulfite tolerance is suitably used for brewing alcoholic beverages with high sulfite concentrations. Furthermore, by measuring the expression level of the polynucleotide encoding the mutant polypeptide of the present invention in the test yeast and selecting the test yeast with the expression level of the polynucleotide corresponding to the desired sulfite-producing ability, the desired sulfite-producing ability can be obtained. Yeast having a sulfite-producing ability suitable for brewing alcoholic beverages can also be selected.

EXAMPLES Hereinafter, the present invention will be explained in more detail with reference to Examples, but the scope of the present invention is not limited thereby.
The molecular biological techniques used in the examples followed the method described in Molecular Cloning (Sambrook et al., Cold Spring Harbor Laboratory Press, 2001), unless otherwise detailed.

<Example 1>
Extraction of candidate amino acids ScSSU1 of Saccharomyces cerevisiae S288C strain (hereinafter also referred to as S288C strain) is SbSSU1 (Sb type SSU) possessed by Saccharomyces pastorianus, a lager beer yeast. Sulfite encoded by one gene The sulfite excretion ability (sulfite excretion activity) is lower than that of polypeptides with excretion ability (polypeptides with excretion ability).
The amino acid sequence of ScSSU1 of S288C strain (SEQ ID NO: 2) and the amino acid sequence of SbSSU1 of Saccharomyces pastorianus WEIHENSTEPHAN 34/70 strain (also referred to as WH34/70 strain) (SEQ ID NO: 4) were aligned using ClustalW. , extracted candidate acid residues contributing to activity. As pairwise alignment parameters, open gap penalty=10.0 and extend gap penalty=0.1 (default parameters).
FIG. 1 is a diagram showing a sequence alignment of the amino acid sequence of SbSSU1 of the WH34/70 strain (upper row) and the amino acid sequence of ScSSU1 of the S288C strain (lower row).
As a result of alignment, it was found that SbSSU1 (SEQ ID NO: 4) and ScSSU1 (SEQ ID NO: 2) showed 79% (362 residues) sequence identity, and there were 96 different amino acid residues between them (Fig. 1).

<Example 2>
Creation of SSU1 mutants Among the different amino acid residues between SbSSU1 of SEQ ID NO: 4 and ScSSU1 of SEQ ID NO: 2, we focused on 11 amino acid residues (including continuous parts) and introduced SbSSU1 type amino acid substitution mutations into ScSSU1. went. The base sequence of the polynucleotide encoding ScSSU1 of SEQ ID NO: 2 is shown in SEQ ID NO: 1, and the base sequence of the polynucleotide encoding SbSSU1 of SEQ ID NO: 4 is shown in SEQ ID NO: 3.
(1) ScSSU1 mutant The following amino acid substitution mutations were introduced into the amino acid sequence shown in SEQ ID NO: 2 as the ScSSU1 mutant. Below, the non-mutated amino acid (amino acid residue in SEQ ID NO: 2 or 4 before substitution) is written before the number of the substitution position, and the amino acid after the mutation is written after the number of the substitution position, Mutations that substitute amino acids are described (amino acids are represented by one letter). For example, a mutation that replaces methionine at position 19 with valine is written as M19V.
(1-1) Single amino acid substitution mutant M19V (ScSSU1-M19V)
A52T (ScSSU1-A52T)
H89Y (ScSSU1-H89Y)
Y164H (ScSSU1-Y164H)
N175H (ScSSU1-N175H)
C194G (ScSSU1-C194G)
L258V (ScSSU1-L258V)
V269I (ScSSU1-V269I)
G390A (ScSSU1-G390A)
(1-2) Continuous mutation substitution mutant Substitute amino acids 110-124 with the sequence 110-124 of SbSSU1 of SEQ ID NO: 4 (ScSSU1(110-124))
Replacement of amino acids 198-216 with the sequence 198-216 of SbSSU1 of SEQ ID NO: 4 (ScSSU1(198-216))

(2) ScSSU1 mutant of Saccharomyces cerevisiae EOY001 strain (hereinafter referred to as EOY001 strain) ScSSU1 of EOY001 strain (hereinafter referred to as ScSSU1 (EOY001)) is the 52nd amino acid in the amino acid sequence shown in SEQ ID NO: 2. and 61st alanine becomes threonine (A52T, A61T), 90th asparagine becomes serine (N90S), 122nd alanine becomes serine (A122S), 157th proline becomes serine (P157S), 164th alanine becomes serine (P157S), It is a polypeptide consisting of an amino acid sequence in which tyrosine is replaced with histidine (Y164H). In the amino acid sequence of ScSSU1 (EOY001), a mutation (M19V) was introduced that replaced methionine at position 19 with valine.
M19V (ScSSU1(EOY001)-M19V)

(3) SbSSU1 mutant For the SbSSU1 mutant, the following amino acid substitution mutations were introduced into the amino acid sequence shown in SEQ ID NO: 4.
V19M (SbSSU1-V19M)

The following primer set (SEQ ID NOs: 5 to 34) was designed to incorporate DNA encoding SSU1 or SSU1 mutants into a yeast expression vector. Regarding mutation introduction by PCR, we followed Noguchi et al 2007 (Noguchi et al (2007) J. Biol. Chem. 282, 23581-23590.). ScSSU1 of SEQ ID NO: 2 and its mutants were made using the genomic DNA of the S288C strain as a template. SbSSU1 and its mutants were produced using genomic DNA of lager yeast WH34/70 strain as a template. Furthermore, for ScSSU1 (EOY001) and its mutants, the genomic DNA of the EOY001 strain was used as a template.

