JP7393070B1 - PCR method - Google Patents

Abstract

An object of the present invention is to provide a PCR method that can suitably measure a fluorescent signal accompanying PCR amplification, even when blood is used as a sample, without performing complicated nucleic acid purification work. [Solution] The PCR method includes a step of preparing a sample by adding blood to a PCR reagent (S10), and a step of repeatedly moving the sample back and forth within the channel of a microfluidic chip to impart a thermal cycle to the sample. (14), and a step (S16) of detecting fluorescence from the sample in the channel in order to monitor the progress of PCR of the sample. [Selection diagram] Figure 7

Description

The present invention relates to a method of polymerase chain reaction (PCR).

Genetic testing is widely used in various medical fields, identification of agricultural products and pathogenic microorganisms, food safety evaluation, and even testing for pathogenic viruses and various infectious diseases. In order to detect minute amounts of DNA with high sensitivity, a method is known in which a portion of DNA is amplified and the resultant product is analyzed. Among them, a method using PCR is a technique that is attracting attention for selectively amplifying a certain part of a very small amount of DNA collected from a living body or the like.

PCR is a mixture of a biological sample containing DNA and a PCR reagent consisting of primers, enzymes, etc., which is subjected to a predetermined thermal cycle to repeatedly cause denaturation, annealing, and elongation reactions to generate a specific portion of DNA. This is selective amplification. PCR analysis can be performed in real time by measuring the fluorescence signal while amplifying the DNA and performing quantitative analysis.

In PCR, it is common to put a predetermined amount of the target sample into a PCR tube or a chip with multiple holes, such as a microplate (microwell), and then apply temperature changes to the sample using a device called a thermal cycler. (For example, see Patent Document 1).

International Publication No. 2020/065917

However, in the conventional PCR method using a PCR tube or microplate as described above, when PCR is performed on a sample in which blood is directly added to a PCR reagent, browning of blood components occurs due to heat denaturation at the initial stage of PCR. As a result, the fluorescence transmittance of the sample decreases, making it impossible to accurately measure the fluorescence signal associated with PCR amplification, and there is a possibility that real-time PCR analysis cannot be performed appropriately. Extract and purify nucleic acids from blood to remove dyes that inhibit fluorescence signal measurement before adding them to PCR reagents, or dilute blood, for example, 10 times or more, and then add only a small amount of blood to PCR reagents. Although real-time PCR is possible using conventional PCR methods such as , etc., performing such work is extremely complicated and time-consuming.

The present invention was made in view of these circumstances, and its purpose is to measure fluorescent signals accompanying PCR amplification without performing complicated nucleic acid purification work, even when blood is used as a sample. An object of the present invention is to provide a PCR method that can suitably perform the following.

In order to solve the above problems, a PCR method according to an embodiment of the present invention includes a step of preparing a sample by adding blood to a PCR reagent, and a step of repeatedly moving the sample back and forth within the channel of a microfluidic chip. and detecting fluorescence from the sample in the channel in order to monitor the progress of PCR of the sample.

According to the present invention, it is possible to provide a PCR method that can suitably measure a fluorescent signal accompanying PCR amplification without performing complicated nucleic acid purification work, etc. even when blood is used as a sample.

FIG. 2 is a perspective view showing the first surface side of a microfluidic chip applicable to the PCR method according to the embodiment of the present invention. FIG. 3 is a perspective view showing the second surface side of the microfluidic chip. FIG. 2 is a plan view of the first surface of a substrate included in the microfluidic chip. FIG. 3 is a plan view of the second surface of the substrate included in the microfluidic chip. FIG. 2 is a conceptual diagram for explaining the cross-sectional structure of a microfluidic chip. FIG. 2 is a schematic diagram for explaining a thermal cycle that can utilize a microfluidic chip and a PCR device for performing PCR. It is a flowchart for explaining the PCR method concerning this embodiment. FIG. 2 is a diagram for explaining how a sample changes when it is moved within a channel of a microfluidic chip. FIG. 2 is a diagram for explaining how a sample changes when it is moved within a channel of a microfluidic chip. FIG. 2 is a diagram for explaining how a sample changes when it is moved within a channel of a microfluidic chip. FIG. 2 is a diagram for explaining how a sample changes when it is moved within a channel of a microfluidic chip. FIG. 2 is a diagram for explaining how a sample changes when it is moved within a channel of a microfluidic chip. FIG. 2 is a diagram for explaining how a sample changes when it is moved within a channel of a microfluidic chip. FIG. 3 is a plan view of the first side of another microfluidic chip applicable to the PCR method according to the embodiment of the present invention. FIGS. 15(a) and 15(b) are diagrams showing amplification curves when using a reciprocal flow type real-time PCR device. It is a figure which shows the amplification curve when using a general real-time PCR apparatus. FIGS. 17(a) and 17(b) are diagrams showing amplification curves when using a reciprocal flow type real-time PCR device. It is a figure which shows the amplification curve when using a general real-time PCR apparatus.

Embodiments of the present invention will be described below. Identical or equivalent components, members, and processes shown in each drawing are designated by the same reference numerals, and redundant explanations will be omitted as appropriate. Further, the embodiments are illustrative rather than limiting the invention, and all features and combinations thereof described in the embodiments are not necessarily essential to the invention.

FIG. 1 is a perspective view showing the first surface side of a microfluidic chip 10 applicable to the PCR method according to the embodiment of the present invention. FIG. 2 is a perspective view showing the second surface side of the microfluidic chip 10. FIG. 3 is a plan view of the first surface 14a of the substrate 14 included in the microfluidic chip 10. FIG. 4 is a plan view of the second surface 14b of the substrate 14 included in the microfluidic chip 10. FIG. 5 is a conceptual diagram for explaining the cross-sectional structure of the microfluidic chip 10. It should be noted that FIG. 5 is a diagram for explaining the positional relationship between a flow path, a film, a filter, and a substrate, and is different from a cross-sectional view of an actual microfluidic chip.

Microfluidic chip (also called "fluidic chip", "(micro)channel chip", "reaction processing chip", "reaction processing container", "nucleic acid amplification chip", "DNA chip", "measuring chip", etc.) 10 includes a flow path 12 through which a sample subjected to a thermal cycle or reaction moves. The microfluidic chip 10 includes a resin substrate 14 mainly formed with a groove-shaped channel 12 through which a sample moves on a first surface 14a, and a first sealing film attached to the first surface 14a of the substrate 14. 16 and a second sealing film 18, and a third sealing film 20 affixed to the second surface 14b of the substrate. Further, in the microfluidic chip 10, a first filter 28 and a second filter 30 may be provided near both ends of the flow path 12 of the substrate 14 for the purpose of suppressing contamination to the flow path 12.

As shown in FIG. 3, the first surface 14a of the substrate 14 of the microfluidic chip 10 has at least a groove-shaped channel 12 and a channel disposed at both ends of the channel 12 and communicating with the channel 12. Air communication ports 24 and 26 for attaching the output from a pump that pressurizes or blows air inside, chamber-like chambers 32 and 34 provided above the flow path 12, and prevention of contamination to the flow path 12. Filter spaces 36 and 38 are provided in which filters 28 and 30 are placed. It is planned that a sample to be subjected to PCR or a thermal cycle will move through the groove-shaped flow path 12 .

As shown in FIG. 4, the second surface 14b of the substrate 14 includes groove-shaped air ducts 40, 42 for communicating the air communication ports 24, 26 with the filter spaces 36, 38, and a groove-shaped air duct 40, 42 for communicating the sample into the flow path 12. A sample introduction port (sample introduction hole) 44 is provided for introduction. The groove-shaped air ducts 40 and 42 may be designed as flow paths through which air mainly passes for air blowing or pressurization from a pump or the like connected to the air communication ports 24 and 26. Providing the flow path 12, the air ducts 40, 42, etc. on the two opposing main surfaces (first surface 14a and second surface 14b) of the substrate 14 in this way helps to effectively utilize the main surface of the substrate 14.

The substrate 14 of the microfluidic chip 10 is preferably formed of a material that is stable against temperature changes and is not easily attacked by the sample solution used. Further, the substrate 14 is preferably formed from a material that has good moldability, good barrier properties, and low autofluorescence. As such a material, resins such as acrylic, polypropylene, and silicone, among which cyclic polyolefin resins are suitable. When the substrate is made of resin, it can be manufactured in large quantities and with high quality by injection molding using a mold.

