JP7372657B2 - Plants with increased resistance to Colorado potato beetle, methods for producing the same, and methods for determining resistance to Colorado potato beetles in plants - Google Patents

Description

The present invention relates to plants with increased resistance to the Colorado potato beetle and plant cells from which the plants can be regenerated. The present invention also relates to a method for producing the plant, and a composition for use in improving resistance of plants to the Colorado potato beetle. Furthermore, the present invention relates to a method for determining resistance to Colorado potato beetle in plants. The present invention also relates to a composition for use in introducing a hydroxyl group or an acetoxy group into the 23rd position of the spirosolane skeleton, or a composition for use in improving the amount of leptinin or leptin accumulated in plants.

The Colorado potato beetle (scientific name: Leptinotarsa decemlineata, English name: Colorado potato beetle) is an insect of the family Coleoptera, suborder Rhinocerosdae (suborder Polyphagus). It is a pest that parasitizes plants in the Solanaceae family and feeds on their leaves.It causes the most damage to potatoes (Solanum tuberosum, etc.), and can reduce production by 40% to 50% if pesticides are not used. There is also a report that an 80% loss may occur (Non-Patent Document 1). Although the Colorado potato beetle (CPB) has not landed in Japan, it has expanded its range from North America to Europe and Asia (Non-Patent Document 1). In recent years, it has become established in China, and in 2010, it was distributed over 270,000 square kilometers, and the growing area is spreading at a rate of 45 km/year in large areas (Non-Patent Document 2). Therefore, breeding of CPB-resistant potatoes and the like is an urgent task in Japan as well as an important issue worldwide.

In this regard, Solanum chacoense (wild variety) is known as a potato that is resistant to CPB. Also, S. It has been revealed that CPB-resistant potatoes derived from C. chacoense can exhibit the resistance by accumulating leptin (Non-patent Documents 3 and 4). Furthermore, these leptins are predicted to be biosynthesized through a two-step reaction from solanine and chaconine, which are accumulated in potatoes (S. tuberosum, etc.), which are commonly cultivated species (Non-Patent Document 5). . Furthermore, the genes responsible for the biosynthesis of leptin are S. chacoense-derived chromosomes No. 2 and No. 8 (Non-Patent Document 6).

However, this S. Chacoense is a wild species that has not been domesticated, and has a problem that it is not suitable for agricultural production because its yield and cultivability are significantly lower than that of ordinary edible potatoes. Therefore, S. Attempts have been made to obtain a line with CPB resistance in the progeny by crossing a line derived from S. chacoense with a normal potato (such as S. tuberosum). In order to breed potatoes as an excellent practical variety, it is necessary to introduce S. It is necessary to remove the genomic region derived from S. chacoense, which is usually done in S. This is done by backcrossing with S. tuberosum and the like. However, as mentioned above, the genes responsible for leptin biosynthesis have not been identified, and only the rough loci of genes 2 and 8 have been revealed. Therefore, it is not possible to perform individual selection using the presence of the gene as an indicator, and a commercial variety with CPB resistance has not yet been obtained.

Furthermore, as a method of imparting CPB resistance to plants such as potatoes, a method of introducing a gene responsible for leptin biosynthesis into potatoes etc. by genetic recombination, genome editing, etc. can also be considered. However, as mentioned above, since the gene has not been identified, CPB-resistant plants have not yet been produced using this method.

Maharijaya and Vosman (2015) Euphytica 4:133-142 Liu et al. (2012) Entomologia Experimentalis et Applicata 143:207-217 Sturckow and Low (1961) Entomologia Experimentalis et Applicata 4:133-142 Sinden et al. (1986) Environmental Entomology 15:1057-1062 Sagredo et al. (1999) Theor Appl Genet. 98:39-46 Sagredo et al. (2006) Theor Appl Genet. 114:131-42

The present invention was made in view of the problems of the prior art, and its purpose is to identify a gene that confers CPB resistance to plants, that is, a gene that is responsible for leptin biosynthesis. Another object of the present invention is to provide a method for efficiently producing plants with increased resistance to CPB using the identified genes. A further object of the present invention is to provide a method for efficiently determining resistance to CPB in plants using the presence of the above-mentioned genes as an indicator.

As mentioned above, the CPB-resistant potato S. In chacoense, leptin, which confers resistance, is predicted to be biosynthesized from solanine and chaconine (compounds having a solanidan skeleton). Regarding this biosynthesis, the present inventors focused on the metabolic process of α-tomatine (a compound having a spirosolane skeleton) in tomato (S. lycopersicum), which is also a Solanaceae plant (see the upper row of FIG. 1). And S. In chacoense, the 23-position hydroxylase (also referred to as "23DOX") and the 23-position acetyltransferase (also referred to as "23ACT"), which are similar to the metabolic process of α-tomatine in tomatoes, produce α-solanine and α-chaconine. It was hypothesized that this protein is involved in leptin biosynthesis via leptinin production, using the protein as a substrate (see the bottom panel of Figure 1).

So, first of all, S. lycopersicum and S. lycopersicum. We attempted to identify the genes encoding these enzymes for each of the enzymes. Although it has been revealed that 23DOX and 23ACT are involved in the metabolic process of α-tomatine, their sequences have not been clarified. Therefore, first, sequences of genes assumed to be involved in the metabolic process were selected from the tomato expression database, and their full-length ORF sequences were determined. Then, the obtained S. Based on the sequence of S. lycopersicum, We screened homologous genes in Chacoense and determined their full-length ORF sequences by the RACE method.

The S. lycopersicum and S. lycopersicum. The enzymes encoded by each gene of chacoense were synthesized in Escherichia coli, and their enzymatic activities were analyzed in vitro. As a result, S. lycopersicum and S. lycopersicum. 23DOX (also referred to as "Sl23DOX" and "Sc23DOX", respectively) of S. lycopersicum and S. lycopersicum. It has been revealed that 23ACT of chacoense (also referred to as "Sl23ACT" and "Sc23ACT", respectively) can acetylate the hydroxyl group.

However, contrary to previous predictions, even when α-solanine or the like is used as a substrate, 23DOX does not introduce a hydroxyl group into the 23-position of the compound, and the hydroxyl group is not acetylated by 23ACT, resulting in leptin could not be generated.

On the other hand, production of leptinin was detected in potatoes (S. tuberosum) into which the 23DOX gene was introduced, and production of leptin was also observed in potatoes into which the 23DOX gene and 23ACT gene were introduced.

From the above, S. In chacoense, leptin is not biosynthesized from compounds with a solanidan skeleton (α-solanine, α-chaconine) as previously assumed, but rather with a hydroxyl group at position 23 of a compound with a spirosolane skeleton, followed by an acetoxy group. It has been revealed that leptin is biosynthesized by introducing the group and further converting the spirosolane skeleton of these compounds to the solanidan skeleton.

In addition, primer sets that recognize the Sc23DOX gene and the Sc23ACT gene were created. Furthermore, S. We created a diploid hybrid between Chacoense and potato that does not produce leptin. As a result of performing PCR using the above primer set and analyzing the amount of leptin produced for these hybrids, we found that the presence of DNA markers (23DOX gene and 23ACT gene of S. chacoense) and the genetic behavior of leptin accumulation It was confirmed that they matched.

In addition, S. When tuberosum was analyzed for the presence or absence of the 23DOX gene and 23ACT gene, surprisingly, it was found that it has genes encoding proteins (St23DOX and St23ACT) that have high sequence identity with the above-mentioned 23DOX and 23ACT. It was revealed.

Furthermore, each protein encoded by these genes was synthesized in Escherichia coli, and their enzymatic activities were analyzed in vitro. As a result, it was revealed that St23DOX, like the above-mentioned Sl23DOX and Sc23DOX, can introduce a hydroxyl group into the 23-position of α-tomatine. Furthermore, it has been revealed that the hydroxyl group of St23ACT can be acetylated similarly to the above-mentioned Sl23ACT and Sc23ACT.

Based on the above findings, the present invention has been completed. More specifically, the present invention provides the following.
<1> A composition for use in introducing a hydroxyl group into the 23rd position of the spirosolane skeleton, comprising at least one DNA selected from the group consisting of the following (a) to (d) (a) SEQ ID NO: 2, 4, or DNA encoding a protein consisting of the amino acid sequence described in 6.
(b) DNA encoding a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6, and having the activity of hydroxylating the 23rd position of the spirosolane skeleton
(c) Consists of an amino acid sequence in which one or more amino acids are substituted, deleted, added, and/or inserted in the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6, and the 23rd position of the spirosolane skeleton is hydroxylated DNA encoding a protein that has the activity of
(d) Codes for a protein that hybridizes under stringent conditions with DNA consisting of a sequence complementary to the nucleotide sequence set forth in SEQ ID NO: 1, 3, or 5 and has the activity of hydroxylating the 23rd position of the spirosolane skeleton. Yes, DNA.
<2> To position 23 of the spirosolane skeleton, containing at least one DNA selected from the group consisting of (a) to (d) above and at least one DNA selected from the group consisting of (e) to (h) below. Composition (e) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 8, 10 or 12
(f) DNA encoding a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence set forth in SEQ ID NO: 8, 10, or 12 and having the activity of acetylating the hydroxyl group at position 23 of the spirosolane skeleton.
(g) Consists of an amino acid sequence in which one or more amino acids are substituted, deleted, added, and/or inserted in the amino acid sequence set forth in SEQ ID NO: 8, 10, or 12, and the hydroxyl group at position 23 of the spirosolane skeleton is acetylated. DNA encoding a protein that has the activity of
(h) A protein that hybridizes under stringent conditions with DNA consisting of a sequence complementary to the nucleotide sequence set forth in SEQ ID NO: 7, 9, or 11 and has the activity of acetylating the hydroxyl group at position 23 of the spirosolane skeleton. Code, DNA.
<3> A composition for use in improving leptinin accumulation in plants, comprising at least one DNA selected from the group consisting of (a) to (d).
<4> A composition for use in improving leptin accumulation in plants, comprising at least one DNA selected from the group consisting of (a) to (h).
<5> A composition for use in improving plant resistance to the Colorado potato beetle, comprising at least one DNA selected from the group consisting of (a) to (h).
<6> A transformed plant cell into which at least one DNA selected from the group consisting of (a) to (h) has been introduced and is capable of regenerating a plant with increased resistance to the Colorado potato beetle.
<7> A transformed plant with increased resistance to Colorado potato beetle, which is regenerated from the transformed plant cell according to <6>.
<8> A method for producing a plant with increased resistance to Colorado potato beetle, comprising:
A method comprising the steps of introducing at least one DNA selected from the group consisting of (a) to (h) above into a plant cell, and regenerating a plant from the transformed plant cell into which the DNA has been introduced in the step. .
<9> A method for determining resistance to Colorado potato beetle in a plant, comprising:
The presence or expression of at least one DNA selected from the group consisting of (a) to (d) and at least one DNA selected from the group consisting of (e) to (h) in the test plant. A method comprising the steps of: detecting; and determining that the test plant has resistance to the Colorado potato beetle if the presence or expression of the DNA is detected in the step.
<10> A method for producing a plant having resistance to Colorado potato beetle, comprising:
A step of crossing a plant having resistance to the Colorado potato beetle with any plant; and a step of determining resistance to the Colorado potato beetle in the plant obtained by the crossing in the step by the method described in <9>. and selecting plants determined to have resistance to the Colorado potato beetle.
<11> A method for producing a plant having resistance to Colorado potato beetle, comprising:
Crossing a plant having at least one DNA selected from the group consisting of (a) to (d) above with a plant having at least one DNA selected from the group consisting of (e) to (h) above. process and
A step of determining resistance to Colorado potato beetle in the plants obtained by the crossbreeding in the step by the method described in <9>;
and selecting plants determined to have resistance to the Colorado potato beetle.

In addition, S. The nucleotide sequence of the 23DOX gene derived from Chacoense and the amino acid sequence of the protein encoded by the sequence are shown in SEQ ID NOs: 1 and 2, respectively. S. The nucleotide sequence of the 23DOX gene derived from M. tuberosum and the amino acid sequence of the protein encoded by the sequence are shown in SEQ ID NOs: 3 and 4, respectively. S. The nucleotide sequence of the 23DOX gene derived from C. lycopersicum and the amino acid sequence of the protein encoded by the sequence are shown in SEQ ID NOs: 5 and 6, respectively.

Also, S. The nucleotide sequence of the 23ACT gene derived from Chacoense and the amino acid sequence of the protein encoded by the sequence are shown in SEQ ID NOs: 7 and 8, respectively. S. The nucleotide sequence of the 23ACT gene derived from M. tuberosum and the amino acid sequence of the protein encoded by the sequence are shown in SEQ ID NOs: 9 and 10, respectively. S. The nucleotide sequence of the 23ACT gene derived from C. lycopersicum and the amino acid sequence of the protein encoded by the sequence are shown in SEQ ID NOs: 11 and 12, respectively.

By using the hydroxylase gene and/or acetyltransferase gene identified in the present invention, it is possible to introduce a hydroxyl group or acetoxy group to the 23rd position of the spirosolane skeleton, and it is also possible to produce leptinin or leptin. It becomes possible. Furthermore, according to the present invention, by enhancing the biosynthetic ability of leptin and accumulating leptin, it is also possible to increase the resistance of plants to CPB. That is, it becomes possible to efficiently provide plants with increased resistance to CPB. Furthermore, according to the present invention, resistance to CPB in plants can be efficiently determined using the expression or presence of the gene as an indicator.

