JP7333579B2 - ALZHEIMER'S DISEASE MODEL NERVE CELLS, METHOD FOR PRODUCING THEREOF, AND SCREENING METHOD FOR ALZHEIMER'S DISEASE ACTIVE DRUG USING SAME NERVE CELLS - Google Patents

Description

The present invention relates to an Alzheimer's disease model neuron, a method for producing the same, and a screening method for drugs acting on Alzheimer's disease using the neuron. According to the present invention, Alzheimer's disease model neurons can be used to develop drugs that affect Alzheimer's disease.

Alzheimer's disease is a disease in which the brain atrophies and presents with symptoms of progressive cognitive impairment. As lesions, degeneration and disappearance of nerve cells and associated cerebral atrophy are observed, particularly atrophy of the cerebral cortex and hippocampus.
In the hippocampus, unlike other parts of the brain, neurogenesis continues into adulthood. In Alzheimer's disease, neurogenesis in the hippocampus is inhibited, and it is believed that the hippocampus atrophies (Non-Patent Document 1). However, the mechanism by which neurogenesis is inhibited in Alzheimer's disease patients has not been elucidated.

“Frontiers in Neuroscience” (Switzerland) 2016, Vol. 10, 178 "NATURE PROTOCOLS" (UK) 2012, Vol. 7, p. 1836-1846 "PLOS ONE" (United States) 2014, Vol. 9, No. 9, e106952 "Cell" (USA) 2006, Vol. 126, p. 663-676 "Science" (USA) 2007, Vol. 318, p. 1917-1920

Recently, methods for inducing nerve cells from induced pluripotent stem cells (hereinafter sometimes referred to as iPS cells) have been reported (Non-Patent Documents 2 and 3).
In order to prepare neurons that serve as a model for Alzheimer's disease, the present inventors used the above-described method for inducing neurons to generate neurons from iPS cells derived from patients with Alzheimer's disease and iPS cells derived from a healthy subject. tried induction. However, when the above induction method is used, normal nerve cells are induced from both Alzheimer's disease patient-derived iPS cells and healthy subject-derived iPS cells, and Alzheimer's disease patient-derived iPS cells are used as models of Alzheimer's disease. It was not possible to obtain new neurons (for example, neurons whose neogenesis was inhibited).
Accordingly, it is an object of the present invention to provide an Alzheimer's disease model neuron and a method for producing the same. Another goal is to screen drugs that affect Alzheimer's disease using the Alzheimer's disease model neurons.

As a result of intensive research on a method for producing Alzheimer's disease model nerve cells, the present inventor surprisingly found that cells were separated into single cells in the step of inducing neuroepithelial cells from iPS cells and in the step of inducing mature nerve cells. It was found that by seeding, mature neurons having characteristics of neurons of Alzheimer's disease patients can be produced.
The present invention is based on these findings.
Accordingly, the present invention provides
[1] (1) Alzheimer's disease patient-derived induced pluripotent stem cells (iPS) cells are separated into single cells, seeded at a cell concentration that becomes 100% confluence after 48 hours from the start of culture, and ROCK inhibitor (2) forming neural rosettes by culturing the neuroepithelial cells; and (3) obtaining in step (2) Manufacture of Alzheimer's disease model neurons from Alzheimer's disease patient-derived iPS cells, comprising the step of inducing mature neurons by dissociating and seeding the cells into single cells and culturing in the presence of a ROCK inhibitor. how to,
[2] The method for producing nerve cells according to [1], wherein in the step (2), the neuroepithelial cells are separated into single cells and seeded;
[3] In step (2), culturing in the presence of basic fibroblast growth factor (bFGF) or in the presence of a factor that activates the PI3-K/AKT pathway or RAS/ERK pathway, [1] or the nerve cell production method according to [2],
[4] Alzheimer's disease model neurons obtained by the method for producing neurons according to any one of [1] to [3], and [5] (A) according to any one of [1] to [3] in one or more steps of steps (1), (2), and (3) in the method for producing nerve cells of , adding a drug candidate substance acting on Alzheimer's disease and culturing the cells; and (B) a screening method for a drug acting on Alzheimer's disease, comprising the step of analyzing cells to which the candidate substance has been added and cells to which the candidate substance has not been added, and selecting a candidate substance that acts on the cell;
Regarding.

According to the method for producing Alzheimer's disease model nerve cells of the present invention, nerve cells exhibiting characteristics of Alzheimer's disease can be produced from iPS cells derived from Alzheimer's disease patients. Furthermore, in the neural rosette formation step, by separating the cells into single cells and seeding them, even better Alzheimer's disease model neurons can be produced.
In addition, by using the Alzheimer's disease model neuron of the present invention, the mechanism of onset of Alzheimer's disease can be studied. In particular, candidate substances for therapeutic agents for Alzheimer's disease can be accurately screened by the screening method for drugs acting on Alzheimer's disease using Alzheimer's disease model nerve cells.

1 is a photograph showing the expression of MAP2, TUJ1, and PAX6 in mature neurons induced from healthy subject iPS cells (HPS0076, HPS0360, P11025) and Alzheimer's iPS cells (HPS0254, HPS0255, HPS0256) of Comparative Example 1. 1 is a photograph showing the expression of MAP2, TUJ1, and PAX6 in mature neurons induced from healthy iPS cells (HPS0076, HPS0360, P11025) and Alzheimer's iPS cells (HPS0254, HPS0255, HPS0256) of Example 1. (A) shows expression of MAP2, TUJ1, and PAX6 genes in mature neurons obtained from healthy iPS cells (HPS0076, HPS0360, P11025) and Alzheimer's iPS cells (HPS0254, HPS0255, HPS0256) analyzed by PCR. graph. (B) is a graph of MAP2, TUJ1, and PAX6 gene expression in the hippocampus of healthy subjects and Alzheimer's patients obtained from the database and analyzed. (C) is a graph of MAP2, TUJ1, and PAX6 gene expression in the frontal cortex of healthy subjects and Alzheimer's patients obtained from the database and analyzed. (D) is a graph of gene expression of MAP2, TUJ1, and PAX6 in the temporal cortex of healthy subjects and Alzheimer's patients obtained from the database and analyzed. iPS cells (HPS0076) of healthy subjects and Alzheimer's disease patients of Comparative Example 2, in which iPS cells were seeded as cell clusters in step (1), and iPS cells were isolated and seeded into single cells in steps (2) and (3) Fig. 10 is a photograph showing the expression of MAP2, TUJ1, and PAX6 in mature neurons induced from iPS cells (HPS0256) derived from iPS cells. In the step (1), the iPS cells were isolated into single cells and seeded, in the step (2), the iPS cells were seeded as cell clusters, and in the step (3), the iPS cells were isolated into single cells and seeded. Fig. 3 shows photographs showing the expression of MAP2, TUJ1, and PAX6 in mature neurons induced from human iPS cells (HPS0076) and Alzheimer's disease patient-derived iPS cells (HPS0256). iPS cells of healthy subjects (HPS0076) and Alzheimer's disease patients of Comparative Example 3, in which iPS cells were seeded as cell clusters in step (3), and iPS cells were isolated and seeded into single cells in steps (1) and (2) Fig. 10 is a photograph showing the expression of MAP2, TUJ1, and PAX6 in mature neurons induced from iPS cells (HPS0256) derived from iPS cells. iPS cells are isolated into single cells in step (1) and seeded at a concentration of 4.0 × 10 ⁵ cells/cm ² (8 times the number of cells in Example 1), step (2) and step (3) of mature neurons induced from healthy human iPS cells (HPS0076, HPS0360, P11025) and Alzheimer's disease patient-derived iPS cells (HPS0254, HPS0255, HPS0256) in Comparative Example 4 in which the iPS cells were isolated and seeded as single cells in FIG. 2 is a photograph showing the expression of MAP2, TUJ1 and PAX6, and a graph obtained by analyzing the expression of the genes of MAP2, TUJ1 and PAX6 by PCR. FIG. iPS cells are isolated into single cells in step (1) and seeded at a concentration of 2.0×10 ⁵ cells/cm ² (4 times the number of cells in Example 1), step (2) and step (3) Expression of MAP2, TUJ1, and PAX6 in mature neurons induced from healthy iPS cells (HPS0360) and Alzheimer's disease patient-derived iPS cells (HPS0256) in Example 3, in which the iPS cells were isolated into single cells and seeded in and a graph obtained by PCR analysis of gene expression of MAP2, TUJ1, and PAX6. Fig. 10 is a photograph showing analysis of TUJ1-positive cells, MAP2-positive cells, and cCASP3-positive cells after screening candidate substances for drugs acting on Alzheimer's disease using iPS cells (HPS0256) derived from Alzheimer's disease patients. Fig. 10 is a photograph showing analysis of TUJ1-positive cells, MAP2-positive cells, and cCASP3-positive cells after screening candidate substances for drugs acting on Alzheimer's disease using iPS cells (HPS0254) derived from Alzheimer's disease patients. 1 is a graph showing the gene expression levels of MAP2 and TUJ1 when SAG, Isobavacin, and Neuropashiazol were screened by the screening method of the present invention.