Typical PCR conditions are as follows.
The PCR reaction solution (50 μL) had a composition consisting of 1 μL of yeast genome (S288C strain, WH34/70 strain, or EOY001 strain), PrimestarMax Premix (2x) (TaKaRaBio), and 0.4 pmol/μL of each primer. The PCR reaction was performed at 95°C for 1 minute, followed by a total of 30 cycles of amplification, including reactions at 95°C for 15 seconds, 55°C for 10 seconds, and 72°C for 30 seconds. As a result of electrophoresing the PCR product on a 1.2% agarose gel and staining with ethidium bromide, it was confirmed that an amplified band of the estimated target size was obtained.

1. ScSSU1-TDH3pro-F CATTAATGCAGGTTGCGGCCGCATGGTTGCCAATTGGGTACTT (SEQ ID NO: 5)
2. ScSSU1-TDH3pro-R CGGGCATTTAAATGCGGCCGCTTATGCTAAACGCGTAAAATCTAGAG (SEQ ID NO: 6)
3. SbSSU1-TDH3pro-R CATTAATGCAGGTTGCGGCCGCATGGTCGCTAGTTGGATGCTC (SEQ ID NO: 7)
4. SbSSU1-TDH3pro-R GGGCATTTAAATGCGGCCGCTTATGTTAAATATGTACTATCGATAGCCG (SEQ ID NO: 8)
5. ScSSU1-M19V-F ATGTTTGTCATGGTCATGGGTG (SEQ ID NO: 9)
6. ScSSU1-M19V-R GACCATGACAAACATGAAGGGG (SEQ ID NO: 10)
7. ScSSU1-H89Y-FW3 CAGAAATATGAAGTACAATTTATTTTGGGGTAC (SEQ ID NO: 11)
8. ScSSU1-H89Y-RV3 GTACCCCAAAATAAATTGTACTTCATATTTCTG (SEQ ID NO: 12)
9. ScSSU1-A52T-FW GTTTGCTATCACTTGCCTTATTTTCATTGC (SEQ ID NO: 13)
10. ScSSU1-A52T-RV GAAAATAAGGCAAGTGATAGCAAACATG (SEQ ID NO: 14)

11. ScSSU1-Y164H-FW GATTGGGAATCATCCTTCATATAATATCAAAATGG (SEQ ID NO: 15)
12. ScSSU1-Y164H-FW CCATTTTGATATTATATGAAGGATGATTCCCAATC (SEQ ID NO: 16)
13. ScSSU1-N175H-F TCCGAACACATGAAAAGTGTATTG (SEQ ID NO: 17)
14. ScSSU1-N175R-R TTTCATGTGTTCGGATGCCA (SEQ ID NO: 18)
15. ScSSU1-C194G-F TCAAGTGGTGGAACATTCACAA (SEQ ID NO: 19)
16. ScSSU1-C194G-R TGTTCCACCACTTGAAGCGA (SEQ ID NO: 20)
17. ScSSU1-L258V-F TTCCTGGTATTGGGCCCG (SEQ ID NO: 21)
18. ScSSU1-L258V-R GCCCAATACCAGGAATAAGGT (SEQ ID NO: 22)
19. ScSSU1-V269I-F TTTGGAATTTTATTGCTTACAGATAATATA (SEQ ID NO: 23)
20. ScSSU1-V269I-R CAATAAAATTCCAAAACTTCCTTGGC (SEQ ID NO: 24)

21. ScSSU1-G390A-FW2 GCATTTAGAGTCCTAGCAACCATATACG (SEQ ID NO: 25)
22. ScSSU1-G390A-RV2 CGTATATGGTTGCTAGGACTCTAAATGC (SEQ ID NO: 26)
23. ScSSU1-110-124Sense ACTGTCACAAAAATTTACCACGACAAGCCCTGCGAATGCCAAGCACTTG (SEQ ID NO: 27)
24. ScSSU1-110-124AntiS CAAGTGCTTGGCATTCGCAGGGCTTGTCGTGGTAAATTTTTGTGACAGT (SEQ ID NO: 28)
25. ScSSU1-110-124-F AATGCCAAGCACTTGATGATATTTGTTTACGTCTTGTG (SEQ ID NO: 29)
26. ScSSU1-110-124-R AAATTTTTGTGACAGTGCTCCTAAGAAATTTATAATTGTAAC (SEQ ID NO: 30)
27.ScSSU1-198-216Sense CAAAAATATTCGGTACCACTTTTGATAGGAATATTCAATTGCTAACACTG (SEQ ID NO: 31)
28.ScSSU1-198-216AntiS CAGTGTTAGCAATTGAATATTCCTATCAAAAGTGGTACCGAATATTTTTG (SEQ ID NO: 32)
29. ScSSU1-198-216-F CAATTGCTAACACTGGTCATATGTGCCTTAACG (SEQ ID NO: 33)
30. ScSSU1-198-216-R GGTACCGAATATTTTTGACATTGTGAATGTTCCACA (SEQ ID NO: 34)
31. SbSSU1-V19M-F CCTTTCATGTTTATGATGGTTATGG (SEQ ID NO: 35)
32. SbSSU1-V19M-R AACCATCATAAACATGAAAGGGTT (SEQ ID NO: 36)

A plasmid containing DNA encoding a single amino acid substitution variant was prepared as follows. For example, for M19V (ScSSU1-M19V), a DNA fragment obtained by PCR with the above 1+6 primer set (SEQ ID NO: 5 and SEQ ID NO: 10) and the genomic DNA of the S288C strain as a template, and a 2+5 primer set (SEQ ID NO: 10) were used. 6 and SEQ ID NO: 9) (template is S288C strain genomic DNA), and a fragment obtained by digesting the yeast expression vector YCpG-TDH3pt vector (Japanese Patent Application Laid-open No. 2016-077160) with StuI, A total of three fragments were ligated using GeneArt Seamless (Thermoscientific) to obtain a plasmid containing DNA encoding the ScSSU1-M19V mutant. Plasmids containing DNA encoding other mutants were similarly prepared.
The plasmid containing the DNA encoding ScSSU1(EOY001)-M19V is the same as the plasmid containing the DNA encoding ScSSU1-M19V described above, except that the genomic DNA of the EOY001 strain was used as a template instead of the genomic DNA of the S288C strain. Prepared in the same manner as in Preparation.

