JP7290859B2 - Plasmid vectors for inexpensive blue-white screening in molecular cloning - Google Patents

Description

The present invention relates to plasmid vectors. Specifically, the present invention relates to plasmid vectors and the like that enable inexpensive blue-white screening in molecular cloning.

Gene cloning is an essential technique in genetic engineering. Blue-white screening is widely used to examine the success or failure of molecular cloning (see Non-Patent Documents 1 to 3, etc.). This screening method utilizes the cleavage of the substrate X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside) by the enzyme LacZ to yield the blue colored indigo analogue. are doing. However, the substrate X-gal used in this method is expensive, which is disadvantageous in terms of cost. In addition, the host used for blue-white screening is limited, and it is necessary to use Escherichia coli that lacks lacZ and retains lacZΔM15. In addition, blue-white screening based on the enzyme LacZ can have difficulty distinguishing blue-white colonies if the insert is short.

"Etcetra related to pUC plasmid", Yoshiteru Hashimoto: Biotechnology, 89, 609 (2011). "Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.", Yanisch-Perron, C. et al.: Gene, 33, 103 (1985). "Cloning in M13 phage or how to use biology at its best.", Messing, J.: Gene, 100, 3 (1991).

There is a need to provide a system and a plasmid vector for the purpose of screening in molecular cloning, which can be performed at low cost, has a wide selection of hosts, and can be screened even when the insert is short.

The inventors of the present invention have made extensive studies and found that the above problems can be solved by using a plasmid vector into which a gene encoding indole oxidase has been inserted, and have completed the present invention.

Accordingly, the present invention provides:
(1) A plasmid vector containing a gene encoding an oxidase that introduces a hydroxyl group at the 3-position of an indole analog, which is used for screening in molecular cloning.
(2) The vector according to (1), wherein the oxidase is dibenzothiophene desulfurase BdsC.
(3) The vector according to (1) or (2), wherein the oxidase is BdsC derived from Bacillus subtilis WU-S2B.
(4) The oxidase according to (1) or (2), wherein the oxidase has an amino acid sequence in which serine at position 97 of SEQ ID NO: 1 is substituted with methionine and proline at position 99 is substituted with lysine. vector.
(5) The vector according to any one of (1) to (4), wherein the gene encoding the oxidase has multiple restriction enzyme sites.
(6) of (1) to (5), wherein the indole analog is selected from the group consisting of unsubstituted indole, 5-bromoindole, 6-bromoindole, 5-chloroindole and 6-chloroindole; Any of the described vectors.
(7) A screening method in molecular cloning, which comprises performing blue-white screening using the vector according to any one of (1) to (6).

By using the plasmid vector of the present invention, the success or failure of molecular cloning can be checked at low cost. The plasmid vector of the present invention has a wide selection of hosts and can be used even when the insert is short.

FIG. 1 shows a map of the plasmid vector pUC19-bdsC. FIG. 2 is a photograph showing color development when E. coli harboring pUC19-bds is grown on a medium containing an indole analogue as a substrate. FIG. 3 shows a map of the plasmid vector pKBlue. FIG. 4 is a photograph showing blue coloration when E. coli harboring pUC19-bdsC, pUC19-bdsC(MK) and pKBlue were grown on a medium containing 5-bromoindole. FIG. 5 is a graph showing the results of practicality evaluation of pKBlue. ○ indicates white colonies and ● indicates blue colonies. The number on the right side of ○ and ● is the number of colonies.

In one aspect, the present invention provides a plasmid vector containing a gene encoding an oxidase that introduces a hydroxyl group at the 3-position of an indole analogue, which vector is used for screening in molecular cloning.

