JP7269620B2 - Method for producing cartilage tissue from pluripotent stem cells - Google Patents

Description

The present invention relates to a method for producing cartilage tissue from pluripotent stem cells. The invention also relates to medicaments containing cartilage tissue so produced.

The nose, ears, and joints are made up of cartilage tissue, which is composed of chondrocytes and a specific extracellular matrix (containing type II, IX, and XI collagen and proteoglycans, but not collagen type I). formed. Since cartilage tissue lost due to joint damage or the like does not heal naturally, it will worsen unless restorative treatment such as transplantation is performed. However, it is necessary to obtain cartilage tissue in order to transplant it to the damaged site, and if the patient's own cartilage from another site is used, the cartilage tissue will eventually be lost, so it is suitable for transplantation treatment. There is a limit to the amount of damage that can be done. For this reason, a method has been used in which the collected chondrocytes are expanded and cultured and used for transplantation. However, when cultured in vitro, the chondrocytes become fibrous, and the therapeutic effect is not sufficient (non-patent literature). 1). In addition to this, a method of administering mesenchymal stem cells has been proposed. Tissues and hypertrophic tissues that express type X collagen will be transplanted (Non-Patent Document 2).

In recent years, methods of inducing chondrocytes from pluripotent stem cells such as iPS cells and ES cells and using them have been proposed (for example, Non-Patent Documents 3 and 4). Problems such as fibrocartilage formation and teratoma formation have been raised. Therefore, there is a need for a method for producing high-quality cartilage tissue from these pluripotent stem cells without cancer formation in vivo.

The present inventor has developed a method capable of stably inducing differentiation from pluripotent stem cells (e.g., iPS cells) to high-quality chondrocytes in a simplified process (Patent Documents 1, 2, Non-Patent Document 5). However, since this method uses a serum-containing medium, it is difficult to use the cartilage tissue produced by this method for human regenerative medicine. Therefore, it has been desired to develop a method capable of inducing the differentiation of pluripotent stem cells into equivalent cartilage cells and cartilage tissue using a serum-free medium.

International publication WO2015/064754 International Publication WO2016/133208

Roberts, S., et al., Immunohistochemical study of collagen types I and II and procollagen IIA in human cartilage repair tissue following autologous chondrocyte implantation, Knee 16, 398-404 (2009). Mithoefer, K., et al., Clinical efficacy of the microfracture technique for articular cartilage repair in the knee: an evidence-based systematic analysis, Am. J. Sports Med. 37, 2053-2063 (2009). Oldershaw, R.A. et al., Directed differentiation of human embryonic stem cells toward chondrocytes, Nat. Biotechnol. 28, 1187-1194 (2010). Umeda, K. et al., Human chondrogenic paraxial mesoderm, directed specification and prospective isolation from pluripotent stem cells, Scientific Reports volume 2, Article number: 455 (2012). Yamashita, A. et al., Generation of Scaffoldless Hyaline Cartilaginous Tissue from Human iPSCs, Stem cell reports, 4 (2015) 404-418.

An object of the present invention is to provide a method for producing cartilage tissue from pluripotent stem cells using a serum-free medium.

The present invention includes the following inventions in order to solve the above problems.
[1] A method for producing cartilage tissue from pluripotent stem cells, comprising the steps of:
(i) a step of suspension culture in a culture medium in which pluripotent stem cells can be cultured in an undifferentiated state;
(ii) the cells obtained in step (i) are adhered in a serum-free culture medium containing one or more substances selected from the group consisting of BMP2, TGFβ and GDF5 and an HMG-CoA reductase inhibitor; and (iii) culturing the cells obtained in step (ii) above, containing one or more substances selected from the group consisting of BMP2, TGFβ and GDF5 and an HMG-CoA reductase inhibitor, and serum A step of culturing under suspension conditions in a culture medium that does not contain.
[2] The method according to [1] above, wherein the culture medium used in steps (ii) and (iii) further contains serum albumin, fatty acid and PDGF.
[3] The method according to [2] above, wherein the culture medium used in steps (ii) and (iii) further contains cholesterol.
[4] The above [1] to [3], wherein the culture medium used in steps (ii) and (iii) contains BMP2, TGFβ, GDF5, and an HMG-CoA reductase inhibitor and does not contain serum. ] The method according to any one of .
[5] Any one of [1] to [4] above, wherein the HMG-CoA reductase inhibitor is a drug selected from the group consisting of mevastatin, atorvastatin, pravastatin, rosuvastatin, fluvastatin and lovastatin described method.
[6] The method of [5] above, wherein the HMG-CoA reductase inhibitor is rosuvastatin.
[7] Any one of [1] to [6], wherein the step (iii) is a step of performing suspension culture of the cells obtained in the step (ii) without using a separation solution described method.
[8] The method according to any one of [1] to [7], wherein the pluripotent stem cells obtained in step (i) are in the form of cell clusters.
[9] The method according to any one of [1] to [8], wherein the cartilage tissue is a mass containing chondrocytes and an extracellular matrix.
[10] A pharmaceutical product containing cartilage tissue produced by the method according to any one of [1] to [9] above.
[11] The drug according to [10] above, which is for treating articular cartilage damage.

The present invention can provide a method for producing high-quality cartilage tissue from pluripotent stem cells using a serum-free medium. The cartilage tissue produced by the method of the present invention can be suitably used for cartilage regenerative medicine.