The size of the substrate 14 of the microfluidic chip 10 is not particularly limited, and may be any size as long as it satisfies the chemical and physical effects within the flow channels formed within the substrate. . On the other hand, if there is a desire to make the device on which the microfluidic chip is mounted smaller, the microfluidic chip and the substrate that constitutes it can also be made smaller or thinner. The substrate 14 of the microfluidic chip 10 may be in the shape of a parallel plate, which has good moldability, portability, and handling.

The size of the substrate 14 of the microfluidic chip 10 is, for example, 1 mm to 10 mm thick, preferably 2 mm to 6 mm, and has a rectangular shape of W×L in plan view, where W is 10 mm to 60 mm. Preferably, it is 20 mm to 35 mm, and H is 45 mm to 100 mm, preferably 60 mm to 85 mm.

Further, the microfluidic chip 10 may be made of transparent resin. The microfluidic chip 10 is expected to be used to amplify nucleic acids contained in a sample by real-time PCR. When a reaction of a sample containing a nucleic acid progresses within the channel of the microfluidic chip 10, the progress and completion of the reaction can be known by detecting and monitoring fluorescence emitted from the sample in real time. The microfluidic chip 10 is preferably made of a transparent material as a part used for optical measurements such as detection of fluorescence from a sample in a flow channel and irradiation with excitation light that causes fluorescence.

A groove-shaped channel 12 is formed on the first surface 14a of the substrate 14. In the microfluidic chip 10, most of the channel 12 is formed in the shape of a groove exposed on the first surface 14a of the substrate. Further, the groove-shaped air ducts 40 and 42 are formed in groove shapes exposed on the second surface 14b of the substrate 14. By adopting such a configuration, the substrate 14 having the flow path 12 and the like on two opposing main surfaces can be easily molded by injection molding using a mold. In order to seal the grooves formed in the substrate 14 and utilize them as the channels 12, a channel sealing film is pasted on each surface of the substrate 14. The dimensions of the channel 12 are, for example, about 0.2 mm to 1.5 mm in width and 0.2 mm to 2 mm in depth, and the dimensions of the channel 12 may be 0.7 mm in width and 0.7 mm in depth. . Furthermore, in order to produce the substrate 14 industrially more advantageously by the injection molding method, the structure of the flow path 12 is so-called "pull taper" that the structure is fixed to the first surface 14a and the second surface 14b of the substrate 14. It may include sides with angles. The angle of the taper may be between 1° and 30°, or between 3° and 15°.

The sealing films 16, 18, 20 for sealing the flow path 12, the sample introduction port 44, the air communication ports 24, 26, the chambers 32, 34, and the filters 28, 30 have adhesive on one main surface. Alternatively, a functional layer that exhibits adhesiveness or adhesion by pressing, irradiation with energy such as ultraviolet rays, heating, etc. may be formed on one main surface, and the first surface 14a of the substrate 14, It has a function that allows it to be closely integrated with the second surface 14b. It is desirable that the sealing films 16, 18, and 20, including the adhesive, be formed of a material that has low autofluorescence, preferably almost zero autofluorescence. Transparent films made of resins such as, but not limited to, cycloolefin polymers, polyesters, polypropylene, polyethylene or acrylics are suitable in this regard. Moreover, the sealing films 16, 18, and 20 may be formed from plate-shaped glass or resin. In this case, rigidity can be expected, which helps prevent warping and deformation of the microfluidic chip 10.

A first filter 28 is provided near one end of the flow path 12 . A second filter 30 may be provided near the other end of the flow path 12 . A pair of first filters 28 and second filters 30 provided near both ends of the flow path 12 are designed to prevent amplification and detection of the target DNA by PCR or to prevent deterioration of the quality of the target DNA. The purpose is to prevent contamination within the flow path and onto the sample. The dimensions of the first filter 28 and the second filter 30 are such that they fit into the filter spaces 36 and 38 formed on the first surface 14a of the substrate 14 without any gaps.

A first air communication port 24 that communicates with one end of the flow path 12 via a first air duct 40 and a first filter 28 is formed in the substrate 14 . Similarly, a second air communication port 26 is formed in the substrate 14 and communicates with the other end of the flow path 12 via the second air duct 42 and the second filter 30. The pair of first air communication ports 24 and second air communication ports 26 are formed so as to be exposed on the first surface 14a of the substrate 14.

A part of the flow path 12 includes a thermal cycle region between a pair of first filter 28 and second filter 30, in which multiple levels of temperature can be controlled by a PCR device, which will be described later. By setting the microfluidic chip 10 in a PCR device having a temperature control system including a heater, a part of the channel 12 of the microfluidic chip 10 is heated by the temperature control system and maintained at a desired temperature. The temperature is controlled to be maintained at the temperatures necessary to impart thermal cycling and cause a reaction such as PCR to occur. Reactions include reactions in which nucleic acids contained in a sample are thermally denatured, annealing reactions, and elongation reactions. The temperature controlled in a portion of the flow path 12 may be a temperature that causes these reactions to occur. By continuously moving the sample back and forth through the reaction area where multiple levels of temperature are maintained, a thermal cycle can be applied to the sample.

In this embodiment, the thermal cycle region includes a first temperature region 46 and a second temperature region 48. When the microfluidic chip 10 is mounted on a PCR device to be described later, the first temperature region 46 is maintained at a relatively high temperature (for example, about 95° C.), and the second temperature region 48 is maintained at a lower temperature than the first temperature region 46. (for example, about 60°C). Nucleic acids, etc. contained in the sample may undergo a thermal denaturation reaction in the channel included in the first temperature region 46, or may undergo an annealing reaction and an elongation reaction in the channel included in the second temperature region 48. good. Note that the first temperature region 46 and the second temperature region 48 may be respectively referred to as a "high temperature region" and a "medium temperature region" from the viewpoint of the height of the temperature. Further, the first temperature region 46 and the second temperature region 48 may be referred to as a "denaturation region" and an "annealing/extension region" from the viewpoint of their reaction attributes.

One end of the first temperature region 46 communicates with the first chamber 32 . Further, the first chamber 32 communicates with the first air communication port 24 via the first filter 28 and the first air duct 40. The other end of the first temperature region 46 communicates with one end of the second temperature region 48 via a connecting flow path 50 . The other end of the second temperature region 48 communicates with one end of the third meandering channel 52 through the connecting channel 41 . The other end of the third serpentine flow path 52 communicates with the second chamber 34 . Furthermore, the second chamber 34 communicates with the second air communication port 26 via the second filter 30 and the second air duct 42 .

In this embodiment, the third meandering flow path 52 is a flow path that is not directly related to thermal cycles or PCR, and includes a straight flow path and a curved flow path. By having a structure in which the sample introduction port 44 for introducing the sample into the flow path is communicated with the third meandering flow path 52, a buffer-like flow is created in which the sample scheduled to be subjected to PCR is kept waiting. It may also be used as a road.

The first temperature region 46 and the second temperature region 48 each include a first serpentine flow path 54 and a second serpentine flow path 56 that are continuously folded back and are a combination of a curved flow path and a straight flow path. It can also be said that a plurality of curved channels are connected by a straight channel. When creating such a meandering flow path, the limited effective area of the heaters, etc. that make up the temperature control system, which will be described later, can be used effectively, contributing to reducing temperature variations within each temperature range. At the same time, there is an advantage that the actual size of the microfluidic chip 10 can be reduced, contributing to miniaturization of PCR devices. Further, by combining a curved channel and a straight channel, it is possible to promote stirring and mixing of the sample flowing through the channel, compared to, for example, a case where the temperature region is configured only with a linear channel. Thereby, the sample can be effectively separated into a solid component and a transparent solution component as described below. The radius of curvature R2 of the curved channel may be between 0.3 mm and 10 mm, preferably between 0.5 mm and 6 mm.

On the other hand, the first temperature region 46 and the second temperature region 48 are connected by a linear connecting channel 50. The connection channel 50 has a region (a "fluorescence detection region" or 58 may be provided (simply referred to as a "detection area"). The flow path included in this fluorescence detection region 58 is referred to as a detection flow path 59.