Indole analogues include all compounds having an indole skeleton. Indole analogues preferred in the present invention are unsubstituted indole (hereinafter referred to as “indole”) and halogen, nitrile group, hydroxyl group, aldehyde group, carboxylic acid group and amino group at 4-, 5-, 6- or 7-position of indole. , a methoxy group, or an indole substituted at one or more positions with a lower alkyl having 1 to 3 carbon atoms. Examples of such preferred indole analogues include, but are not limited to, indole, 5-bromoindole, 6-bromoindole, 5-chloroindole, 6-chloroindole. Since these compounds are inexpensive compared to X-gal, the running cost of screening can be reduced.

The oxidase that introduces a hydroxyl group at the 3-position of the indole analogue (hereinafter sometimes referred to as "enzyme") is not particularly limited, and may be derived from any biological species and have any structure. It may be what you have. Preferred enzymes in the present invention include, but are not limited to, dibenzothiophene desulfurase, oxygenase, and the like. Enzymes more preferred in the present invention include, but are not limited to, dibenzothiophene desulfurase BdsC, cytochrome P450 monooxygenase, and tryptophan hydroxylase. Among BdsC, the genus Bacillus, the genus Aeribacillus, the genus Alicyclobacillus, the genus Aliterella, the genus Calothrix, the genus Chroococcidiopsis, the genus Cyanobacteria, the genus Cyanothece, the genus Domibacillus, the genus Fischerella, the genus Gordonia , genus Methylibium, genus Methyllocaldum, genus Methylococcales, genus Methylovulum, Enzymes derived from the genus Mycobacterium, Mycobacteroides, Nocardia, Nostoc, Paenibacillus, Pseudanabaena, Rhodococcus, Synechococcus, and Synechocystis are preferred, and Bd from Bacillus subtilis WU-S2B sC is particularly preferred. The amino acid sequence of BdsC (wild type) derived from Bacillus subtilis WU-S2B is shown in SEQ ID NO: 1, and the nucleotide sequence of the gene encoding BdsC (wild type) derived from Bacillus subtilis WU-S2B is shown in SEQ ID NO: 2. Bacillus subtilis WU-S2B is known as a moderately thermophilic dibenzothiophene desulfurizing bacterium.

The enzyme may be a wild type or a mutant as long as it has the activity of introducing a hydroxyl group at the 3-position of the indole analogue. Enzyme mutants may have amino acid sequences in which one to several tens, preferably one to several amino acids in the wild-type amino acid sequence are substituted, deleted, inserted, added or modified. good. Amino acid substitutions, deletions, insertions, additions and modifications are known. The enzyme variant has 70% or more, preferably 80% or more, more preferably 90% or more, for example, 95% or more, 97% or more, or 99% or more identity to the amino acid sequence shown in SEQ ID NO: 1. It may have an amino acid sequence having Enzyme mutants can be obtained by known methods such as random mutagenesis, site-directed mutagenesis, and chemical modification. Enzyme variants may be naturally occurring.

An example of a mutant enzyme is an amino acid sequence in which serine at position 97 in the amino acid sequence shown in SEQ ID NO: 1 is substituted with methionine, valine, cysteine or threonine, and proline at position 99 is substituted with lysine or leucine. Enzymes with A preferred example of the above-mentioned mutant is a mutant in which positions 97 and 99 of the amino acid sequence shown in SEQ ID NO: 1 are those shown in Table 2 of Examples. Such mutants have a strong oxidative activity and can rapidly and vividly color colonies in screening. In addition, when the number of amino acid residues is changed by deletion, insertion, or addition in the mutant of the enzyme, the numbers of the above "position 97" and "position 99" are also changed according to the change.

The enzyme mutant preferably has an oxidation activity equal to or higher than that of the wild-type enzyme. For example, the oxidation activity of the enzyme mutant may be about 80% or more, about 90% or more, preferably about 100% or more, more preferably about 120% of the wild-type enzyme oxidation activity. That's it. Methods for measuring the oxidation activity of enzymes are known. For example, by measuring the amount of 3-hydroxyindole analogues produced from indole analogues as substrates or the amount of indigo analogues produced by oxidative dimerization of 3-hydroxyindole analogues, the oxidation activity of the enzyme is examined. good too. The method for measuring the oxidation activity of the enzyme is not limited to the above.