Fig. 2 shows the results of hematoxylin-eosin (HE) staining or safranin O staining of tissue clusters after inducing the differentiation of human iPS cell clusters in a serum-containing chondrogenic differentiation medium or a serum-free chondrogenic differentiation medium. FIG. 2 shows the results of immunostaining of type II collagen and lubricin in a tissue mass after inducing differentiation of a human iPS cell mass with a serum-containing chondrogenic differentiation medium or a serum-free chondrogenic differentiation medium. FIG. 2 shows the results of quantification of glycosaminoglycans in tissue masses after differentiation induction of human iPS cell masses in a serum-containing chondrogenic differentiation medium or a serum-free chondrogenic differentiation medium. Fig. 2 shows the results of RT-PCR measurement of the expression of SOX9, type I collagen, type II collagen and aggrecan in tissue masses after human iPS cell masses were differentiated in a serum-containing chondrogenic medium or serum-free chondrogenic medium. be. One osteochondral defect was formed in each of the knee joints of female nude rats (4 weeks old), and human iPS cell-derived cartilage tissue obtained by induction of differentiation in serum-free medium was transplanted and harvested one month later. FIG. 3 shows the results of safranin O staining, type II collagen immunostaining, lubricin immunostaining, and human vimentin immunostaining of knee samples. Human iPS cell-derived cartilage tissue obtained by inducing differentiation in a serum-free medium was transplanted into female nude rats (4 weeks old) with 1 osteochondral defect in each knee joint and collected 6 months later. FIG. 2 shows the results of hematoxylin and eosin (HE) staining, safranin O staining, and human vimentin immunostaining of knee samples. Human iPS cell-derived cartilage tissue obtained by inducing differentiation in a serum-free medium was transplanted into female nude rats (4 weeks old) with 1 osteochondral defect in each knee joint and collected 6 months later. FIG. 2 shows the results of immunostaining of type I collagen, type II collagen, type X collagen, and lubricin immunostaining of knee samples.

The present invention provides a method for producing cartilage tissue from pluripotent stem cells, including the following steps.
(i) a step of suspension culture in a culture medium in which pluripotent stem cells can be cultured in an undifferentiated state;
(ii) the cells obtained in the step (i) in a serum-free culture medium containing one or more substances selected from the group consisting of BMP2, TGFβ and GDF5 and an HMG-CoA reductase inhibitor; step (iii) of culturing under adherent conditions, the cells obtained in step (ii) containing one or more substances selected from the group consisting of BMP2, TGFβ and GDF5 and an HMG-CoA reductase inhibitor, containing serum Step of culturing under suspension conditions in a non-free culture medium

Pluripotent stem cells that can be used in the present invention are stem cells that have pluripotency capable of differentiating into all cells existing in a living body and also proliferative potential, and are not particularly limited thereto. , e.g., embryonic stem (ES) cells, cloned embryo-derived embryonic stem (ntES) cells obtained by nuclear transfer, spermatogonial stem (GS) cells, embryonic germ (EG) cells, induced pluripotent stem (iPS) cells, cultured fibroblasts, and pluripotent cells (Muse cells) derived from bone marrow stem cells. Preferred pluripotent stem cells are ES cells, ntES cells and iPS cells.

(A) Embryonic stem cells
ES cells are stem cells that are established from the inner cell mass of early embryos (for example, blastocysts) of mammals such as humans and mice and that have pluripotency and the ability to proliferate through self-renewal.

ES cells are embryo-derived stem cells derived from the inner cell mass of the blastocyst, which is the 8-cell stage of a fertilized egg and the post-morula embryo. and have the ability to proliferate by self-renewal. ES cells were discovered in mice in 1981 (M.J. Evans and M.H. Kaufman (1981), Nature 292:154-156), and later ES cell lines were established in primates such as humans and monkeys (J.A. Thomson et al. (1998), Science 282:1145-1147; J.A. Thomson et al. (1995), Proc. Natl. Acad. Sci. USA, 92:7844-7848; ., 55:254-259; J.A. Thomson and V.S. Marshall (1998), Curr. Top. Dev. Biol., 38:133-165).

ES cells can be established by removing the inner cell mass from the blastocyst of a fertilized egg of a target animal and culturing the inner cell mass on a fibroblast feeder. In addition, the maintenance of cells by subculturing uses a culture medium supplemented with substances such as leukemia inhibitory factor (LIF) and basic fibroblast growth factor (bFGF). It can be carried out. For methods of establishing and maintaining human and monkey ES cells, see, eg, USP 5,843,780; Thomson JA, et al. (1995), Proc Natl. Acad. Sci. USA. 92:7844-7848; (1998), Science. 282:1145-1147; H. Suemori et al. (2006), Biochem. Biophys. Res. Commun., 345:926-932; USA, 103:9554-9559; H. Suemori et al. (2001), Dev. Dyn., 222:273-279; H. Kawasaki et al. (2002), Proc. Natl. USA, 99:1580-1585; Klimanskaya I, et al. (2006), Nature. 444:481-485.

DMEM/F supplemented with 0.1 mM 2-mercaptoethanol, 0.1 mM non-essential amino acids, 2 mM L-glutamic acid, 20% KSR (KnockOut Serum Replacement, Invitrogen) and 4 ng/ml bFGF as a culture medium for ES cell preparation. -12 culture medium can be used to maintain human ES cells in a humidified atmosphere of 2% CO ₂ /98% air at 37°C (O. Fumitaka et al. (2008), Nat. Biotechnol., 26 :215-224). Also, ES cells should be passaged every 3-4 days, when passages are performed with, for example, 0.25% trypsin and 0.1 mg/ml collagenase IV in PBS containing 1 mM CaCl ₂ and 20% KSR. can be done using

ES cells can generally be selected by real-time PCR using the expression of gene markers such as alkaline phosphatase, Oct-3/4, and Nanog as indicators. In particular, in the selection of human ES cells, the expression of gene markers such as OCT-3/4, NANOG, and ECAD can be used as indicators (E. Kroon et al. (2008), Nat. Biotechnol., 26:443). -452).