[1] Method for producing Alzheimer's disease model nerve cells The method for producing Alzheimer's disease model nerve cells of the present invention comprises (1) separating Alzheimer's disease patient-derived induced pluripotent stem (iPS) cells into single cells and starting culturing. (2) inducing neuroepithelial cells by seeding at a cell concentration that results in 100% confluence after 48 hours and culturing in the presence of a ROCK inhibitor, (2) culturing said neuroepithelial cells , forming neural rosettes, and (3) dissociating the cells obtained in step (2) into single cells, seeding them, and inducing them into mature neurons by culturing in the presence of a ROCK inhibitor. and the step of

<<Conventional method for inducing nerve cells from iPS cells>>
In the conventional methods for inducing mature neurons from healthy human iPS cells described in Non-Patent Documents 2 and 3, in the steps corresponding to steps (1) to (3), a state of high cell density or a cell cluster (cell The cells are either seeded and cultured in aggregates), or are cultured in step (3) without passaging while still forming rosettes in step (2). That is, in Non-Patent Documents 2 and 3, it is considered that mature neurons are induced from iPS cells by culturing cells in contact with each other. As used herein, the term "cell cluster" means that a large number of iPS cells form clusters in a non-adhesive state of the cells to the culture dish.

<<Alzheimer's disease patient-derived induced pluripotent stem (iPS) cells>>
Alzheimer's disease patient-derived iPS cells used in the method for producing Alzheimer's disease model nerve cells of the present invention are not particularly limited as long as they are derived from Alzheimer's disease patients. For example, introducing OCT3/4, SOX2, KLF4, and C-MYC into fibroblasts, dental pulp cells, peripheral blood cells, cord blood cells, mesenchymal stem cells, skeletal myoblasts or periosteal cells derived from Alzheimer's disease patients. iPS cells can be obtained by (Non-Patent Document 4).
Also, by introducing OCT3/4, SOX2, NANOG, and LIN28 into fibroblasts, dental pulp cells, peripheral blood cells, cord blood cells, mesenchymal stem cells, skeletal myoblasts, or periosteal cells derived from Alzheimer's disease patients , iPS cells can be obtained (Non-Patent Document 5).
Specifically, the Alzheimer's disease patient-derived iPS cells include, for example, HPS0254 cells, HPS0255 cells, or HPS0256 cells (provided by RIKEN Cell Bank).

<<Neuroepithelial cell induction step (1)>>
In the neuroepithelial cell induction step (1), Alzheimer's disease patient-derived induced pluripotent stem (iPS) cells are separated into single cells and seeded at a cell concentration that will reach 100% confluence 48 hours after the start of culture, and cultured in the presence of a ROCK inhibitor. A neuroepithelial cell sheet can be obtained by this step (1).
Preculture of iPS cells can be performed by a known method. For example, mTeSR1 medium, MEF medium, Essential 8 ^TM medium, or TeSR-E8 medium can be used for pre-culture at 37° C., 5% CO ₂ for 4-7 days.

In this step (1), the pre-cultured cells are separated into single cells. The method of separating into single cells is not particularly limited, but cells adhering to the culture plate can be detached with, for example, a proteolytic enzyme and separated into single cells. As a proteolytic enzyme, for example trypsin, collagenase, hyaluronidase, elastase, pronase or accutase can be used. As a substitute for trypsin, a commercially available enzyme TrypLE (Thermo Fisher SCIENTIFIC) or Gentle Cell Dissociation Reagent (STEMCELL Technologies) can be used.

The cells are seeded separately into single cells. The cell concentration at the time of seeding is not particularly limited as long as the effects of the present invention can be obtained, but a cell concentration at which 100% confluence is achieved 48 hours after the initiation of culture is preferred. By reaching 100% confluence after 48 hours, cell-to-cell contact in the initial stage of culture can be suppressed, and the pathology of Alzheimer's disease patients can be reproduced. In addition, the time when the seeded cells reach 100% confluence is more preferably 3 days (72 hours) or later, still more preferably 4 days (96 hours) or later, and most preferably 5 days ( 120 hours) and later.

The proliferation rate of iPS cells differs from iPS cell to iPS cell. Therefore, the cell concentration at the time of seeding that reaches 100% confluence after 48 hours from the start of culture also differs depending on the iPS cells used. For example, the cell concentration at the time of seeding at which 100% confluence occurs 48 hours after the start of culture can be determined by inoculating different cell concentrations and culturing for 48 hours to determine the cell concentration at which 100% confluence occurs. In addition, the cell concentration at the time of seeding that reaches 100% confluence 3 days (72 hours), 4 days (96 hours), or 5 days (120 hours) after the start of culture can also be determined by the same method. Basically, the cell concentration at the time of seeding that reaches 100% confluence 3 days (72 hours), 4 days (96 hours), or 5 days (120 hours) after the start of culture is 100% confluence 48 hours after the start of culture. The cell concentration is less than the cell concentration at the time of seeding.
For example, iPS cells from healthy subjects (HPS0076, HPS0360, P11025) and Alzheimer's disease patient-derived iPS cells (HPS0254, HPS0255, HPS0256) used in Examples were seeded at a concentration of 5.0×10 ⁴ cells/cm ² . (Example 1), 100% confluence is reached in about 5 to 7 days. That is, for these cells, the seeding concentration at the start of culture of 5.0×10 ⁴ cells/cm ² is “the cell concentration at which 100% confluence is reached 48 hours after the start of culture”. On the other hand, when seeding at a concentration of 4.0×10 ⁵ cells/cm ² (Comparative Example 4), 100% confluence is achieved in one day. That is, for these cells, the seeding concentration at the start of culture, which is 4.0×10 ⁵ cells/cm ² , is not the “cell concentration at which 100% confluence is reached 48 hours after the start of culture”.

In addition, “100% confluence” as used herein basically means a state in which there are no gaps between cells on the bottom surface of the culture vessel. However, due to variations in cell seeding, the state in which less than 5% of the bottom surface is not covered with cells (the state in which 95% or more of the bottom surface is covered with cells) is also defined as "100% confluence."

(ROCK inhibitor)
In this step (1), Alzheimer's disease patient-derived induced pluripotent stem (iPS) cells are cultured in the presence of a ROCK inhibitor.
ROCK (Rho-associated coiled-coil forming kinase: Rho kinase) is an intracellular phosphorylation enzyme, and by inhibiting the action of this phosphorylation enzyme, iPS cells can be induced to differentiate into neuroepithelial cells. .
ROCK inhibitors include, but are not limited to Y-27632, N-Boc-Y-27632, CS-0341, Thiazovivin or Ripasudil.
The addition concentration of the ROCK inhibitor is not particularly limited as long as it is a concentration capable of suppressing the cell death of iPS cells, and can be appropriately determined according to the activity of each ROCK inhibitor. 1 μM to 1 mM, preferably 1 to 100 μM.

The Rock inhibitor may be added in all steps of step (1), or may be added and cultured in the early stages of step (1) and cultured in the absence of the ROCK inhibitor in the later stages. good. This is because the addition of the Rock inhibitor at the initial stage of step (1) can prevent the iPS cells seeded in a state of being separated into single cells from being easily killed.
The initial stage time for adding the ROCK inhibitor is not particularly limited, but may be, for example, 6 to 48 hours, preferably 12 to 24 hours.

The culture plate used for culture is not particularly limited as long as the effects of the present invention can be obtained. For example, a plate coated with an extracellular matrix or the like may be used, or an uncoated plate may be used. . The extracellular matrix used for coating is not particularly limited, but includes laminin, collagen (eg, type IV collagen), heparin sulfate proteoglycan, poly-L-ornithine, vitronectin, or entactin/nidogen. Matrigel™ or CELLStart can be used as commercially available products.

The culture conditions are not particularly limited as long as the _iPS cells can be cultured. The medium is not particularly limited as long as it is a medium for iPS cells, but for example, Neural differential basal medium, mTeSR1 medium, MEF medium, Essential 8 ^TM medium, or TeSR-E8 medium can be used.
The culture period is not particularly limited as long as the effect of the present invention is obtained, but is, for example, 2 to 15 days, more preferably 3 to 10 days, and still more preferably 5 to 8 days. .

(TGFβ inhibitor)
In the neuroepithelial cell induction step (1), the iPS cells are preferably cultured in the presence of, but not limited to, a TGFβ inhibitor and/or a BMP (bone morphogenetic protein) inhibitor. Examples of TGFβ inhibitors include, but are not limited to, A83-01, SB-431542, SB-505124, SB-525334, SD-208, LY-36494, and SJN-2511. BMP inhibitors include noggin, chordin, a chordin-like protein containing a chordin domain, follistatin, a follistatin-related protein containing a follistatin domain, DAN, a DAN-like protein containing a DAN cysteine knot domain, sclerostin/SOST. , LDN193189, or α-2 macroglobulin.
The concentration of the TGFβ inhibitor or BMP inhibitor is not particularly limited, and can be appropriately selected according to the effective concentration of each TGFβ inhibitor or BMP inhibitor. For example, SB-431542 can be used at 1-100 μM, preferably 5-50 μM, more preferably 7-20 μM. Also, Noggin can be used at 20 ng/mL to 2 μg/mL, preferably 50 ng/mL to 1 μg/mL, more preferably 100 to 500 ng/mL.