The connection channel 50 corresponds to a portion where a part of a fluorescence detection device for detecting fluorescence of a sample is arranged. Therefore, the distance between the first temperature region 46 and the second temperature region 48 may be relatively long. For example, the distance between the first temperature region 46 and the second temperature region 48 may be /or it may be longer than the straight flow path included in the second temperature region 48; A part of the fluorescence detection device disposed in the connection flow path 50 has a predetermined volume, so in order to arrange some parts of the fluorescence detection device, the interval should be a certain distance or more. has advantages. Further, the longer the interval between the first temperature region 46 and the second temperature region 48, the more advantageous it is that thermal interference between both temperature regions can be reduced. When thermal interference between temperature regions is small, heat provided from the device through temperature control means such as a heater can be effectively used, contributing to power saving of the device.

On the other hand, since there is an advantage of reducing the size of the PCR device or the microfluidic chip 10 (portability, weight, etc.), the interval between the first temperature region 46 and the second temperature region 48 is, for example, smaller than the size of the microfluidic chip 10. It may be shorter than 1/2 of the length L of the long side in the plan view. At this time, it is possible to improve the degree of freedom in designing the microfluidic chip, such as mounting other elements and arranging margins and blank spaces, and it is easy to ensure the desired size and portability of the PCR device.

The first chamber 32 is arranged between the thermal cycle area and the first air communication port 24. More specifically, the first chamber 32 is arranged between the first temperature region 46 of the thermal cycle region and the first filter 28 . The sample in the flow path moves toward the first temperature region 46 by being pressurized or blown from the second air communication port 26, for example. The first chamber 32 has the role of suppressing the sample from being pushed too much or overrunning the first temperature region 46 and reaching the first filter 28 . By providing the first chamber 32 with a constant volume in the flow path, the sample remains in the first chamber 32 and is stopped even if the sample passes through a predetermined scheduled stopping position in the thermal cycle area. Therefore, the flow of the sample toward the first air communication port 24 can be suppressed.

As shown in FIG. 3, the first chamber 32 has a first connecting portion 32a, which is a connecting portion (or opening) with the end of the flow path extending from the first temperature region 46 of the thermal cycle region, and a first A second connection portion 32b is provided, which is a connection portion to the end of the flow path toward the filter 28. The first chamber 32 has a first structure 32c near the first connecting portion 32a. This first structure 32c suppresses the liquid sample that has entered the first chamber 32 from the first connection part 32a from going directly to the second connection part 32b, and prevents the sample from flowing in the direction of the first filter 28. Contributes to suppressing intrusion.

The second chamber 34 is arranged between the thermal cycle area and the second air communication port 26. More specifically, the second chamber 34 is arranged between the third serpentine flow path 52 and the second filter 30. The sample in the flow path is moved toward the second temperature region 48 by, for example, pressurizing or blowing air from the first air communication port 24 . The second chamber 34 has the role of suppressing the sample from reaching the second filter 30 by being pushed excessively or by overrunning the second temperature region 48 or the third serpentine flow path 52 .

As shown in FIG. 3, the second chamber 34 has a third connecting portion 34a, which is a connecting portion with the end of the flow path extending from the third meandering flow path 52, and a flow path toward the second filter 30. It includes a fourth connection part 34b that is a connection part with the roadside. The second chamber 34 has a second structure 34c near the third connection part 34a. This second structure 34c suppresses the liquid sample that has entered the second chamber 34 from the third connection part 34a from going directly to the fourth connection part 34b, and prevents the sample from flowing in the direction of the second filter 30. Contributes to suppressing intrusion.

The first chamber 32 and the second chamber 34 may have a function other than preventing sample overrun. For example, the first chamber 32 and the second chamber 34 may be used as reaction chambers. Specifically, a PCR reagent is held in the first chamber 32 and the second chamber 34 in advance, and a sample is added to the PCR reagent in the first chamber 32 and the second chamber 34, and then PCR is performed. good.

As shown in FIG. 3, a first widened channel 60 may be provided between the first meandering channel 54 and the first chamber 32. The first widened channel 60 is adjacent to the channel belonging to the first temperature region 46 and is provided further back than the first meandering channel 54 when viewed from the connecting channel 50 . Further, a second widened channel 62 may be provided between the second meandering channel 56 and the third meandering channel 52. The second widened channel 62 is adjacent to the channel belonging to the second temperature region 48 and is formed further back than the channel belonging to the second temperature region 48 when viewed from the connecting channel 50 .

The first widened channel 60 is provided so that its cross-sectional area is larger than the cross-sectional area of the first meandering channel 54. Similarly, the second widened channel 62 is provided so that its cross-sectional area is larger than the cross-sectional area of the second meandering channel 56. The first widened channel 60 and the second widened channel 62 have the role of exerting a braking effect on the sample flowing through the first serpentine channel 54 and the second serpentine channel 56, respectively. This utilizes Bernoulli's law, which states that the speed of fluid passing through a flow tube is inversely proportional to the cross-sectional area of the flow tube. When the sample flows through the first temperature area 46 and the second temperature area 48, a brake is applied to the sample to try to stop the sample within the first temperature area 46 and the second temperature area 48. Features will be added. Further, by providing a region where the cross-sectional area changes in a part of the flow path 12 in this way, stirring and mixing of the sample can be promoted in the region. Thereby, the sample can be effectively separated into a solid component and a transparent solution component as described below.

The microfluidic chip 10 may have at least one sample introduction port for introducing a sample into the flow channel.The sample introduction port is for introducing a sample containing a nucleic acid to be amplified into the flow channel. This is an inlet for The shape, size, and arrangement of the sample introduction port are not limited as long as the sample introduction port has a structure in which the hole is opened from the main surface of the substrate 14 and communicates with any channel. In FIGS. 3 and 4, as an example, the sample introduction port 44 is provided so as to communicate with the third meandering channel 52. 3 and 4, the channel 12 is provided on the surface 14a and the sample introduction port 44 is provided on the surface 14b, and although they are formed on opposing surfaces of the substrate 14, they are not provided on the same surface of the substrate 14. You can leave it there. A microfluidic chip according to another embodiment may include two sample introduction ports (a first sample introduction port and a second sample introduction port).

As shown in FIG. 1, a first sealing film 16 for sealing at least the flow path is attached to the first surface 14a of the substrate 14. The first sealing film 16 may be large enough to cover substantially the entire first surface 14a of the substrate 14. The first sealing film 16 is arranged at positions corresponding to the air communication ports 24 and 26 so that the air communication ports 24 and 26 are not sealed in order to connect the nozzle communicating with the discharge port of the pump of the liquid delivery system. A hole may be made in advance. The first sealing film 16 may have a form in which the air communication ports 24 and 26 are sealed. In this case, when the microfluidic chip 10 is used, the air communication ports 24 and 26 are attached with nozzles that communicate with the discharge port of a pump used in a liquid delivery system for pressurizing or blowing air inside the channel. If a hollow needle or the like is provided at the nozzle end, the output port of the pump and the air communication ports 24 and 26 can be communicated after perforating the film with the tip of the needle.

On the first surface 14a of the substrate 14, a first sealing film 16 is used to seal the flow path 12, the filter spaces 36, 38, and the chambers 32, 34, excluding the air communication ports 24, 26. For example, the second adhesive sealing film 18 may be attached so that only the second air communication port 26 is sealed. At this time, the first air communication port 24 does not need to be covered with a sealing film for sealing. When a sample is introduced into the microfluidic chip 10 through the sample introduction port 44, the first air communication port 24 functions as an air exhaust port corresponding to the volume of the sample introduced into the channel. Then, the output end of the pump of the liquid delivery system may be directly connected to the air communication ports 24 and 26 of the microfluidic chip 10 into which the sample has been introduced into the flow path. At this time, the second sealing film may be peeled off. During circulation, the first air communication port 24 is open, but the other ports, including the second air communication port 26, are sealed with a sealing film, so dust and dirt are removed from the first air communication port 24. , it is difficult for dust to enter, and it is possible to suppress contamination.

As shown in FIG. 2, the second surface 14b of the substrate 14 includes groove-shaped air ducts 40, 42 that communicate the air communication ports 24, 26 with the filter spaces 36, 38, and groove-shaped air ducts 40, 42 for introducing the sample into the flow path. A sample inlet 44 is provided. A third sealing film 20 for sealing the groove-shaped air ducts 40 and 42 may be attached to the second surface 14b of the substrate 14. Furthermore, a fourth sealing film for sealing the sample introduction port 44 may be attached to the second surface 14b of the substrate 14. If the air ducts 40, 42 and the sample inlet 44 are located close to each other, the third sealing film 20 may seal the air ducts 40, 42 and the sample inlet 44 at the same time. At this time, the fourth sealing film is not necessary.