Human ES cell lines, such as WA01 (H1) and WA09 (H9), from WiCell Research Institute, KhES-1, KhES-2, and KhES-3 from Institute for Frontier Medical Sciences, Kyoto University (Kyoto, Japan) It is possible.

(B) Spermatogonial stem cells Spermatogonial stem cells are pluripotent stem cells derived from the testis, and are the origin cells for spermatogenesis. Similar to ES cells, these cells can be induced to differentiate into cells of various lineages. 2003) Biol. Reprod., 69:612-616; K. Shinohara et al. (2004), Cell, 119:1001-1012). Sperm can self-replicate in a culture medium containing glial cell line-derived neurotrophic factor (GDNF), and by repeating passages under the same culture conditions as ES cells, Stem cells can be obtained (Masanori Takebayashi et al. (2008), Jikken Igaku, Vol. 26, No. 5 (extra edition), pp. 41-46, Yodosha (Tokyo, Japan)).

(C) Embryonic germ cells Embryonic germ cells are cells that are established from embryonic primordial germ cells and have the same pluripotency as ES cells. LIF, bFGF, stem cell factors, etc. (Y. Matsui et al. (1992), Cell, 70:841-847; JL Resnick et al. (1992), Nature, 359:550 -551).

(D) Induced pluripotent stem cells Induced pluripotent stem (iPS) cells are almost equivalent to ES cells, which can be generated by introducing specific reprogramming factors into somatic cells in the form of DNA or protein. , such as pluripotency and self-renewal proliferation (K. Takahashi and S. Yamanaka (2006) Cell, 126:663-676; K. Takahashi et al. (2007), Cell, 131:861-872; J. Yu et al. (2007), Science, 318:1917-1920; Nakagawa, M. et al., Nat. Biotechnol. 26:101-106 (2008); International Publication WO 2007/069666). A reprogramming factor is a gene specifically expressed in ES cells, its gene product or non-coding RNA, or a gene, its gene product or non-coding RNA that plays an important role in maintaining undifferentiated ES cells, or It may be composed of a low-molecular-weight compound. Genes involved in reprogramming factors include, for example, Oct3/4, Sox2, Sox1, Sox3, Sox15, Sox17, Klf4, Klf2, c-Myc, N-Myc, L-Myc, Nanog, Lin28, Fbx15, ERas, ECAT15 -2, Tcl1, beta-catenin, Lin28b, Sall1, Sall4, Esrrb, Nr5a2, Tbx3, Glis1, etc., and these reprogramming factors may be used alone or in combination. Combinations of initialization factors include WO2007/069666, WO2008/118820, WO2009/007852, WO2009/032194, WO2009/058413, WO2009/057831, WO2009/075119, WO2009/079007, WO2009/0916 59, WO2009/101084, WO2009/ 101407, WO2009/102983, WO2009/114949, WO2009/117439, WO2009/126250, WO2009/126251, WO2009/126655, WO2009/157593, WO2010/009015, WO2010/0339 06, WO2010/033920, WO2010/042800, WO2010/050626, WO2010/056831, WO2010/068955, WO2010/098419, WO2010/102267, WO2010/111409, WO2010/111422, WO2010/115050, WO2010/124290, WO2010/147395, WO 2010/147612, Huangfu D, et al. 2008), Nat. Biotechnol., 26: 795-797; Shi Y, et al. (2008), Cell Stem Cell, 2: 525-528; Eminli S, et al. (2008), Stem Cells. -2474, Huangfu D, et al. (2008), Nat Biotechnol. 26:1269-1275, Shi Y, et al. (2008), Cell Stem Cell, 3, 568-574, Zhao Y, et al. ), Cell Stem Cell, 3:475-479, Marson A, (2008), Cell Stem Cell, 3, 132-135, Feng B, et al. (2009), Nat Cell Biol. 11:197-203, RL Judson et al., (2009), Nat. Biotech., 27:459-461, Lyssiotis CA, et al. (2009), Proc Natl Acad Sci US A. 106:8912-8917, Kim JB, et al. 2009), Nature. 461:649-643, Ichida JK, et al. (2009), Cell Stem Cell. 5:491-503, Heng JC, et al. (2010), Cell Stem Cell. , Han J, et al. (2010), Nature. 463:1096-100, Mali P, et al. (2010), Stem Cells. 28:713-720, Maekawa M, et al. (2011), Nature. 474:225-9.

The above reprogramming factors include histone deacetylase (HDAC) inhibitors [e.g., small molecule inhibitors such as valproic acid (VPA), trichostatin A, sodium butyrate, MC 1293, M344, siRNAs and shRNAs against HDACs (e.g. , HDAC1 siRNA Smartpool (Millipore), HuSH 29mer shRNA Constructs against HDAC1 (OriGene), etc.], MEK inhibitors (e.g., PD184352, PD98059, U0126, SL327 and PD0325901), Glycogen synthase kinase- 3 inhibitors (e.g. Bio and CHIR99021), DNA methyltransferase inhibitors (e.g. 5-azacytidine), histone methyltransferase inhibitors (e.g. small molecule inhibitors such as BIX-01294, Suv39hl, Suv39h2, SetDBl and G9a nucleic acid expression inhibitors such as siRNA and shRNA), L-channel calcium agonist (e.g. Bayk8644), butyric acid, TGFβ inhibitor or ALK5 inhibitor (e.g. LY364947, SB431542, 616453 and A-83-01), p53 inhibition agents (e.g. siRNA and shRNA against p53), ARID3A inhibitors (e.g. siRNA and shRNA against ARID3A), miRNAs such as miR-291-3p, miR-294, miR-295 and mir-302, Wnt Signaling (e.g. ), neuropeptide Y, prostaglandins (e.g., prostaglandin E2 and prostaglandin J2), hTERT, SV40LT, UTF1, IRX6, GLISl, PITX2, DMRTBl, etc. In this specification, the factors used for the purpose of improving the establishment efficiency are not distinguished from the initialization factors.