The neuroepithelial cells obtained in this step (1) are undifferentiated cells and can be differentiated into neurons, glial cells, and the like. In addition, neuroepithelial cells have the property of forming tight junctions with each other in vivo. Markers for neuroepithelial cells can include Nestin, SOX2, Notch1, HES1, HES3, Occludin, E-cadherin, or SOX10.

<<Neural rosette formation step (2)>>
In the neural rosette formation step (2), neural rosettes are formed by culturing the neuroepithelial cells. The neuroepithelial cells may be seeded in the form of cell aggregates, but are preferably isolated into single cells and seeded. In the neural rosette formation step (2), although not limited, preferably in the presence of basic fibroblast growth factor (bFGF), or by activating the PI3-K/AKT pathway or RAS/ERK pathway Incubated in the presence of factors.

The method of seeding cells as cell aggregates is not particularly limited, but can be carried out, for example, as follows. A neuroepithelial cell sheet is treated with 1 mg/mL dispase (Dispase) at 37° C. for 3 minutes. The cell sheet is gently pipetted to form cell clumps. Also, for example, EDTA (0.5 mM) can be acted on cells to form cell aggregates. Furthermore, Collagenase can be used to form cell clusters.
The number of cells per cell cluster is not particularly limited, but is preferably 10-2000, more preferably 50-1000, and more preferably 100-500.

In addition, the method of separating the cells into single cells and seeding them can be carried out by the method described in the above-mentioned “neuroepithelial cell induction step (1)”.
The cell concentration at the time of seeding is not particularly limited as long as the effect of the present invention can be obtained, whether it is seeded as a cell mass or seeded separately into single cells. Cells induced to become epithelial cells have a lower proliferative ability than iPS cells, and therefore are preferably seeded at a concentration higher than the cell concentration in step (1). For example, the concentration of cells is 1.0×10 ⁴ to 1.0×10 ⁶ cells/cm ² , preferably 5.0×10 ⁴ to 5.0×10 ⁵ cells/cm ² and more It is preferably 7.0×10 ⁴ to 3.0×10 ⁵ cells/cm ² . In the case of separating into single cells and seeding, it is preferable to use a ROCK inhibitor, and it can be used under the same conditions as in step (1).
In the step (2), the effect of the present invention can be obtained by seeding the cell mass, but more preferably, by seeding in the above-mentioned cell concentration range, cell-to-cell contact is suppressed and Alzheimer's disease is prevented. It is thought that the pathological conditions in patients can be reproduced.

(Basic fibroblast growth factor (bFGF))
In the neural rosette formation step (2), for example, neuroepithelial cells may be cultured in the presence of basic fibroblast growth factor (hereinafter sometimes referred to as bFGF). bFGF, also called FGF2, is one of 22 FGFs identified in humans. It binds to the fibroblast growth factor receptor (FGFR) and exhibits, for example, potent angiogenic effects.
The concentration of bFGF is not particularly limited as long as neural rosettes are formed, but is preferably 5-300 ng/mL, more preferably 10-200 ng/mL.

(PI3-K/AKT pathway activator)
In the neural rosette formation step (2), neuroepithelial cells may be cultured, for example, in the presence of a PI3-K/AKT pathway activator.
The PI3-K/AKT pathway is a pathway in which phosphatidylinositol 3-kinase (PI3K) phosphorylates and activates protein kinase B (PKB, also known as AKT). Activation of this pathway is reported to promote self-renewal and neurogenesis of neural stem cells, which are necessary for the proliferation of neurons.
PI3-K/AKT pathway activators include, but are not limited to, Akt Activator II, SC79 (CAS 305834-79-1), Insulin, 740-YP, EGF, or VEGF.

(RAS/ERK pathway activator activator)
In the neural rosette formation step (2), neuroepithelial cells may be cultured in the presence of, for example, a RAS/ERK pathway activator activator.
The RAS/ERK pathway is a pathway in which Ras protein (RAS) activates extracellular signal-regulated kinase (ERK) via RAF protein kinase (RAF), MAPK/ERK kinase (MEK). Inhibition of the MEK/ERK pathway is reported to inhibit neurogenesis of hippocampal cells. From the above, activation of the RAS/ERK pathway (more precisely, the RAS/RAF/MEK/ERK pathway) is believed to promote neurogenesis, which is necessary for the proliferation of neurons.
RAS/ERK pathway activators include, but are not limited to, isoproterenol hydrochloride, t-Butylhydroquinone, fisetin, ceramide C6, and KU-0058948.

The culture plate used for culture is not particularly limited as long as the effects of the present invention can be obtained, and the culture plate described in the section "Neuroepithelial cell induction step (1)" can be used, It is preferred to use laminin-coated culture plates.
Culture conditions (temperature, CO ₂ concentration, medium, etc.) are not particularly limited as long as neural rosettes are formed, and the conditions described in the section "Neural epithelial cell induction step (1)" above are used. can be used.
The culture period is not particularly limited as long as the effects of the present invention can be obtained, but is, for example, 2 to 10 days, more preferably 3 to 7 days, and still more preferably 4 to 6 days. .

The neural rosette formed in the neural rosette formation step (2) means that a plurality of neural stem cells gather (arrange) in a rosette shape (radially). That is, the term "rosette formation" means that a plurality of neural stem cells gather (arrange) in a rosette shape (radially) in a culture in which cells adhere to a culture plate.

<<Mature nerve cell induction step (3)>>
In the mature neuronal cell induction step (3), the cells obtained in step (2) are dissociated into single cells, seeded, and cultured in the presence of a ROCK inhibitor.

In addition, the method of separating the cells into single cells and seeding them can be carried out by the method described in the above-mentioned “neuroepithelial cell induction step (1)”.
The cell concentration at the time of seeding is not particularly limited as long as the effects of the present invention can be obtained. Seeding at high concentrations is preferred. The cell concentration is 2.0×10 ⁴ to 2.0×10 ⁶ cells/cm ² , preferably 5.0×10 ⁴ to 1.0×10 ⁶ cells/cm ² , more preferably 0.8×10 ⁴ to 5.0×10 ⁵ cells/cm ² .

As the ROCK inhibitor used in the step (3) of inducing mature nerve cells, the one described in the above “step (1) of inducing neuroepithelial cells” can be used. The Rock inhibitor may be added in all the steps of step (3), but it is added and cultured in the early stages of step (3), and the concentration of the rock inhibitor is reduced in the later stages, or It may be cultured in the presence. This is because the addition of the Rock inhibitor at the initial stage of step (3) can prevent the cells seeded in a state of being separated into single cells from easily dying. The initial stage time for adding the ROCK inhibitor is not particularly limited, but may be, for example, 6 to 48 hours, preferably 12 to 24 hours.

(brain-derived neurotrophic factor)
In the step (3) of inducing mature nerve cells, the cells may be cultured in the presence of, but not limited to, brain-derived neurotrophic factor (hereinafter sometimes referred to as BDNF). By adding BDNF or the like, mature neurons can be induced more efficiently.
The concentration of BDNF is not particularly limited as long as mature neurons are induced, but is preferably 1-80 ng/mL.

The culture plate used for culture is not particularly limited as long as the effects of the present invention can be obtained, and the culture plate described in the section "Neuroepithelial cell induction step (1)" can be used, It is preferred to use laminin-coated culture plates.
Culture conditions (temperature, CO ₂ concentration, medium, etc.) are not particularly limited as long as mature neurons are induced, and the conditions described in the section "Neuroepithelial cell induction step (1)". can be used.
The culture period is not particularly limited as long as the effects of the present invention can be obtained, but is, for example, 5 to 40 days, more preferably 10 to 30 days, and still more preferably 12 to 20 days. .

The mature neurons obtained in step (3) preferably have markers such as TUJ1 and MAP2.

When mature neurons are induced from iPS cells of healthy subjects and iPS cells derived from Alzheimer's disease patients by the method for producing Alzheimer's disease model neurons of the present invention, the iPS cells of healthy subjects have the characteristics of the hippocampus of healthy subjects. Nerve cells are induced, and nerve cells having the characteristics of the hippocampus of Alzheimer's disease patients are induced from iPS cells derived from Alzheimer's disease patients. Specifically, in cells derived from iPS cells of Alzheimer's disease patients, the number of neural stem cells (PAX6-positive cells) does not decrease, but immature neurons (TUJ1-positive cells) and mature neurons (MAP2-positive cells) cells) were suppressed. This feature is consistent with that of the hippocampus of Alzheimer's disease patients.