For the continuous substitution mutant ScSSU1 (110-124), PCR was performed using the DNA fragment obtained by annealing the above 23 and 24 (SEQ ID NO: 27 and SEQ ID NO: 28) and the 1+26 primer set (SEQ ID NO: 5 and SEQ ID NO: 30). DNA fragment obtained by PCR with 2+25 primer set (SEQ ID NO: 6 and SEQ ID NO: 29) (template is genomic DNA of S288C strain), and A total of 4 fragments obtained by digesting the YCpG-TDH3pt vector with StuI were ligated using GeneArt Seamless (Thermoscientific) to obtain a plasmid containing DNA encoding ScSSU1 (110-124). A plasmid containing DNA encoding the continuous substitution mutant ScSSU1 (198-216) was also prepared in the same manner.

From the obtained plasmids, DNA fragments encoding each mutant were subcloned into the YCpG_TDH3pt vector for yeast expression to obtain expression vectors. The sequence of this expression vector was determined by the primer walking method using synthetic oligonucleotide primers using DNA Sequencer model 3100 (Applied Biosystems), and it was confirmed that only the desired gene and mutation had been introduced. In this expression vector, the introduced gene is inserted downstream of the promoter of the TDH3 gene, thereby constitutively expressing the inserted gene.

<Example 3>
Transformation of yeast Containing DNA encoding SSU1 (ScSSU1 or SbSSU1) or its mutant produced above using Saccharomyces cerevisiae strain EOY002 (hereinafter also referred to as EOY002 strain) by the lithium acetate method. Transformation was performed using an expression vector (plasmid). Transformants that grew on YPD+G418 agar medium (20 g of glucose, 10 g of Yeast extract, 20 g of peptone, 20 g of Bacto agar, and 20 μg/mL of G418 sulfate per liter) were selected as transformants.
The EOY002 transformant carrying each plasmid was cultured overnight at 30°C in YPD medium containing 20 μg/mL of G418 sulfate (20 g of glucose, 10 g of Yeast extract, 20 g of peptone per liter). 1×10 ⁷ cells were transferred to 10 mL of SSY medium (10 g of glucose, 60 g of maltose, 5 g of Yeast extract, 10 g of peptone per liter) and cultured with shaking at 20° C. for 3 days. After 3 days, the supernatant was collected.
Sulfite in the supernatant was measured using F-Kit Sulfite (JK International Co., Ltd.) according to the protocol. This measurement method involves reacting dissolved sulfite with sulfite oxidase, reducing the generated hydrogen peroxide with NADH peroxidase in the presence of reduced nicotinamide adenine dinucleotide (NADH), and detecting the decreased NADH at 340 nm. This is a method of quantifying sulfite by determining the change in absorbance. In the examples, sulfurous acid was determined as an amount converted to SO ₂ amount. The sulfite measurement results measured using F-Kit sulfite were expressed as a ratio with the SO ₂ amount of the reference strain as 1.

Results of evaluation of sulfite-producing ability of SSU1 Figure 2 shows the sulfite-producing ability of transformants introduced with DNA encoding ScSSU1 or its mutants and transformants introduced with DNA encoding SbSSU1 or its mutants. It is a figure showing an evaluation result. The results shown in Figure 2 show the sulfite production of each transformant, with the sulfite production amount (sulfite concentration in the medium supernatant) of the transformant (ScSSU1) introduced with S288C strain ScSSU1 (SEQ ID NO: 2) as 1. It is a ratio of amounts (concentration ratio). When the amount of sulfite produced by the transformant (ScSSU1) introduced with S288C strain ScSSU1 is set to 1, a relative activity of about 0.3 is observed in the yeast transformed with the empty vector YCpG_TDH3pt vector (control). This was the background level of yeast (Figure 2). In contrast, the transformant (SbSSU1) into which SbSSU1 (SEQ ID NO: 4) was introduced showed a relative activity of about 2.2 times that of ScSSU1, which is thought to greatly contribute to the high sulfite production of lager yeast. .
Next, a transformant (ScSSU1-M19V) into which a mutant in which the 19th Met residue of ScSSU1 was replaced with Val was evaluated, and sulfite production approximately 1.8 times that of ScSSU1 was detected.
Similarly, when the M19V mutation was introduced into ScSSU1 (EOY001) derived from the EOY001 strain (which has six amino acid polymorphisms compared to SSU1 derived from the S288C strain (A52T, A61T, N90S, A122S, P157S, Y164H)), It showed a relative activity about 1.9 times higher than the original ScSSU1 (EOY001) in which M19V was not introduced. Therefore, it has become clear that the M19V mutation is important for increasing the sulfite excretion ability (sulfite excretion activity) of ScSSU1 to, for example, SbSSU1.
On the contrary, when a transformant (SbSSU1-V19M) into which a mutant in which the 19th Val residue of SbSSU1 was replaced with Met was introduced, it showed a low sulfite production activity comparable to that of ScSSU1. Therefore, it was shown that the 19th Val residue is largely responsible for the high sulfite excretion ability of SbSSU1.
Since no significant change in activity was observed in the other 10 ScSSU1 mutants compared to the original ScSSU1, it was expected that these alone would hardly contribute to sulfite production.