1 and 2 show an example in which the substrate 14 and each of these sealing films 16, 18, and 20 are attached and integrated. FIG. 2 shows an example of the third sealing film 20 that seals the air ducts 40, 42 and the sample introduction port 44 at the same time.

An example in which a sample is introduced into the channel through the sample introduction port 44 will be described. First, the operator peels off the third sealing film 20 to open the sample introduction port 44. At this time, the third sealing film 20 is peeled off to the extent that the sample introduction port 44 is opened, and the groove-shaped air ducts 40 and 42 remain sealed.

Next, the measured sample is introduced into the channel 12 through the sample introduction port 44 using a pipette, dropper, syringe, or the like. Furthermore, by operating a pipette, dropper, syringe, etc., the sample may be pushed until it reaches the first temperature region 46 or the second temperature region 48 of the thermal cycle region. In this case, the position reached by the sample can be used as the initial position of the sample during PCR or thermal cycling. The introduced sample forces air in a volume approximately equal to the volume of the sample into the flow path, and is released from the open first air communication port 24. At this time, the first air communication port 24 becomes an exhaust port when introducing the sample.

Next, the third sealing film 20 is pasted back on. The third sealing film 20 preferably has characteristics that can withstand multiple cycles of pasting and peeling. This is preferable from the viewpoints of maintaining cleanliness of the microfluidic chip 10 during distribution and convenience of sample introduction work.

In addition, the second sealing film 18 and the third sealing film 20 are initially attached to the main surface of the substrate 14, but are partially peeled off (possibly reattached) during use. To facilitate this, tabs 18a and 20a having non-adhesive surfaces may be provided at the edges of the film. This helps improve the convenience of the operator in opening the sample introduction port 44 and the air communication ports 24 and 26 of the microfluidic chip 10.

Further, the third sealing film 20 may have a corner portion 20b between the sample introduction port 44 and the air duct 42, as shown in FIG. This corner portion 20b serves as a guideline for the limit to which the third sealing film 20 can be peeled off when the operator opens only the sample introduction port 44. Furthermore, the film may be made less likely to break by providing a substantially circular cut in the corner portion to emphasize the guideline, or by peeling the film halfway.

FIG. 6 is a schematic diagram for explaining a PCR device (also referred to as a “thermal cycle device,” “thermal cycler,” or “reaction processing device”) 100 for performing thermal cycles and PCR that can use the microfluidic chip 10. It is a diagram.

The PCR device 100 includes an installation section 101 in which the microfluidic chip 10 is installed, a first heater 102 for heating the first temperature region 46 of the channel 12 that is controlled to a relatively high temperature, and a second heater 102 for heating the first temperature region 46 of the channel 12 that is controlled to a relatively high temperature. A temperature control system including a second heater 104 for heating the temperature region 48 and a temperature sensor (not shown) such as a thermocouple for measuring the actual temperature of each reaction region is provided. Each heater may be, for example, a resistance heating element, a Peltier element, or the like. These heaters, an appropriate heater driver, and a control device 110 composed of a microcomputer, microprocessor, electronic circuit, etc. control the first temperature region 46 in the flow path 12 of the microfluidic chip 10 to approximately 95° C. and the second temperature to approximately 95° C. Zone 48 is maintained at approximately 60° C., setting the temperature of each reaction zone of the thermal cycling zone necessary to perform PCR. Further, in order to properly operate each of these parts, the PCR device 100 includes a battery built into the device and a power supply unit (both not shown) for receiving power from an external source. Descriptions and descriptions of drivers for driving each part will be omitted.

The PCR device 100 further includes a fluorescence detection device 106. A predetermined fluorescent probe is added to the sample S. Since the intensity of the fluorescent signal emitted from the sample S increases as the amplification of the DNA progresses, the intensity value of the fluorescent signal can be used as an index as a material for determining the progress of PCR and its termination.

The fluorescence detection device 106 is an optical fiber type fluorescence detection device manufactured by Nippon Sheet Glass Co., Ltd., which has a very compact optical system, can perform measurements quickly, and can detect fluorescence regardless of whether it is in a bright or dark place. A device FLE-510 can be used. This optical fiber type fluorescence detector can tune the wavelength characteristics of its excitation light/fluorescence to be suitable for the fluorescence characteristics emitted by the sample S, and can provide the optimal optical and detection system for samples with various characteristics. Furthermore, the small diameter of the light beam provided by the fiber optic fluorescence detector makes it suitable for detecting fluorescence from samples present in small or narrow areas such as flow channels. He also has good speed.

The optical fiber type fluorescence detection device 106 includes an optical head 108, a fluorescence detection device main body (including a driver) 112, and an optical fiber 114 connecting the optical head 108 and the fluorescence detection device main body 112. The fluorescence detection device main body 112 includes an excitation light source (LED, laser, or other light source adjusted to emit a specific wavelength), an optical fiber type multiplexer/demultiplexer, and a photoelectric conversion element (PD, APD, or photomultiplier, etc.). (photodetector) (none of which are shown), etc., and includes a driver, a microcomputer, etc. for controlling these. The optical head 108 consists of an optical system such as a lens, and has the functions of directional irradiation of excitation light onto the sample and collection of fluorescence emitted from the sample. The collected fluorescence is separated from excitation light through an optical fiber 114 by an optical fiber multiplexer/demultiplexer in the fluorescence detector driver, and converted into an electrical signal by a photoelectric conversion element. As the optical fiber type fluorescence detector, the one described in JP-A No. 2010-271060 can be used. The optical fiber type fluorescence detection device 106 can also be modified to enable coaxial detection of multiple wavelengths using a single optical head or multiple optical heads. Regarding the fluorescence detector related to multiple wavelengths and its signal processing, the invention described in International Publication No. 2014/003714 can be utilized.

In the PCR apparatus 100, the optical head 108 is arranged so as to be able to detect fluorescence from the sample S in the detection channel 59. The reaction progresses as the sample S is repeatedly moved back and forth within the thermal cycle area within the flow path, and the predetermined DNA contained in the sample S is amplified, so by monitoring changes in the amount of detected fluorescence, The progress of DNA amplification can be known in real time (real-time PCR). Furthermore, in the PCR apparatus 100, the output value from the fluorescence detection device 106 is used to control the movement of the sample S. For example, the output value from the fluorescence detection device 106 may be sent to the control device 110 and used as a parameter when controlling the liquid feeding system 120, which will be described later. The fluorescence detection device 106 is not limited to an optical fiber type fluorescence detection device as long as it exhibits the function of detecting fluorescence from a sample.

Further, the fluorescence detection device 106 can be provided with a plurality of excitation light/fluorescence light sets. For example, the first fluorescence detection device irradiates blue excitation light to detect green fluorescence emitted from the sample, and the second fluorescence detection device irradiates green excitation light to detect red fluorescence. It may be set as follows. In addition, a fluorescence detection device may be arranged in which the combination of excitation light/fluorescence wavelength characteristics is set in advance depending on the combination of nucleic acids and fluorescent probes to be detected.

In the PCR device 100, the optical head 108 of the fluorescence detection device 106 is arranged to detect fluorescence from the sample within the connecting channel 50 within the thermal cycle region. The connection channel 50 is a channel that connects the first temperature region 46 and the second temperature region 48 . As described above, the area where fluorescence from the sample is expected to be detected is referred to as the fluorescence detection area 58. Further, a channel belonging to the fluorescence detection region 58 is referred to as a detection channel 59. The detection flow path 59 is provided on the first surface 14a of the substrate 14 where the flow path is formed.

The PCR apparatus 100 further includes a liquid feeding system 120 for moving and stopping the sample S within the channel of the microfluidic chip 10. The liquid feeding system 120 moves the sample S into the flow path by feeding (blowing) air from either the first air communication port 24 or the second air communication port 26, although this is not limited thereto. can be moved in one direction. Further, the liquid feeding system 120 can be stopped at a predetermined position by stopping the air blowing to the channel or by equalizing the pressure on both sides of the sample S in the channel.