The plasmid vector of the present invention contains a gene encoding a wild-type enzyme or a mutant thereof as described above. Examples of nucleotide sequences of enzyme-encoding genes include, but are not limited to, those encoding the amino acid sequence shown in SEQ ID NO: 1 or its variant amino acid sequence. The nucleotide sequence of the enzyme was mutated from the wild-type nucleotide sequence by truncation for integration into a plasmid vector, mutation to improve oxidation activity, mutation without changing the encoded amino acid, or introduction of a restriction enzyme site. can be anything.

In the following description of this specification, unless otherwise specified, the term "enzyme" also includes variants thereof.

Usually, multiple restriction enzyme sites (multicloning sites) are provided in the gene encoding the enzyme in the plasmid vector of the present invention. The presence of multiple cloning sites facilitates insertion of foreign genes.

It is preferable to exhibit or improve the oxidation activity by coupling the oxidation reaction by the enzyme used in the plasmid vector of the present invention with the reduction reaction. A preferred reduction reaction includes, but is not limited to, reduction of FMN to _FMNH2 by flavin reductase. Therefore, in the screening using the plasmid vector of the present invention, when using a host that does not have a reducing system that couples with an enzymatic oxidation reaction, it is necessary to introduce an appropriate reducing system into the host. For example, a flavin reductase gene may be introduced into a host to express flavin reductase in the host. Genes encoding reductases such as flavin reductase are known, and methods and means for introducing the genes into hosts are also known. When a host having flavin reductase such as E. coli is used for screening, introduction of a gene encoding flavin reductase is unnecessary. There are many types of organisms that have a reduction system that couples with the oxidation reaction of the enzyme of the present invention, and the range of hosts for which the plasmid vector of the present invention can be used is extremely wide.

The plasmid vector of the present invention may be constructed based on any plasmid vector. Many types of plasmid vectors are known. Methods for constructing plasmid vectors are known. Preferably, the plasmid vector of the present invention is constructed based on the pUC plasmid. Typical examples of pUC plasmids are pUC18 and pCU19. The plasmid vector of the present invention contains a promoter, a gene encoding the above enzyme, a drug resistance gene, a replication origin, and the like. These elements contained in the plasmid vectors of the present invention are known, and those skilled in the art can incorporate these elements into plasmid vectors using known methods.

Examples of promoters used in plasmid vectors of the present invention include, but are not limited to, lac promoter, T5 promoter, T7 promoter, tac promoter, ara promoter, and trp promoter. Examples of preferred promoters for use in the plasmid vector of the present invention include, but are not limited to, lac promoter and tac promoter. One type or two or more types of promoters may be used in the plasmid vector of the present invention.

Examples of drug resistance genes used in the plasmid vector of the present invention include, but are not limited to, ampicillin resistance gene, kanamycin resistance gene, neomycin resistance gene, tetracycline resistance gene, and chloramphenicol resistance gene. Examples of preferred drug resistance genes used in the plasmid vector of the present invention include, but are not limited to, ampicillin resistance genes and kanamycin resistance genes. For example, cells introduced with a plasmid vector containing an ampicillin-resistant gene can grow in an ampicillin-containing medium, allowing selection of such plasmid-introduced cells. One type of drug resistance gene may be used in the plasmid vector of the present invention, or two or more types may be used.

In another aspect, the present invention provides a screening method in molecular cloning, characterized by performing blue-white screening using the plasmid vector described above.

Blue-white screening is a known screening method, and the substrate X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside) is cleaved by the enzyme LacZ to produce a blue substance, an indigo analogue. This is a technique for examining whether or not the target gene has been introduced into the host by utilizing the fact that . In the method of the present invention, the substrate used is different from that of the known blue-white screening, but the presence or absence of indigo analogue production is examined, so the screening using the method of the present invention is called "blue-white screening".