<Example 4>
SSU1 sulfite tolerance evaluation system (medium)
Sulfite tolerance was evaluated by culturing some of the strains (transformants) produced in Example 3 in a medium containing potassium pyrosulfite (K ₂ S ₂ O ₅ ).
The composition of the medium containing potassium pyrosulfite is as follows. Potassium pyrosulfite was added to an SD agar medium (20 g of glucose, 6.7 g of Yeast nitrogen base, 20 g of Bacto agar per liter) at concentrations of 1 mM, 3 mM, and 5 mM.
Each transformant was cultured overnight at 30° C. in YPD medium (20 g of glucose, 10 g of Yeast extract, 20 g of peptone per liter) containing 20 μg/mL of G418 sulfate. After culturing, 3 μL of bacterial body fluids of 1×10 ⁶ cells/mL, 1×10 ⁵ cells/mL, and 1×10 ⁴ cells/mL were each spotted on the above-mentioned medium containing potassium pyrosulfite. The cells were cultured at 30°C for 3 days.

Evaluation of sulfite tolerance of SSU1 (results)
FIG. 3 shows the evaluation results of the sulfite tolerance ability of transformants introduced with DNA encoding ScSSU1 or its mutants and transformants introduced with DNA encoding SbSSU1 or its mutants. Figure 3 is a photograph of a plate after each transformant was cultured for 3 days at a potassium pyrosulfite concentration of 0mM or ^5mM . ×10 ⁵ cells, 1 × 10 ⁴ cells).
Yeast carrying an empty vector in the negative control group (control) could not grow in a medium containing 5mM potassium pyrosulfite, but yeast that constitutively expressed ScSSU1 (SEQ ID NO: 2) did not. Growth was confirmed when the number of bacteria was increased (Figure 3). It was confirmed that the growth of yeast that constitutively expressed ScSSU1 was inhibited in a medium containing 5mM potassium pyrosulfite, but yeast that expressed SbSSU1 (SEQ ID NO: 4) (SbSSU1) showed growth inhibition in a control group that did not contain potassium pyrosulfite ( 0mM). Therefore, it was confirmed that the ability to produce sulfite also contributes to the discharge of sulfite from the outside.
When we evaluated the above-mentioned ScSSU1-M19V mutant with increased sulfite-producing activity and transformants into which the ScSSU1 (EOY001 strain)-M19V mutant was introduced, we found that 5mM potassium pyrosulfite was not introduced despite the introduction of a single amino acid residue mutation. It also grew in a medium containing SbSSU1 and showed the same sulfite tolerance as SbSSU1. On the other hand, in the transformant into which the SbSSU1-V19M mutant with reduced sulfite excretion ability was introduced, the sulfite tolerance was reduced to the same level as the ScSSU1 transformant, indicating that the sulfite production activity due to the M19V mutation and the sulfite tolerance were A positive correlation was confirmed between the two.
In this plate medium, sulfite is given to the outside of yeast cells, so we observed resistance to extracellular sulfite, and yeast SbSSU1 not only excretes endogenous sulfite, but also responds to externally exposed sulfite. It was also shown that the excretion of sulfite also contributes to sulfite tolerance. In particular, the 19th Val residue of SbSSU1 is important for this high activity, and simply replacing the 19th Met residue of ScSSU1, which has low activity, with a Val residue can impart sulfite production ability and sulfite tolerance. It became clear.

<Example 5>
As mentioned above, in yeast SSU1, replacing the methionine residue of ScSSU1 type with the valine residue found in SbSSU1 for the amino acid at the 19th position of SEQ ID NO: 2 improves the sulfite excretion ability of SSU1 and yeast The sulfite tolerance ability of the material is greatly improved.
Next, we examined whether the activity of SSU1 could be improved by substituting the amino acid at position 19 of SEQ ID NO: 2 with an amino acid other than the valine residue in SSU1. Using the following primer set for mutation introduction (SEQ ID NOs: 49 to 56), the methionine at position 19 of the amino acid sequence shown in SEQ ID NO: 2 was prepared in the same manner as in the production of the M19V mutant described in Example 2 above. Plasmids containing DNA encoding the following four ScSSU1 mutants in which (M) was replaced with glycine (G), alanine (A), leucine (L), or isoleucine (I) were prepared. Genomic DNA of the S288C strain was used as a template.
M19G (ScSSU1-M19G)
M19A (ScSSU1-M19A)
M19L (ScSSU1-M19L)
M19I (ScSSU1-M19I)

ScSSU1-M19G
ScSSU1-M19G-FW: CTTCATGTTTGGAATGGTCATGGGTGTC (SEQ ID NO: 49)
ScSSU1-M19G-RV: ATGACCATTCCAAACATGAAGGGGTCAAA (SEQ ID NO: 50)
ScSSU1-M19A
ScSSU1-M19A-FW: CTTCATGTTTGCAATGGTCATGGGTGTC (SEQ ID NO: 51)
ScSSU1-M19A-RV: ATGACCATTGCAAACATGAAGGGGTCAAA (SEQ ID NO: 52)
ScSSU1-M19L
ScSSU1-M19L-FW: CTTCATGTTTCTGATGGTCATGGGTGTC (SEQ ID NO: 53)
ScSSU1-M19L-RV: ATGACCATCAGAAACATGAAGGGGTCAAA (SEQ ID NO: 54)
ScSSU1-M19I
ScSSU1-M19I-FW: CTTCATGTTTATCATGGTCATGGGTGTC (SEQ ID NO: 55)
ScSSU1-M19I-RV: ATGACCATGATAAACATGAAGGGGTCAAA (SEQ ID NO: 56)