FIG. 1 is a schematic diagram showing glycoalkaloids in tomatoes (S. lycopersicum), CPB-resistant potatoes (S. chacoense) and CPB-non-resistant potatoes (S. tuberosum). The frame lines in the figure indicate steroid glycoalkaloids produced in each Solanaceae plant. means a glycoconjugate that binds. In addition, in the upper part of the figure (within the frame of S. lycopersicum), in the metabolic process of α-tomatine (a compound with a spirosolane skeleton) in tomatoes, 23-hydroxylase (23DOX) is added to the 23rd position of the skeleton. It shows that a hydroxyl group is introduced, and an acetyl group is further introduced into the hydroxyl group by 23-position acetyl transferase (23ACT). S. lycopersicum-derived 23DOX expression vector, S. lycopersicum-derived 23DOX expression vector. chacoense-derived 23DOX expression vector and S. chacoense-derived 23DOX expression vector. The results of detecting the 23-position hydroxylase activity using crude extracted fractions of Escherichia coli (indicated by "Sl23DOX", "Sc23DOX" and "St23DOX", respectively in the figure) into which vectors for expressing 23DOX derived from M. tuberosum were introduced are shown below. This is LC-MS chart data shown. In the figure, the vertical axis indicates intensity, and the horizontal axis indicates retention time (the notation in the figure is the same in FIGS. 4, 7, 9, 13, and 14). This is a mass spectrum of peaks (1) to (4) shown in FIG. 2. In the figure, the vertical axis indicates intensity, and the horizontal axis indicates mass-to-charge ratio (the notation in the figure is the same in FIGS. 5, 8, 10, and 15). S. lycopersicum-derived 23ACT expression vector, S. lycopersicum-derived 23ACT expression vector. chacoense-derived 23ACT expression vector, S. The crude extracted fractions of Escherichia coli (indicated by "Sl23ACT", "Sc23ACT", "St23ACT" and "23hydroxy-tomatine + negative control" in the figure) into which the E. tuberosum-derived 23ACT expression vector and the empty vector were introduced, respectively, were This is LC-MS chart data showing the results of detecting acetyltransferase at position 23 using the following methods. In the figure, "23acetoxy-tomatine" indicates chart data for the standard product. This is a mass spectrum of peaks (1) to (4) shown in FIG. 4. FIG. 2 is a diagram showing the structure of a vector used for transformation. The figure shows the right border (RB) and left border (LB) of the T-DNA of the gene portion to be introduced, the internal structure of these borders, and the restriction enzyme recognition site. CPB non-resistant potato ("S. tuberosum" in the figure), potato expressing Sc23DOX ("S. tuberosum Sc23DOX-ox-#9" in the figure), and CPB-resistant potato flower ("S. chacoense" in the figure) This is LC-MS chart data showing the results of an analysis of "Flowers"). This is a mass spectrum of peaks (1) to (4) shown in FIG. 7. A CPB non-resistant potato introduced with an empty vector ("vector control" in the figure), a potato expressing Sc23DOX and Sc23ACT ("Sc23DOX+Sc23ACT co-expression" in the figure), and a CPB-resistant potato flower ("S. chacoense" in the figure) This is LC-MS chart data showing the results of an analysis of "Flowers"). 9 is a mass spectrum of the peaks (peaks I and II, and leptin I and II) shown in FIG. 9. Shows the results of detecting the Sc23DOX gene by PCR using genomic DNA extracted from potato varieties that do not show CPB resistance, lines used for potato breeding, and the CPB-resistant wild variety "S. chacoense PI 458310" as templates. , is a photograph of gel electrophoresis. In the figure, "M" indicates a 100bp marker, "1" indicates the analysis result for Baron yam, "2" indicates the analysis result for May-In, "3" indicates the analysis result for Sayaka, and " 4" shows the analysis results for Sassy, "5" shows the analysis results for Konafubuki, "6" shows the analysis results for Desiree, "7" shows the analysis results for 97H32-6, and " 8" shows the analysis results for Saikai No. 35, "9" shows the analysis results for Hokkai No. 87, "10" shows the analysis results for VTn 62-33-3, and "11" shows the analysis results for W553- The analysis results for S.4 are shown, and "12" is for S.4. 12 shows the analysis results for Chacoense (PI 458310) (the notation in the figure is the same as in FIG. 12). Shows the results of detecting the Sc23ACT gene by PCR using genomic DNA extracted from potato varieties that do not exhibit CPB resistance, lines used for potato breeding, and the CPB-resistant wild variety "S. chacoense PI 458310" as templates. , S. coli expressing leptin. LC-MS chart data showing the results of steroid glycoalkaloid analysis of the hybrid obtained by crossing three seedling lines obtained from Chacoense PI 458310 and potato line 97H32-6 that does not express leptin. be. In the figure, "97H32-6" indicates the result of analysis of 97H32-6, and "2-34", "2-19" and "2-3" respectively indicate the hybrid PI 458310-2×97H32 shown in Table 1. -6 34, PI 458310-2×97H32-6 19 and PI 458310-2×97H32-6 3 are shown. LC-MS chart data showing the results of analysis of the CPB non-resistant potato variety Konafubuki introduced with the empty vector ("vector control" in the figure) and Konafubuki expressing Sc23DOX ("Sc23DOX #15" in the figure). be. In the box in the figure, chart data for a holding time of 14.5 to 15.5 minutes is shown enlarged. 15 is a mass spectrum of the peaks (leptin I and II) shown in FIG. 14.

<About the composition of the present invention>
As shown in the Examples below, the present inventors have developed tomato (S. lycopersicum) and CPB-resistant potato S. lycopersicum. The 23-position hydroxylase (23DOX) genes (Sl23DOX gene and Sc23DOX gene) in S. chacoense were isolated, and their sequences were identified. And, potato S. in which leptinin biosynthesis is not observed. As a result of introducing the 23DOX gene into S. tuberosum, a hydroxyl group is introduced into the 23rd position of the steroid glycoalkaloid having a spirosolane skeleton, and the spirosolane skeleton is further converted to a solanidan skeleton, resulting in significant biosynthesis of leptinin in the potato. has become recognized.

Furthermore, the 23DOX gene was added to S. It was also revealed that although the potato also has the potato tuberosum, its expression level is not sufficient, and therefore leptinin biosynthesis is not observed in the potato.

Therefore, the present invention can be used to introduce a hydroxyl group into the 23rd position of the spirosolane skeleton, including a DNA encoding a protein having the activity of hydroxylating the 23rd position of the spirosolane skeleton (hereinafter also referred to as "23DOX of the present invention"). or a composition for use in improving the amount of leptinin accumulated in plants.

In addition, as shown in the Examples below, the present inventors have also developed S. lycopersicum and S. lycopersicum. The 23-position acetyltransferase (23ACT) genes (Sl23ACT gene and Sc23ACT gene) in S. chacoense were also isolated, and their sequences were identified. Potato S. cerevisiae does not exhibit leptin biosynthesis and has no resistance to CPB. As a result of introducing the 23DOX gene and the 23ACT gene into S. tuberosum, the hydroxyl group introduced by 23DOX in the steroid glycoalkaloid having a spirosolane skeleton is further acetylated, and the spirosolane skeleton is converted to a solanidan skeleton. Significant biosynthesis of leptin, which is involved in CPB resistance, has been observed in potatoes.

Also, S. Among S. tuberosum varieties, S. It was revealed that cultivars such as 97H32-6 and Konafubuki, which are produced using Chacoense but do not produce leptin, have the Sc23ACT gene.

Furthermore, the 23ACT gene was added to S. It was also revealed that although the potato has the same gene, leptin biosynthesis is not observed in the potato because its expression level is not sufficient.

Therefore, the present invention also includes DNA encoding the 23DOX of the present invention and DNA encoding a protein having the activity of acetylating the hydroxyl group at position 23 of the spirosolane skeleton (hereinafter also referred to as "23ACT of the present invention"). , a composition for use in introducing an acetoxy group into the 23rd position of the spirosolane skeleton, a composition for use in improving leptin accumulation in plants, or a composition for use in improving resistance to CPB in plants. Also provided.

In the present invention, the substrate into which a hydroxyl group or acetoxy group is introduced may have at least a spirosolane skeleton, and examples thereof include spirosolane glycosides.

In the present invention, examples of the substrate into which a hydroxyl group is introduced at the 23-position include α-tomatine, α-dehydrotomatine, α-soramarin, β-soramarin, and their respective aglycones; Examples of the substrate into which the group is introduced include leptinin, 23-hydroxytomatine, and 23-hydroxydehydrotomatine.

In the present invention, "leptinin" includes, for example, leptinin I (3β-[2-O,4-O-bis(α-L-rhamnopyranosyl)-β-D-glucopyranosiloxy]solanid-5-ene- 23β-ol), leptinin II (3β-[(3-O-β-D-glucopyranosyl-2-O-α-L-rhamnopyranosyl-β-D-galactopyranosyl)oxy]solanid-5-ene-23β -all).

In the present invention, "leptin" includes, for example, leptin I (3β-[2-O,4-O-bis(α-L-rhamnopyranosyl)-β-D-glucopyranosiloxy] solanid-5-ene- 23β-ol 23-acetate), 3β-[2-O,4-O-bis(α-L-rhamnopyranosyl)-β-D-glucopyranosiloxy]solanid-5-en-23β-ol), leptin II (3β-[(3-O-β-D-glucopyranosyl-2-O-α-L-rhamnopyranosyl-β-D-galactopyranosyl)oxy]solanid-5-ene-23β-acetate), .

Moreover, as an aspect of the "composition" of the present invention, it is sufficient that the "DNA of the present invention" described below is included as an active ingredient, but it may be one in which other components are mixed. Such other components are not particularly limited, and include, for example, sterile water, physiological saline, vegetable oil, surfactants, lipids, solubilizing agents, buffers, and preservatives.

<About the DNA of the present invention>
As an example of "DNA encoding 23DOX of the present invention" contained as an active ingredient in the above-mentioned composition, S. The sequence of cDNA encoding 23DOX derived from Chacoense is shown in SEQ ID NO: 1. The amino acid sequence of the protein (Sc23DOX) encoded by this sequence is shown in SEQ ID NO: 2. As another example of "DNA encoding 23DOX of the present invention", S. The sequence of cDNA encoding 23DOX derived from C. lycopersicum is shown in SEQ ID NO: 5. The amino acid sequence of the protein (Sl23DOX) encoded by this sequence is shown in SEQ ID NO: 6. Note that the Sl23DOX gene is located on Solyc02g062460 of tomato chromosome 2. As another example of "DNA encoding 23DOX of the present invention", S. The sequence of cDNA encoding 23DOX derived from C. tuberosum is shown in SEQ ID NO: 3. The amino acid sequence of the protein (St23DOX) encoded by this sequence is shown in SEQ ID NO: 4.

As an example of "DNA encoding 23ACT of the present invention" contained as an active ingredient in the above-mentioned composition, S. The sequence of cDNA encoding 23ACT derived from Chacoense is shown in SEQ ID NO: 7. The amino acid sequence of the protein (Sc23ACT) encoded by this sequence is shown in SEQ ID NO: 8. As another example of "DNA encoding 23ACT of the present invention", S. The sequence of cDNA encoding 23ACT derived from C. lycopersicum is shown in SEQ ID NO: 11. The amino acid sequence of the protein (Sl23ACT) encoded by this sequence is shown in SEQ ID NO: 12. Note that the Sl23ACT gene is located on Solyc08g075210 of tomato chromosome 8. As another example of "DNA encoding 23ACT of the present invention", S. The sequence of cDNA encoding 23ACT derived from S. tuberosum is shown in SEQ ID NO: 9. The amino acid sequence of the protein (St23ACT) encoded by this sequence is shown in SEQ ID NO: 10.

At the current state of the art, a person skilled in the art would understand that the above-mentioned "DNA encoding 23DOX of the present invention" or "DNA encoding 23ACT of the present invention" (these two types of DNA are also collectively referred to as "DNA of the present invention") When sequence information is obtained, various modifications are made to the nucleotide sequence to produce a protein that has the activity of introducing a hydroxyl group at position 23 of the spirosolane skeleton, or to acetylate the hydroxyl group at position 23 of the spirosolane skeleton. It is possible to produce mutant genes encoding active proteins. Furthermore, mutations in nucleotide sequences can occur even in nature.

Therefore, as long as the DNA encoding 23DOX of the present invention encodes a protein having the activity of introducing a hydroxyl group into the 23rd position of the spirosolane skeleton, the DNA encoding 23DOX of the present invention includes one or more of the amino acid sequences set forth in SEQ ID NO: 2, 4, or 6. Also included is DNA encoding a protein consisting of an amino acid sequence in which amino acids are substituted, deleted, added, and/or inserted. In addition, the DNA encoding 23ACT of the present invention includes one or more of the amino acid sequences set forth in SEQ ID NO: 8.10 or 12, as long as it encodes a protein having the activity of acetylating the hydroxyl group at position 23 of the spirosolane skeleton. Also included is DNA encoding a protein consisting of an amino acid sequence in which amino acids have been substituted, deleted, added, and/or inserted.

Here, "plurality" refers to the entire amino acid sequence of 23DOX or 23ACT, usually within 100 amino acids (for example, within 90 amino acids, within 80 amino acids, within 70 amino acids), preferably within 60 amino acids (for example, within 50 amino acids). , within 40 amino acids), more preferably within 30 amino acids (for example, within 20 amino acids, within 10 amino acids), particularly preferably within several amino acids (for example, within 5 amino acids, within 3 amino acids, within 2 amino acids).

In addition, to introduce a mutation into each nucleotide sequence, a known method such as the Kunkel method or the Gapped duplex method, or a method similar thereto, may be used, for example, a mutation introduction kit using a site-directed mutagenesis method. (For example, Mutant-K (manufactured by TAKARA), Mutant-G (manufactured by TAKARA), etc.) or the LA PCR in vitro Mutagenesis series kit of TAKARA.