The screening method of the present invention is characterized by low running costs due to inexpensive substrates used. Furthermore, the screening method of the present invention has a wide range of applications, since the host of the vector of the present invention to be used can be selected from a wide range, and blue-white screening is possible even when the insert is short.

EXAMPLES The present invention will be described in more detail and specifically below by way of examples, but the examples are not intended to limit the scope of the present invention.

1. Construction of Plasmid Vector pUC19-bdsC Containing Gene Encoding Oxidase BdsC Full-length bdsC was amplified by PCR using the bdsC gene (SEQ ID NO: 1) derived from Bacillus subtilis WU-S2B as a template. The primers at that time include bdsC5H (5′-GGC AAGCTT GACCCTGACCGATGACACCGCC-3′ (SEQ ID NO: 3); underlined, HindIII site) and bdsC3X (5′-GGC TCTAGA TTAGGAAGTGAAAACCGGGTATC-3′ (SEQ ID NO: 4); underlined , XbaI site) was used. The PCR product buffer was replaced with sterilized water using QIAquick PCR Purification Kit (Qiagen), and the ends were cleaved with HindIII and XbaI. pUC19 (Takara Bio) was digested with the same restriction enzyme, and the resulting fragment was ligated with the bdsC fragment. The ligation product was introduced into Escherichia coli DH5α and cultured on a plate coated with 40 μl of 50 mg/ml X-gal in LB medium (LA medium) containing 50 μg/ml ampicillin (37° C., 16 hours). Plasmids were extracted from pale blue colonies to obtain pUC19-bdsC. A map of pUC19-bdsC is shown in FIG.

2. Colored indole substrates of E. coli with pUC19-bdsC (indole (Ind); 5-bromoindole (5Br-Ind); 5-chloroindole (5Cl-Ind); 6-bromoindole (6Br-Ind); 6-chloroindole (6Cl-Ind)) was purchased from Tokyo Kasei. These were dissolved in dimethylformamide (final concentration 25 mg/mL) and stored at -20°C. 0.5×LA medium consisted of 0.25% yeast extract, 0.5% tryptone, 0.5% NaCl, 2% agar, and 50 μg/mL ampicillin. If necessary, indole substrate was added at a final concentration of 25 μg/mL. E. coli DH5α harboring pUC19-bdsC was precultured and approximately 10 ² cells were plated in 0.5×LA medium containing Ind, 5Br-Ind, 5Cl-Ind, 6Br-Ind, or 6Cl-Ind. Each plate was incubated at 37° C. and photographed at 24 and 36 hours of incubation. E. coli DH5α harboring pUC19 was used as a negative control.

The results are shown in FIG. No coloration of colonies was observed on any of the plates after 24 hours of culture. At 36 hours of culture, colony coloration was observed on plates containing indole substrates (5Br-Ind, 5Cl-Ind, 6Br-Ind, and 6Cl-Ind). At 48 hours of culture, colony coloration was observed on plates containing all indole substrates used, including unsubstituted indole. Since the plate containing 5Br-Ind was the easiest to develop color and the substrate was inexpensive, 0.5×LA medium (BrILA medium) containing 5Br-Ind was used in subsequent experiments.