Reprogramming factors, in the form of proteins, may be introduced into somatic cells by techniques such as lipofection, fusion with cell membrane-permeable peptides (eg, HIV-derived TAT and polyarginine), and microinjection.

On the other hand, DNA forms can be introduced into somatic cells by methods such as viruses, plasmids, vectors such as artificial chromosomes, lipofection, liposomes, and microinjection. Viral vectors include retroviral vectors and lentiviral vectors (see Cell, 126, pp.663-676, 2006; Cell, 131, pp.861-872, 2007; Science, 318, pp.1917-1920, 2007 ), adenovirus vectors (Science, 322, 945-949, 2008), adeno-associated virus vectors, Sendai virus vectors (WO 2010/008054), and the like. In addition, artificial chromosome vectors include, for example, human artificial chromosomes (HAC), yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC, PAC) and the like. As a plasmid, a plasmid for mammalian cells can be used (Science, 322:949-953, 2008). The vector can contain regulatory sequences such as promoters, enhancers, ribosome-binding sequences, terminators, and polyadenylation sites so that nuclear reprogramming substances can be expressed, and furthermore, drug resistance genes ( kanamycin resistance gene, ampicillin resistance gene, puromycin resistance gene, etc.), selection marker sequences such as thymidine kinase gene and diphtheria toxin gene, reporter gene sequences such as green fluorescent protein (GFP), β-glucuronidase (GUS), FLAG, etc. can contain. In addition, the above vector has LoxP sequences before and after the gene or promoter encoding the reprogramming factor and the gene encoding the reprogramming factor binding thereto, in order to excise both the gene or the promoter encoding the reprogramming factor after introduction into somatic cells. may

In the case of RNA, it may be introduced into somatic cells by techniques such as lipofection and microinjection, and RNA incorporating 5-methylcytidine and pseudouridine (TriLink Biotechnologies) is used to suppress degradation. (Warren L, (2010) Cell Stem Cell. 7:618-630).

Culture media for iPS cell induction include, for example, DMEM, DMEM/F12 or DME culture media containing 10-15% FBS (these media also contain LIF, penicillin/streptomycin, puromycin, L-glutamine , non-essential amino acids, β-mercaptoethanol, etc.), mouse ES cell culture medium (TX-WES culture medium, Thrombo X), primate ES cell culture medium (primate ES/iPS cell culture medium, Reprocell), serum-free pluripotent stem cell maintenance medium (e.g., mTeSR (Stemcell Technology), Essential 8 (Life Technologies), StemFit AK03 (AJINOMOTO)). exemplified.

As an example of the culture method, for example, somatic cells are brought into contact with reprogramming factors in DMEM or DMEM/F12 culture medium containing 10% FBS at 37°C in the presence of 5% CO ₂ and cultured for about 4 to 7 days. Then, the cells were reseeded on feeder cells (e.g., mitomycin C-treated STO cells, SNL cells, etc.), and about 10 days after contact between the somatic cells and the reprogramming factors, they were incubated with bFGF-containing primate ES cell culture medium. It can be cultured to give rise to iPS-like colonies after about 30 to about 45 days or more after said contact.

Alternatively, at 37°C in the presence of 5% _CO2 , feeder cells (e.g., mitomycin C-treated STO cells, SNL cells, etc.) in 10% FBS-containing DMEM culture medium (this further includes LIF, penicillin/streptomycin, puromycin, L-glutamine, non-essential amino acids, β-mercaptoethanol, etc.), and after about 25 to about 30 days or longer, ES-like colonies can be generated. Desirably, instead of feeder cells, somatic cells themselves to be reprogrammed are used (Takahashi K, et al. (2009), PLoS One. 4: e8067 or WO2010/137746), or an extracellular matrix (e.g., Laminin- 5 (WO2009/123349) and Matrigel (BD)).

In addition, a method of culturing using a serum-free medium is also exemplified (Sun N, et al. (2009), Proc Natl Acad Sci U S A. 106:15720-15725). Furthermore, in order to increase the establishment efficiency, iPS cells may be established under hypoxic conditions (oxygen concentration of 0.1% or more and 15% or less) (Yoshida Y, et al. (2009), Cell Stem Cell. 5:237 -241 or WO2010/013845).

During the above culture, the medium is replaced with a fresh medium once a day from the second day onwards. The number of somatic cells used for nuclear reprogramming is not limited, but ranges from about 5×10 ³ to about 5×10 ⁶ cells per 100 cm ² of culture dish.

iPS cells can be selected by the shape of the formed colony. On the other hand, when a drug-resistant gene that is expressed in conjunction with a gene that is expressed when somatic cells are reprogrammed (e.g., Oct3/4, Nanog) is introduced as a marker gene, the culture medium containing the corresponding drug (selection The established iPS cells can be selected by culturing in culture solution). If the marker gene is a fluorescent protein gene, iPS cells are selected by observing with a fluorescence microscope, by adding a luminescent substrate if the marker gene is a luciferase gene, or by adding a chromogenic substrate if the marker gene is a chromogenic enzyme gene. can do.