Furthermore, with the current state of the art, if a person skilled in the art has obtained a specific DNA, he or she can use the sequence information of that DNA to extract homologs encoding proteins with each activity from plants of the same species or from other plants. It is possible to isolate the gene. Plants from which such homologous genes can be obtained include plants of the Solanaceae family, such as Solanum panduraeforme, Solanum verbascifolium, and Solanum penneli. Pennellii), Solanum aethiopicum, Solanum americanum, Solanum nigrum, Solanum carolinense, Tamarillo (Solanum betaceum), Bulbul funnel (Solanum lyratum), Horned eggplant (Solanum mammosum), Eggplant Plants belonging to the genus Solanum such as (Solanum melongena), pepino (Solanum muricatum), Solanum pseudocapsicum, tomato (Solanum lycopersicum), Solanum chacoense, etc. Mustard (capsicum, paprika) (Capsicum annuum), Aji Amarillo (Capsicum baccatum) , plants belonging to the Capsicum genus such as Capsicum cardenasii, Capsicum chinense, Capsicum frutescens, and Capsicum pubescens, N. al. ata), tobacco (Nicotiana spp.), etc. Plants belonging to the genus Tobacco such as Datura metel, Datura inoxia, Datura stramonium, Brugmansia arborea, Kida Chichosen Plants belonging to the genus Brugmansia such as Brugmansia suaveolens, Physalis alkekengi var. franchetii, and Tomatillo (Physalis ixocar) plants belonging to the physalis genus such as pa, etc., plants belonging to the physalis genus , plants that belong to the genus Naked Physalis, plants that belong to the genus Petunia, plants that belong to the genus Hacilidae, plants that belong to the genus Mucuna, plants that belong to the genus Belladonna, plants that belong to the genus Mandragora, plants that belong to the genus Lycium, and plants that belong to the genus Calibrachoa. , can be mentioned.

Moreover, as a plant for obtaining a homologous gene of the DNA of the present invention, a plant containing 23-acetoxyl spirosolane is preferable, and examples of such a plant include the known Solanum nigrum. (Eich, Soloanaceae and Convolvulaceae: Secondary Metabolite (2008), Springer, Table 7.3). Furthermore, as a plant for obtaining a homologous gene of "DNA encoding 23DOX of the present invention", a plant containing 23-hydroxyspirosolane is preferable, and examples of such a plant include, for example, Solanum pandula. Eich, Soloanaceae and Convolvulaceae: Secondary Metabolit e (2008), Springer, Table 7.3).

Methods for obtaining homologous genes include hybridization technology (Southern, EM, J. Mol. Biol., 98:503, 1975) and polymerase chain reaction (PCR) technology (Saiki, R.K. , et al. Science, 230:1350-1354, 1985; Saiki, R.K. et al. Science, 239:487-491, 1988). In order to isolate homologous genes, hybridization reactions are usually performed under stringent conditions. Stringent hybridization conditions include, for example, "1XSSC, 0.1% SDS, 37°C", and more stringent conditions include "0.5XSSC, 0.1% SDS, 42°C". Conditions such as "0.2XSSC, 0.1% SDS, 65°C" can be cited as even more severe conditions. Thus, the more severe the hybridization conditions are, the more DNA can be expected to be isolated with higher identity. However, the above combinations of SSC, SDS, and temperature conditions are just examples, and the required stringency can be achieved by appropriately combining DNA concentration, DNA length, hybridization reaction time, etc. be.

Therefore, the DNA encoding 23DOX of the present invention includes a sequence complementary to the nucleotide sequence set forth in SEQ ID NO: 1, 3, or 5, as long as it encodes a protein having the activity of introducing a hydroxyl group into the 23rd position of the spirosolane skeleton. This also includes DNA that hybridizes under stringent conditions with DNA consisting of. In addition, the DNA encoding 23ACT of the present invention includes a DNA that is complementary to the nucleotide sequence set forth in SEQ ID NO: 7, 9, or 11, as long as it encodes a protein having the activity of acetylating the hydroxyl group at position 23 of the spirosolane skeleton. It also includes DNA that hybridizes under stringent conditions with DNA consisting of a sequence. Furthermore, DNAs containing sequences based on the degeneracy of the genetic code (degenerate sequences) in each of the nucleotide sequences are also included in each DNA of the present invention.

The protein encoded by the obtained homologous gene usually has high identity with the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6, or the amino acid sequence set forth in SEQ ID NO: 8, 10, or 12. High identity means, for example, 80% or more, preferably 85% or more, more preferably 90% or more (for example, 91% or more, 92% or more, 93% or more, 94% or more), and still more preferably 95% or more ( For example, sequence identity of 96% or more, 97% or more, 98% or more, 99% or more). Sequence identity was determined using BLAST (Basic Local Alignment Search Tool at the National Center for Biological Information) (for example, by default, i.e. default parameters ) can be determined.

Therefore, the DNA encoding 23DOX of the present invention includes an amino acid sequence having 80% or more identity with the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6, and hydroxylating at position 23 of the spirosolane skeleton. Also included is DNA encoding an active protein. Furthermore, the DNA encoding 23ACT of the present invention has an amino acid sequence having 80% or more identity with the amino acid sequence set forth in SEQ ID NO: 8, 10, or 12, and has an acetylated hydroxyl group at position 23 of the spirosolane skeleton. Also included is DNA encoding a protein that has the activity of

Whether a protein encoded by DNA has the activity of introducing a hydroxyl group into the 23rd position of the spirosolane skeleton or the activity of acetylating the hydroxyl group at the 23rd position of the spirosolane skeleton can be determined by, for example, as described in the Examples below. A protein encoding the DNA is synthesized using Escherichia coli or the like, and a compound having a spirosolane skeleton (for example, α-tomatine or 23 Hydroxy-tomatine) is added and allowed to react. The obtained reaction product was then analyzed by commonly reported methods such as Matsuda et al. (Phytochem. Anal. 15:121-124, 2004), Kozuku et al. (Plant Physiol. 175:120-133) by analyzing glycoalkaloids using liquid chromatography (for example, by subjecting the reaction product to liquid chromatography, The obtained fractions can be analyzed using mass spectrometry, UV or multi-wavelength detectors, etc.). Note that conditions for analysis can be appropriately set by those skilled in the art.

The "DNA of the present invention" is not particularly limited in its form, and includes cDNA, genomic DNA, and chemically synthesized DNA. These DNAs can be prepared by those skilled in the art using conventional methods. For example, genomic DNA is extracted from plants, a genomic library (plasmid, phage, cosmid, BAC, PAC, etc. can be used as a vector) is created, and this is developed to extract the 23DOX gene (e.g. , SEQ ID NO: 1, 3, or 5) or the 23ACT gene (e.g., SEQ ID NO: 7, 9, or 11) using a probe prepared based on the nucleotide sequence. It can be prepared by hybridization. It can also be prepared by creating primers specific to the 23DOX gene or 23ACT gene and performing PCR using these. For example, cDNA can be synthesized based on mRNA extracted from plants, inserted into a vector such as λZAP to create a cDNA library, expanded, and subjected to colony hybridization in the same manner as above. Alternatively, it can be prepared by plaque hybridization or PCR. Furthermore, if a commercially available DNA synthesizer is used, it is also possible to synthesize the desired DNA.

Furthermore, the DNA of the present invention may be included in the above-mentioned composition in the form of being inserted into a vector. Such vectors are not particularly limited, and include, for example, vectors that are capable of expressing inserted DNA in plant cells. The vector according to the present invention may contain a promoter for constitutively or inducibly expressing the DNA of the present invention, and may also contain an enhancer, terminator, selection marker, etc. as appropriate.

Furthermore, when the transformed plant cell of the present invention is prepared by the Agrobacterium-mediated method described below, the DNA of the present invention is contained in the above-mentioned composition in the form of being introduced into Agrobacterium. It's okay.

Further, more detailed aspects of the vector and Agrobacterium are illustrated in <About the plant cell of the present invention 1> below.

<About the plant cells of the present invention 1>
At least one of the DNA encoding the 23DOX of the present invention and the DNA encoding the 23ACT of the present invention described above is introduced as a plant cell capable of regenerating a plant with increased resistance to CPB of the present invention. Examples include plant cells transformed by.

The plant from which the plant cells of the present invention are derived is not particularly limited, and includes, for example, Solanaceae plants such as potatoes. The plant cells of the present invention are not limited to these plant species, but common potato (Solanum tuberosum), which produces glycoalkaloids with solanidan rings, is particularly preferred. Plants other than the common potato include, but are not limited to, plant species within the tuber-forming Potatoe subsection of the Solanum species (Hawkes, The Potato (1990), Smithonian Inst. Press, Table 6. 1).

In addition, in order to increase the resistance to CPB for plant species that have low expression levels of the 23DOX gene and 23ACT gene or do not have these genes, the DNA encoding the 23DOX of the present invention and the 23ACT gene of the present invention may be used. It is desirable to introduce both DNAs encoding the . On the other hand, as shown in Examples below, some S. tuberosum naturally have at least the Sc23ACT gene. It is desirable to introduce at least the DNA encoding the 23DOX of the present invention into such plant species. Conversely, it is desirable to introduce at least the DNA encoding the 23ACT of the present invention into plant species that naturally have at least the 23DOX gene.

The plant cells of the present invention include cultured plant cells, whole plants of cultivated plants, plant organs (e.g., leaves, flowers, stems, roots, tubers, rhizomes, seeds, etc.), or plant tissues (e.g., epidermis, phloem, etc.). , soft tissue, xylem, vascular bundles, etc.). Furthermore, various forms of plant cells are included, such as suspension culture cells, protoplasts, leaf sections, callus, immature embryos, pollen, and the like.

Methods for introducing the DNA of the present invention into plant hosts include indirect introduction methods such as the Agrobacterium infection method, direct introduction methods such as electroporation method, particle gun method, polyethylene glycol method, liposome method, and microinjection method. can be mentioned.

For example, when using the Agrobacterium infection method, transformed plant cells into which the DNA of the present invention has been introduced can be produced as follows.

First, a recombinant vector for transformation is prepared, and then transformation is performed using Agrobacterium. A recombinant vector for transformation can be obtained by cutting a fragment containing the DNA of the present invention with an appropriate restriction enzyme, ligating it with an appropriate linker as necessary, and inserting it into a cloning vector for plant cells. . As cloning vectors, binary vector-based plasmids such as pBE2113Not, pBI2113Not, pBI2113, pBI101, pBI121, pGA482, pGAH, and pBIG, and intermediate vector-based plasmids such as pLGV23Neo, pNCAT, and pMON200 can be used.

When using a binary vector-based plasmid, the DNA of the present invention is inserted between the border sequences (LB, RB) of the above-mentioned binary vector, and this recombinant vector is amplified in E. coli. Next, the amplified recombinant vector is introduced into Agrobacterium tumefaciens EHA105, C58, LBA4404, EHA101, C58C1RifR, etc. by electroporation method or the like, and the Agrobacterium into which the DNA of the present invention has been introduced is used to induce plant traits. It can be used for conversion. In addition, Agrobacterium used for transformation containing the DNA of the present invention can be prepared by the three-way conjugation method (Nucleic Acids Research, 12:8711 (1984)). That is, by culturing a mixture of E. coli carrying a plasmid containing the DNA of the present invention or E. coli carrying a helper plasmid (for example, pRK2013) and Agrobacterium, and culturing it on a medium containing rifampicillin and kanamycin, the conjugation for transformation is performed. body Agrobacterium can be obtained.

In order to express the DNA of the present invention, which is a foreign gene, in plant cells, it is desirable to link a promoter, enhancer, terminator, etc. for plants before and after the gene of the present invention. Examples of promoters that can be used in the present invention include the 35S promoter derived from cauliflower mosaic virus (CaMV), the maize ubiquitin (UBI) promoter, the nopaline synthase (NOS) gene promoter, and the octopine (OCT) synthase gene promoter. It will be done. As the enhancer, a translation enhancer of viral origin or a translation enhancer of plant origin can be used. Translation enhancers of viral origin include, for example, sequences of tobacco mosaic virus, alfalfa mosaic virus RNA4, bromo mosaic virus RNA3, potato virus X, tobacco etch virus, and the like. Further, examples of translation enhancers of plant origin include sequences derived from soybean β-1,3 glucanase (Glu) and sequences derived from tobacco ferredoxin-binding subunit (PsaDb). As the terminator, for example, a CaMV-derived terminator or a NOS gene-derived terminator can be used. However, the promoter, enhancer, and terminator are not limited to those mentioned above, and any promoter, enhancer, and terminator that are known to function in plants can be used. These promoters, enhancers, and terminators are linked so that the DNA of the present invention to be expressed can function.

The promoter used to express the DNA of the present invention in potatoes is not particularly limited, and may be a promoter that enables the expression of the target gene in the whole plant, such as the 35S promoter, or the promoter used to express the target gene in potatoes. S. It may be a promoter derived from Chacoense. Examples of the promoter include S. Examples include the promoter of the 23DOX gene or 23ACT gene of Chacoense. These can be appropriately prepared by those skilled in the art by isolating several kb upstream of the Sc23DOX coding region or the Sc23ACT coding region.

Furthermore, in order to efficiently select the desired transformed plant cells, it is preferable to use a selection marker gene. Examples of the selection marker include the kanamycin resistance gene (NPTII), the hygromycin resistance gene (htp), and the bialaphos resistance gene (bar and pat). The DNA of the present invention and the selection marker gene may be integrated into a single vector, or two types of recombinant DNA may be integrated into separate vectors.