3. Enhancement of BdsC Activity by Random Mutation Introduction Mutations were introduced into the bdsC gene for the purpose of shortening the color development time. Error-prone PCR was used for mutagenesis rate. The mutation incidence rate at that time was adjusted by the Mn ²⁺ concentration. The MnCl ₂ solution was prepared by dissolving MnCl ₂ (Wako Pure Chemical Industries, Ltd.) in ultrapure water to a concentration of 10 mM. 10×dNTPe consisted of 2 mM dATP, 2 mM dGTP, 10 mM dCTP, and 10 mM dTTP. The error-prone PCR reaction solution (50 μl) contains 10× Standard Taq Reaction buffer (Mg-free, New England Biolabs; 5 μl), 25 mM MgCl ₂ (New England Biolabs; 14 μl), 10 mM MnCl ₂ (1.5 μl; end concentration 0.3 mM), primers (M13 RV and M13(-20); 10 pmol each), pUC19-bdsC (0.2 μg), 10×dNTPe (5 μL), and Taq polymerase (New England Biolabs, 1 μl; 5 U) Constructed from PCR conditions were as follows: 95° C., 1 minute, then 30 cycles of 95° C. (30 seconds), 50° C. (30 seconds), and 72° C. (1 minute). The PCR product was replaced with sterile water (25 μl), 22 μl of which was cut with XbaI and HindIII. The bdsC fragment (1.2 kb) was gel recovered and eluted with 20 μl of sterile water. 10 μl of this sample was mixed with pUC19 (XbaI-HindIII digest; 5 μl; about 2 μg), and further mixed with Ligation Mix (Takara Bio) solution (15 μl). After reacting at 16° C. for 30 minutes, E. coli DH5α competent cells (500 μl) were transformed with the total amount of the reaction mixture. About 30 BrILA plates were inoculated with 100 µl of the resulting E. coli suspension (3 ml in total), and cultured at 37°C for 24 hours. A colony with a deep blue color was selected, and the bdsC sequence of the plasmid it harbored was analyzed by sequence analysis. A similar operation was performed by changing the concentration of _MnCl2 to 0.15 mM, 0.3 mM and 0.6 mM. Table 1 shows the results.
The nucleotide sequence of primer M13 RV used in the above experiment is 5'-CAGGAAACAGCTATGAC-3' (SEQ ID NO: 5), and the nucleotide sequence of M13 (-20) is 5'-GTAAACGACGGCCAG-3' (SEQ ID NO: 6). .

In the first experiment, 20 colonies with strong coloring were subjected to secondary screening, and 8 strains with stable and strong coloring were obtained. In the second experiment, 10 strains with strong coloring were subjected to secondary screening, and 9 strains with stable and strong coloring were obtained. In the third experiment, 12 strains with strong coloring were subjected to secondary screening, and 11 strains with stable and strong coloring were obtained. In the fourth experiment, two strains with strong coloration were subjected to secondary screening, but no strains with stable and strong coloration were obtained. Plasmids were purified from a total of 28 positive clones obtained in the above experiments, and sequence analysis of the bdsC gene revealed various mutation points. Mutations at position 97 or 99 were found in 23 out of 28 clones, and these mutations were considered to be effective in improving BdsC activity.

4. Improvement of BdsC Activity by Introduction of Saturation Mutation Primer S97P99 mutations (5′-CAGATCAATAACGGCSNNGTSNNGAGGTGGTATCCGAACAAGTG-3′) (SEQ ID NO: 7) for introducing saturation mutations into the 97th and 99th amino acid residues of BdsC were synthesized. Using pUC19-bdsC as a template, PCR was performed using S97P99 mutations and bdsC5H as primers to amplify the bdsC upstream portion containing random mutations. Taq DNA polymerase was used for this PCR. In parallel, the bdsC downstream portion was amplified using bdsC3X and bdsC300F (5'-GGCGTTATTGATCTGTGGGGG-3') (SEQ ID NO: 8). PrimeSTAR DNA polymerase was used for this PCR. The resulting two fragments were ligated using the fusion PCR method, and bdsC full length was re-amplified using bdsC5H and bdsC3X. PrimeSTAR DNA polymerase was also used for PCR at this time. The PCR product (50 μl) was buffer replaced with water and eluted in 25 μl. 22 μl of this was cleaved with XbaI and HindIII, and the bdsC fragment was gel recovered. Purified products were eluted with 20 μl of sterile water. 10 μl of this sample was mixed with pUC19 (XbaI-HindIII digest; 5 μl; about 2 μg), and further mixed with Ligation Mix solution (15 μl). After reacting at 16° C. for 30 minutes, DH5α competent cells (500 μl) were transformed with the total amount of the reaction mixture. About 30 BrILA plates were inoculated with 100 µl of the resulting E. coli suspension (3 ml in total), and cultured at 37°C for 24 hours. Thirty strains with strong coloring were subjected to secondary screening, and 11 strains with stable and strong coloring were obtained. The bdsC sequence of the plasmid it carries was sequenced. Table 2 shows the results. Amino acid designations are known one-letter designations.