A yeast transformant was produced in the same manner as in Example 3 using the produced plasmid. The sulfite-producing ability of the obtained yeast transformant was evaluated in the same manner as in Example 3 using F-Kit Sulfite (JK International Co., Ltd.). For comparison, yeast transformants introduced with an empty vector, transformants (WT) introduced with ScSSU1 of SEQ ID NO: 2, ScSSU1-M19V produced in Examples 2 and 3, and transformants introduced with SbSSU1 of SEQ ID NO: 4. Transformants were also evaluated in the same way. The results are shown in Figure 4.

FIG. 4 is a graph showing the evaluation results of the sulfite production ability of transformants into which DNA encoding ScSSU1 or its mutants or SbSSU1 was introduced. The results shown in Figure 4 show that the ratio of the amount of sulfite produced by each transformant is ( concentration ratio). Vector is yeast carrying an empty vector (control). In the yeast into which the four ScSSU1 mutants created above were introduced, although all of the point mutants were slightly inferior to the M19V mutation, it was confirmed that the sulfite production ability was improved compared to the wild type ScSSU1 (Fig. 4). Therefore, it has been found that the activity of SSU1 protein can also be improved by substituting the amino acid at the 19th position of SEQ ID NO: 2 with a G, A, L, or I residue other than V.

<Example 6>
Identification of amino acid residues that are additively involved in the effect of V19 of SbSSU1 SbSSU1 of the lager yeast Saccharomyces pastorianus WH34/70 strain is highly active due to the effect of the unique 19th Val (V19) I understand that.
Using the sulfite production amount evaluation system used in Example 3 (F-Kit Sulfite, JK International Co., Ltd.), lager yeast with high sulfite production ability was searched for. As a result of evaluating various lager yeasts, it was found that Saccharomyces pastorianus EOY005 strain (hereinafter also referred to as EOY005 strain) has a high sulfite-producing ability.

In evaluating the sulfite production ability, 1×10 ⁷ cells of yeast were inoculated into 10 mL of SSY medium as in Example 3, and cultured with shaking at 20° C. for 3 days. After 3 days, the supernatant was collected. As in Example 3, the sulfite concentration of the supernatant was measured using F-Kit Sulfite. The sulfite-producing ability of Saccharomyces cerevisiae EOY002 (hereinafter also referred to as EOY002 strain), which is an ale beer yeast, was evaluated in the same manner.
FIG. 5 shows the evaluation results of the sulfite-producing ability of the EOY002 strain, WH34/70 strain, and EOY005 strain. The results shown in Figure 5 show that the amount of sulfite produced (sulfite concentration in the medium supernatant) of the transformant (ScSSU1 in Figure 8) in which ScSSU1 consisting of the amino acid sequence of SEQ ID NO: 2 was introduced into the yeast strain EOY002 was 1. It is expressed as the ratio (concentration ratio) of the amount of sulfite produced by each strain.

Compared to the ale beer yeast strain EOY002 having ScSSU1, the lager yeast WH34/70 strain having SbSSU1 was found to have approximately twice the sulfite production ability in this evaluation system. Furthermore, it was found that another lager yeast strain, EOY005, has a sulfite-producing ability that is approximately four times higher than that of the WH34/70 strain (FIG. 5).

Furthermore, in order to evaluate the sulfite tolerance ability, in the method described in Example 4, the WH34/70 strain and the EOY005 strain were cultured on a medium containing 1 mM potassium pyrosulfite. The results are shown in Figure 6. Figure 6 is a photograph of a plate after culturing WH34/70 strain and EOY005 strain at a potassium pyrosulfite concentration of 0 or 1 mM for 3 days (the number of bacteria in the spotted bacterial fluid (per 1 mL) is 1 × 10 ⁶ cells, 1×10 ⁵ cells, 1×10 ⁴ cells). 3 μL of each bacterial cell fluid at the above concentration was spotted. Since the EOY005 strain showed better growth than the WH34/70 strain in the presence of 1 mM potassium pyrosulfite, it was confirmed that it also has a high sulfite tolerance.

In order to investigate the cause of the high sulfite production ability and sulfite tolerance ability of the lager yeast strain EOY005, the sequence of the SbSSU1 (SbSSU1-EOY005) gene possessed by the EOY005 strain was confirmed. The DNA sequence of the SbSSU1-EOY005 gene is shown in SEQ ID NO: 47, and the amino acid sequence of SbSSU1-EOY005 is shown in SEQ ID NO: 48. When ClustalW multiple alignment (default setting) was performed on the amino acid sequence of SbSSU1 of WH34/70 strain and the amino acid sequence of SbSSU1 of EOY005 strain, SbSSU1-EOY005 had two positions (M259 and L423) compared to SbSSU1 of WH34/70 strain. It was found that the protein had an amino acid polymorphism (Fig. 7). FIG. 7 is a diagram showing a sequence alignment between the amino acid sequence of SbSSU1 of the EOY005 strain (upper row, SbSSU1-EOY005) and the amino acid sequence of SbSSU1 of the WH34/70 strain (lower row, SbSSU1). Note that the 259th and 423rd amino acids of SbSSU1 of the EOY005 strain are amino acids located at positions corresponding to the 259th and 423rd positions, respectively, of the amino acid sequence shown in SEQ ID NO: 2.