As used herein, the term "somatic cell" refers to any animal cell (preferably mammalian cells, including humans), excluding germ line cells or totipotent cells such as eggs, oocytes, ES cells. say. Somatic cells include, but are not limited to, fetal (pup) somatic cells, neonatal (pup) somatic cells, and mature healthy or diseased somatic cells, as well as primary cultured cells. , passaged cells, and cell lines are all included. Specifically, somatic cells include, for example, (1) tissue stem cells (somatic stem cells) such as neural stem cells, hematopoietic stem cells, mesenchymal stem cells, dental pulp stem cells, (2) tissue progenitor cells, (3) lymphocytes, epithelial cells, endothelial cells, muscle cells, fibroblasts (skin cells, etc.), hair cells, hepatocytes, gastric mucosa cells, enterocytes, splenocytes, pancreatic cells (pancreatic exocrine cells, etc.), brain cells, lung cells, kidney cells and differentiated cells such as adipocytes.

In addition, when iPS cells are used as a material for cells for transplantation, it is desirable to use somatic cells that have the same or substantially the same HLA genotype as the recipient individual from the viewpoint of avoiding rejection. Here, the term "substantially identical" means that the HLA genotypes match the transplanted cells to the extent that an immunosuppressive agent can suppress an immune reaction. and HLA-DR 3 loci or 4 loci including HLA-C are somatic cells that have the same HLA type.

(E) ES cells derived from cloned embryos obtained by nuclear transfer
ntES cells are cloned embryo-derived ES cells produced by nuclear transfer technology, and have almost the same characteristics as fertilized egg-derived ES cells (T. Wakayama et al. (2001), Science, 292: 740-743; S. Wakayama et al. (2005), Biol. Reprod., 72:932-936; J. Byrne et al. (2007), Nature, 450:497-502). That is, ntES (nuclear transfer ES) cells are ES cells established from the inner cell mass of a cloned embryo-derived blastocyst obtained by replacing the nucleus of an unfertilized egg with the nucleus of a somatic cell. For the production of ntES cells, a combination of nuclear transfer technology (JB Cibelli et al. (1998), Nature Biotechnol., 16:642-646) and ES cell production technology (above) is used (Wakayama Seika (2008), Jikken Igaku, Vol. 26, No. 5 (extra edition), pp. 47-52). In nuclear transfer, the nucleus of a somatic cell is injected into an enucleated unfertilized egg of a mammal and cultured for several hours to initialize the egg.

(F) Multilineage-differentiating stress enduring cells (Muse cells)
Muse cells are pluripotent stem cells produced by the method described in WO2011/007900. Pluripotent cells obtained by suspension culture after treatment, and are positive for SSEA-3 and CD105.

(i) A step of suspension culture in a culture medium that allows pluripotent stem cells to be cultured in an undifferentiated state. Cells obtained by Cells in a cell aggregate state by three-dimensional suspension culture are preferred. In the present invention, three-dimensional suspension culture is a method of culturing cells under non-adhesive conditions in a culture solution while stirring or shaking.

When the diameter of the cell cluster exceeds 300 μm, differentiation induction and necrosis occur inside the cell cluster due to the effects of cytokines and the like secreted by the cells. In order to adjust the diameter of the cell aggregates, adjusting the cell density and stirring speed appropriately, and adjusting the size by passing the cell aggregates through a mesh are exemplified. The mesh used here is not particularly limited as long as it can be sterilized, and examples thereof include nylon mesh and metal mesh such as stainless steel.

The culture medium used for 3D suspension culture of pluripotent stem cells is not particularly limited as long as it can maintain the undifferentiated state of pluripotent stem cells. Such a medium contains 10-15% FBS. DMEM/F12 or DMEM culture media (these culture media may further contain LIF, penicillin/streptomycin, puromycin, L-glutamine, non-essential amino acids, β-mercaptoethanol, etc. as appropriate), or mice ES cell culture medium (TX-WES culture medium, Thrombo X), primate ES cell culture medium (primate ES/iPS cell culture medium, Reprocell), serum-free pluripotent stem cell maintenance medium ( Examples include commercially available culture solutions such as mTeSR (Stemcell Technology), Essential 8 (Life Technologies), StemFit AK03 (AJINOMOTO).

A ROCK inhibitor may be added to the culture medium used for three-dimensional suspension culture of pluripotent stem cells in order to suppress cell death. ROCK inhibitors are not particularly limited as long as they can suppress the function of Rho-kinase (ROCK). Narumiya et al., Methods Enzymol. 325,273-284 (2000)), Fasudil/HA1077 (e.g. Uenata et al., Nature 389: 990-994 (1997)), H-1152 (e.g. Sasaki et al.) Ther. 93: 225-232 (2002)), Wf-536 (see e.g. Nakajima et al., Cancer Chemother Pharmacol. 52(4): 319-324 (2003)) and their derivatives, and antisense nucleic acids against ROCK, RNA interference-inducing nucleic acids (eg, siRNA), dominant-negative mutants, and expression vectors thereof. In addition, other known low-molecular-weight compounds can also be used as ROCK inhibitors (e.g., US Patent Application Publication Nos. 2005/0209261, 2005/0192304, 2004/0014755, 2004/0002508). , WO 2004/0002507, WO 2003/0125344, WO 2003/0087919, WO 2003/062227, WO 2003/059913, WO 2003/062225, WO 2002/076976 , 2004/039796). One or more ROCK inhibitors may be used in the present invention. Preferred ROCK inhibitors include Y-27632. The concentration of the ROCK inhibitor can be appropriately selected by those skilled in the art depending on the ROCK inhibitor to be used. Preferably from 5 μM to 20 μM.

A reagent for suppressing adhesion between cell clusters or a reagent for maintaining the floating state of cell clusters may be added to the culture medium used for three-dimensional suspension culture of pluripotent stem cells. Examples include water-soluble polymers, more preferably water-soluble polysaccharides (eg, methylcellulose, gellan gum).