As shown in FIG. 6, the liquid feeding system 120 in this embodiment includes a liquid feeding pump 128, a first three-way valve 122, a second three-way valve 124, and a pressurizing chamber 126. Further, the liquid feeding system 120 may include a tube and a nozzle that connect the discharge port of the liquid feeding pump 128 and the air communication port.

The pressurized chamber 126 forms a space having a certain volume inside thereof. The pressurized chamber 126 is configured to be able to change the pressure in its internal space. The pressure inside the pressurized chamber 126 is maintained at least at a pressure higher than the atmospheric pressure of the surrounding environment of the PCR apparatus 100 (for example, 1.05 to 1.3 atmospheres) while performing PCR. In order to increase the pressure within the pressurizing chamber 126, the PCR device 100 uses a pressurizing pump, a blower pump, a blower, a micro pump, a syringe, etc. whose output port is connected to the pressurizing chamber 126, including but not limited to these. It may include a pump or the like (not shown). The atmospheric pressure of the surrounding environment of the PCR device 100 refers to the location where the PCR device 100 is installed, the location where PCR is performed by the PCR device 100, or when the PCR device 100 is installed in a location separated from the surroundings. Refers to the pressure (or atmospheric pressure) in that divided area. The pressure in the pressurized chamber 126 should be increased to such an extent that even if the sample is repeatedly exposed to high temperatures (approximately 95° C.), significant evaporation of the sample and generation of bubbles that would affect the PCR reaction process can be prevented. good. The higher the pressure inside the pressurized chamber 126, the more effective it is to suppress the effects of sample evaporation, etc. However, on the other hand, the liquid delivery system 120, including its handling, becomes more complicated and larger. can comprehensively judge the use, purpose, cost, effectiveness, etc. of the equipment and design the entire system.

The pressurized chamber 126 is provided with an atmospheric pressure release valve (leak valve) 127 . The atmospheric pressure release valve 127 is controlled so that the pressure within the liquid delivery system 120 and the channel 12 of the microfluidic chip 10 becomes equal to atmospheric pressure when the microfluidic chip 10 is attached or detached. This makes it possible to prevent the sample S from rapidly moving or popping out.

A liquid feeding pump 128 is arranged within the pressurized chamber 126. The liquid feeding pump 128 may be a blower or a micro blower in which the pressure on the primary side (air suction side) and the secondary side (air discharge side) are equal when stopped. It should be noted that the liquid feeding pump 128 has the role of feeding air into the flow path and moving the liquid sample in response to the air flow and the increase in pressure, and is not a pump that actually feeds the liquid itself.

The first port A of the first three-way valve 122 is connected to the output port (discharge port) 128a of the liquid feeding pump 128. The second port B of the first three-way valve 122 communicates with the internal space of the pressurizing chamber 126 . The third port C of the first three-way valve 122 is connected to one end of the first tube 130, and the other end of the first tube 130 is connected to the first output port 131 of the microfluidic chip 10 as the first output port 131 of the liquid delivery system 120. It is connected to the air communication port 24. The first three-way valve 122 is configured such that the first air communication port 24 of the microfluidic chip 10 communicates with the output port 128a of the liquid feeding pump 128, and the first air communication port 24 of the microfluidic chip 10 communicates with the pressurizing chamber 126. It is possible to switch between the state in which it is open to the interior space of the When communicating the first air communication port 24 of the microfluidic chip 10 and the output port 128a of the liquid feeding pump 128, the first three-way valve 122 is controlled so that port A and port C communicate with each other. On the other hand, when opening the first air communication port 24 of the microfluidic chip 10 to the internal space of the pressurizing chamber 126, the first three-way valve 122 is controlled so that port B and port C communicate with each other.

The first port A of the second three-way valve 124 is connected to the output port 128a of the liquid feeding pump 128. The second port B of the second three-way valve 124 communicates with the internal space of the pressurized chamber 126 . The third port C of the second three-way valve 124 is connected to the second air communication port 26 of the microfluidic chip 10. The third port C of the second three-way valve 124 is connected to one end of the second tube 132, and the other end of the second tube 132 is connected to the second port C of the microfluidic chip 10 as the second output port 133 of the liquid delivery system 120. It is connected to the air communication port 26. The second three-way valve 124 is configured such that the second air communication port 26 of the microfluidic chip 10 communicates with the output port 128a of the liquid feeding pump 128, and the second air communication port 26 of the microfluidic chip 10 communicates with the pressurizing chamber 126. It is possible to switch between the state in which it is open to the interior space of the When communicating the second air communication port 26 of the microfluidic chip 10 with the output port 128a of the liquid feeding pump 128, the second three-way valve 124 is controlled so that port A and port C communicate with each other. On the other hand, when the second air communication port 26 of the microfluidic chip 10 is opened to the internal space of the pressurizing chamber 126, the second three-way valve 124 is controlled so that port B and port C communicate with each other.

The liquid feeding pump 128, the first three-way valve 122, and the second three-way valve 124 can be operated by the control device 110 through an appropriate driver. In particular, the optical head 108 arranged as described above transmits an output value based on the obtained fluorescence signal to the control device 110 to make the control device 110 recognize the position of the sample S in the flow path and its passage. By doing so, the liquid feeding system 120 can be controlled.

A case will be described in which the sample S is moved from the first temperature region 46 to the second temperature region 48 using the liquid feeding system 120. The liquid feeding pump 128 is controlled to be in an operating state (ON). Further, the first three-way valve 122 is controlled so that the first port A and the third port C communicate with each other, and the second three-way valve 124 is controlled so that the second port B and the third port C communicate with each other. As a result, the first air communication port 24 of the microfluidic chip 10 communicates with the output port 128a of the liquid feeding pump 128, and the second air communication port 26 of the microfluidic chip 10 opens to the internal space of the pressurizing chamber 126. It will be in a state where it is In this embodiment, the liquid feeding pump 128 is disposed within the pressurizing chamber 126, so when air is discharged from the liquid feeding pump 128, the pressure in the first air communication port 24 of the microfluidic chip 10 decreases to 2 air communication port 26, and the sample S moves from the first temperature region 46 toward the second temperature region 48. When the sample S reaches the second temperature region 48, the first three-way valve 122 has the second port B and the third port C in communication, and the second three-way valve 124 has the second port B and the third port C in communication. It is controlled to a certain state. As a result, the first air communication port 24 and the second air communication port 26 are both opened to the internal space of the pressurizing chamber 126, so the sample S is stopped in the second temperature region 48. Conversely, when moving the sample S from the second temperature region 48 to the first temperature region 46, the first three-way valve 122 and the second three-way valve 124 may be operated in the opposite manner to the above.

In this way, by sequentially and continuously operating the first three-way valve 122 and the second three-way valve 124 connected to both sides of the flow path 12, the sample S is brought into the first temperature range within the flow path. 46 and the second temperature region 48, thereby making it possible to subject the sample S to an appropriate thermal cycle.

In the PCR device 100, a liquid feeding pump 128 is disposed in the internal space of a pressurized chamber 126 set at a pressure higher than the atmospheric pressure of the surrounding environment (for example, 1.3 atm), and the first three-way valve 122 and the second The second port B of the three-way valve 124 is configured to be open to the internal space of the pressurizing chamber 126. Therefore, during reaction processing, the entire channel 12 of the microfluidic chip 10 is maintained at a pressure higher than the atmospheric pressure of the surrounding environment. This can be especially advantageous when the PCR device 100 is used, for example, at high altitudes such as Mexico City or inside an airplane in flight. The first temperature of the first temperature region 46 is at or around 95°C. Since the pressure at high altitudes and inside airplanes is lower than 1 atm, there is a possibility that part of the sample S will boil even at 95°C. However, by employing the liquid delivery system 120 including the pressurized chamber 126 of the PCR apparatus 100, it is possible to suppress undesirable boiling of the sample in such a low atmospheric pressure environment. Further, the PCR apparatus 100 can be used without problems even in an environment of low atmospheric pressure.

The liquid feeding system may adopt a form other than the form shown in FIG. 6. As the pump, a syringe pump, diaphragm pump, microblower, blower, etc. can be used. Since two pumps are used, it may be necessary to adjust individual differences between the pumps in order to stop the pump accurately in the target temperature range. Also in this case, for the two pumps, it is possible to use an air blowing pump consisting of an air blower or a micro blower whose pressure on the primary side (air suction side) and secondary side (air discharge side) are equal when stopped. When moving the sample, operate only the pump corresponding to that direction. When stopping the sample, stop both pumps. This balances the pressure on both sides of the sample, allowing the sample to stop.