In order to investigate whether the amino acid polymorphism of SbSSU1-EOY005 contributes to the activity of the SbSSU1 protein, the SSU1 gene was constitutively expressed in yeast (EOY002 strain) using the method described in Examples 2 to 3. Sulfite production and tolerance capacity were evaluated.
Mutants of SbSSU1-EOY005 include a mutant in which valine at position 19 of SbSSU1-EOY005 is replaced with methionine (SbSSU1-EOY005-V19M mutant), and a mutant in which methionine at position 259 of SbSSU1-EOY005 is replaced with leucine (SbSSU1-EOY005-M259L). A vector was prepared for introducing into yeast a mutant in which leucine at position 423 was replaced with proline (SbSSU1-EOY005-L423P mutant). A vector for introducing the V19M mutant was constructed using the above primer set of SEQ ID NOs: 35 and 36 by the method described in Examples 2 and 3. Vectors for introducing each mutant were created using the primer set of SEQ ID NOs: 57 and 58 for the M259L mutant, and the primer set of SEQ ID NOs: 59 and 60 for the L423P mutant. In the production of these SbSSU1-EOY005 mutants, the genomic DNA of the EOY005 strain was used as a template to create the M259L mutant, and the genomic DNA of the WH34/70 strain was used as a template to create the L423P mutant. . The amino acid sequence of the L423P mutant (SbSSU1-EOY005-L423P mutant) is the same as the amino acid sequence of the WH34/70 strain SbSSU1 (SEQ ID NO: 4) in which leucine at position 259 is replaced with methionine (L259M).
SbSSU1-EOY005-M259L-FW 5'-GTTGTTCTTGGTATTGGGGCCATTG (SEQ ID NO: 57)
SbSSU1-EOY005-M259L-RV 5'-CAATGGCCCCAATACCAAGAACAAC (SEQ ID NO: 58)
SbSSU1-L259M-FW 5'-GTTGTTCTTGGTAATGGGGCCATTG (SEQ ID NO: 59)
SbSSU1-L259M-RV 5'-CAATGGCCCCATTACCAAGAACAAC (SEQ ID NO: 60)
The obtained vector was introduced into the yeast strain EOY002 to produce yeast transformants expressing the SbSSU1-EOY005-V19M mutant, the SbSSU1-EOY005-M259L mutant, and the SbSSU1-EOY005-L423P mutant, respectively.

The sulfite-producing ability of the yeast transformants expressing these three SbSSU1-EOY005 mutants was evaluated in the same manner as in Example 3 using F-Kit Sulfite (JK International Co., Ltd.). In addition, the sulfite tolerance of yeast expressing each of these three SbSSU1-EOY005 mutants was evaluated by the method described in Example 4.
Instead of the SbSSU1-EOY005 mutant, a transformant (SbSSU1 (EOY005)) in which DNA encoding SbSSU1 (wild type) of the EOY005 strain was introduced was also created, and the sulfite production ability and sulfite tolerance ability were evaluated in the same manner as above. did. Transformant expressing ScSSU1 having the amino acid sequence of SEQ ID NO: 2 prepared in Examples 2 to 3 (ScSSU1), transformant expressing SbSSU1 of WH34/70 strain (SbSSU1), and SbSSU1-V19M mutant A similar evaluation was performed on yeast expressing .

FIG. 8 shows the evaluation results of the sulfite production ability of each of the above transformants. The results shown in FIG. 8 are the ratio (concentration ratio) of the amount of sulfite produced by each transformant, with the amount of sulfite produced by the transformant expressing ScSSU1 (ScSSU1) being 1.
When the sulfite production ability of the SbSSU1-EOY005 mutant was evaluated, it was found that the yeast expressing the SbSSU1-EOY005-V19M mutant (SbSSU1(EOY005)-V19M) was different from the yeast expressing the wild-type SbSSU1-EOY005 (SbSSU1( The sulfite production ability was lower than that of EOY005)) and was at the same level as ScSSU1 (Figure 8). On the other hand, in yeast expressing the SbSSU1-EOY005-M259L mutant (SbSSU1(EOY005)-M259L), an approximately 31% decrease in activity was observed compared to the wild type SbSSU1-EOY005, and the activity was at the same level as SbSSU1. There was (Figure 8). In addition, SbSSU1-L259M (that is, the SbSSU1-EOY005 mutant (SbSSU1-EOY005-L423P) in which leucine at position 423 in the amino acid sequence of SbSSU1-EOY005 is replaced with proline) has approximately 17 % decrease in activity was observed (Figure 8).

The results of evaluating the sulfite tolerance of each transformant are shown in FIG. 9. Figure 9 is a photograph of a plate after culturing for 3 days at a potassium pyrosulfite concentration of 0mM or ^{5mM .} , 1×10 ⁴ cells). 3 μL of each bacterial cell fluid at the above concentration was spotted. In FIG. 9, Vector is yeast holding an empty vector (control). ScSSU1 is yeast that expressed the above-mentioned ScSSU1, SbSSU1 is yeast that expressed SbSSU1 of WH34/70, and SbSSU1-V19M is yeast that expressed SbSSU1-V19M mutant of WH34/70.
In the yeast expressing the SbSSU1-EOY005-V19M mutant (SbSSU1(EOY005)-V19M), the ability to tolerate sulfite was significantly reduced and was comparable to that of the strain expressing ScSSU1 (FIG. 9). In the yeast expressing one SbSSU1-EOY005-M259L mutant (SbSSU1(EOY005)-M259L) and the yeast expressing the SbSSU1-L259M (that is, SbSSU1-EOY005-L423P) mutant, the wild type SbSSU1-EOY005 Growth inhibition was observed compared to yeast (SbSSU1 (EOY005)) in which SbSSU1 (EOY005) was expressed (Fig. 9). Therefore, a correlation was confirmed between the amount of sulfite produced by yeast and the ability to tolerate sulfite. The above results showed that the two unique amino acids of SbSSU1 derived from strain EOY005 contribute to high sulfite production ability and tolerance ability. Table 1 shows SSU1 or its mutant introduced into yeast and expressed in Example 6, and its amino acid sequence corresponding to the 19th, 259th, and 423rd positions in the amino acid sequence shown in SEQ ID NO: 2. Indicates a certain amino acid.