The culture vessel used for three-dimensional suspension culture is not particularly limited as long as it is a non-adhesive culture vessel. Examples include microplates, microwell plates, multiplates, multiwell plates, chamber slides, petri dishes, tubes, trays, culture bags, and roller bottles. These containers may be appropriately equipped with an agitator and an air supply system. By using gas-permeable materials for the incubator and adjusting the size and shape of the stirring blades of the stirring device, an axial flow is generated on the upper surface of the culture tank, making it possible to omit the air supply system. can. A suitable culture vessel for use in the three-dimensional suspension culture of the present invention is exemplified by a bioreactor equipped with a magnetic stirrer manufactured by ABLE.

In three-dimensional suspension culture, when using an incubator equipped with a stirrer, the stirring speed is not particularly limited as long as the cells can be kept in a floating state, but is, for example, 30 rpm to 80 rpm, preferably 40 rpm to 70 rpm. , and more preferably 50 rpm to 60 rpm.

The three-dimensional suspension culture is exemplified by a cell density of 1.0 x 10 ⁴ cells/ml to 1.0 x 10 ⁶ cells/ml, preferably 3.0 x 10 ⁴ cells/ml to 1.0 x 10 ⁵ cells/ml, A desired number of cells can be adjusted by appropriately increasing or decreasing the volume of the culture medium.

In the three-dimensional suspension culture, although the culture temperature is not particularly limited, it is about 30° C. to about 40° C., preferably about 37° C., and the culture is performed in an atmosphere of air containing CO ₂ . The _CO2 concentration is about 2% to about 5%, preferably about 5%. The culture period in this step is not particularly limited as long as the diameter of the cell mass is maintained within 300 μm. Five days is preferred.

In the present invention, chondrocytes mean cells that produce extracellular matrix that constitutes cartilage such as collagen, or progenitor cells that produce such cells. In addition, such chondrocytes may be cells expressing chondrocyte markers, and examples of chondrocyte markers include type II collagen (COL2A1) and SOX9. In the present invention, COL2A1 includes a gene having a nucleotide sequence described in NCBI accession numbers NM_001844 or NM_033150 for humans and NM_001113515 or NM_031163 for mice, proteins encoded by the genes, and these Naturally occurring variants having the function of are included. In the present invention, SOX9 includes a gene having a nucleotide sequence described in NCBI accession numbers NM_000346 for humans and NM_011448 for mice, a protein encoded by the gene, and functions thereof. Naturally occurring variants are included. Chondrocytes produced in the present invention may be produced as a cell population containing other cell types. is a cell population containing

The cartilage tissue obtained by the production method of the present invention is a tissue mass containing chondrocytes and an extracellular matrix, and is also called cartilage particles. Cartilage tissue is composed of an adventitia and contents bound to the adventitia. The adventitia contains COL1 fibers but does not contain COL2 fibers, and has a thickness of 10 μm or more and 50 μm or less. The contents include Col11 fibers, Col2 fibers, proteoglycans and chondrocytes. In the present invention, COL1 fibers are fibers in which the protein encoded by the COL1 gene forms a triple helix structure. In the present invention, COL2 fibers are fibers in which the protein encoded by the COL2 gene forms a triple helix structure. In the present invention, COL11 fibers are fibers in which the protein encoded by the COL11 gene forms a triple helix structure. In the present invention, proteoglycan is a compound in which core protein amino acid serine and carbohydrates (xylose, galactose, glucuronic acid) are bound to each other, and continuous disaccharide units such as chondroitin sulfate are bound to polysaccharides.

(ii) the cells obtained in step (i) are adhered in a serum-free culture medium containing one or more substances selected from the group consisting of BMP2, TGFβ and GDF5 and an HMG-CoA reductase inhibitor; The culture solution used in the step step (ii) of culturing under the conditions is BMP2 (Bone Morphogenetic Protein-2: Bone Morphogenetic Protein-2), TGFβ (Transforming Growth Factor-β: It can be prepared by adding one or more substances selected from the group consisting of transforming growth factor β) and GDF5 (Growth Differentiation Factor-5) and an HMG-CoA reductase inhibitor. A preferred culture medium used in step (i) is a basal medium supplemented with BMP2, TGFβ, GDF5 and an HMG-CoA reductase inhibitor. Examples of basal media include IMDM medium, Medium 199 medium, Eagle's Minimum Essential Medium (EMEM) medium, αMEM medium, Dulbecco's modified Eagle's Medium (DMEM) medium, Ham's F12 medium, RPMI 1640 medium, Fischer's medium, and mixtures thereof. A culture medium etc. are mentioned.

The culture medium used in step (ii) does not contain serum (e.g., FBS), but the basal medium may optionally contain albumin, transferrin, KnockOut Serum Replacement (KSR) (for FBS Serum Replacement (Invitrogen), N2 Supplement (Invitrogen), B27 Supplement (Invitrogen), Fatty Acids, Insulin, Sodium Selenite, Ethanolamine, Collagen Precursors, Trace Elements, 2-Mercaptoethanol, 3'-Thioglycerol , lipids, amino acids, L-glutamine, GlutaMAX (Invitrogen), non-essential amino acids (NEAA), sodium pyruvate, vitamins, growth factors, low molecular weight compounds, antibiotics, antioxidants, pyruvic acid, buffers, inorganic salts, etc. may contain substances of In one embodiment of this process, the basal medium is serum-free DMEM containing insulin, transferrin, sodium selenite, ethanolamine, ascorbic acid, non-essential amino acids, sodium pyruvate, antibiotics.