The PCR device 100 to which the microfluidic chip 10 equipped with the flow path 12 can be applied is also called a reciprocal flow type real-time PCR device.

As mentioned above, in conventional PCR methods using PCR tubes or microplates, when performing real-time PCR using blood as a sample, nucleic acids are extracted and purified from blood to remove dyes that inhibit fluorescence signal measurement. It was necessary to perform operations such as adding the blood to the PCR reagent after diluting the blood, or diluting the blood by, for example, 10 times or more and then adding only a small amount of blood to the PCR reagent. This is because in conventional PCR methods, when PCR is performed on a sample in which blood is directly added to a PCR reagent, the blood components become brown due to heat denaturation in the initial stage of PCR, and the fluorescence transmittance of the sample decreases. Particularly, this is because the intensity of the fluorescent signal accompanying PCR amplification cannot be accurately measured. That is, in conventional PCR methods, the color of blood components in the sample interferes with fluorescence detection.

While conducting real-time PCR experiments on various samples, the present inventor discovered a microfluidic chip 10 equipped with a microscopic channel 12 through which the sample flows as described above, and a thermal recycler applied to the microfluidic chip 10. It has been found that by using the PCR apparatus 100, it is possible to suitably measure the fluorescence signal accompanying PCR amplification even for a sample in which blood is directly added to a PCR reagent.

FIG. 7 is a flowchart for explaining the PCR method according to this embodiment. The PCR method according to this embodiment is a real-time PCR method using blood as a sample.

In the PCR method according to this embodiment, first, blood is added to a PCR reagent to prepare a sample (S10). "Blood" here means "whole blood." In this specification, "adding blood to a PCR reagent" means adding whole blood directly to a PCR reagent as it is; adding nucleic acid purified from blood to a PCR reagent, or adding blood to a PCR reagent. Adding simply purified crude to a PCR reagent is not called adding blood to a PCR reagent. Please note that in conventional technical literature, such addition of blood to a PCR reagent is sometimes expressed as "adding blood to a PCR reagent."

PCR reagents include primers and probes. The probe may be a TaqMan probe (TaqMan is a registered trademark of Roche Diagnostics Gesellschaft mit Beschrenchtel Haftsung).

A sample is prepared by adding a predetermined amount of blood to a predetermined amount of PCR reagent. The blood loading rate in the sample may be between 0.01% and 20%, preferably between 0.1% and 10%, more preferably between 1% and 5%. For example, by adding 1 μL of whole blood to 19 μL of PCR reagent, 20 μL of a sample with a blood addition rate of 5% can be prepared.

Next, the microfluidic chip 10 is prepared, and the prepared sample is introduced into the channel 12 within the microfluidic chip 10 (S12). The sample is introduced into the channel 12 through the sample introduction port 44 of the microfluidic chip 10 using a pipette, dropper, syringe, or the like.

In S10 and S12, the sample was prepared and then introduced into the microfluidic chip 10, but the sample may also be prepared within the microfluidic chip 10. For example, as described above, a PCR reagent may be held in the first chamber 32 and the second chamber 34 in advance, and blood may be added to the PCR reagent in the first chamber 32 and the second chamber 34.

Next, the sample is repeatedly moved back and forth between the first temperature region 46 and the second temperature region 48 of the microfluidic chip 10 to apply a thermal cycle to the sample (S14). The target nucleic acid is amplified by subjecting the sample to tens of thermal cycles.

During the thermal cycle in S14, a fluorescent signal emitted from the sample in the channel 12 is detected in order to monitor the progress of PCR of the sample (S16). Then, real-time PCR analysis is performed based on the detected fluorescence signal (S18). In real-time PCR analysis, an amplification curve is created with the horizontal axis representing the number of cycles (C) and the vertical axis representing the fluorescence signal intensity. When a thermal cycle is applied to a sample and the target nucleic acid in the sample is amplified, the intensity of the fluorescent signal increases. The number of cycles at which the fluorescence signal intensity rises exponentially is called the Ct value (threshold cycle number), and as the initial analyte concentration increases, the Ct value decreases. In real-time PCR analysis, it is extremely important to accurately measure the fluorescence signal intensity in order to determine the Ct value.

8 to 13 are diagrams for explaining how the sample S changes when the sample S is moved within the channel 12 of the microfluidic chip 10. 8 to 13 schematically illustrate the channel 12 formed on the first surface 14a of the microfluidic chip 10. Sample S is obtained by adding blood directly to the PCR reagent.

FIG. 8 shows the state immediately after the sample S is introduced into the channel 12 from the sample introduction port 44. Immediately after introduction, the sample S is located within the third meandering channel 52, as shown in FIG. Sample S immediately after introduction is red and transparent.

FIG. 9 shows a state in which the sample S is moved from the third meandering channel 52 to the first temperature region 46 through the second temperature region 48 and the connecting channel 50. As described above, the sample can be moved within the flow path 12 by pressurizing or blowing air through the air communication ports 24 and 26. In the first temperature region 46, heating is performed at approximately 95° C. for 15 seconds. As a result, the sample S changes from red and transparent to light brown and opaque.

FIG. 10 shows a state in which the sample S is moved from the first temperature region 46 to the second temperature region 48 through the connecting channel 50. In the second temperature region 48, heating is performed at approximately 60° C. for 15 seconds. As a result, the sample S gradually begins to separate into a solid component (precipitate) and a transparent solution component. The solid component of sample S is light brown and opaque, and the transparent solution component is light brown and transparent.

FIG. 11 shows a state in which the sample S is moved from the second temperature region 48 to the first temperature region 46 through the connecting channel 50. In the first temperature region 46, heating is performed at approximately 95° C. for 15 seconds. As a result, the aggregation of the solid components of the sample S progresses, and the separation of the colored solid components and the transparent solution components further progresses.

FIG. 12 shows a state in which the sample S is moved from the first temperature region 46 to the second temperature region 48 through the connecting channel 50. In the second temperature region 48, heating is performed at approximately 60° C. for 15 seconds. This further progresses the aggregation of the solid components of the sample S, and as shown in FIG. 12, the separation of the colored solid components and the transparent solution component becomes clear. The solid component of sample S changes from light brown opaque to dark brown opaque. The clear solution component is light brown and transparent.

FIG. 13 shows a state in which the sample S is moved from the second temperature region 48 to the first temperature region 46 through the connecting channel 50. In the first temperature region 46, heating is performed at approximately 95° C. for 15 seconds. As a result, the aggregation of the solid components of the sample S further progresses, and the separation between the colored solid components (dark brown) and the transparent solution components (light brown and transparent) further progresses.

Thereafter, by repeatedly moving the sample S back and forth between the first temperature region 46 and the second temperature region 48 (several tens of cycles), PCR proceeds and the target nucleic acid is amplified. During this time, the sample S remains separated into a colored solid component (dark brown) and a transparent solution component (light brown and transparent).

The present inventor has discovered that by reciprocating several times between the first temperature region 46 and the second temperature region 48 at the initial stage of PCR, the sample S, which is blood as a specimen, becomes an opaque colored solid component as described above. It was found that the liquid was separated into clear solution components. In general PCR, in which reagents do not move, separation of blood components does not occur after blood is heated and denatured, so it is difficult to accurately measure the intensity of the fluorescent signal due to PCR amplification. By separating the sample S into a colored solid component and a transparent solution component, the intensity of the fluorescent signal emitted from the transparent solution component can be accurately measured, making it possible to suitably perform real-time PCR analysis. can.

In the PCR method according to the present embodiment, the phenomenon in which the sample is separated into a solid component and a transparent solution component in the channel 12 is due to the sample being stirred and mixed during the process of moving the sample in the channel 12. It is presumed that. In the microfluidic chip 10, the first temperature region 46 and the second temperature region 48 include a first meandering channel 54 and a second meandering channel 56, which are a combination of a straight channel and a curved channel. . By flowing the sample through the curved channel, the sample is stirred and mixed more than when simply flowing through the straight channel, so that the separation effect between the fixed component and the transparent solution component of the sample is promoted.