[2] Alzheimer's disease model nerve cell The Alzheimer's disease model nerve cell of the present invention can be obtained by the method for producing the Alzheimer's disease model nerve cell. In the Alzheimer's disease model neurons, the numbers of immature neurons (TUJ1-positive cells) and mature neurons (MAP2-positive cells) are reduced.
By using the Alzheimer's disease model neurons of the present invention, drugs that affect the pathology of Alzheimer's disease can be screened.

[3] Screening method for drugs acting on Alzheimer's disease The screening method for drugs acting on Alzheimer's disease of the present invention comprises (A) steps (1), (2), and (3) in the method for producing Alzheimer's disease model nerve cells. ) in one or more steps of adding a drug candidate substance acting on Alzheimer's disease and culturing the cells, and (B) analyzing cells to which the candidate substance has been added and cells to which the candidate substance has not been added and selecting a candidate substance that acts on the cell.

<<Step (A)>>
In step (A), in one or more of steps (1), (2), and (3) in the method for producing Alzheimer's disease model nerve cells, a drug candidate substance that acts on Alzheimer's disease to culture the cells. That is, in any one or more of the steps of inducing neuroepithelial cells (1), forming neural rosettes (2), and inducing mature neurons (3), a candidate substance is brought into contact with a cell, and the candidate substance is By comparing with uncontacted cells, the effect of candidate substances on Alzheimer's disease model neurons can be analyzed.
The step of adding the candidate substance is not particularly limited. For example, in order to screen for a drug that has a direct effect on Alzheimer's disease in vivo, it is considered preferable to add a candidate substance in step (2) or step (3). In addition, when iPS cells are used for the treatment of Alzheimer's disease, it is considered preferable to add a candidate substance in step (1) in order to screen for drugs that assist the induction of iPS cells into nerve cells in vivo. . However, these explanations do not limit the screening method of the present invention.

Steps (1), (2), and (3) are performed as described in the section "[1] Alzheimer's disease model nerve cell production method", except that the candidate substance is added. can be implemented.

(candidate substance)
Candidate substances that can be subjected to the screening method of the present invention are not particularly limited. NK et al., Tetrahedron, 51, 8135-8137, 1995) or the phage display method (Felici, F. et al., J. Mol. Biol., 222, 301-310, 1991). ) or the like can be used. Culture supernatants of microorganisms, natural components derived from plants or marine organisms, animal tissue extracts, and the like can also be used as candidate substances for screening. Furthermore, compounds (including peptides) chemically or biologically modified from compounds (including peptides) selected by the screening method of the present invention can be used.
The concentration of the candidate substance to be added is not particularly limited, but it is highly likely that the concentration at which it acts varies depending on the compound, so it is preferable to add the candidate substance at several concentrations.

<<Step (B)>>
In step (B), cells to which the candidate substance has been added and cells to which the candidate substance has not been added are analyzed to select candidate substances that act on the cells.
The cell analysis method is not particularly limited as long as it is a method capable of recognizing the difference between cells to which the candidate substance has been added and cells to which the candidate substance has not been added. For example, if a candidate substance affects neuronal cell number, the effect of the candidate substance can be analyzed by measuring cell number. When the number of cells to which the candidate substance is added increases compared to the cells to which the candidate substance is not added, it can be determined that there is a promoting effect on cell neogenesis. Conversely, when the number of cells decreases, it can be determined that there is an inhibitory effect on cell neogenesis. In addition, the effect on cells can be determined not only by the number of cells but also by visually observing the appearance of the cells.
Furthermore, the action of the candidate substance can be analyzed by measuring the expression level of TUJ1, which is a marker for immature neurons, or MAP2, which is a marker for mature neurons, by PCR or the like. For example, when TUJ1 or MAP2 is increased in cells to which the candidate substance has been added as compared to cells to which the candidate substance has not been added, it can be determined that Alzheimer's disease improvement is promoted. Conversely, when TUJ1 or MAP2 decreases, it can be determined that improvement in Alzheimer's disease has a suppressive effect.

《Action》
In the method for producing Alzheimer's disease model neurons of the present invention, the reason why neurons produced from iPS cells derived from Alzheimer's disease patients could be induced into cells having characteristics of hippocampal neurons of Alzheimer's disease patients was analyzed in detail. However, it can be estimated as follows.
It is considered that there are essential differences between iPS cells derived from Alzheimer's disease patients and iPS cells derived from healthy subjects. Here, when inducing mature neurons from iPS cells, it is presumed that contact between iPS cells is effective in inducing neurons. In the methods of inducing mature neurons in Non-Patent Documents 2 and 3, induction of iPS cells in a high-density state into mature neurons is initiated. When these methods of inducing mature neurons in Non-Patent Documents 2 and 3 are used, even iPS cells derived from patients with Alzheimer's disease exhibit the same level of ability to generate mature neurons as healthy subjects due to excessive cell contact. It is thought that the neural stem cells with
That is, when the induction of mature nerves is started for high-density iPS cells (Comparative Examples 1 and 4), neural stem cells having the ability to generate mature nerve cells comparable to those of healthy subjects are induced. In addition, when neural stem cells were seeded in a cell mass (Comparative Example 3), mature neurons of the same level as those of healthy subjects were generated. This suggests that neural stem cell contact does not occur in the hippocampus of actual Alzheimer's disease patients. In the method for producing Alzheimer's disease model nerve cells of the present invention, iPS cells are isolated, seeded and cultured at a low density to generate neural stem cells with low ability to generate mature nerve cells, which are thought to exist in the Alzheimer's disease hippocampus. generated. In addition, by isolating, seeding and culturing the above stem cells, mature neurons having the characteristics of the hippocampus of Alzheimer's disease patients could be produced.
It should be noted that mature neurons having the characteristics of the hippocampus of healthy individuals are induced from iPS cells derived from healthy individuals. It is considered that a state close to contact between cells can be reproduced.

EXAMPLES The present invention will be specifically described below with reference to Examples, but these are not intended to limit the scope of the present invention.

<<Comparative example 1>>
In this comparative example, iPS cells were seeded at high density in step (1). In step (2), cells were seeded as cell clumps, and in step (3), cells were seeded as single cells. Mature neurons were prepared from iPS cells from 3 healthy subjects (HPS0076, HPS0360, P11025) and iPS cells from 3 Alzheimer's disease patients (HPS0254, HPS0255, HPS0256).

Preculture of iPS cells was performed as follows.
Two healthy subject-derived iPS cell lines (HPS0076, HPS0360) and three Alzheimer's patient-derived iPS cell lines (HPS0254, HPS0255, HPS0256) transferred from RIKEN were used. In addition, one iPS cell line (P11025) derived from a healthy subject purchased from Takara Bio was also used. The 6 iPS cell lines were stored in vials with a freezing solution until use. Preservation was carried out by immersing the vial in liquid nitrogen.
The iPS cells were thawed from the frozen state and used in the following flow. The vial storing the cells was removed from the liquid nitrogen and lysed by immersion in a constant temperature bath filled with warm water at 37°C. ^A solution (Y27632 concentration was 10 μM; hereinafter, mTeSR1-Y) was prepared, and cells (1 mL) and mTeSR1-Y (6-8 mL) were mixed in a 15 mL tube. After centrifugation (290 G, 25° C., 5 minutes), the supernatant was removed, mixed with mTeSR ^™ 1-Y (2 mL/well), and applied to a 6-well plate (Nunc ^™ Cell-Culture Treated Multidishes) coated with Matrigel solution. sown. Matrigel solutions and Matrigel solution coats were prepared as follows.
Matrigel solution: DMEM/F-12 (Thermo Fisher Scientific) and Corning® Matrigel basement membrane matrix (Corning) were mixed at 61:1.
Matrigel solution coating: 1 mL/well of Matrigel solution was added to a 6-well plate, allowed to stand at 4° C. for 12 hours or longer, and used after removing the Matrigel solution.
Thereafter, all cells were cultured in a 37° C. CO ₂ incubator unless otherwise specified.

iPS cells were pre-cultured in the following flow. The iPS cells were cultured to about 60-90% confluence. In the culture, the medium was changed every day from the day after the cells were seeded on the 6-well plate or the day after that. The medium was replaced with new mTeSR ^™ 1 (2 mL/well). The iPS cells were subcultured when they reached 60-90% confluence. In passage, first, after washing once with DPBS (Thermo Fisher Scientific), EDTA in DPBS (UltraPure ^™ 0.5M EDTA, pH 8.0, Invitrogen ^™ and DPBS were mixed at 1:1000. Thereafter, EDTA in DPBS ) for 5-15 minutes. After completion of the treatment, the EDTA in DPBS was removed and mTeSR ^™ 1 was sprayed to detach the iPS cells from the 6-well plate in the form of cell clusters. Subsequently, the mixture of iPS cell clusters and mTeSR ^TM 1 was seeded onto a 6-well plate coated with a new Matrigel solution (the amount of cells to be seeded was 1/2 to 1/6 of 1 well). The solution volume is 2-3 mL/well). After seeding, the cells were cultured again until they reached 60-90% confluence.