A preferred culture medium used in step (ii) is a basal medium supplemented with BMP2, TGFβ, GDF5, HMG-CoA reductase inhibitor, serum albumin, fatty acids and PDGF (Platelet-Derived Growth Factor). be. A preferred culture medium used in step (ii) is a basal medium supplemented with BMP2, TGFβ, GDF5, HMG-CoA reductase inhibitor, serum albumin, fatty acids, cholesterol and PDGF.

The BMP2 used in step (ii) includes BMP2 derived from humans and other animals, and functional variants thereof. For example, commercially available BMP2 can be preferably used. Human BMP2 is preferred. BMP2 may be naturally occurring or recombinant. The concentration of BMP2 is 0.1 ng/ml to 1000 ng/ml, preferably 1 ng/ml to 100 ng/ml, more preferably 5 ng/ml to 50 ng/ml, even more preferably 10 ng/ml. In the present invention, BMP2 may be replaced with BMP4.

TGFβ used in step (ii) includes TGFβ derived from humans and other animals, and functional variants thereof. For example, commercially available TGFβ can be preferably used. TGFβ may be naturally occurring or recombinant. Human TGFβ is preferred. The concentration of TGFβ is 0.1 ng/ml to 1000 ng/ml, preferably 1 ng/ml to 100 ng/ml, more preferably 5 ng/ml to 50 ng/ml, still more preferably 10 ng/ml.

GDF5 used in step (ii) includes GDF5 derived from humans and other animals, and functional variants thereof. For example, commercially available GDF5 can be preferably used. GDF5 may be naturally occurring or recombinant. Human GDF5 is preferred. The concentration of GDF5 is 0.1 ng/ml to 1000 ng/ml, preferably 1 ng/ml to 100 ng/ml, more preferably 5 ng/ml to 50 ng/ml, even more preferably 10 ng/ml.

HMG-CoA reductase inhibitors are drugs that suppress cholesterol synthesis by inhibiting the action of HMG-CoA reductase. HMG-CoA reductase inhibitors used in step (ii) include, for example, mevastatin (compactin) (see USP3983140), pravastatin (see JP-A-57-2240 (USP4346227)), lovastatin (see JP-A-57 -163374 (USP4231938)), simvastatin (see JP-A-56-122375 (USP4444784)), fluvastatin (JP-A-60-500015 (USP4739073)), atorvastatin (JP-A-3-58967) (USP5273995)), rosuvastatin (see JP-A-5-178841 (USP5260440)), pitavastatin (see JP-A-1-279866 (USP5854259 and USP5856336)), but not limited thereto. The HMG-CoA reductase inhibitor in the present invention is preferably a drug selected from the group consisting of mevastatin, atorvastatin, pravastatin, rosuvastatin, fluvastatin and lovastatin. Rosuvastatin is more preferred. When rosuvastatin is used as an HMG-CoA reductase inhibitor, its concentration is 0.01 μM to 100 μM, preferably 0.1 μM to 10 μM, more preferably 0.5 μM to 5 μM, further preferably about 1 μM.

Serum albumin used in step (ii) includes serum albumin derived from humans and other animals, and functional variants thereof. For example, commercially available serum albumin can be preferably used. Serum albumin may be naturally occurring or recombinant. Human serum albumin (HSA) is preferred. The concentration of serum albumin is 0.01 mg/ml to 10 mg/ml, preferably 0.05 mg/ml to 5 mg/ml, more preferably 0.1 mg/ml to 3 mg/ml, more preferably about 1 mg/ml. be.

Fatty acids used in step (ii) include, for example, linoleic acid, linoleic acid, arachidonic acid, myristic acid, oleic acid, palmitoic acid, palmitic acid, and stearin. These fatty acids may be contained singly or in combination. For example, a commercially available lipid concentrate (trade name: Chemically defined lipid concentrate, gibco #11905-031) can be preferably used. When a "chemically defined lipid concentrate" is used, it is preferable to add the stock solution in an amount of 1/1000 or more and 1/10 or less of the volume of the culture medium, more preferably about 1/100. "Chemically defined lipid concentrates" contain, besides fatty acids, cholesterol and tocopherol acetates. The composition of the "Chemically defined lipid concentrate" is shown in the table below.

The PDGF used in step (ii) includes PDGF derived from humans and other animals, and functional variants thereof. For example, commercially available PDGF can be preferably used. Human PDGF is preferred. PDGF may be naturally occurring or recombinant. PDGF may be PDGF-AA, PDGF-AB or PDGF-BB, preferably PDGF-BB. The concentration of PDGF is 0.1 ng/ml to 1000 ng/ml, preferably 1 ng/ml to 100 ng/ml, more preferably 5 ng/ml to 50 ng/ml, more preferably about 10 ng/ml. .

The culture medium used in step (ii) may further contain bFGF (Basic fibroblast growth factor). bFGF includes bFGF derived from humans and other animals, and functional variants thereof. For example, commercially available bFGF can be preferably used. The concentration of bFGF is 0.1 ng/ml to 1000 ng/ml, preferably 1 ng/ml to 100 ng/ml, more preferably 5 ng/ml to 50 ng/ml, more preferably about 10 ng/ml. .

The culture medium used in step (ii) may further contain a pterosine derivative. Pterosin derivatives are exemplified by, for example, pterosin derivatives described in US 2015/0051293 A1, and more preferably pterosin B. The concentration of pterosin B is 10 μM to 1000 μM, preferably 100 μM to 1000 μM.

In the present invention, culturing under adhesive conditions means culturing cells in a state that allows them to adhere to a culture dish, and may be performed by culturing using a culture vessel having a surface that is suitable for cell adhesion. Commercially available culture vessels with such a surface treatment can be used, for example, IWAKI's tissue culture dishes are exemplified. In another embodiment, culture may be performed using a culture vessel coated with an extracellular matrix. The coating treatment can be performed by adding a solution containing an extracellular matrix to the culture vessel and then removing the solution as appropriate.