Furthermore, when introducing both the DNA encoding 23DOX of the present invention and the DNA encoding 23ACT of the present invention, these DNAs may be integrated into a single vector as shown in the Examples below. However, two types of recombinant DNA, each integrated into a separate vector, may be used.

Furthermore, as a method for introducing the DNA of the present invention into a plant host, in addition to the above-mentioned indirect introduction method and direct introduction method, gene insertion by genome editing may be used. Genome editing methods utilize site-specific nucleases (e.g., DNA double-strand cleaving enzymes such as zinc finger nucleases (ZFNs), transcription activation-like effector nucleases (TALENs), and CRISPR-Cas9) to target genes. This is a method of modification. For example, ZFNs (US Pat. No. 6,265,196, No. 8,524,500, No. 7,888,121, European Patent No. 1,720,995), TALENs (US Pat. No. 8,470,973, US Pat. Mura et al. Plant Cell Physiol 53:1171-1179 (2012)), CRISPR-Cas9 (US Patent No. 8697359, International Publication No. 2013/176772), CRISPR-Cpf1 (Zetsche B. et al., Cell, 16 3( 3): 759-71, (2015)) and Target-AID (K. Nishida et al., Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptation) e immune systems, Science, DOI: 10.1126/science.aaf8729, (2016) ), etc., and a method using a complex of a guide RNA (gRNA) and a protein.

<About the plant cells of the present invention 2>
As shown in the Examples below, S. tuberosum has 23 DOX genes and 23 ACT genes. However, because their expression levels are low, leptin cannot be sufficiently accumulated. That is, by enhancing the expression of these endogenous genes, it is possible to improve the amount of leptin accumulated and to enhance resistance to CPB.

Therefore, the present invention:
The present invention also provides plant cells capable of regenerating plants with increased resistance to CPB, in which the expression of at least one endogenous DNA selected from the group consisting of (a) to (h) below is enhanced.
(a) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6
(b) DNA encoding a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6, and having the activity of hydroxylating the 23rd position of the spirosolane skeleton
(c) Consists of an amino acid sequence in which one or more amino acids are substituted, deleted, added, and/or inserted in the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6, and the 23rd position of the spirosolane skeleton is hydroxylated DNA encoding a protein that has the activity of
(d) Codes for a protein that hybridizes under stringent conditions with DNA consisting of a sequence complementary to the nucleotide sequence set forth in SEQ ID NO: 1, 3, or 5 and has the activity of hydroxylating the 23rd position of the spirosolane skeleton. Do, DNA
(e) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 8, 10 or 12
(f) DNA encoding a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence set forth in SEQ ID NO: 8, 10, or 12 and having the activity of acetylating the hydroxyl group at position 23 of the spirosolane skeleton.
(g) Consists of an amino acid sequence in which one or more amino acids are substituted, deleted, added, and/or inserted in the amino acid sequence set forth in SEQ ID NO: 8, 10, or 12, and the hydroxyl group at position 23 of the spirosolane skeleton is acetylated. DNA encoding a protein that has the activity of
(h) A protein that hybridizes under stringent conditions with DNA consisting of a sequence complementary to the nucleotide sequence set forth in SEQ ID NO: 7, 9, or 11 and has the activity of acetylating the hydroxyl group at position 23 of the spirosolane skeleton. Code, DNA.

As a method for enhancing the expression of endogenous genes, for example, by genome editing or homologous recombination, the promoters located upstream of the endogenous 23DOX gene and/or the endogenous 23ACT gene can be replaced with other promoters by homologous recombination, etc. An example of this method is to replace Examples of "other promoters" include the above-mentioned CaMV-derived 35S promoter, maize UBI promoter, NOS gene promoter, OCT synthase gene promoter, S. The promoter of the 23DOX gene of S. chacoense. Examples include the promoter of the 23ACT gene of Chacoense. There are no particular restrictions on the genome editing used here, but SDN-2 (Site-Directed Nuclease 2) is a method that artificially synthesizes a short DNA fragment (template) homologous to the target sequence and uses it during cleavage. SDN-3 (Site-Directed Nuclease 3), a type of genome editing that intentionally induces mutations of one or several bases by introducing nucleases together with artificial restriction enzymes, SDN-3 (Site-Directed Nuclease 3) Genome editing is a type of genome editing in which a long DNA fragment containing a gene (transgene) that is not derived from the same or closely related species is introduced sandwiched between homologous sequences, thereby forming the DNA fragment at a predetermined site on the genome. It will be done. More specifically, the expression of endogenous 23DOX gene and endogenous 23ACT gene can be enhanced by the method shown below.

First, gRNA that recognizes 20 nucleotides including the start codon site of the St23DOX gene, Cas9 protein, and DNA in which the promoter of the St23DOX gene, the CaMV-derived 35S promoter, and the St23DOX gene were linked were attached to a stem section by electroporation. Introduce into a certain cell. The gRNA and Cas9 complex taken into the cell cleave the DNA between the St23DOX gene promoter and the St23DOX gene, and at this time, the SDN-3 phenomenon of genome editing occurs, resulting in CaMV immediately upstream of the St23DOX gene. The derived 35S promoter can be inserted. After the treatment, the stem sections were placed in MS medium containing plant hormones (containing zeatin 2 ppm, indole-3-acetic acid 0.05 ppm, and agar 0.8%) at 25°C for 16 hours under illumination (photon flux density 32 μE). /m2s)/8 hours by subculturing the cells every week under no light conditions to obtain redifferentiated individuals. DNA is extracted from the redifferentiated individuals, and individuals into which the CaMV-derived 35S promoter has been inserted are selected. Individuals into which the CaMV-derived 35S promoter has been inserted can increase the expression level of the endogenous St23DOX gene and can produce leptinin. The stem of this plant was similarly treated with gRNA that recognizes the 20 bases including the start codon site of the St23ACT gene, Cas9 protein, the promoter of the St23ACT gene, the 35S promoter derived from CaMV, and the DNA in which the St23ACT gene was linked. It is introduced into the cells in the stem section by electroporation. As a result, the expression levels of the endogenous St23DOX gene and the endogenous St23ACT gene can be increased, making it possible to produce leptin.

Furthermore, the expression of the endogenous 23DOX gene and/or the endogenous 23ACT gene can also be enhanced by introducing DNA encoding a factor (transcription activator) that activates the expression of the endogenous 23DOX gene and/or the endogenous 23ACT gene. Furthermore, the expression of the endogenous 23DOX gene and/or the endogenous 23ACT gene can also be enhanced by destroying the DNA encoding the factor (transcription repressor) that suppresses the expression of the endogenous gene by genome editing or the like. can. It should be noted that those skilled in the art would be able to determine the endogenous 23DOX gene and/or the endogenous 23ACT gene by appropriately selecting transcriptional regulators of the glycoalkaloid biosynthesis gene group and targeting them based on the descriptions in the literature. Expression can be enhanced. For example, those skilled in the art would be able to target the endogenous gene by targeting JRE4 (see Thagun et al. Plant Cell Physiol. 2016 57:961-75), which is known as a transcription factor of the glycoalkaloid biosynthesis gene group. Expression can be easily enhanced.

<About the plant of the present invention and its manufacturing method 1>
The present invention provides a plant regenerated from the plant cells. Regeneration of a plant from plant cells can be carried out by methods known to those skilled in the art depending on the type of cell. For example, the method described in "Plant Cell Culture Manual" edited by Yasuyuki Yamada, Kodansha Scientific, 1984, "Transformation Protocol [Plant Edition]", edited by Yutaka Tabei, published by Kagaku Dojin Co., Ltd., September 20, 2012, etc. Accordingly, plants can be regenerated from transformed plant cells.

Once a transformed plant in which the DNA of the present invention has been introduced into the genome or a plant in which the expression of the endogenous DNA is enhanced is obtained, it is possible to obtain progeny from these plants by sexual or asexual reproduction. It is. Therefore, the plants of the present invention include all types of cultivation and breeding based on the T0 generation, such as the "T0 generation" which is the current redifferentiated generation, as well as progeny obtained from self-pollinated or cross-pollinated seeds of the plant. It also includes generations and individuals that can be obtained by means of. It is also possible to obtain propagation materials (eg, seeds, fruits, cuttings, stocks, callus, protoplasts, etc.) from the plant or its descendants or clones, and mass-produce the plant based on these materials. The invention therefore includes plant cells of the invention, plants containing the cells, progeny and clones of the plants, and propagation material of the plants, progeny and clones.

The present invention also provides a step of introducing a DNA encoding 23DOX of the present invention and a DNA encoding 23ACT of the present invention into a plant cell, and regenerating a plant from transformed plant cells into which the DNA has been introduced in the step. The present invention also provides a method for producing a plant with increased resistance to CPB, the method comprising the steps of:

In addition, confirmation that the DNA has been integrated in the thus obtained transformed plants into which the DNA of the present invention has been introduced, as well as their next generation, etc., can be confirmed by extracting the DNA from these cells and tissues according to a conventional method. This can be carried out by extracting and detecting the introduced DNA of the present invention using known techniques (eg, PCR method, Southern blotting method).

The present invention also provides a step of enhancing the expression of the endogenous DNA encoding the 23DOX of the present invention and the endogenous DNA encoding the 23ACT of the present invention in plant cells, and the step of enhancing the expression of the endogenous DNA in the step. The present invention also provides a method for producing a plant with increased resistance to CPB, which comprises a step of regenerating the plant from the plant cells that have been harvested.

In addition, to confirm that the expression of the endogenous DNA has been enhanced in plants with enhanced expression of the endogenous DNA obtained in this way, and their next generation, etc., it can be confirmed that the expression of the endogenous DNA has been enhanced by using conventional methods from these cells and tissues. Extract the mRNA or protein, and express the DNA of the present invention using a known method (for example, RT-PCR method, Northern blotting method, ELISA method, Western blotting method) to express the mRNA or protein encoded by the DNA. This can be done through the detection of

In addition, confirmation of whether the plant of the present invention obtained in this way has enhanced resistance to CPB can be, for example, by investigating the number of adults and the number of feeding damage on the plant using CPB in the field. The feeding rate of adults on leaves cut into discs was investigated, and the larval growth and larval survival rates were investigated on detached above-ground parts (see Non-Patent Document 4), and the results were compared with controls (e.g., the present invention). Confirm that the resistance to CPB has been increased by comparing it with that of a plant in which the DNA of the present invention has not been introduced, or a plant in which the expression of the endogenous DNA of the present invention has not been enhanced (e.g., wild type). be able to.

Furthermore, as described above, resistance to CPB depends on the amount of leptin accumulated. Therefore, by measuring the amount of leptin using the glycoalkaloid analysis method using liquid chromatography described above, if the amount is higher than that of the control, it can be confirmed that the resistance to CPB has been increased.

<About the determination method of the present invention>
The method of determining resistance to CPB in plants of the present invention includes the steps of detecting the presence or expression of DNA encoding 23DOX of the present invention and DNA encoding 23ACT of the present invention in a test plant; In the step, if the presence or expression of the DNA is detected, the test plant is determined to have resistance to CPB.

Detection of the "presence" of DNA according to the present invention is characterized by analyzing the nucleotide sequence of the DNA or its expression control region in the test plant. Note that "DNA encoding 23DOX of the present invention" and "DNA encoding 23ACT of the present invention" to be detected are as described above.

For example, if the DNA encoding the 23DOX of the present invention and the DNA encoding the 23ACT of the present invention are not present in the genomic DNA of the test plant, it is determined that the plant does not have CPB resistance. I can do it. Further, even if the 23DOX gene and the 23ACT gene are present, if nucleotide insertions or deletions are observed in these genes, CPB resistance is reduced or eliminated. Therefore, by analyzing the nucleotide sequences of the DNA encoding the 23DOX of the present invention and the nucleotide sequence of the 23ACT of the present invention, it is possible to determine whether or not the animal has CPB resistance.

Furthermore, by analyzing the nucleotide sequences of the regions (enhancers, promoters, silencers, insulators) that control the expression of the 23DOX gene and the 23ACT gene, it is also possible to determine whether the animal has CPB resistance.

When analyzing the nucleotide sequences of the 23DOX gene and 23ACT gene or their expression control regions, amplification products obtained by amplifying these sequences by PCR can be used. When carrying out the PCR, the primers used are not limited as long as they can specifically amplify the genes or their expression control regions, and can be appropriately designed based on their sequence information. .

Note that the method for determining whether or not a subject has CPB resistance may include, for example, a step of comparing with a "control nucleotide sequence." Examples of the "control nucleotide sequence" to be compared with the nucleotide sequences of the 23DOX gene and 23ACT gene in the test plant include nucleotide sequences encoding Sl23DOX, Sl23ACT, St23DOX, St23ACT, Sc23DOX, and Sc23ACT, respectively.

By comparing the detected nucleotide sequence of the genes or their expression control regions in the test plant with the nucleotide sequence of the control, it can be determined whether the test plant has CPB resistance. can. For example, if there is a large difference in the nucleotide sequence compared to the reference nucleotide sequence (especially if the appearance of a new stop codon or a frame shift causes a large change in the molecular weight or amino acid sequence of the encoded protein), It is determined that there is a high probability that the test plant does not have CPB resistance.

On the other hand, as shown in Examples below, S. tuberosum has the St23DOX gene and St23ACT gene, but because the expression levels of these genes are low, CPB resistance is not exhibited. Therefore, when comparing the expression control regions of the 23DOX gene and 23ACT gene in the test plant, the expression control regions of the Sl23DOX gene, Sl23ACT gene, Sc23DOX gene, and Sc23ACT gene are used as positive control nucleotide sequences, The expression control regions of the St23DOX gene and St23ACT gene are used as negative control nucleotide sequences.