From the above results, it is clear that V19 contributes to the high sulfite production activity and tolerance activity of SSU1 in SbSSU1-EOY005, and V19 It was shown that these amino acid residues contribute additively to sulfite production and tolerance. Therefore, based on these findings, it will be possible to isolate and design the highly active SSU1 protein, as well as select yeast with high sulfite-producing ability and use it to brew beer with a high sulfite content (ale beer). .

<Example 7>
Confirmation of the effect of M19V mutation introduction in ScSSU1 The effect of replacing the 19th methionine residue of ScSSU1 with a valine residue (M19V) in the beer fermentation process was confirmed. First, a genomic DNA fragment (approximately 2.3 kb) containing the promoter to terminator of ScSSU1 of the S288C strain was used with the following primer set and the aforementioned primer set for M19V mutation introduction (SEQ ID NO: 9 and 10) to generate V19 type. Genomic DNA containing the mutated ScSSU1 (gScSSU1-M19V) was amplified by PCR and inserted into the NotI site of the YCpG vector using the GeneArt system (Thermo Fisher) according to the manufacturer's recommended method.
SSU1-F-790: CATTAATGCAGGTTGCGGCCGCTAATCTTTTTGGGCTGGTAGG (SEQ ID NO: 61)
SSU1-R+405: CGGGCATTTAAATGCGGCCGCGTAATGCTTGGTGTTCGTG (SEQ ID NO: 62)
After confirming that there is no mutation other than the mutated base sequence, the vector containing gScSSU1-M19V was introduced into Ale yeast strain 3 (hereinafter referred to as EOY003 strain) and Ale yeast strain 4 (hereinafter referred to as EOY004 strain), and these was transformed into ScSSU1-M19V. Both the EOY003 strain and the EOY004 strain are top-fermenting yeasts.

The EOY003 strain is a strain in which the function of the MET5 gene possessed by the EOY002 strain has been partially disrupted by a general homologous recombination method. The MET5 gene encodes a protein involved in methionine synthesis (Masselot M and De Robichon-Szulmajster H (1975) Methionine biosynthesis in Saccharomyces cerevisiae. I. Genetical analysis of auxotrophic mutants. Mol Gen Genet 139(2):121-32) . Since the polypeptide encoded by MET5 is a component of the enzyme responsible for the reaction that further reduces sulfite, by suppressing its function, strain EOY003 is expected to have the effect of increasing the amount of intracellular sulfite, which is a substrate for the SSU1 protein.
Although the EOY004 strain has the genetic background of the EOY002 strain, it contains the FZF1 protein, a transcription factor that increases the expression level of the SSU1 gene (Avram D, et al. (1999) Fzf1p of Saccharomyces cerevisiae is a positive regulator of SSU1 transcription and its first This is a mutant strain with high activity of zinc finger region is required for DNA binding. Yeast 15(6):473-80)). Specifically, through mutation treatment by EMS, the EOY004 strain was transformed into a Tyr residue at the 162nd Cys residue of the amino acid sequence (SEQ ID NO: 64) of the FZF1 protein encoded by the wild-type FZF1 gene (SEQ ID NO: 63). It has a C162Y mutation that is substituted with . The DNA sequence encoding the mutant FZF1 protein having the above C162Y mutation is shown in SEQ ID NO: 65, and the amino acid sequence of the mutant FZF1 protein (FZF1-C162Y) is shown in SEQ ID NO: 66, respectively. Although several activating mutations of FZF1 have been reported, this mutant (C162Y mutation) is new.

In order to confirm that the ScSSU1 gene expression actually increases in the EOY004 strain and the EOY002 strain in which the FZF1-C162Y mutation gene is introduced, compared to the EOY002 strain, we used the following primer set with SEQ ID NOs: 67 to 70. , performed general qPCR.
scSSU1-F-RT: ACGACGAAGAGCCCCACTAA (SEQ ID NO: 67)
scSSU1-R-RT: TTCCCAATCCCTTCCAAAGA (SEQ ID NO: 68)
TDH3-F-RT: CGGTAACATCATCCCATCC (SEQ ID NO: 69)
TDH3-R-RT: CGGCAGCCTTAACAACCTTC (SEQ ID NO: 70)
The expression level of ScSSU1 in each strain was normalized by TDH3 gene expression. FIG. 10 is a graph showing the results of expression analysis of the ScSSU1 gene by qPCR. Figure 10(a) shows the expression level of the ScSSU1 gene in the EOY002 strain and the EOY004 strain, and Figure 10(b) shows the expression level of the ScSSU1 gene in the EOY002 strain (vec(EOY002)) and the wild type strain in the EOY002 strain (vec(EOY002)). The expression level of the ScSSU1 gene is shown in a strain into which FZF1 was introduced (FZF1) and a strain into which mutant FZF1 (FZF1-C162Y) was introduced into the EOY002 strain (FZF1-C162Y). The expression level of the ScSSU1 gene shown in Figures 10(a) and (b) was determined by normalizing the expression level of the ScSSU1 gene by the expression level of the TDH3 gene (ScSSU1 gene/TDH3 gene). This is the relative expression level when the ScSSU1 gene expression level (ScSSU1 gene/TDH3 gene) is set to 1.