The microfluidic chip may be configured such that the cross-sectional area of a portion of the channel 12 is different from the cross-sectional area of the other portion. In this case, the sample is more agitated and mixed by the unevenness of the portion where the cross-sectional area changes, so that the separation effect between the fixed component and the transparent solution component of the sample is promoted. An example of this is shown below.

FIG. 14 is a plan view of the first surface 14a of another microfluidic chip 70 applicable to the PCR method according to the embodiment of the present invention. As shown in FIG. 14, in the microfluidic chip 70, the cross-sectional area of the detection channel 59 in the connecting channel 50 is larger than the cross-sectional area of the first meandering channel 54 and the second meandering channel 56. There is. The unevenness of the portion where the cross-sectional area of the flow path changes allows the sample to be more agitated and mixed, so that the separation effect between the fixed component and the transparent solution component of the sample is promoted.

PCR reagents may also include a surfactant. When a surfactant is added to the PCR reagent, the sample can be suitably mixed while flowing through the channel 12. As the surfactant, any of cationic surfactants, anionic surfactants, zwitterionic surfactants, and nonionic surfactants can be used, including polymer-based and low-molecular surfactants. Any of these can be used. Examples of surfactants include pure soap, alpha sulfo fatty acid ester salts, linear alkylbenzene sulfonates, alkyl sulfate ester salts, alkyl ether sulfate ester salts, alpha olefin sulfonates, alkyl sulfonates, and sucrose fatty acid esters. , sorbitan fatty acid ester, polyoxyethylene sorbitan fatty acid ester, polyoxyethylene fatty acid ester, fatty acid alkanolamide, alkyl glucoside, polyoxyethylene alkyl ether, polyoxyethylene alkylphenyl ether, alkylamino fatty acid salt, alkyl betaine, alkyl amine oxide, Contains alkyltrimethylammonium salts and dialkyldimethylammonium salts, specifically N,N-Bis (3-D-gluconamidopropyl) cholamide [BIGCHAP], N,N-Bis (3-D-gluconamidopropyl) deoxycholamide [Deoxy- BIGCHAP], NIKKOL BL-9EX [Polyoxyethylene (9) Lauryl Ether], Octanoyl-N-methylglucamide [MEGA-8], Nonanoyl-N-methylglucamide [MEGA-9], Decanoyl-N-methylglucamide [MEGA-10], Polyoxyethylene (8) Octylphenyl Ether [Triton X-114], Polyoxyethylene (9) Octylphenyl Ether [NP-40], Polyoxyethylene (10) Octylphenyl Ether [Triton 20) Sorbitan Monopalmitate [Tween 40], Polyoxyethylene (20) Sorbitan Monostearate [Tween 60], Polyoxyethylene (20) Sorbitan Monooleate [Tween 80], Polyoxyethylene (20) Sorbitan Trioleate, Polyoxyethylene (23) Lauryl Ether [Brij35], Polyoxyethylene ( 20) Cethyl Ether [Brij58], n-Dodecyl-β-D-maltopyranoside, n-Heptyl-β-D-thioglucopyranoside, n-Octyl-β-D-glucopyranoside, n-Octyl-β-D-thioglucopyranoside, n- Nonyl-β-D-thiomaltoside, IGEPAL CA-630, Digitonin, Saponin, from Soybeans, 3-[(3-Cholamidopropyl)dimethylammonio]-2-hydroxy-1-propanesulfonate [CHAPSO], 3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate [CHAPS], Sodium Dodecylsulfate [SDS], Lithium Dodecyl Sulfate [LDS], Lithium 3,5-Diiodosalicylate, Tris(hydroxymethyl)aminomethane Dodecyl Sulfate [Tris DS], Sodium Cholate, N-Lauroylsarcosine, Sodium N-Dodecanoylsalcosinate, Cetyldimethylethylammonium Bromide, Cetyltrimethylammonium Bromide [CTAB], Cetyltrimethylammonium Chloride, Guanidine Thiocyanate, etc. are used.

PCR reagents may include additives. When additives are added to the PCR reagent, the sample can be suitably mixed while flowing through the channel 12. This is because proteins in the blood are denatured and do not interfere with PCR. In order to increase the efficiency and specificity of the amplification reaction of the present invention, ammonium sulfate, bovine serum albumin, dimethyl sulfoxide (DMSO), dimethyl formamide (DMF), betaine, formamide, gelatin, glycerol, PEG6000, SDS, spermidine, etc. It is effective to add additives such as , Triton, Triton X-100, urea, etc. in appropriate amounts. In addition to the addition of the above-mentioned substances, this can be carried out efficiently by mixing an alkaline solution with the sample. Examples of the alkaline solution include, but are not limited to, alkali metal hydroxide solutions, such as sodium hydroxide solution and potassium hydroxide solution. The alkali concentration (concentration of OH-1) can be 0.1 mM or higher, or 1 mM or higher, preferably 10 mM or higher, and more preferably 30 mM or higher. Alternatively, the pH can be set to 7 or higher, preferably 8 or higher, more preferably 9 or higher. The alkaline concentration and pH can be any concentration and pH (eg, 10 M or less) as long as it does not interfere with subsequent detection or amplification steps.

Examples will be described below.

(First example)
In the first example, a sample was prepared by adding blood directly to a PCR reagent using a reciprocal flow type real-time PCR device and a general real-time PCR device using a PCR tube, and real-time PCR measurement was performed. .

A sample was prepared under the following conditions. The primers listed in SEQ ID NO: 1 and 2 (each 0.9 μM) for amplifying the horse mackerel gene were added to SEQ ID NO: 3 so that the 2x PCR reagent of GoTaq (registered trademark) Enviro qPCR Systems (manufactured by Promega) was diluted 2 times. 19 μL of PCR reagent was prepared by adding the described probe (0.4 μM) and ^{10 5} copies of the template DNA described in SEQ ID NO: 4. 1 μL of whole blood or ddH ₂ O was added thereto to prepare a 20 μL sample, which was used as a sample per reaction for each device. The array is shown below.
Primer: 5'-CAGATATCGCAACCGCCTTT-3' (SEQ ID NO: 1)
Primer: 5'-CCGATGTGAAGGTAAATGCAAA-3' (SEQ ID NO: 2)
Probe: 5'-[FAM]-TATGACGCCAACGGCGCCT-[BHQ1]-3' (SEQ ID NO: 3)
Template DNA: 5'CAGATATCGCAACCGCCTTTACATCCGTAGCACACATCTGCCGGGACGTAAACTACGGCTGACTTATTCGCAATATGCACGCCAACGGCGCCTCCTTCTTTTTCATTTGCATTTACCTTCACATCGG-3' (SEQ ID NO: 4)

The real-time PCR device and PCR conditions are shown below. The reciprocal flow type measurement chip and real-time PCR device correspond to the microfluidic chip 10 and PCR device 100 described above.
(Reciprocating calflow type real-time PCR device and PCR conditions)
Measuring equipment: PicoGene PCR1100 (manufactured by Go Photon)
Measuring chip: MCP2000 (manufactured by Go Photon)
Measurement conditions: Set value at PCR1100
Hot Start 95℃,15sec.
Denature 95℃,3.5sec.
Annealing & Extension 60℃,15sec.
Cycle 50
(General real-time PCR equipment and PCR conditions)
Measuring equipment: CFX96 Touch Deep Well (manufactured by Bio-Rad)
Measurement tube: 8 tubes Measurement conditions: Actual measurement value of CFX96 Touch Deep Well (same as PCR1100)
Hot Start 95℃,15sec.
Denature 95℃,3.5sec.
Annealing & Extension 60℃,15sec.
Cycle 50

When a reciprocal flow type real-time PCR device is used, a sample obtained by adding blood to a PCR reagent is alternately sent to a first temperature region 46 of 95° C. and a second temperature region 48 of 60° C. in the flow path 12. As the sample was stirred and mixed, blood coagulation progressed, and the solid component and clear solution component were separated, making it possible to measure the fluorescence signal of the clear solution component.

FIGS. 15(a) and 15(b) show amplification curves when using a reciprocal flow type real-time PCR device. FIG. 15(a) is a real-time amplification curve of a sample with blood addition, and FIG. 15(b) is a real-time amplification curve of a sample without blood addition. As shown in FIGS. 15(a) and 15(b), similar amplification curves can be obtained for samples with and without blood addition, and it is very easy to determine the PCR amplification. .