That is, the nucleotide sequence of the expression control region in the detected test plant has high identity (e.g., 90% or more identity, preferably 95% If the above (96% or more, 97% or more, 98% or more, 99% or more, 100% identity), it is determined that there is a high probability that the test plant is a plant that has CPB resistance. On the other hand, it has high identity (for example, 90% or more identity, preferably 95% or more (96% or more, 97% or more, 98% or more, 99% or more) with each expression control region of the St23DOX gene and the St23ACT gene. 100% identity), it is determined that the test plant has a low probability of being a plant having CPB resistance.

As mentioned above, some plants cannot exhibit CPB resistance even if they have the 23DOX gene and 23ACT gene because their expression levels are low. Therefore, by combining the determination results using the nucleotide sequences encoding 23DOX and 23ACT as indicators and the determination results using the nucleotide sequences of the expression control regions of the 23DOX and 23ACT genes as indicators, the test plant can be resistant to CPB. It is desirable to determine whether or not the person has sex.

Furthermore, the "presence" of the DNA of the present invention can also be detected by detecting a DNA marker consisting of a DNA sequence that serves as a marker for the location of the DNA of the present invention. Such DNA markers may be those present within the 23DOX gene and the 23ACT gene, adjacent to or in the vicinity of these genes.

The DNA markers that can be used in the present invention are not particularly limited, and various commonly known DNA markers can be suitably used. Examples include microsatellite markers such as SSR (simple repeat sequence) markers, RFLP (restriction fragment length polymorphism) markers, and SNP (single nucleotide polymorphism) markers.

In addition, preparation of DNA from a test plant in the determination method of the present invention can be performed using a conventional method, for example, the CTAB method. As plants for preparing DNA, not only grown plants but also seeds, seedlings, and tubers can be used. Further, the nucleotide sequence can be determined by conventional methods such as the dideoxy method and the Maxam-Gilbert method. In determining the base sequence, commercially available sequencing kits and sequencers can be used.

Whether the nucleotide sequences of the 23DOX gene and 23ACT gene or their expression control regions in a test plant are different from the nucleotide sequence of a control can be determined indirectly by various methods in addition to the direct nucleotide sequence determination described above. It can be analyzed in detail. Examples of such methods include Southern blotting, PCR-SSCP (single-strand conformation polymorphism), and restriction fragment length polymorphism (R). FLP) RFLP method, PCR-RFLP method, denaturant gradient gel electrophoresis (DGGE), allele specific oligonucleotide (ASO) hybridization method , ribonuclease A mismatch cleavage method.

Furthermore, the determination method of the present invention is characterized by detecting the expression of DNA encoding 23DOX of the present invention and DNA encoding 23ACT of the present invention in a test plant.

Here, "detection of DNA expression" includes both detection at the transcription level and detection at the translation level. Furthermore, "detection of expression" includes not only detection of the presence or absence of expression, but also detection of the degree of expression, and also includes detection of the molecular weight of the DNA expression product.

Detection of the DNA of the present invention at the transcription level can be carried out by conventional methods, such as RT-PCR (Reverse transcribed-Polymerase chain reaction) method or Northern blotting method. The primers used in carrying out the PCR are not limited as long as they can specifically amplify the DNA of the present invention, and can be appropriately designed based on the nucleotide sequence of the DNA.

On the other hand, detection at the translation level can be carried out by conventional methods, such as Western blotting or ELISA. Antibodies used in Western blotting may be polyclonal or monoclonal antibodies, and methods for preparing these antibodies are well known to those skilled in the art.

As a result of detecting the expression, if the expression level of the DNA of the present invention in the test plant is significantly lower than that of the CPB-resistant plant (e.g., S. (e.g., if the DNA of the invention is not substantially expressed), or if the molecular weight of the expression product of the DNA of the invention is lower than or equal to that of CPB-resistant plants (e.g., if the DNA of the invention is not substantially expressed). If the test plant is significantly different from the above, it is determined that the test plant does not have or has low CPB resistance.

<About the plant of the present invention and its manufacturing method 2>
The present invention provides a method for producing a plant resistant to CPB using the above determination method.

Such a production method includes a step of crossing a plant having resistance to CPB with an arbitrary plant, a step of determining resistance to CPB in the plant obtained by the crossing in the above step by the method described above, Selecting plants determined to have resistance to
Further, a step of crossing a plant having DNA encoding 23DOX of the present invention with a plant having DNA encoding 23ACT of the present invention,
A step of determining resistance to CPB in the plants obtained by the crossbreeding in the step by the method described above;
and selecting plants determined to have resistance to CPB.

There are no particular restrictions on "plants with resistance to CPB" as long as they have the resistance or the ability to biosynthesize leptin. An example is chacoense.

Examples of "any plant" to be crossed with the above variety include a variety that does not have resistance to CPB, and a plant variety obtained by crossing a plant variety that has resistance to CPB with a variety that does not have resistance to CPB. These include, but are not limited to, plants that have been cultivated. Furthermore, the "any plant" may be one that has other characteristics than resistance to CPB. "Other characteristics" are not particularly limited, and include, for example, resistance to pests other than CPB, resistance to various diseases, high yield, and early maturity.

The "plant having DNA encoding 23DOX of the present invention" may be any plant having at least DNA encoding 23DOX, for example, a plant having at least DNA encoding Sc23DOX: S. An example is chacoense. "Plants having DNA encoding 23ACT of the present invention" only need to have at least DNA encoding 23DOX, for example, plants having at least DNA encoding Sc23ACT: S. chacoense, S. tuberosum (Konafubuki, 97H32-6 and Saikai 35-go, Sakurafubuki, pearl starch, etc.).

Further, by using the production method of the present invention, it becomes possible to select CPB-resistant plants at the stage of seedlings, etc., and it becomes possible to breed varieties having this trait in a short period of time. Therefore, the present invention also provides a method for breeding plants resistant to CPB.

In such a method, a CPB-resistant variety and any plant variety (plant line) are crossed, or a plant having DNA encoding 23DOX of the present invention and a plant having DNA encoding 23ACT of the present invention are crossed. Breeding can be achieved by crossing and selecting, as described above, using the presence or expression of the DNA of the present invention as an indicator. As a more specific selective breeding method, for example, an arbitrary plant variety (e.g., S. tuberosum) and a plant variety (e.g., S. chacoense) having the DNA of the present invention are crossed to obtain a hybrid, and the resulting hybrid is obtained. and any of the plant varieties mentioned above, select a hybrid having the DNA of the present invention, and further perform backcrossing. Backcrossing and selection are preferably repeated several times, preferably 2 to 10 times. By such a method, a practical variety having the DNA of the present invention can be obtained.

The present invention also provides plants produced in this way that are resistant to CPB. There is no particular restriction as long as the plant has at least the DNA of the present invention, but it is preferable that the substitution rate in any of the plant varieties in the entire chromosome is 50% or more (for example, 60% or more), and 70% or more. % or more (for example, 80% or more), and even more preferably 90% or more (for example, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more). Note that the substitution rate can be obtained by analyzing DNA markers present throughout the genome and calculating the ratio in the above-mentioned arbitrary plant variety. In addition, breeding by DNA marker selection is described, for example, by Hamwieh et al. (2011) Euphytica, 179:451-459.

<About the kit used in the determination method of the present invention>
As described above, by detecting the DNA encoding 23DOX and the DNA encoding 23ACT of the present invention, it is possible to determine whether a plant has resistance to CPB. Therefore, the present invention provides a drug for determining resistance to CPB in plants by the above-described determination method, the drug (a) containing at least one compound selected from the following (a) to (d). (b) an oligonucleotide having a chain length of at least 15 nucleotides that hybridizes to the gene encoding 23DOX of the present invention, its transcript or its complementary nucleotide; (b) the gene encoding 23ACT of the present invention, its transcript or its complementary nucleotide; an oligonucleotide having a chain length of at least 15 nucleotides that hybridizes to a complementary nucleotide; (c) an antibody that binds to 23DOX of the invention; (d) an antibody that binds to 23ACT of the invention.

The oligonucleotide according to the present invention may be in the form of a primer or a probe, depending on the above detection method.

The primer hybridizes to the gene encoding 23DOX of the present invention or the gene encoding 23ACT of the present invention (genomic DNA), its transcription product (mRNA), or its complementary nucleotide (cDNA, cRNA), and generates the transcription product, etc. There is no particular limitation as long as it allows amplification and detection of. The primer may be only DNA, or may be partially or entirely replaced with an artificial nucleic acid (modified nucleic acid) such as a crosslinked nucleic acid. The size of the primer should be at least about 15 nucleotides long, preferably 15 to 100 nucleotides, more preferably 18 to 50 nucleotides, and even more preferably 20 to 40 nucleotides. Further, such primers can be designed and produced by a method known to those skilled in the art in accordance with the above detection method.

The probe is not particularly limited as long as it hybridizes to the gene encoding the 23DOX of the present invention or the gene encoding the 23ACT of the present invention, its transcription product, or its complementary nucleotide, and enables detection thereof. Probes can be DNA, RNA, artificial nucleic acids, or chimeric molecules thereof. The probe may be either single-stranded or double-stranded. The size of the probe should be at least about 15 nucleotides long, preferably 15 to 1000 nucleotides, more preferably 20 to 500 nucleotides, and even more preferably 30 to 300 nucleotides. Such probes can be produced by methods known to those skilled in the art. Further, the probe may be provided in a form immobilized on a substrate, such as a microarray.

The antibody is not particularly limited as long as it can specifically bind to 23DOX or 23ACT of the present invention. For example, it may be a polyclonal antibody or a monoclonal antibody, or it may be a functional fragment of an antibody (Fab, Fab', scFv, etc.). Such antibodies can be produced by methods known to those skilled in the art. Further, the antibody may be provided in a form immobilized on a substrate such as a plate for use in ELISA methods, antibody arrays, and the like.

Furthermore, the oligonucleotide or antibody contained in the kit of the present invention may be labeled with a labeling substance depending on the detection method. Labeling substances include, for example, fluorescent substances such as FITC, FAM, DEAC, R6G, TexRed, and Cy5, enzymes such as β-D-glucosidase, luciferase, and HRP, ³ H, ¹⁴ C, ³² P, and ³⁵ S. and ¹²³ I, affinity substances such as biotin and streptavidin, and luminescent substances such as luminol, luciferin, and lucigenin.

Furthermore, the oligonucleotide or antibody may include other components that are acceptable as a composition. Examples of such other components include carriers, excipients, disintegrants, buffers, emulsifiers, suspending agents, stabilizers, preservatives, preservatives, physiological saline, and secondary antibodies.

In addition to the oligonucleotides and antibodies described above, the kit of the present invention may also include a substrate necessary for detection of a label, a positive control or a negative control, a buffer solution used for sample dilution and washing, and the like. Additionally, such kits can include instructions for use of the kit.

Although the preferred embodiments of the present invention have been described above, the present invention is not limited to the above embodiments. For example, the plant cells, plants, and production methods of the present invention, as well as the determination methods of the present invention, and the production methods of plants using the determination methods, as well as the compositions of the present invention, are not only resistant to CPB. , leptin production, etc. can also be targeted. That is, the present invention can also provide the following aspects.
<12> A plant cell into which at least one DNA selected from the group consisting of the following (a) to (h) has been introduced and capable of regenerating a plant with increased leptin accumulation (a) SEQ ID NO: 2 DNA encoding a protein consisting of the amino acid sequence described in , 4 or 6
(b) DNA encoding a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6, and having the activity of hydroxylating the 23rd position of the spirosolane skeleton
(c) Consists of an amino acid sequence in which one or more amino acids are substituted, deleted, added, and/or inserted in the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6, and the 23rd position of the spirosolane skeleton is hydroxylated DNA encoding a protein that has the activity of
(d) Codes for a protein that hybridizes under stringent conditions with DNA consisting of a sequence complementary to the nucleotide sequence set forth in SEQ ID NO: 1, 3, or 5 and has the activity of hydroxylating the 23rd position of the spirosolane skeleton. Do, DNA
(e) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 8, 10 or 12
(f) DNA encoding a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence set forth in SEQ ID NO: 8, 10, or 12 and having the activity of acetylating the hydroxyl group at position 23 of the spirosolane skeleton.
(g) Consists of an amino acid sequence in which one or more amino acids are substituted, deleted, added, and/or inserted in the amino acid sequence set forth in SEQ ID NO: 8, 10, or 12, and the hydroxyl group at position 23 of the spirosolane skeleton is acetylated. DNA encoding a protein that has the activity of
(h) A protein that hybridizes under stringent conditions with DNA consisting of a sequence complementary to the nucleotide sequence set forth in SEQ ID NO: 7, 9, or 11 and has the activity of acetylating the hydroxyl group at position 23 of the spirosolane skeleton. Code, DNA.
<13> A plant cell capable of regenerating a plant in which the expression of at least one endogenous DNA selected from the group consisting of (a) to (h) is enhanced and the amount of accumulated leptin is increased.
<14> A plant regenerated from the plant cell according to <12> or <13>, in which the amount of leptin accumulated is increased.
<15> A method for producing a plant with increased accumulation of leptin, comprising:
A method comprising the steps of introducing at least one DNA selected from the group consisting of (a) to (h) above into a plant cell, and regenerating a plant from the transformed plant cell into which the DNA has been introduced in the step. .
<16> A method for determining leptin production ability in a plant, comprising:
In the test plant,
detecting the presence or expression of at least one DNA selected from the group consisting of (a) to (d) and at least one DNA selected from the group consisting of (e) to (h); A method comprising the step of determining that the test plant has the ability to produce leptin when the presence or expression of the DNA is detected in the step.
<17> A method for producing a plant capable of producing leptin, comprising:
A step of crossing a plant capable of producing leptin with any plant;
A step of determining the ability to produce leptin in the individual obtained by the mating in the step by the method described in <16>;
A method comprising the step of selecting a plant determined to have the ability to produce leptin.
<18> A method for producing a plant capable of producing leptin, comprising:
Crossing a plant having at least one DNA selected from the group consisting of (a) to (d) above with a plant having at least one DNA selected from the group consisting of (e) to (h) above. process and
A step of determining leptin production ability in the plants obtained by the crossbreeding in the step by the method described in <16>;
A method comprising the step of selecting a plant determined to have the ability to produce leptin.