Step (1) was performed as follows.
The iPS cells that had reached about 60-90% confluence in the preculture were washed once with PBS (-), and then added with Trp-Y (TrypLE ^™ Select (1X), no Phenol Red, Gibco containing 10 μM Y27632; The cells were treated with Trp-Y for 5 to 15 minutes. After completion of the treatment, the iPS cells were detached from the 6-well plate in the form of single cells by spraying Trp-Y. After detachment, the iPS cells and mTeSR1-Y made into single cells were mixed and centrifuged (290 G, room temperature, 5 min), and the supernatant was removed. Then, it was mixed with fresh mTeSR1-Y and plated on a low adsorption 96-well plate (SC U-bottom plate, Greiner) coated with a Lipidure solution. (1.8×10 ⁴ cells/200 μL/well). Finally, the seeded low-adsorption 96-well plate was centrifuged (200 G, normal temperature, 3 min). By centrifuging to collect the cells at the bottom of a U-bottom plate, the iPS cells were formed into high-density cell clusters and cultured in suspension. Lipidure solutions and Lipidure solution coats were prepared as follows.
Lipidure solution: Ethanol (Fuji Film Wako Pure Chemical Industries, Ltd.) and Lipidure (NOF Corporation) were mixed so that the Lipidure content was 0.5 wt %.
Lipidure solution coating: 100 μL/well of Lipidure solution was added to a low-adsorption 96-well plate and allowed to stand at room temperature for 12 hours or more to evaporate ethanol from the Lipidure solution.

After 48 hours, the medium of the cells was changed.
All the medium was removed from the low-adsorption 96-well plate. The culture medium was removed using a 1000 μL tip from which 3 mm of the tip was cut so as not to break the cell mass (Embryoid body; hereinafter referred to as EB). A DFK 5% DS solution was added to the wells of a low-adsorption 96-well plate (200 μL/well).

Step (2) was performed as follows.
Ten days after the nerve induction in step (1) (Day 10), 48 EBs together with the medium were transferred to a 15 mL tube, allowed to stand at room temperature for 5 to 7 minutes, and then the supernatant was removed. After removing the supernatant, 4 mL of DFN2B_5% KSR solution was added and plated on the DFN2B plate. 48 EBs and 4 mL of DFK 5% DS solution were used as a guideline per well.
A DFN2B_5% KSR solution was prepared by mixing the solutions in the table below.

A DFN2B solution was prepared by mixing the solutions in the table below.

DFN2B plates were made as follows.
A 1 mL/well mixed solution (DFN2B solution and Corning (registered trademark) Matrigel basement membrane matrix mixed at 19:1) was added to a 6-well plate and allowed to stand at 4° C. for 12 hours or longer. The admixture was removed and used as DFN2B plates.
The medium was replaced 4 days (Day 14), 8 days (Day 18), and 12 days (Day 22) after step (2). The medium was removed from the wells of the DFN2B plate (2 mL/well). The DFN2B solution was added to the wells of the DFN2B plate (2 mL/well).

Step (3) was performed as follows.
Sixteen days after step (2) (Day 26), the iPS cells undergoing neural induction were washed once with PBS(-) and then treated with Trp-Y for 5 to 15 minutes. After completion of the treatment, the iPS cells were detached from the 6-well plate in the form of single cells by spraying Trp-Y. Subsequently, the iPS cells made into single cells and NDBM+BD+Y were mixed, centrifuged (290 G. normal temperature, 5 min), and the supernatant was removed. Then, it was mixed with fresh NDBM+BD+Y and seeded on a 96-well plate coated with poly-L-ornithine/laminin solution (1×10 ⁵ cells/200 μL/well).
The NDBM+BD+Y was a mixture of Neural differential basal medium, brain-derived neurotrophic factor (BDNF, 100 μg/mL; Fujifilm Wako Pure Chemical Industries, Ltd.), and Y27632 (10 mM) at a ratio of 5000:1:5.

Medium exchange was performed on the second day (Day 27) of step (3).
Neural differential basal medium (normal temperature) and BDNF were mixed at a ratio of 5000:1 (hereinafter referred to as NDBM+BD). After removing 50 μL/well of the medium from the 96-well palte, NDBM+BD was added to the wells of the 96-well palte (100 μL/well).
Medium exchange was performed on the 4th day and the 7th day (Day29 and Day32) of step (3).
After removing 100 μL/well of the medium from the 96-well palte, NDBM+BD was added to the wells of the 96-well palte (100 μL/well).
Medium exchange was performed on the 10th day, the 13th day, and the 16th day (Day 35, Day 38, and Day 41) of step (3).
After removing the entire amount of medium from the 96-well palte, NDBM+BD was added to the wells of the 96-well palte (200 μL/well).

Expression of MAP2, TUJ1, and PAX6 in the obtained neurons was confirmed by fluorescent antibody staining. 250 μL/well of 4% PFA in PBS (PBS containing 4% paraformaldehyde) was added to the cells in the 96-well plate with 100 μL/well of the medium remaining, and the cells were treated at room temperature for 10 minutes. After discarding the entire amount of the treatment solution, the cells were treated with 350 μL/well of 4% PFA in PBS for 15 minutes. After the treatment was completed, all the treatment solution was discarded, and the plate was washed with PBS three times. Next, 100 μL/well of TX in PBS (PBS containing 0.2% Triton-X) was added, treated for 15 minutes, and then washed four times with PBS. 100 μL of 3% BSA in PBS (PBS containing 3% BSA) was added and blocked for 30 minutes. After blocking, discard all the blocking solution, anti-chick MAP2 antibody solution (Abcam, 5000 times), anti-mouse TUJ1 antibody solution (Abcam, 1000 times), and anti-rabbit PAX6 antibody (sigma, 100 times) solution. 50 μL of 3% BSA in PBS was added, and left at 4° C. for 12 to 24 hours. Washed 4 times with PBS, anti-chick Alexa488 antibody solution (Jackson ImmunoResearch, 500 times), anti-mouse Alexa546 antibody solution (ThermoFisher, 500 times), and anti-rabbit Alexa647 antibody solution (ThermoFisher, 500 times). including 3 50 μL of %BSA in PBS was added, and the mixture was allowed to stand at room temperature for 1 hour. After washing with PBS four times, fluorescence-stained images of MAP2, TUJ1 and PAX6 were taken under a microscope (A1 system, Nikon). FIG. 1 shows a fluorescence microscope image.
In addition, DAPI was added for probing the cells when the secondary antibody was added.

As shown in FIG. 1, healthy subject iPS cells (HPS0076, HPS0360, P11025) and Alzheimer's iPS cells (HPS0254, HPS0255, HPS0256), nerve cells (MAP2 positive cells or TUJ1 positive cells) and neural stem cells (PAX6 positive cells) No difference was found in the number of Differences between individual cell lines were observed, but no difference was observed between the healthy iPS cell group and the Alzheimer's iPS cell group.

<<Example 1>>
In this example, in steps (1), (2), and (3), iPS cells were isolated and seeded into single cells, iPS cells from 3 healthy individuals (HPS0076, HPS0360, P11025) and 3 Mature neurons were produced from iPS cells (HPS0254, HPS0255, HPS0256) derived from human Alzheimer's disease patients.

The operation of Comparative Example 1 was repeated for preculture of iPS cells.
Step (1) was performed as follows.
The iPS cells that reached about 60-90% confluence were washed once with DPBS and then treated with Trp-Y for 5-15 minutes. After completion of the treatment, the iPS cells were detached from the 6-well plate in the form of single cells by spraying Trp-Y. After detachment, the iPS cells and mTeSR1-Y made into single cells were mixed and centrifuged (290 G, room temperature, 5 min), and the supernatant was removed. Then, it was mixed with fresh mTeSR1-Y and seeded onto a 6-well plate coated with fresh Matrigel solution (4.8×10 ⁵ cells/2 mL/well).

From the 2nd day to the 6th day, the following operations were performed every day.
Neural differential basal medium (room temperature), Noggin (Fuji Film Wako Pure Chemicals, 20 μg/mL) and SB431542 (Fuji Film Wako Pure Chemicals, 10 mM) were mixed at a ratio of 1000:10:1 (hereinafter referred to as NDBM+SN). After removing the entire amount of medium from the 6-well palte, NDBM+SN was added to the wells of the 6-well palte (2 mL/well). iPS cells reached 100% confluence on Days 4-7.