At 97th, methionine, valine, cysteine, and threonine, and at 99th, lysine and two or more leucines were observed. The combination of 97th most abundant methionine and 99th most abundant lysine was found in two clones. The plasmid pUC19- ^bdsCMK of this combination was used in subsequent experiments. E. coli harboring pUC19-bdsC ^MK developed earlier on BrILA plates than E. coli harboring pUC19-bdsC.

5. Construction of cloning vector pKBlue (1) Using pUC19-bdsC ^MK as a template, bdsC5 and bdsC3A (5'-GGC GACGTC TTAGGAAGTGAAAACCGGTATC-3'; underlined, AatII site) (SEQ ID NO: 9) by PCR using primers to obtain the full length of bdsC ^MK . was amplified. PrimeSTAR DNA polymerase was used for PCR at this time. PCR products (50 μl) were buffer replaced and eluted with 25 μl of sterile water. 22 μl of it was digested with HindIII and AatII and inserted between HindIII and AatII of pUC19. This was named pUC19-bdsC ^MK (HA).

(2) Using pUC19-bdsC ^MK (HA) as a template, bdsC (G225A) F (5'-GGCCTACCGCTCTAGAAGTGGTGCGTG-3') (SEQ ID NO: 10) and bdsC (A1014G) R (5'-CCTGTACGCGCGAGCTCGCCGCGTTTCTT-3') ( The internal sequence of ^bdsCMK was amplified using SEQ ID NO: 11) as a primer. XbaI and SacI sites were introduced into the bdsC ^MK region of pUC19-bdsC ^MK (HA) by the QickChange method using this as a mutagenesis primer.

(3) PUC19 -BDSC ^MK (HA) is a mold, BDSC (T255C) F (5' -GATCCCAGAGGGGGGGGGGGATCCTGGGCGCGC -3) (SEQ ID NO: 12) and BDSC (C909T) R (5' -CTGTTCGAT) ACCAAATTCCGTAGCTGCGAAA -3 ') ( The internal sequence of ^bdsCMK was amplified using SEQ ID NO: 13) as a primer. By the QickChange method using it as a mutagenesis primer (the template is the plasmid product of (1) above), a SalI site was introduced into the bdsC ^MK region of pUC19-bdsC ^MK (HA), and at the same time, one of the two EcoRI sites was inactivated in places.

(4) Using pUC19-bdsC ^MK (HA) as a template, bdsC (C387G) F (5'-CCGGGAACGCCTCGAGCGAGAACAACA-3') (SEQ ID NO: 14) and bdsC (G621C) R (5'-GTGCGCCGCATGCCTAGCGCCTG-3') ( SEQ ID NO: 15) was used as a primer to amplify the internal sequence of ^bdsCMK . By the QickChange method using this as a mutagenesis primer (the template is the plasmid product of (3) above), XhoI and SphI sites were introduced into the bdsC ^MK region of pUC19-bdsC ^MK (HA). The resulting plasmid was named pKBlue. The presence of the introduced restriction enzyme site was confirmed by restriction enzyme mapping. A map of plasmid pKBlue is shown in FIG. The nucleotide sequence of the modified bdsC gene in plasmid pKBlue is shown in SEQ ID NO:16.