Further, as described above, according to the present invention, a plant capable of producing leptin can be obtained. Therefore, the present invention can target not only CPB but also organisms whose feeding is suppressed by leptin, organisms that avoid leptin, organisms whose growth is suppressed by leptin, organisms killed by leptin, and the like.

In addition, all documents cited in this specification are incorporated herein by reference as they are.

EXAMPLES Hereinafter, the present invention will be described in more detail based on Examples, but the present invention is not limited to the following Examples.

Wild potato S. It has been revealed that Chacoense exhibits resistance to CPB by accumulating leptin (leptin I, leptin II). Furthermore, as shown in the lower part of Figure 1, the accumulation of leptin is caused by the hydroxylation of solanidan (α-chaconine, α-solanine) at the 23-position, resulting in the production of leptinin I and leptinin II, and furthermore, these compounds 23 It is assumed that this is caused by acetylation of the hydroxyl group at this position (see Non-Patent Document 5). However, S. The gene that confers CPB resistance to S. chacoense has not been identified.

Therefore, in order to identify such a gene, the present inventors focused on the metabolic process of spirosolane glycoside (α-tomatine) in tomato (S. lycopersicum), which is also a Solanaceae plant (upper panel of Figure 1). . And S. In leptin production in Chacoense, 23-position hydroxylase (also referred to as "23DOX") and 23-position acetyl transferase (also referred to as "23ACT") are involved, similar to the metabolic process of spirosolane glycoside in this tomato. S. An attempt was made to identify the genes encoding these enzymes in Chacoense using the method described below. Note that the sequences of the genes encoding these enzymes have not been clarified in tomatoes either. Therefore, the first step was to identify the sequence.

(Example 1) Obtaining the 23DOX gene In tomatoes, it has been revealed that the metabolism of the spirosolane glycoside (generation of esculeoside A from tomatine) occurs during the ripening process of the fruit. Therefore, we attempted to identify the gene encoding hydroxylase (dioxygenase) expressed in tomato fruits.

Specifically, first, RNA was extracted from the fruits of the dwarf tomato cultivar Microtom using an RNA extraction kit (product name: RNeasy, manufactured by Qiagen), and a cDNA synthesis kit for real-time PCR (product name: ReverTra Ace (registered)) was used. cDNA was created using the qPCR RT Kit (Trademark) (manufactured by Toyobo Co., Ltd.).

On the other hand, in the tomato expression database (Sol Genomics Network: https://solgenomics.net/), we found a sequence (Solyc02g062460) that encodes a protein with the structure of dioxygenase that is specifically expressed in fruits.

Then, using the cDNA of the tomato fruit as a template and the primers GGATCCATGGCATCTATCAAATCAG (SEQ ID NO: 13) and CTCGAGTCAAAATACCACAATAAATCTTG (SEQ ID NO: 14) synthesized based on the above sequence, PCR was performed at an annealing temperature of 55°C (30 cycles, Takara (using Ex taq HS manufactured by Bio Inc.) to amplify the gene. This was cloned into pMD19 vector (manufactured by Takara Corporation), a gene fragment was obtained, and the full-length sequence was determined. ).

Next, leptin-expressing S. RNA was extracted from leaves of chacoense PI 458310 (sown with seeds obtained from USDA Potato Genbank) using RNeasy (manufactured by Qiagen), and cDNA was prepared using ReverTra Ace qPCR RT Kit (manufactured by Toyobo). S. As the nucleotide sequence of chacoense has not been comprehensively analyzed and most of the sequence is unknown, the degenerate primer CTWAAACCAAACACTYCAYWATGGGAAT (SEQ ID NO: 15) was created based on the sequence of the Sl23DOX gene. , GGGTGTTYWTCATCYACWARTTCTTTTGG (SEQ ID NO: 16), PCR was performed at an annealing temperature of 55° C. (30 cycles, using KOD FX Neo manufactured by Toyobo Co., Ltd.). The obtained PCR amplification product was cloned into pCR4Blunt-TOPO vector (manufactured by Thermo Fisher) to obtain a gene fragment, and the partial sequence was determined.

Next, the RACE method was performed to determine the full-length ORF sequence of the cDNA fragment. More specifically, first, using the SMARTer RACE cDNA Amplification Kit (manufactured by Clontech), S. cDNA for RACE was synthesized from chacoense RNA. Next, using this RACE cDNA as a template, for 5'-RACE, use the universal primer and gene-specific primer TGGTGATTACCCTGAGGCCAAAGA (SEQ ID NO: 17), which are attached to the kit, and for 3'-RACE, use the gene-specific primer Using GGTCGATTGCATTCCTGTCCAC (SEQ ID NO: 18) and the universal primer attached to the kit, PCR (35 cycles, using Ex Taq HS manufactured by Takara Bio Inc.) was performed for each at an annealing temperature of 58°C.

Then, the amplified gene was cloned into pMD19 vector (manufactured by Takara), and sequence analysis of the gene fragment was performed. As a result, a sequence expected to be a start codon was found in the fragment obtained by 5'-RACE, and a stop codon was found in the fragment obtained by 3'-RACE.

Next, S. chacoense cDNA, PCR was performed at an annealing temperature of 55°C using primers CATATGGCATCTACCAAATCAGTTAAAGT (SEQ ID NO: 19) and GTCGACTCAAACACCGCAATAAGTCTTGA (SEQ ID NO: 20), which were created based on the base sequence of the obtained RACE fragment. (35 cycles, Takara (using PrimeSTAR HS manufactured by Bio Inc.). The obtained PCR amplification product was cloned into pCR4Blunt-TOPO vector (manufactured by Thermo Fisher) to obtain a gene fragment, and the full-length sequence was determined (the amino acid sequence encoded by the determined sequence is shown in SEQ ID NO: 2). The protein encoded by this gene is also referred to hereinafter as "Sc23DOX"). Note that the sequence identity at the amino acid level between Sl23DOX and Sc23DOX was 87%.

(Example 2) Obtaining the 23ACT gene Similar to the hydroxylase described above, an attempt was made to identify the gene encoding the acetyltransferase expressed in tomato fruits. Specifically, first, we found a sequence (Solyc08g075210) encoding a protein with the structure of acetyltransferase expressed in fruits in the tomato expression database (Sol Genomics Network: https://solgenomics.net/). . Using the primers GGATCCCATATGACAGCATCAAGTTTTGTATCTATG (SEQ ID NO: 21) and GTCGACCTAGAGATTCGTAACTGGAGAAGC (SEQ ID NO: 22) synthesized based on this sequence, PCR was performed on tomato fruit cDNA at an annealing temperature of 55°C (40 cycles, Takara PrimeStar manufactured by Bio Inc. HS) to amplify the gene. This was cloned into the pCR4Blunt-TOPO vector (manufactured by Thermo Fisher) to obtain a gene fragment, and the full-length sequence was determined (hereinafter, the protein encoded by this gene is also referred to as "Sl23ACT". Also, this amino acid sequence was SEQ ID NO: 12).

Next, S. RNA extracted from leaves of Chacoense was comprehensively decoded using a next-generation sequencer, and an EST (expressed sequence tag) database was created. Blast was performed on this EST database using Sl23DOX as a query sequence, and a 3' fragment of a gene thought to encode an acetyltransferase was found.

Next, the RACE method was performed to obtain the 5' fragment of the gene and to determine the full-length ORF sequence. The RACE method was performed using the SMARTer RACE cDNA Amplification Kit (manufactured by Clontech). More specifically, following the kit protocol, S. cDNA for RACE was synthesized from chacoense RNA. Furthermore, using this RACE cDNA as a template, PCR was performed at an annealing temperature of 58°C (35 cycles, Ex Taq HS manufactured by Takara Bio Inc.) using the universal primer and gene-specific primer TGCCATCCACTGGCATTCACATGG (SEQ ID NO: 23) attached to the kit. ) was performed to amplify the gene. Next, the obtained amplification product was cloned into pMD19 vector (manufactured by Takara), and sequence analysis of the gene fragment was performed. As a result, a sequence predicted to be an initiation codon was found in the fragment obtained by 5'-RACE.

In order to determine the full-length ORF sequence of the gene thought to encode an acetyltransferase, S. chacoense cDNA as a template and the primers CATATGGCAGCATCAAGTTGTGTAT (SEQ ID NO: 24) and GTCGACTTAATTAAGATTAGTAATTGGAGAAGA (SEQ ID NO: 25) prepared based on the base sequences of each of the above fragments, PCR was carried out at an annealing temperature of 55°C ( 30 cycles, Takara Bio The gene was amplified using PrimeStar (manufactured by Co., Ltd.). The obtained PCR product was cloned into pENTR/D-TOPO vector (manufactured by Thermo Fisher) to obtain a gene fragment, and the full-length sequence was determined (Sc23ACT. The amino acid sequence is shown in SEQ ID NO: 8). . Note that the amino acid identity homology between Sl23ACT and Sc23ACT was 80%.

(Example 3) Detection of in vitro enzymatic activity of 23DOX As expected, the protein encoded by the gene identified in Example 1 was detected at the 23rd position of these compounds using α-tomatine or α-solanine as a substrate. The following method was used to verify whether a hydroxyl group could be introduced into .

First, in order to synthesize 23DOX in E. coli, the Sl23DOX gene and the Sc23DOX gene were each ligated to the pCold ProS2 vector (manufactured by Takara Bio) and introduced into E. coli BL21 (DE3). The obtained recombinant E. coli was cultured at 37°C until the _OD600 value reached 0.5, cooled to 15°C, and left for 30 minutes. IPTG was added to the final concentration of 0.1 mM, and the mixture was submerged and cultured at 15° C. for 24 hours to induce expression of the recombinant protein.

Next, the expression-induced E. coli cells were collected, suspended in a sonication buffer [50mM Bis-Tris-HCl (pH 7.0), 150mM NaCl, 1mM dithiothreitol, 10% glycerol], and sonicated in a sonicator. After disrupting the bacterial cells, centrifugation was performed to obtain a crude extracted fraction from the supernatant. A 100 mM Bis-Tris-HCl solution (pH 7.2, containing 5 mM 2-oxoglutaric acid, 10 mM sodium ascorbate, and 200 μM FeSO ₄ ) containing 50 μM substrate was added to cause a reaction.

The obtained reaction product was analyzed using LC-MS (manufactured by Waters, product name: UPLC-ESI-MS ACQUITY). The column used was ACQUITY HSS T3 1.8 μm φ2.1×100 mm (manufactured by Waters). In the LC analysis, gradient elution was performed with mobile phase A: 0.1% formic acid water and B: acetonitrile. Gradient elution was 0-3 minutes, hold at 90% A/10% B, then 3-33 minutes, 90% A/10% B to 57.5% A/42.5% B, 33-38 minutes, The test was carried out by changing from 57.5% A/42.5% B to 0% A/100% B and holding at 100% B for 38-43 minutes.

As a result, as shown in FIGS. 2 and 3, when α-tomatine was used as a substrate, S. lycopersicum (Sl23DOX) as well as S. lycopersicum (Sl23DOX). It was also revealed that a product with a hydroxyl group introduced at the 23-position can be obtained from 23DOX derived from chacoense (Sc23DOX).

However, although not shown in the figure, when α-solanine was used as a substrate, no new reaction products could be obtained for both Sl23DOX and Sc23DOX.

(Example 4) Detection of in vitro enzymatic activity of 23ACT As expected, the protein encoded by the gene identified in Example 2 was detected using 23hydroxy-tomatine, leptinin I, or leptinin II as a substrate. Whether the hydroxyl group at position 23 of the compound could be acetylated was verified by the method shown below.

First, in order to synthesize 23ACT in vitro, the Sl23ACT gene and the Sc23ACT gene were each ligated to pCold ProS2 (manufactured by Takara Bio) and introduced into E. coli BL21 (DE3). The obtained recombinant E. coli was cultured at 37°C until the _OD600 value reached 0.5, cooled to 15°C, and left for 30 minutes. IPTG was added to the final concentration of 0.1 mM, and cultured with shaking at 15° C. for 24 hours to induce expression of the recombinant protein. The E. coli cells subjected to expression induction were collected, suspended in sonication buffer [50mM Bis-Tris-HCl (pH 7.0), 150mM NaCl, 1mM dithiothreitol, 10% glycerol], and the cells were disrupted using an ultrasonic disruptor. After crushing, centrifugation was performed to obtain a crude extracted fraction from the supernatant. A 100 mM Bis-Tris-HCl solution (pH 7.2, containing 400 μM acetyl-CoA) containing 50 μM of substrate was added thereto, and the mixture was reacted.

The obtained reaction product was analyzed using LC-MS (manufactured by Waters, product name: UPLC-ESI-MS ACQUITY). The column used was ACQUITY HSS T3 1.8 μm φ2.1×100 mm (manufactured by Waters). In the LC analysis, gradient elution was performed with mobile phase A: 0.1% formic acid water and B: acetonitrile. Gradient elution was 0-30 minutes, 90% A/10% B to 45% A/55% B, 30-31 minutes, 45% A/55% B to 100% B, 31-35 minutes, 100% B. This was done by holding it in.