Step (2) was performed as follows: On day 7 of step (1), the iPS cells undergoing neural induction were washed once with DPBS, and then treated with Trp-Y for 5 to 15 minutes. After completion of the treatment, the cells were detached from the 6-well plate in the form of single cells by spraying Trp-Y. After detachment, the single-celled cells and NDBM+F+Y were mixed and centrifuged (290 G, room temperature, 5 min), and the supernatant was removed. Then, it was mixed with fresh NDBM + F + Y and seeded on a 24-well plate (Thermo, hereinafter unless otherwise specified) coated with poly-L-ornithine/laminin solution (2 × 10 ⁵ cells/1 mL/well ).
NDBM+F+Y was made as follows. Neural differential basal medium, fibroblast growth factor (basic) (Fuji Film Wako Pure Chemical Industries, Ltd., 100 μg/mL), and Y27632 (10 mM) were mixed at 5000:1:5 (hereinafter, NDBM+F+Y).
Poly-L-ornithine/laminin solution coating was performed as follows.
A poly-L-ornithine solution (poly-L-ornithine (sigma, P3655-10MG) dissolved in 100 mL of sterilized water) was added to a 24-well plate at 300 μL/well and allowed to stand at 4° C. for 12 hours or longer. Washed three times with sterilized water (1 mL/well). A laminin solution (iMatrix-511 solution (Nippi, 892-012) and sterilized water mixed at 1:133) was added to a 24-well plate at 300 μL/well and allowed to stand at 4° C. for 12 hours or more. After standing, the laminin solution was removed and used.
From the next day (Day 7-11) onwards, the cell culture medium was changed. A Neural differential basal medium (room temperature) and FGF were mixed at a ratio of 5000:1 (hereinafter referred to as NDBM+F). After removing the entire amount of medium from the 24-well palte, NDBM+F was added to the wells of the 24-well palte (1 mL/well).

Step (3) was performed as follows.
On day 6 (Day 12) of step (2), the iPS cells undergoing neural induction were washed once with DPBS and then treated with Trp-Y for 5-15 min. After completion of the treatment, the cells were detached from the 24-well plate in the form of single cells by spraying Trp-Y. Subsequently, the single-celled cells and NDBM+BD+Y were mixed and centrifuged (290 G, normal temperature, 5 min), and the supernatant was removed. Then, it was mixed with fresh NDBM+BD+Y and seeded on a 24-well plate coated with poly-L-ornithine/laminin solution (4×10 ⁵ cells/1 mL/well). Similarly, a 96-well plate (Thermo, 164588, hereinafter the plate will be used unless otherwise indicated) coated with a poly-L-ornithine/laminin solution (the coating method is described below) was seeded (the amount of cells to be seeded was 1×10 ⁵ cells/well, the amount of solution to be seeded is 200 μL/well).
A 96-well plate was coated with a poly-L-ornithine/laminin solution in the same manner as in step (2) except that the 96-well plate was used.

Medium exchange was performed on the second day (Day 13) of step (3).
After removing 500 μL/well of the medium from the 24-well palte, NDBM+BD was added to the wells of the 24-well palte (1 mL/well). After removing 50 μL/well of the medium from the 96-well palte, NDBM+BD was added to the wells of the 96-well palte (100 μL/well).
Medium exchange was performed on the 4th day and the 7th day (Day 15 and Day 18) of step (3).
After removing 1 mL/well of the medium from the 24-well palte, NDBM+BD was added to the wells of the 24-well palte (1 mL/well). After removing 100 μL/well of the medium from the 96-well palte, NDBM+BD was added to the wells of the 96-well palte (100 μL/well).
Medium exchange was performed on the 10th day, the 13th day, and the 16th day (Day21, Day24, and Day27) of step (3).
After removing the entire amount of medium from the 24-well palte, NDBM+BD was added to the wells of the 24-well palte (1 mL/well). After removing the entire amount of medium from the 96-well palte, NDBM+BD was added to the wells of the 96-well palte (200 μL/well).

The expression of MAP2, TUJ1, and PAX6 was confirmed by the same fluorescent antibody staining as in Comparative Example 1.
As shown in FIG. 2, there was no significant change in neogenesis of neural stem cells (PAX6-positive cells) between iPS cells from healthy subjects (HPS0076, HPS0360, P11025) and Alzheimer's iPS cells (HPS0254, HPS0255, HPS0256). The numbers of neurons (TUJ1-positive cells) and mature neurons (MAP2-positive cells) were suppressed in Alzheimer's iPS cells. That is, in the production method of the present invention, the induction of mature neurons from Alzheimer's iPS cells reflected the characteristics of the hippocampus of Alzheimer's patients.

<<Analysis example>>
In Example 1, expression of MAP2, TUJ1, and PAX6 genes in mature neurons obtained from iPS cells (HPS0076, HPS0360, P11025) and Alzheimer's iPS cells (HPS0254, HPS0255, HPS0256) from normal subjects was examined as follows. analyzed to
After washing the cells on the 28th day after seeding in step (1) once with DPBS, 2-mercaptoethanol (99%; Fujifilm Wako Pure drug) was mixed at a ratio of 100:1) was gently added at 350 μL/well. RNA was extracted according to the RNeasy Mini Kit protocol. Using the extracted RNA, cDNA was synthesized based on the ReverTra Ace (registered trademark) qPCR RT Master Mix (TOYOBO) protocol. cDNA was measured by RT-PCR method using Fast SYBR ^™ Green Master Mix (Thermo Fisher Scientific). RT-PCR reactions were performed using the StepOnePlus Real-Time PCR System (Applied Biosystems) according to the protocol. The primers for MAP2, TUJ1 and PAX6 are as follows.
MAP2 forward primer: CCGTGTGGACCATGGGGCTG
MAP2 Reverse primer: GTCGTCGGGGTGATGCCACG
TUJ1 forward primer: CCTGGAACCCGGAACCAT
TUJ1 Reverse primer: AGGCCTGAAGAGATGTCCAAAG
PAX6 forward primer: TTACGAGACTGGCTCCATCA
PAX6 Reverse primer: CCGCTTATACTGGGCTATTT
GAPDH forward primer: GTCAACGGATTTGGTCGTATTG
GAPDH Reverse primer: CATGGGTGGAATCATATTGGAA
The amount of mRNA of MAP2, TUJ1, and PAX6 was calculated assuming that the amount of cDNA measured corresponded to the amount of mRNA. The mRNA levels of MAP2, TUJ1 and PAX6 in HPS0076, HPS0360, P11025, HPS0254, HPS0255 and HPS0256 were corrected with the mRNA levels of GAPDH. The mRNA amounts of HPS0076, HPS0360, P11025, HPS0254, HPS0255, and HPS0256 are shown as the average value and standard error of 4 samples. A significant difference test for HPS0076, HPS0360, P11025, HPS0254, HPS0255, and HPS0256 was performed based on the values of 4 samples. Welch's T-test was used for the significance test.

As shown in the first diagram from the top of FIG. A cell group that was neurally induced until Day 28 by the method) and a diseased cell group (iPS cells derived from Alzheimer's patients (HPS0254 (254 in the figure), HPS0255 (255 in the figure), HPS0256 (256 in the figure) , MAP2, TUJ1 and PAX6 mRNA levels (gene expression levels) were compared in the cell group nerve-induced until Day 28 by the method of the example.The mRNA levels of MAP2, TUJ1 and PAX6 were measured and normalized by the method of the example. (corrected by the amount of GAPDH mRNA) [1] Level 5 of significant difference in the amount of MAP2, TUJ1, or PAX6 mRNA of HPS0254, HPS0255, or HPS0256 relative to all of the corresponding mRNAs of HPS0076, HPS0360, and P11025 and [2] the amount of MAP2, TUJ1 or PAX6 mRNA of HPS0254, HPS0255 or HPS0256 is commonly increased or decreased relative to all of the corresponding mRNAs of HPS0076, HPS0360 and P11025 When satisfying the two points, * was described above the bar graphs of HPS0254, HPS0255, and HPS0256.In summary, when there is a significant increase or decrease for all measured values of HPS0076, HPS0360, and P11025, *.The data are expressed as mean ± standard error with the mean value of HPS0076 as 1. Welch's T-test was used to test significant differences.Regardless of the presence or absence of normality and equal variance of data, high The reason for adoption was that it was possible to detect a significant difference in accuracy and reliability.Each sample was 4. As shown in the second row from the top of Fig. 3, the hippocampus of a healthy subject and that of an Alzheimer's patient Hippocampal MAP2, TUJ1 and PAX6 mRNA levels were compared.Data for MAP2, TUJ1 and PAX6 mRNA levels in the hippocampus of healthy subjects and that of Alzheimer's patients were obtained from the public database Gene Expression Omnibus (https: //www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE36980) Data of 10 hippocampal samples from healthy subjects and 7 samples from Alzheimer's patient hippocampi were compared. The applicants did not measure and normalize the data (correction of mRNA levels between samples) because they had been performed at the time of database registration. When the amount of MAP2, TUJ1 or PAX6 mRNA in the hippocampus of Alzheimer's patients was significantly increased or decreased relative to the corresponding mRNA in the hippocampus of healthy subjects, * was written above the graph. The data were expressed as mean±standard error, with the mean value of the hippocampus of healthy subjects being set to 1. For the test of significance, Welch's T-test was used for the same reason as described above. As shown in the third row from the top of FIG. 3, the mRNA levels of MAP2, TUJ1 and PAX6 in the frontal cortex of healthy subjects and those of Alzheimer's patients were compared. Data on the amount of MAP2, TUJ1 and PAX6 mRNA in the frontal cortex of healthy subjects and the frontal cortex of Alzheimer's patients were obtained from the public database Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/ geo/query/acc.cgi?acc=GSE36980). Data from 18 samples of the frontal cortex of healthy subjects and 15 samples of the frontal cortex of Alzheimer's patients were compared. The applicants did not measure and normalize the data (correction of mRNA levels between samples) because they had been performed at the time of database registration. When the amount of MAP2, TUJ1 or PAX6 mRNA in the frontal cortex of Alzheimer's patients was significantly increased or decreased relative to the corresponding mRNA in the frontal cortex of healthy subjects, * was written above the graph. The data were expressed as mean±standard error, with the mean value of the frontal cortex of healthy subjects being set to 1. For the test of significance, Welch's T-test was used for the same reason as described above. As shown in the fourth row from the top of FIG. 3, the mRNA levels of MAP2, TUJ1 and PAX6 in the temporal cortex of healthy subjects and those of Alzheimer's patients were compared. Data on the amount of MAP2, TUJ1 and PAX6 mRNA in the temporal cortex of healthy subjects and the temporal cortex of Alzheimer's patients were obtained from the public database Gene Expression Omnibus (https://www.ncbi.nlm.nih. gov/geo/query/acc.cgi?acc=GSE36980). Data from 19 samples of the temporal cortex of healthy subjects and 10 samples of the temporal cortex of Alzheimer's patients were compared. The applicants did not measure and normalize the data (correction of mRNA levels between samples) because they had been performed at the time of database registration. When the amount of MAP2, TUJ1 or PAX6 mRNA in the temporal cortex of Alzheimer's patients was significantly increased or decreased relative to the corresponding mRNA in the temporal cortex of healthy subjects, * was written above the graph. The data were expressed as mean±standard error, with the mean value of the temporal cortex of healthy subjects being set to 1. For the test of significance, Welch's T-test was used for the same reason as described above.