6. Evaluation of Practical Use of pKBlue When E. coli carrying pKBlue was cultured on a BrILA plate at 37° C. for 24 hours, color development comparable to that of pUC19- ^bdsCMK was observed. E. coli harboring pUC19-bdsC showed color development after 36 hours of culture (Fig. 4).

In order to examine whether pKBlue can actually be used for cloning, a restriction enzyme digest of the thermophilic bacterium (Geobacillus kaustophilus HTA426) chromosome was ligated to pKBlue cloning sites (12 sites in total). Thermophile chromosomes were prepared according to a conventional method. 2-3 μl of this solution was digested with restriction enzymes and ligated with pKBlue digested with the same restriction enzymes. The reaction products were introduced into E. coli DH5α and plated on BrILA plates. After culturing at 37° C. for 24 hours, 8 blue colonies and 8 white colonies were randomly selected, and plasmids were extracted from them. The inserted DNA fragment length was analyzed from restriction enzyme mapping of the resulting plasmid.

The results are shown in FIG. No inserts were found for all plasmids from colonies colored blue. Almost all plasmids from colonies that did not develop color had inserted some DNA fragment. Some clones had inserted short DNA fragments of 100 bp or less. From these results, it was found that cloning using pKBlue has a wide range of DNA fragment lengths, and blue-white screening is possible even with short DNA fragments.

INDUSTRIAL APPLICABILITY The present invention can be used in a wide range of fields such as biology, molecular biology and genetic engineering.

SEQ ID NO: 1 shows the amino acid sequence of BdsC (wild type) from Bacillus subtilis WU-S2B.
SEQ ID NO: 2 shows the nucleotide sequence of the gene encoding BdsC (wild type) derived from Bacillus subtilis WU-S2B.
SEQ ID NO: 3 shows the base sequence of primers for amplifying bdsC derived from Bacillus subtilis WU-S2B.
SEQ ID NO: 4 shows the base sequence of primers for amplifying bdsC derived from Bacillus subtilis WU-S2B.
SEQ ID NO: 5 shows the nucleotide sequence of the primer used for error-prone PCR.
SEQ ID NO: 6 shows the nucleotide sequence of the primer used for error-prone PCR.
SEQ ID NO: 7 shows the nucleotide sequence of primers for introducing saturation mutations into the 97th and 99th amino acid residues of BdsC.
SEQ ID NO: 8 shows the nucleotide sequence of primers for amplifying the downstream portion of bdsC.
SEQ ID NO: 9 shows the nucleotide sequence of primers for amplifying the full-length ^bdsCMK .
SEQ ID NO: 10 shows the nucleotide sequence of primers for amplifying the internal sequence of ^bdsCMK .
SEQ ID NO: 11 shows the base sequence of primers for amplifying the internal sequence of ^bdsCMK .
SEQ ID NO: 12 shows the base sequence of primers for amplifying the internal sequence of ^bdsCMK .
SEQ ID NO: 13 shows the base sequence of primers for amplifying the internal sequence of ^bdsCMK .
SEQ ID NO: 14 shows the base sequence of primers for amplifying the internal sequence of ^bdsCMK .
SEQ ID NO: 15 shows the base sequence of primers for amplifying the internal sequence of ^bdsCMK .
SEQ ID NO: 16 shows the base sequence of modified bdsC in plasmid pKBlue.

Claims (3)

A plasmid vector used for screening in molecular cloning, containing a gene encoding an oxidase that introduces a hydroxyl group at position 3 of an indole analogue , wherein the oxidase converts serine at position 97 of SEQ ID NO: 1 to methionine A vector having an amino acid sequence in which proline at position 99 is substituted with lysine, and a gene encoding the oxidase has a plurality of restriction enzyme sites. The vector of claim 1 , wherein the indole analog is selected from the group consisting of unsubstituted indole, 5-bromoindole, 6-bromoindole, 5-chloroindole and 6-chloroindole. 3. A screening method in molecular cloning, which comprises performing blue-white screening using the vector according to claim 1 or 2 .

Images