As a result, as shown in FIGS. 4 and 5, it was revealed that when 23-hydroxytomatine was used as a substrate, a product with an acetoxy group introduced at the 23-position could be obtained in the presence of Sl23ACT or Sc23ACT.

On the other hand, although not shown in the figure, when leptinin I or leptinin II was used as a substrate, no new reaction product could be obtained in either Sl23ACT or Sc23ACT.

As mentioned above, tomato and S. It has been revealed that 23DOX and 23ACT of chacoense catalyze the hydroxylation reaction and acetylation reaction at the 23rd position of α-tomatine (spirosolane skeleton). On the other hand, these enzymes were not found to be involved in the previously assumed reaction process from α-solanine (solanidan skeleton) to leptin. That is, it was suggested that 23DOX and 23ACT are enzymes that act specifically on compounds having a spirosolane skeleton.

(Example 5) Analysis of steroid glycoalkaloids in potatoes introduced with the 23DOX gene Next, S. A transformed potato into which the 23DOX gene derived from Chacoense was introduced was prepared, and whether leptinin I and leptinin II were produced in this transformant was verified by the method shown below.

First, the Sc23DOX gene was ligated to the pRI201 vector (manufactured by Takara Bio Inc.) to create the pRI201_Sc23DOX vector (see the top of FIG. 6). This was introduced into Agrobacterium tumefaciens EHA105 strain. Agrobacterium tumefaciens containing the vector was grown in YEB liquid medium containing 50 ppm kanamycin [5 g/l beef extract, 1 g/l yeast extract, 5 g/l peptone, 5 g/l sucrose, 2 mM magnesium sulfate (pH 7.2). ] and cultured with shaking at 28°C for 12 hours. After collecting bacteria by centrifuging 1.5 ml of the culture solution at 10,000 rpm for 3 minutes, 1.5 ml of MS medium containing 3% sucrose [Murashige & Skoog, Physiol. Plant. , 15, 473-497 (1962)] to prepare a bacterial solution for infection.

Stems of potato (Solanum tuberosum) cultivar "Sassy" cultured in vitro and cut into 3-5 mm lengths without nodes were used as material for Agrobacterium infection. After soaking this in the above Agrobacterium solution, it was placed on sterilized filter paper to remove excess Agrobacterium. This was placed on an MS medium containing plant hormones (containing 100 μM acetosyringone, 2 ppm zeatin, 0.05 ppm indole-3-acetic acid, and 0.8% agar) in a petri dish, and cultured for 3 days. Cultivation was performed at 25° C. under conditions of 16 hours of illumination (photon flux density 32 μE/m 2 s)/8 hours of no illumination. The cells were then subcultured every two weeks in a medium containing 250 ppm of carbenicillin instead of acetosyringone. We were able to obtain redifferentiated individuals.

Approximately 100 mg of leaves of the obtained regenerated individual (#9) were frozen in liquid nitrogen and crushed with a mixer mill (1/30 sec, 2 min). 300 μL of methanol was added to the crushed leaves and sonicated for 10 minutes. Centrifugation (15000 rpm, 10 min) was performed and the supernatant was collected. This extraction operation was repeated three times, the collected supernatant was dried under reduced pressure, and the residue was redissolved in 200 μL of methanol. 20 μL of the re-dissolved solution was dissolved in 180 μL of methanol, and glycoalkaloid was analyzed using LC-MS (manufactured by Waters, product name: UPLC-ESI-MS ACQUITY). The column used was ACQUITY HSS T3 1.8 μm φ2.1×100 mm (manufactured by Waters). In the LC analysis, gradient elution was performed using mobile phase A: 0.1% formic acid water and B: acetonitrile. Gradient elution was 0-30 minutes, 90% A/10% B to 45% A/55% B, 30-31 minutes, 45% A/55% B to 100% B, 31-35 minutes, 100% B. This was done by holding it in. As a preparation containing leptinin, S. An extract from flowers of Chacoense PI 458310 was used for comparison.

As a result, as shown in Figures 7 and 8, S. It has been revealed that expression of Sc23DOX in S. tuberosum enables the production of leptinin I and leptinin II.

(Example 6) Analysis of steroid glycoalkaloids in the hairy roots of potatoes into which the 23DOX gene and 23ACT gene have been introduced Next, S. A transformed potato into which the 23DOX gene and 23ACT gene derived from Chacoense were introduced was prepared, and whether leptin I and leptin II were produced in this transformant was verified by the method described below.

First, a vector pBin+201_Sc23DOX_Sc23ACT was created in which both the Sc23DOX gene and the Sc23ACT gene were linked to pBin+201 (see the bottom of FIG. 6), and this was introduced into Agrobacterium rhizogenes strain C15834. Agrobacterium containing the vector was placed in YEB liquid medium [5 g/l beef extract, 1 g/l yeast extract, 5 g/l peptone, 5 g/l sucrose, 2 mM magnesium sulfate (pH 7.2)] containing 50 ppm kanamycin. The cells were cultured with shaking at 28°C for 12 hours. The culture solution was spread on YEB agar medium (2% agarose) and cultured in the dark at 28°C for 72 hours. Cut the potato variety "Sassy" cultured in a test tube into 1-1.5 cm pieces, attach the root end of the stem to a colony of Rhizogenes, and place in a plant box on B5 medium (0.3% Gelrite, 2% sucrose). ) with the root end pointing upwards. This was cultured in the dark at 20°C for 20 days, and the upper part of the stem where the formation of hairy roots was confirmed was cut off and transferred to MS medium (containing 0.3% Gelrite, 2% sucrose, and 250 ppm cefotaxime). The cells were cultured at ℃ for 7 days and sterilized. The tips of the elongated hairy roots (1 cm) were cut off and transferred to B5 medium (containing 0.3% Gelrite, 2% sucrose, and 250 ppm cefotaxime), and cultured in the dark at 25°C for 7 days. The hairy roots obtained were divided into sections, transferred to B5 liquid medium (containing 2% sucrose), and cultured with shaking at 20° C. in the dark (100 rpm) for an additional 14 days. 100 mg of the cells grown from the sections were frozen in liquid nitrogen and crushed using a mixer mill (1/30 sec, 2 min). 300 μL of methanol was added to the crushed material and sonicated for 10 minutes. Centrifugation (15000 rpm, 10 min) was performed and the supernatant was collected. This extraction operation was repeated three times, the collected supernatant was dried under reduced pressure, and the residue was redissolved in 200 μL of methanol. 20 μL of the re-dissolved solution was dissolved in 180 μL of methanol, and glycoalkaloid was analyzed using LC-MS (manufactured by Waters, product name: UPLC-ESI-MS ACQUITY). The column used was ACQUITY BEH C-18 1.7 μm φ2.1×100 mm (manufactured by Waters). In the LC analysis, gradient elution was performed with mobile phase A: 0.1% formic acid water and B: acetonitrile. Gradient elution was 0-3 minutes, hold at 90% A/10% B, then 3-33 minutes, 90% A/10% B to 57.5% A/42.5% B, 33-38 minutes, The test was carried out by changing from 57.5% A/42.5% B to 0% A/100% B and holding at 100% B for 38-43 minutes. As a preparation containing leptin, S. An extract from flowers of Chacoense PI 458310 was used for comparison.

As a result, as shown in Figures 9 and 10, S. It has been revealed that the production of leptin I and leptin II becomes possible by expressing Sc23DOX and Sc23ACT in S. tuberosum.

From the above, S. In chacoense, leptin is not produced from a compound with a solanidan skeleton (solanine, chaconine) as previously assumed, but through the introduction of a hydroxyl group and then an acetoxy group to the 23rd position of a compound with a spirosolane skeleton. Furthermore, it has been revealed that leptin is produced by converting the spirosolane skeleton of the compound into a solanidan skeleton.

(Example 7) Test for the presence or absence of the Sc23DOX gene in potato varieties and lines used for potato breeding S. In order to confirm that C. tuberosum does not have the Sc23DOX gene, the following analysis was performed.

Potato varieties that do not show CPB resistance and lines used for potato breeding (``Danshaku'', ``May Queen'', ``Sayaka'', ``Sassy'', ``Konafubuki'', ``Desiree'', ``97H32-6'', ``Sakai 35'') S. chacoense PI 458310, a CPB-resistant wild species, using the CTAB method (Hosaka and Hanneman Euphytica, 1998 , 103:265-271). The extracted DNA was subjected to PCR (35 cycles, using BioLine BIOTAQ) using primer GGCATCTACCAAATCAGTTAAAG (SEQ ID NO: 26) and primer GTCTTGAAACATCACTGGGAG (SEQ ID NO: 27) at an annealing temperature of 60°C to amplify the gene. . The obtained results are shown in FIG. 11.

As a result, S. An amplified fragment of approximately 1700 bases was observed in chacoense PI 458310. In addition, during the breeding process, S. Amplified fragments were also observed in Konafubuki and Nishikai No. 35 using chacoense. However, these amplified fragments are It was about 200 bases larger than that of chacoense, about 2000 bases. Furthermore, as a result of determining these base sequences, it was confirmed that the sequences were different from the Sc23DOX gene (for this sequence, see Example 10).

Therefore, within the range of investigation, CPB-resistant potato S. In addition to chacoense PI 458310, no species containing the Sc23DOX gene was detected among the varieties and materials used for breeding.

(Example 8) Testing for the presence or absence of the Sc23ACT gene in potato varieties and lines used for potato breeding Similarly to Example 7, S. In order to confirm that C. tuberosum does not have the Sc23ACT gene, the following analysis was performed.

Potato varieties and lines used for potato breeding (``Danshaku'', ``May Queen'', ``Sayaka'', ``Sassy'', ``Konafubuki'', ``Desiray'', ``97H32-6'', ``Nishikai 35'', ``Hokkai 87'') DNA was extracted by the CTAB method described above. The extracted DNA was subjected to PCR (40 cycles, using BioLine BIOTAQ) using primer GATTATGAATTTTACAATTTG (SEQ ID NO: 28) and primer TACAGGTAGTGACAACGAGGATC (SEQ ID NO: 29) at an annealing temperature of 60°C to amplify the gene. . The obtained results are shown in FIG. 12.

As a result, it was surprisingly revealed that Konafubuki, 97H32-6 and Saikai 35, which do not show CPB resistance, also have the Sc23ACT gene. Konafubuki, 97H32-6 and Saikai No. 35 have S. chacoense (W84 and chc525-3) (Asama et al., Hokkaido Agricultural Experiment Station Bulletin, 1982, 48:75-84, Phumichai et al. Genome, 2005, 48:977-984). Furthermore, there is no report that W84 and chc525-3 accumulate leptin. However, by introducing the Sc23DOX gene into Konafubuki and 97H32-6, which have been shown to have the Sc23ACT gene, it can be expected that these potatoes will also exhibit leptin production ability.

Therefore, it was found that by detecting the Sc23ACT gene, it is possible to easily identify materials that potentially have such leptin-producing ability.

In addition, the above analysis was also performed on Sakurafubuki and pearl starch, which are used in the growing process of Konafubuki. As a result, although not shown in the figure, it was revealed that these also had Sc23ACT.

(Example 9) S. Analysis of steroid glycoalkaloids and genes in the progeny of a cross between Chacoense and potato. In order to confirm the correlation between the Sc23DOX gene and Sc23ACT gene and leptin accumulation, the following analysis was performed.

First, S. cerevisiae expressing leptin. Five seedling lines were obtained from Chacoense PI 458310. It was confirmed that all of these cells accumulated leptin.

Next, these five lines were crossed with potato line 97H32-6, which does not express leptin, to obtain hybrid seeds. Then, DNA was extracted from the leaves of 263 hybrid seeds grown by the method of Hattori et al. (Breed. Sci. 57:305-314), and the Sc23DOX gene and The Sc23ACT gene was amplified. In addition, each steroid glycoalkaloid was analyzed using the method described in Example 3 from approximately 100 mg of leaves grown from hybrid seeds. The results obtained are shown in Table 1. Further, LC-MS analysis data for the three strains are shown in FIG.

As a result, it was revealed that all the hybrids had the Sc23DOX gene and the Sc23ACT gene. Also, from this, S. Chacoense PI 458310 seedlings have homozygous Sc23DOX gene, S. It was revealed that either the seedlings of chacoense PI 458310 or the potato line 97H32-6, or both, have the Sc23ACT gene homozygously.

Furthermore, as shown in Table 1, accumulation of leptin was observed in all individuals of the hybrids, confirming that the presence of the Sc23DOX gene and the Sc23ACT gene was correlated with leptin accumulation.

Note that the thus obtained line having the Sc23DOX gene and Sc23ACT gene and producing leptin can be further backcrossed with 97H32-6 to obtain hybrid seeds. By analyzing the presence or absence of these genes using the same method as described above, it is also possible to identify hybrid seeds that produce leptin.

(Example 10) S. ｔｕｂｅｒｏｓｕｍにおける２３ＤＯＸ遺伝子についての検証 ジャガイモ（Ｓ．ｔｕｂｅｒｏｓｕｍ）のゲノムデータベース（Ｓｐｕｄ ＤＢ：ｈｔｔｐ：／／ｓｏｌａｎａｃｅａｅ．ｐｌａｎｔｂｉｏｌｏｇｙ．ｍｓｕ．ｅｄｕ／ｉｎｄｅｘ．ｓｈｔｍｌ）にある配列を対象とした、ｔｂｌａｓｔ解析では、Ｓｃ２３ＤＯＸにEven the sequence with the highest homology (PGSC0003DMT400081914) has a low identity of 79%, and S. It was thought that the 23DOX gene did not exist in M. tuberosum.