Hippocampal data of healthy subjects were obtained from the following.
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907861
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907862
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907863
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907864
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907865
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907866
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907867
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907868
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907869
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907870
Hippocampal data from Alzheimer's patients were obtained from:
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907854
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907855
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907856
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907857
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907858
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907859
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907860
Frontal cortex data of healthy subjects were obtained from:
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907807
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907808
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907809
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907810
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907811
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907812
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907813
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907814
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907815
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907816
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907817
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907818
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907819
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907820
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907821
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907822
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907823
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907824
Frontal cortex data for Alzheimer's patients were obtained from:
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907792
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907793
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907794
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907795
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907796
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907797
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907798
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907799
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907800
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907801
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907802
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907803
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907804
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907805
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907806
Temporal cortex data of healthy subjects were obtained from:
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907825
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907826
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907827
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907828
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907829
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907830
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907831
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907832
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907833
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907834
Alzheimer's patient temporal cortex data were obtained from:
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907835
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907836
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907837
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907838
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907839
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907840
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907841
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907842
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907843
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907844
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907845
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907846
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907847
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907848
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907849
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907850
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907851
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907852
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907853

The URL of the paper on which the data is based is shown below.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4128707/
The results in FIG. 3 showed that in the Alzheimer's patient cell group, compared to the healthy subject cell group, the mRNA levels of MAP2 and TUJ1 were significantly reduced, and the PAX6 mRNA level was not significantly different (Fig. 3A). This feature was also confirmed when comparing the amounts of hippocampal mRNA in Alzheimer's disease and healthy subjects (Fig. 3B). On the other hand, this characteristic was not confirmed even when mRNA levels in the frontal cortex and temporal cortex of Alzheimer's disease and healthy subjects were compared (FIGS. 3C and 3D). These results suggested that cell populations derived from Alzheimer's patient-derived iPS cells mimic the characteristics of decreased neuronal cell numbers found in the hippocampus of Alzheimer's patients (Padurariu et al, 2012).

<<Comparative Example 2>>
In this comparative example, iPS cells were seeded as cell clusters in step (1), and iPS cells were isolated and seeded into single cells in steps (2) and (3). As iPS cells, iPS cells from a healthy subject (HPS0076) and iPS cells derived from an Alzheimer's disease patient (HPS0256) were used.

The procedure of Example 1 was repeated except that iPS cells were seeded as cell clusters in step (1). Step (1) was performed as follows.
The iPS cells that reached about 60-90% confluence were washed once with DPBS and then treated with EDTA in DPBS for 5-15 minutes. After the treatment, the EDTA in DPBS was removed and mTeSR1-Y was sprayed to detach the iPS cells from the 6-well plate in the form of cell clusters. After detachment, the mixture of iPS cells and mTeSR1-Y formed into cell aggregates was centrifuged (290 G, room temperature, 5 min), and the supernatant was removed. Thereafter, the cells were mixed with fresh mTeSR1-Y and seeded onto a 6-well plate coated with fresh Matrigel solution while maintaining the cell mass (4.8×10 ⁵ cells/2 mL/well).
As shown in FIG. 4, there was no difference in the number of MAP2-positive cells, TUJ1-positive cells, and PAX6-positive cells between the Alzheimer's disease patient-derived iPS cells (HPS0256) and the iPS cells of a healthy subject (HPS0076). Ta.
Therefore, it was considered that the characteristics of the hippocampus of Alzheimer's patients cannot be reflected when iPS cells are seeded as cell clusters in step (1).

<<Example 2>>
In this example, iPS cells were isolated into single cells and seeded in step (1), iPS cells were seeded as cell clusters in step (2), and iPS cells were isolated into single cells and seeded in step (3). . As iPS cells, iPS cells from a healthy subject (HPS0076) and iPS cells derived from an Alzheimer's disease patient (HPS0256) were used.

The procedure of Example 1 was repeated except that the iPS cells were seeded as cell clusters in step (2). Step (2) was performed as follows.
On day 7 of step (1), the iPS cells undergoing neural induction were washed once with DPBS and then treated with EDTA in DPBS for 5-25 min. After the treatment was completed, the EDTA in DPBS was removed, and the cells were detached from the 6-well plate in the form of cell clusters by spraying NDBM+F+Y. After detachment, the cells formed into cell aggregates and NDBM+F+Y were mixed and centrifuged (290 G. normal temperature, 5 min), and the supernatant was removed. Then, it was mixed with fresh NDBM+F+Y and seeded onto a poly-L-ornithine/laminin solution-coated 24-well plate while maintaining the cell mass (2×10 ⁵ cells/1 mL/well).
As shown in FIG. 5, in Alzheimer's disease patient-derived iPS cells (HPS0256), neural stem cell (PAX6-positive cells) generation did not change significantly, but immature neurons (TUJ1-positive cells) and mature neurons (MAP2) positive cells) were suppressed. Therefore, even when iPS cells were seeded as cell clusters in step (2), it was thought that the characteristics of the hippocampus of Alzheimer's patients could be reflected.

<<Comparative Example 3>>
In this comparative example, iPS cells were seeded as cell clusters in step (3), and iPS cells were isolated and seeded into single cells in steps (1) and (2). As iPS cells, iPS cells from a healthy subject (HPS0076) and iPS cells derived from an Alzheimer's disease patient (HPS0256) were used.

The procedure of Example 1 was repeated except that the iPS cells were seeded as cell clusters in step (3). Step (3) was performed as follows.
On day 6 (Day 12) of step (2), the iPS cells undergoing neural induction were washed once with DPBS and then treated with EDTA in DPBS for 5-25 minutes. After the treatment was completed, the EDTA in DPBS was removed, and the cells were detached from the 24-well plate in the form of cell clusters by spraying NDBM+BD+Y. After detachment, the cells made into cell aggregates and NDBM+BD+Y were mixed and centrifuged (290 G. normal temperature, 5 min), and the supernatant was removed. Then, it was mixed with fresh NDBM + BD + Y and seeded onto a 96-well plate coated with a poly-L-ornithine/laminin solution (the coating method is described below) while maintaining the cell mass (the amount of cells to be seeded was 1 × 10 ⁵ Cells/well, the amount of solution to be seeded is 200 μL/well).
As shown in FIG. 6, there was no difference in the number of MAP2-positive cells, TUJ1-positive cells, and PAX6-positive cells between the Alzheimer's disease patient-derived iPS cells (HPS0256) and the iPS cells of a healthy subject (HPS0076). Ta.
Therefore, it was considered that the characteristics of the hippocampus of Alzheimer's patients cannot be reflected when iPS cells are seeded as cell clusters in step (3).

<<Comparative Example 4>>
In this comparative example, iPS cells are isolated into single cells in step (1), seeded at a concentration of 4.0 × 10 ⁵ cells/cm ² (8 times the number of cells in Example 1), and step (2) and iPS cells were isolated and seeded into single cells in step (3). As iPS cells, iPS cells from 3 healthy subjects (HPS0076, HPS0360, P11025) and iPS cells derived from 3 Alzheimer's disease patients (PS0254, HPS0255, HPS0256) were used.
The procedure of Example 1 was repeated except that in step (1), the seeding cell concentration was changed from 5.0×10 ⁴ cells/cm ² to 4.0×10 ⁵ cells/cm ² . The iPS cells reached 100% confluence on Day1. In addition, gene expression of MAP2, TUJ1, and PAX6 was analyzed by PCR.
As shown in the first row from the top of FIG. No difference in the number of stem cells (PAX6 positive cells) was observed. In addition, as shown in the second row from the top of FIG. 7, no significant difference was observed in the expression of the MAP2, TUJ1, and PAX6 genes, common to the healthy subject iPS cell and Alzheimer's iPS cell groups. The data were expressed as mean±standard error, with the mean value of HPS0076 being 1. For the test of significance, Welch's T-test was used for the same reason as described above.