The relative expression level with the ScSSU1 expression level of the EOY002 strain as 1 is 8.56 for the EOY004 strain and 18.7 for the EOY002 strain (FZF1-C162Y) into which the FZF1-C162Y mutant gene has been introduced, indicating that the ScSSU1 gene expression level is It was confirmed that there was a marked increase (Fig. 10). Therefore, the EOY004 strain is expected to increase the expression level of ScSSU1 due to the active FZF1-C162Y mutation, thereby increasing its ability to produce sulfite through ScSSU1.

A beer fermentation test was conducted using the following wort.
<wort>
Wort extract concentration 13%
Wort FAN (free amino nitrogen) concentration 30mg/100mL
<Fermentation test>
Wort capacity 2L
Wort dissolved oxygen concentration 10ppm
Fermentation temperature 19℃
Yeast input amount 1×10 ⁷ cells/mL
Fermentation was carried out for 6 days, and the wort extract and sulfite concentration of the fermented liquor (beer) after completion of fermentation were measured. The sulfite concentration was measured by the Rankine method (aeration-oxidation method) (National Institute of Alcoholic Beverages Standard Analysis Method, "9-16 Sulfite"). The measured sulfite concentration is the concentration of total sulfite (the total value of free and bound sulfite), and is expressed as a value converted to the amount of SO ₂ . The wort extract concentration was measured using DMA4500M (vibrating density/specific gravity/densitometer, Anton Paar).

The results are shown in Table 2. Extract (%) is wort extract concentration (%). Beer obtained using two types of yeast strains (EOY003 strain and EOY004 strain) that did not introduce ScSSU1-M19V had SO ₂ of 0.16 ppm or less, but beer obtained using the ScSSU1-M19V-introduced strain EOY003 ( In the beer obtained using EOY003+gScSSU1-M19V), SO ₂ was 2.7 ppm or more. Furthermore, SO ₂ production of 5.5 ppm or more was confirmed in the EOY004 strain (EOY004+gScSSU1-M19V) into which ScSSU1-M19V was introduced.

From the above results, in an actual beer fermentation test using wort, an increase in sulfite production was confirmed by introducing the M19V mutation into ScSSU1 in two different types of ale yeast.
The EOY003 and EOY004 strains have a genetic background that increases the expression level and substrate amount of SSU1, but since similar effects can be obtained with these different mutant types, sulfite production is improved through SSU1. It can be said that it did.

According to the present invention, the sulfite content in alcoholic beverages such as beer can be increased, and it is possible to produce alcoholic beverages such as beer that have excellent flavor stability and a longer quality retention period. INDUSTRIAL APPLICATION This invention is useful in the field of food and beverages.

Claims (4)

Ale beer containing 5.5 to 20 ppm of sulfite (excluding beers (1) to (3) below:
(1) Introducing an expression vector containing the SbSSU1 gene consisting of the base sequence of SEQ ID NO: 3 and the promoter and terminator of the glyceraldehyde-3-phosphate dehydrogenase gene (TDH3), in which the SbSSU1 gene is expressed by the TDH promoter and terminator. Beer produced using top-fermenting yeast
(2) Introduction of an expression vector containing the SbSSU1 gene consisting of the base sequence of SEQ ID NO: 3 and the promoter and terminator of the glyceraldehyde-3-phosphate dehydrogenase gene (TDH3), in which the SbSSU1 gene is expressed by the promoter and terminator of TDH. Beer containing top-fermenting yeast
(3) Contains the promoter and terminator of the Sc-type MET14 gene or non-Sc-type MET14 gene and glyceraldehyde-3-phosphate dehydrogenase gene (TDH3) shown in FIG. 11 of JP-A-2004-283169, and the MET14 gene is (Beer containing top-fermenting yeast into which an expression vector is expressed using the TDH promoter and terminator) . Beer containing 5.5 to 20 ppm of sulfites and labeled as "ale" (excluding beers (1) to (3) below:
(1) Introducing an expression vector containing the SbSSU1 gene consisting of the base sequence of SEQ ID NO: 3 and the promoter and terminator of the glyceraldehyde-3-phosphate dehydrogenase gene (TDH3), in which the SbSSU1 gene is expressed by the TDH promoter and terminator. Beer produced using top-fermenting yeast
(2) Introduction of an expression vector containing the SbSSU1 gene consisting of the base sequence of SEQ ID NO: 3 and the promoter and terminator of the glyceraldehyde-3-phosphate dehydrogenase gene (TDH3), in which the SbSSU1 gene is expressed by the promoter and terminator of TDH. Beer containing top-fermenting yeast
(3) Contains the promoter and terminator of the Sc-type MET14 gene or non-Sc-type MET14 gene and glyceraldehyde-3-phosphate dehydrogenase gene (TDH3) shown in FIG. 11 of JP-A-2004-283169, and the MET14 gene is (Beer containing top-fermenting yeast into which an expression vector is expressed using the TDH promoter and terminator) . The ale beer according to claim 1, wherein the sulfite is yeast-derived sulfite. The beer according to claim 2, wherein the sulfite is yeast-derived sulfite.

Images