However, surprisingly, as shown in Example 7, S. Amplification of a fragment of approximately 2000 bases, approximately 200 bases larger than the amplification product derived from the Sc23DOX gene of S. chacoense PI 458310 (approximately 1700 bases), observed in tuberosum. As a result of determining these base sequences, it was revealed that a sequence extremely similar to the Sc23DOX gene was amplified.

Therefore, S. The cDNA of S. tuberosum cultivar Sassy was subjected to PCR (40 cycles, Takara Bio Inc. Prim using eSTAR) . The obtained PCR amplification product was cloned into pENTR/D-TOPO vector (manufactured by Thermo Fisher) to obtain a gene fragment, and the full-length sequence was determined (the amino acid sequence encoded by the determined nucleotide sequence was SEQ ID NO: 4). (The protein encoded by this gene is also hereinafter referred to as "St23DOX"). Note that the sequence identity at the amino acid level between St23DOX and Sc23DOX was 94%. Furthermore, as a result of further analysis, it was found that the St23DOX gene is present in at least Konafubuki, Sakurafubuki, pearl starch, Nishikai 35gogo, and Danshaku yam, in addition to Sassy.

(Example 11) Detection of in vitro enzymatic activity of St23DOX The St23DOX gene identified in Example 10 was analyzed in the same manner as in Example 3. As a result, as shown in FIGS. 2 and 3, when α-tomatine was used as a substrate, S. It was also revealed that a product derived from St. tuberosum (St23DOX) had a hydroxyl group introduced at the 23rd position. That is, it was revealed that St23DOX, like Sc23DOX and Sl23DOX, can be involved in leptinin production. On the other hand, S. CPB resistance through leptinin production is not observed in C. tuberosum (variety Sassy). Therefore, the above suggests that, at least in the Sassy variety, St23DOX is not expressed to the extent that it contributes to sufficient production of leptinin.

(Example 12) S. Verification of the 23ACT gene in S. tuberosum In tblast analysis of sequences in the potato (S. tuberosum) genome database (Spud DB: http://solanaceae.plantbiology.msu.edu/index.shtml), Sc23ACT to Even for the sequence with the highest homology (PGSC0003DMT400023800), the identity was as low as 75%, and it was confirmed that 30 extra amino acids were added to the N-terminus. Therefore, we have not found any species with a full length similar to Sc23ACT that has more than 50% homology, and S. It was thought that the 23ACT gene did not exist in M. tuberosum.

However, surprisingly, when preparing the test primers in Example 8, S. It was suggested that M. tuberosum also has a sequence that is extremely close to the Sc23ACT gene. Therefore, PCR was performed on the genome of Sassy variety using primer CATATGGCAGCATCAAGTTGTGT (SEQ ID NO: 32) and primer GTCGACTTAATTAAGATTAGTAATTGGAGAAG (SEQ ID NO: 33) at an annealing temperature of 55°C (40 cycles, using PrimeSTAR HS manufactured by Takara Bio). did Ta. The obtained PCR amplification product was cloned into pCR4Blunt-TOPO vector (manufactured by Thermo Fisher) to obtain a gene fragment, and the full-length sequence was determined (the amino acid sequence encoded by the determined nucleotide sequence is shown in SEQ ID NO: 10). The protein encoded by this gene is also hereinafter referred to as "St23ACT"). Note that the sequence identity at the amino acid level between St23ACT and Sc23ACT was 91%.

(Example 13) Detection of in vitro enzymatic activity of St23ACT The St23ACT gene identified in Example 12 was analyzed in the same manner as in Example 4. As a result, as shown in FIGS. 4 and 5, it was revealed that when 23-hydroxytomatine was used as a substrate, a product with an acetoxy group introduced at the 23-position could be obtained in the presence of St23ACT. That is, it was revealed that St23ACT, like Sc23ACT and Sl23ACT, can be involved in leptin production. On the other hand, S. CPB resistance due to leptin accumulation is not observed in C. tuberosum (variety Sassy). Therefore, the above suggests that, at least in the Sassy variety, St23ACT is not expressed to the extent that it contributes to sufficient production of leptin, similar to the above-mentioned St23DOX.

(Example 14) Introduction of the Sc23DOX gene into the Sc23ACT gene In Example 8, it was revealed that the Sc23ACT sequence is present in the Sc23ACT gene, and this sequence is functional, and the Sc23DOX gene expresses 23ACT activity. In order to confirm this, steroid glycoalkaloids in the hairy roots of potatoes into which the Sc23DOX gene had been introduced were analyzed.

Specifically, in the same manner as in Example 6, a vector pBin+201_Sc23DOX was created in which the Sc23DOX gene was linked to pBin+201, and this was introduced into Agrobacterium rhizogenes strain C15834. Agrobacterium containing the vector was placed in YEB liquid medium [5 g/l beef extract, 1 g/l yeast extract, 5 g/l peptone, 5 g/l sucrose, 2 mM magnesium sulfate (pH 7.2)] containing 50 ppm kanamycin. The cells were cultured with shaking at 28°C for 12 hours. The culture solution was spread on YEB agar medium (2% agarose) and cultured in the dark at 28°C for 72 hours. Cut the potato variety "Konafubuki" cultured in a test tube into 1-1.5 cm pieces, attach the root end of the stem to a colony of Rhizogenes, and place in a plant box on B5 medium (0.3% Gelrite, 2% sucrose). ) with the root end pointing upwards. This was cultured in the dark at 20°C for 20 days, and the upper part of the stem where the formation of hairy roots was confirmed was cut off and transferred to MS medium (containing 0.3% Gelrite, 2% sucrose, and 250 ppm cefotaxime). The cells were cultured at ℃ for 7 days and sterilized. The tips of the elongated hairy roots (1 cm) were cut off and transferred to B5 medium (containing 0.3% Gelrite, 2% sucrose, and 250 ppm cefotaxime), and cultured in the dark at 25°C for 7 days. The hairy roots obtained were divided into sections, transferred to B5 liquid medium (containing 2% sucrose), and cultured with shaking at 20° C. in the dark (100 rpm) for an additional 14 days. 100 mg of the cells grown from the sections were frozen in liquid nitrogen and crushed using a mixer mill (1/30 sec, 2 min). 300 μL of methanol was added to the crushed material and sonicated for 10 minutes. Centrifugation (15000 rpm, 10 min) was performed and the supernatant was collected. This extraction operation was repeated three times, the collected supernatant was dried under reduced pressure, and the residue was redissolved in 200 μL of methanol. 20 μL of the re-dissolved solution was dissolved in 180 μL of methanol, and glycoalkaloid was analyzed using LC-MS (manufactured by Waters, product name: UPLC-ESI-MS ACQUITY). The column used was ACQUITY HSS T3 1.8 μm φ2.1×100 mm (manufactured by Waters). In the LC analysis, gradient elution was performed with mobile phase A: 0.1% formic acid water and B: acetonitrile. Gradient elution was 0-30 minutes, 90% A/10% B to 45.0% A/55.0% B, 30-31 minutes, 45.0% A/55.0% B to 0% A/ This was done by holding in 100% B for 31-35 minutes.

As a result, as shown in Figures 14 and 15, it was confirmed that by forcibly expressing only the Sc23DOX gene, it was possible to produce leptin I and leptin II in P. elegans, in which leptin production was not observed. .

From the above, it was suggested that in strains and varieties that have the Sc23ACT gene, leptin can be produced by introducing only the Sc23DOX gene.

As explained above, according to the present invention, by using the identified hydroxylase gene and/or acetyl transferase gene, it is possible to introduce a hydroxyl group or acetoxy group into the 23rd position of the spirosolane skeleton, It also becomes possible to produce leptinin or leptin. Furthermore, according to the present invention, by biosynthesizing and accumulating leptin, it is also possible to increase the resistance of plants to CPB. That is, it becomes possible to efficiently provide plants with increased resistance to CPB. Furthermore, according to the present invention, resistance to CPB in a plant can be efficiently determined using the presence of the gene as an indicator. Therefore, the present invention is useful in the cultivation of Solanaceae plants that are subject to insect damage caused by CPB.

Sequence number: 13-33
<223> Sequence of artificially synthesized primer

Claims (9)

An acetoxy group at position 23 of the spirosolane skeleton, comprising at least one DNA selected from the group consisting of the following (a) to (b) and at least one DNA selected from the group consisting of the following (e) to (f). Composition for use in introduction (a) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6
(b) DNA encoding a protein consisting of an amino acid sequence having 90 % or more identity with the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6 and having the activity of hydroxylating the 23rd position of the spirosolane skeleton.
(e) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 8, 10 or 12
(f) DNA encoding a protein consisting of an amino acid sequence having 90 % or more identity with the amino acid sequence set forth in SEQ ID NO: 8, 10, or 12, and having the activity of acetylating the hydroxyl group at position 23 of the spirosolane skeleton. . A method for improving leptin accumulation in plants, comprising at least one DNA selected from the group consisting of the following (a) to (b) and at least one DNA selected from the group consisting of the following (e) to (f). Composition for use (a) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6
(b) DNA encoding a protein consisting of an amino acid sequence having 90 % or more identity with the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6 and having the activity of hydroxylating the 23rd position of the spirosolane skeleton.
(e) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 8, 10 or 12
(f) DNA encoding a protein consisting of an amino acid sequence having 90 % or more identity with the amino acid sequence set forth in SEQ ID NO: 8, 10, or 12, and having the activity of acetylating the hydroxyl group at position 23 of the spirosolane skeleton. . Resistance to Colorado potato beetle in plants, comprising at least one DNA selected from the group consisting of the following (a) to (b) and at least one DNA selected from the group consisting of the following (e) to (f) Composition (a) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6
(b) DNA encoding a protein consisting of an amino acid sequence having 90 % or more identity with the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6 and having the activity of hydroxylating the 23rd position of the spirosolane skeleton.
(e) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 8, 10 or 12
(f) DNA encoding a protein consisting of an amino acid sequence having 90 % or more identity with the amino acid sequence set forth in SEQ ID NO: 8, 10, or 12, and having the activity of acetylating the hydroxyl group at position 23 of the spirosolane skeleton. . At least one DNA selected from the group consisting of the following (a) to (b) and at least one DNA selected from the group consisting of the following (e) to (f) have been introduced , and the plant has resistance to the Colorado potato beetle. Transformed plant cell capable of regenerating an enhanced plant body (a) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6
(b) DNA encoding a protein consisting of an amino acid sequence having 90 % or more identity with the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6 and having the activity of hydroxylating the 23rd position of the spirosolane skeleton.
(e) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 8, 10 or 12
(f) DNA encoding a protein consisting of an amino acid sequence having 90 % or more identity with the amino acid sequence set forth in SEQ ID NO: 8, 10, or 12, and having the activity of acetylating the hydroxyl group at position 23 of the spirosolane skeleton. . A transformed plant with increased resistance to Colorado potato beetle, regenerated from the transformed plant cell according to claim 4 . A method for producing a plant with increased resistance to Colorado potato beetle, comprising:
A step of introducing at least one DNA selected from the group consisting of the following (a) to (b) and at least one DNA selected from the group consisting of the following (e) to (f) into a plant cell, and
A method comprising the step of regenerating a plant from a transformed plant cell into which the DNA has been introduced in the step (a) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6.
(b) DNA encoding a protein consisting of an amino acid sequence having 90 % or more identity with the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6 and having the activity of hydroxylating the 23rd position of the spirosolane skeleton.
(e) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 8, 10 or 12
(f) DNA encoding a protein consisting of an amino acid sequence having 90 % or more identity with the amino acid sequence set forth in SEQ ID NO: 8, 10, or 12, and having the activity of acetylating the hydroxyl group at position 23 of the spirosolane skeleton. . A method for determining resistance to Colorado potato beetle in a plant, the method comprising:
In the test plant,
Detecting the presence or expression of at least one DNA selected from the group consisting of the following (a) to (b ) and at least one DNA selected from the group consisting of the following (e) to (f) , and A method comprising the step of determining that the test plant has resistance to Colorado potato beetle when the presence or expression of the DNA is detected in the step (a) SEQ ID NO: 2, 4 or 6 DNA encoding a protein consisting of the amino acid sequence described in
(b) DNA encoding a protein consisting of an amino acid sequence having 90 % or more identity with the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6 and having the activity of hydroxylating the 23rd position of the spirosolane skeleton.
(e) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 8, 10 or 12
(f) DNA encoding a protein consisting of an amino acid sequence having 90 % or more identity with the amino acid sequence set forth in SEQ ID NO: 8, 10, or 12, and having the activity of acetylating the hydroxyl group at position 23 of the spirosolane skeleton. . 1. A method of producing a plant resistant to Colorado potato beetle, the method comprising:
Crossing a plant resistant to the Colorado potato beetle with any plant;
A step of determining resistance to Colorado potato beetle in the plants obtained by the hybridization in the step by the method according to claim 7 ;
and selecting plants determined to have resistance to the Colorado potato beetle. 1. A method of producing a plant resistant to Colorado potato beetle, the method comprising:
A plant having at least one DNA selected from the group consisting of the following (a) to (b) is crossed with a plant having at least one DNA selected from the group consisting of the following (e) to (f). process and
A step of determining resistance to Colorado potato beetle in the plants obtained by the hybridization in the step by the method according to claim 7 ;
A method comprising the step of selecting plants determined to have resistance to the Colorado potato beetle (a) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6.
(b) DNA encoding a protein consisting of an amino acid sequence having 90 % or more identity with the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6 and having the activity of hydroxylating the 23rd position of the spirosolane skeleton.
(e) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 8, 10 or 12
(f) DNA encoding a protein consisting of an amino acid sequence having 90 % or more identity with the amino acid sequence set forth in SEQ ID NO: 8, 10, or 12, and having the activity of acetylating the hydroxyl group at position 23 of the spirosolane skeleton. .