<<Example 3>>
In this comparative example, iPS cells are isolated into single cells in step (1), seeded at a concentration of 2.0 × 10 ⁵ cells/cm ² (4 times the number of cells in Example 1), and step (2) and iPS cells were isolated and seeded into single cells in step (3). As iPS cells, healthy human iPS cells (HPS0360) and Alzheimer's disease patient-derived iPS cells (HPS0256) were used.
The operation of Example 1 was repeated, except that in step (1), the seeding cell concentration was changed from 5.0×10 ⁴ cells/cm ² to 2.0×10 ⁵ cells/cm ² . . The iPS cells reached 100% confluence on Day3. In addition, gene expression of MAP2, TUJ1, and PAX6 was analyzed by PCR.
As shown in FIG. 8, there was no significant change in the generation of neural stem cells (PAX6-positive cells) between healthy iPS cells (HPS0360) and Alzheimer's iPS cells (HPS0256). The number of mature neurons (MAP2-positive cells) or mRNA expression was suppressed in Alzheimer's iPS cells. The mRNA expression data in the lower part of FIG. 8 are shown as mean±standard error, with the mean value of HPS0360 being 1. When the amount of MAP2, TUJ1 or PAX6 mRNA in HPS0256 was significantly increased or decreased relative to the corresponding mRNA in HPS0360, * was written above the graph. For the test of significance, Welch's T-test was used for the same reason as described above. That is, in the production method of the present invention, the induction of mature neurons from Alzheimer's iPS cells reflected the characteristics of the hippocampus of Alzheimer's patients.

<<Example 4>>
In this example, iPS cells (HPS0256) derived from Alzheimer's disease patients were used to screen drug candidate substances acting on Alzheimer's disease.
The procedure of Example 1 was repeated, and the candidate substances SAG (1 μM), Isobavachin (100 nM), and Neuropashiazol (10 μM) were added and cultured on Day 8-Day 11 and Day 13-Day 28 during nerve induction.

MAP2-positive cells and TUJ1-positive cells were stained according to the method of Comparative Example 1. To analyze cell death, cCASP3-positive cells were stained as follows.
Except for using anti-rabbit Cleaved CASP3 (cCASP3) antibody (Cell signaling, 100 times) instead of anti-rabbit PAX6 antibody (Sigma, 100 times) as the primary antibody, Comparative Example 1 " Fluorescent antibody staining" was repeated to stain cCASP3-positive cells.
As shown in FIG. 9(A), addition of SAG restored the numbers of immature neurons (TUJ1-positive cells) and mature neurons (MAP2-positive cells). In addition, cell death (cCASP3-positive cells) increased, but this is because the addition of SAG to Alzheimer's patient iPS-derived cells restores the number of immature and mature neurons, rather than suppressing cell death due to apoptosis. , implying that it is due to improvement of neurogenesis failure. In addition, as shown in FIG. 9(B), the iPS cells from healthy subjects (HPS0076, HPS0360, P11025) showed increased cell death (cCASP3-positive cells) compared to the Alzheimer's-derived iPS cells (HPS0256). These results indicate that (1) addition of SAG to Alzheimer's patient iPS-derived cells restores the number of immature and mature neurons not by suppressing neuronal death but by promoting neurogenesis, and (2) Alzheimer's disease In the derived iPS cells (HPS0256), the number of immature and mature neurons decreased due to inhibition of neurogenesis rather than increased neuronal cell death.
FIG. 9(B) shows a comparison photograph of healthy subject iPS cells (HPS0076, HPS0360, P11025) and Alzheimer-derived iPS cells (HPS0256) treated with SAG (HPS0256 was untreated, water was added, and DMSO additions are also shown).
By adding SAG, the cells of HPS0256 showed the same characteristics as the iPS cells of healthy subjects. Therefore, it is considered that SAG restores the neural network of Alzheimer's patient iPS cells (HPS0256) not through suppression of neuronal cell death but through promotion of neurogenesis.
As described above, it was demonstrated that the screening method of the present invention can be used to screen drugs that act on Alzheimer's disease.

<<Example 5>>
In this example, iPS cells (HPS0254) derived from patients with Alzheimer's disease were used to screen drug candidate substances acting on Alzheimer's disease.
The procedure of Example 4 was repeated except that HPS0254 was used instead of HPS0256 as iPS cells.

As shown in FIG. 10(A), addition of SAG restored the numbers of immature neurons (TUJ1-positive cells) and mature neurons (MAP2-positive cells). In addition, cell death (cCASP3-positive cells) increased.
FIG. 10(B) shows a comparison photograph of healthy subject iPS cells (HPS0076, HPS0360, P11025) and Alzheimer's-derived iPS cells (HPS0254) treated with SAG.
By adding SAG, HPS0254 cells exhibited characteristics similar to iPS cells from healthy subjects. Therefore, it is considered that SAG restores the neural network of Alzheimer's patient iPS cells (HPS0254) not through suppression of neuronal cell death but through promotion of neurogenesis.
As described above, it was demonstrated that the screening method of the present invention can be used to screen drugs that act on Alzheimer's disease.

<<Example 6>>
Alzheimer's patient-derived iPS cells (HPS0254 and HPS0256) were nerve-induced in the same manner as in Example 1. Cells were also prepared by adding SAG, Isobavachin, and Neuropashiazol or a drug negative control solution (DMSO or sterilized water) on Day 8-Day 11 and Day 13-Day 28 during nerve induction. The concentration of the drug at the time of addition was the final concentration of the reagent at the time of addition of the culture solution in Example 4. The amount of DMSO added was 1/150 of the culture solution. The amount was reduced to 1/200, and the mRNA levels (gene expression levels) of the mature neural marker (MAP2) and the immature neural marker (TUJ1) were measured in the same manner as in the example. Similarly, in the SAG-treated HPS0254-derived cell group (black circles in the figure) and HPS0256-derived cell group (dark gray circles in the figure) in which neurogenesis was confirmed, the following tendencies were confirmed. (1) A group of HPS0254-derived cells (light gray circles in the figure) and a group of HPS0256-derived cells (white circles in the figure) that are untreated, treated with Isobavacin, Neuropashiazol, DMSO, and sterile water with low neurogenesis ), the gene expression levels of MAP2 and TUJ1 tended to increase.These results show that SAG treatment restores neurogenesis in Alzheimer's patient-derived iPS cells (HPS0254 and HPS0256), It was also numerically confirmed that neurogenesis similar to that of iPS cells was caused, suggesting that SAG treatment induces neurogenesis in the hippocampus of the brain of Alzheimer's patients, which is the cause of Alzheimer's-induced cognitive dysfunction. The gene expression levels of MAP2 and TUJ1 were normalized with no treatment as 1. The gene expression levels were the average of 3-4 measurements for each sample. used the value

According to the method for producing Alzheimer's disease model nerve cells of the present invention, it is possible to obtain Alzheimer's disease model nerve cells that can be used to explore the mechanism of Alzheimer's disease. In addition, it is possible to search for therapeutic agents for Alzheimer's disease by the method of screening for drugs acting on Alzheimer's disease using Alzheimer's disease model nerve cells of the present invention.

Claims (4)

(1) Alzheimer's disease patient-derived induced pluripotent stem (iPS) cells were separated into single cells, seeded at a cell concentration that reached 100% confluence 48 hours after the start of culture, and in the presence of a ROCK inhibitor. Inducing neuroepithelial cells by culturing,
(2) forming neural rosettes by culturing the neuroepithelial cells; and (3) separating the cells obtained in step (2) into single cells and seeding them, inducing mature neurons by culturing in the presence of
A method for producing Alzheimer's disease model nerve cells from Alzheimer's disease patient-derived iPS cells, comprising: 2. The method for producing nerve cells according to claim 1, wherein in said step (2), said neuroepithelial cells are separated into single cells and seeded. 3. The method according to claim 1 or 2, wherein in step (2), culture is performed in the presence of basic fibroblast growth factor (bFGF) or in the presence of a factor that activates the PI3-K/AKT pathway or RAS/ERK pathway. The described method of producing nerve cells. (A) acting on Alzheimer's disease in one or more of steps (1), (2), and (3) in the method for producing nerve cells according to any one of claims 1 to 3; a step of adding a drug candidate substance and culturing cells; and (B) a step of analyzing cells to which the candidate substance has been added and cells to which the candidate substance has not been added, and selecting a candidate substance that acts on the cell. A screening method for agents acting on Alzheimer's disease, including;