In a general real-time PCR device, measurements were performed using a PCR tube. In a typical real-time PCR device, the PCR reaction proceeds while the sample remains stationary within the PCR tube. In the sample without blood addition, the sample was transparent both before and during PCR, and the fluorescence signal accompanying PCR amplification could be sufficiently measured. On the other hand, in a sample with blood added, it was red and transparent before PCR, but during PCR, the blood components become brown due to heat denaturation at the initial stage of PCR, and the fluorescence transmittance of the sample decreases. Therefore, it became impossible to sufficiently measure the fluorescence signal accompanying PCR amplification.

FIG. 16 shows an amplification curve when using a general real-time PCR device. As shown in FIG. 16, the amplification curve of the sample without blood addition has a clear rising edge, and PCR amplification can be clearly determined. On the other hand, in the amplification curve of the sample with blood addition, the rise of the curve is unclear, making it very difficult to determine PCR amplification.

(Second example)
In the second example, a sample was prepared by directly adding blood to an RT-PCR reagent using a reciprocal flow type real-time PCR device and a general real-time PCR device using a PCR tube. Measurements were taken.

A sample was prepared under the following conditions. Amplify the SFTS gene by adding a predetermined amount of reverse transcriptase attached to GoTaq (registered trademark) Enviro RT-qPCR Systems (manufactured by Promega) and diluting the 2x PCR reagent 2 times. 19 μL of RT-PCR reagent was prepared by adding the primers (0.9 μM each), the probe described in SEQ ID NO: 7 (0.3 μM), and ^{10 5} copies of the template RNA described in SEQ ID NO: 8. 1 μL of whole blood or ddH ₂ O was added thereto to prepare a 20 μL sample, which was used as a sample per reaction for each device. The array is shown below.
Primer: 5'-ACCTGTCTCCTTCAGCTTCT-3' (SEQ ID NO: 5)
Primer: 5'-TGTCAGAGTGGTCCAGGATT-3' (SEQ ID NO: 6)
Probe: 5'-FAM-TGGAGTTTGGTGAGCAGCAGC-BHQ1-3' (SEQ ID NO: 7)
Template RNA: 5'ACCTGTCTCCTTCAGCTTCTTGATGATCAATGCAGGATCAAGGCCTTCATAGGCCAGCTCTCTCGCAAAATCTTCAAGCTCAGTCAAATTGAGCTGCTGCTCACCAAAACTCCACTGCAATCCTGGACCACTCTGACA-3' (SEQ ID NO: 8)

The real-time PCR device and PCR conditions are shown below. The reciprocal flow type measurement chip and real-time PCR device correspond to the microfluidic chip 10 and PCR device 100 described above.
(Reciprocating calflow type real-time PCR device and PCR conditions)
Measuring equipment: PicoGene PCR1100 (manufactured by Go Photon)
Measuring chip: MCP2000 (manufactured by Go Photon)
Measurement conditions: Set value at PCR1100
RT 50℃,5min.
Hot Start 95℃,15sec.
Denature 95℃,3.5sec.
Annealing & Extension 60℃,20sec.
Cycle 45
(General real-time PCR equipment and PCR conditions)
Measuring equipment: CFX96 Touch Deep Well (manufactured by Bio-Rad)
Measurement tube: 8 tubes Measurement conditions: Actual measurement value of CFX96 Touch Deep Well (same as PCR1100)
RT 50℃,5min.
Hot Start 95℃,15sec.
Denature 95℃,3.5sec.
Annealing & Extension 60℃,20sec.
Cycle 45

When using a reciprocal flow type real-time PCR device, when the template is RNA as well as when the template is DAN, the sample prepared by adding blood to the RT-PCR reagent is subjected to a reverse transcription reaction in the flow path 12 at 50°C for 5 minutes, and then By alternately sending the liquid to the first temperature region 46 of 95° C. and the second temperature region 48 of 60° C., the blood coagulates while the sample is stirred and mixed, and its solid component and transparent solution component are separated. , it became possible to measure the fluorescent signals of the components of the transparent solution.

FIGS. 17(a) and 17(b) show amplification curves when using a reciprocal flow type real-time PCR device. FIG. 17(a) is a real-time amplification curve of a sample with blood addition, and FIG. 17(b) is a real-time amplification curve of a sample without blood addition. As shown in FIGS. 17(a) and 17(b), similar amplification curves can be obtained for samples with and without blood addition, and it is very easy to determine the PCR amplification. .

On the other hand, in a general real-time PCR apparatus, the RT-PCR reaction proceeds while the sample remains stationary within the PCR probe. In the sample without blood addition, the sample was transparent both before and during PCR, and the fluorescence signal accompanying PCR amplification could be sufficiently measured. In the sample with blood added, it was red and transparent before PCR, but during PCR, the blood components become brown due to heat denaturation in the initial stage of PCR, and the fluorescence transmittance of the sample decreases. Therefore, it became impossible to sufficiently measure the fluorescence signal accompanying RT-PCR amplification.

FIG. 18 shows an amplification curve when using a general real-time PCR device. As shown in FIG. 18, the amplification curve of the sample without blood addition has a clear rising edge, and PCR amplification can be clearly determined. On the other hand, in the amplification curve of the sample with blood addition, the rise of the curve is unclear, making it very difficult to determine PCR amplification.

From the PCR results of the first and second examples above, the PCR method according to the present embodiment suitably measures the fluorescence signal accompanying PCR amplification for a sample in which blood is directly added to a PCR reagent. It can be seen that real-time PCR analysis can be performed appropriately. The PCR method according to the present embodiment uses a sample obtained by directly adding blood to a PCR reagent, and therefore does not require complicated nucleic acid purification work. Therefore, quick real-time PCR is possible.

The present invention has been described above based on the embodiments. Those skilled in the art will understand that this embodiment is merely an example, and that various modifications can be made to the combinations of the constituent elements and processing processes, and that such modifications are also within the scope of the present invention. be.

10, 70 microfluidic chip, 12 channel, 14 substrate, 16 first sealing film, 18 second sealing film, 20 third sealing film, 24 first air communication port, 26 second air communication port, 28 1st filter, 30 2nd filter, 32 1st chamber, 34 2nd chamber, 40 1st air duct, 42 2nd air duct, 46 1st temperature region, 48 2nd temperature region, 54 1st serpentine flow path, 56 2nd meandering flow path, 58 fluorescence detection region, 59 detection flow path, 60 1st widened flow path, 62 2nd widened flow path, 100 PCR device, 101 installation section, 102 1st heater, 104 2nd heater, 106 Fluorescence detection device, 108 Optical head, 110 Control device, 120 Liquid feeding system, 122 First three-way valve, 124 Second three-way valve, 126 Pressurizing chamber, 128 Liquid feeding pump.

SEQ ID NO: 1: Primer SEQ ID NO: 2: Primer SEQ ID NO: 3: Probe SEQ ID NO: 4: Template DNA
SEQ ID NO: 5: Primer SEQ ID NO: 6: Primer SEQ ID NO: 7: Probe SEQ ID NO: 8: Template RNA

Claims (5)

preparing a sample by adding blood to a PCR reagent;
repeatedly moving the sample back and forth within a channel of a microfluidic chip to apply a thermal cycle to the sample;
detecting fluorescence from the sample in the flow path to monitor the progress of PCR of the sample;
Equipped with
The flow path includes a meandering flow path that is a combination of a straight flow path and a curved flow path,
In the step of applying the thermal cycle, the sample is separated into a colored solid component and a transparent solution component within the flow path by repeatedly moving the sample back and forth within the flow path including the meandering flow path. is,
A PCR method characterized in that, in the step of detecting fluorescence, fluorescence emitted from the transparent solution components is detected . The PCR method according to claim 1, characterized in that the addition rate of blood in the sample is 0.01% to 20%, preferably 0.1% to 10%, more preferably 1% to 5%. The PCR method according to claim 1 , wherein the PCR reagent contains a surfactant. 2. The PCR method according to claim 1 , wherein the PCR reagent contains an additive. The flow path includes a first temperature region maintained at a first temperature, a second temperature region maintained at a second temperature different from the first temperature, and the first temperature region and the second temperature region. a connecting channel for connecting;
The PCR method according to claim 1 , wherein the cross-sectional area of the connecting channel is larger than the cross-sectional area of the channels included in the first temperature region and the second temperature region.

Images