In the present invention, an extracellular matrix is a supramolecular structure existing outside a cell, and may be a natural product or an artificial product (recombinant). Examples include substances such as polylysine, polyornithine, collagen, proteoglycan, fibronectin, hyaluronic acid, tenascin, entactin, elastin, fibrillin, laminin, and fragments thereof. These extracellular matrices may be used in combination as appropriate.

In step (ii), the culture temperature is not particularly limited, but is about 30° C. to about 40° C., preferably about 37° C., and culture is performed in an atmosphere of air containing CO ₂ . The _CO2 concentration is about 2% to about 5%, preferably about 5%. The culture time in this step is, for example, 7 to 28 days, 10 to 25 days, 10 to 20 days, more preferably 14 days.

(iii) suspending the cells obtained in step (ii) in a serum-free culture medium containing one or more substances selected from the group consisting of BMP2, TGFβ and GDF5 and an HMG-CoA reductase inhibitor; The step of culturing under the conditions step (iii) can be performed by detaching the cells (cell mass) obtained in the step (ii) from the culture vessel and culturing them in suspension. The method of detaching the cells (cell mass) obtained in step (ii) from the culture vessel is preferably performed by a mechanical separation method (e.g., pipetting, a method using a scraper, etc.), and protease activity and / or collagenase A method that does not use an active separate solution is preferred.

In the present invention, culturing in suspension conditions means culturing cells (cell clusters) in a non-adherent state to a culture dish, and is not particularly limited, but is artificially treated for the purpose of improving cell adhesiveness ( For example, a culture vessel (e.g., Petri dish) that has not been coated with extracellular matrix, etc., or a treatment that artificially suppresses cell adhesion (e.g., coating with polyhydroxyethyl methacrylic acid (poly-HEMA)) You may perform using the culture vessel which carried out.

As the culture medium used in step (iii), the same culture medium as in step (ii) can be used.

In step (iii), the culture temperature is not particularly limited, but is about 30° C. to about 40° C., preferably about 37° C., and culture is performed in an atmosphere of air containing CO ₂ . The _CO2 concentration is about 2% to about 5%, preferably about 5%. The culture time in this step is, for example, 2 weeks or longer, preferably 6 weeks or longer, and more preferably 10 weeks or longer and 20 weeks or shorter. The culture period is desirably continued until the desired cartilage tissue (tissue mass) is obtained, and the culture period can be appropriately adjusted while confirming the production of the cartilage tissue. Methods for confirming cartilage tissue in the present invention include, for example, a method of collecting a portion of the obtained cartilage tissue and confirming that it is stained with Safranin O. Another example is a method of confirming that the outer membrane of cartilage tissue is lubricin-positive.

The present invention provides pharmaceuticals containing cartilage tissue produced by the method of the present invention. As a method of administering a drug to a patient, for example, the cartilage tissue obtained by the above-described method is solidified with fibrin glue, and the cartilage tissue having a size suitable for the administration site is administered to the cartilage defect site of the patient. be. Other examples include a method in which cartilage tissue is mixed with gelatin gel and/or collagen gel and/or hyaluronic acid gel and the like and administered to the affected area, and a method in which cartilage tissue is administered to the affected area and fixed with periosteum or the like.

In the present invention, the number of cartilage tissues contained in the drug is not particularly limited as long as the graft can survive after administration, and may be prepared by appropriately increasing or decreasing according to the size of the affected area and the size of the body.

EXAMPLES The present invention will be described in detail below with reference to Examples, but the present invention is not limited to these.

[Example 1: Induction of differentiation from iPS cells to chondrocytes using serum-free medium]
1-1 Materials and methods
human iPS cells
The Ff-I01 strain established by the method described in Nakagawa M, et al, Sci Rep. 4:3594 (2014) was received from the Institute for iPS Cell Research and Application, Kyoto University and used as human iPS cells.

Step (i)
For human iPS cells, 0.5X TrypLE Select was added, and after incubation, the cells were detached using a cell scraper. Count the cells, transfer 0.5-1.0×10 ⁷ cells to a 100 mL bioreactor (BWV-S10A, ABLE), add 100 mL of StemFit AK03 (Ajinomoto) supplemented with 10 nM Y-27632 (Wako), It was rotated at 60 rpm with a 6 cm magnetic stirrer (BWS-S03NOS-6, ABLE) and cultured for 5 days at 37° C. and 5% CO ₂ . As a result, iPS cell clusters with a diameter of 50 μm to 300 μm were obtained.

Medium A serum-free medium having the composition shown below was used.

As a control, the serum-containing medium indicated below was used.

Induction of differentiation into chondrocytes
Step (ii)
The iPS cell mass obtained in step (i) above was collected and seeded in a 10 cm suspension culture dish (sumitomo) containing 5 mL of a chondrogenic differentiation medium. After seeding, the cells were cultured under conditions of 37°C and 5% CO ₂ . After 1 to 3 days, the medium was replaced with a new chondrogenic differentiation medium, and thereafter, the medium was replaced at intervals of 2 to 5 days, and culture was continued for 2 to 3 weeks. The iPS cell mass gradually adhered to the dish to form a nodule.

Step (iii)
The nodules obtained in step (ii) above were scraped off with a cell scraper, transferred to a 6 cm suspension culture dish (Sumitomo), and cultured at 37°C under 5% CO ₂ conditions. After 1-5 days, the medium was replaced with fresh chondrogenic differentiation medium. Thereafter, the medium was replaced every 2 to 7 days. At the time of medium exchange, if there was a nodule attached to the dish, it was scraped off with a cell scraper and made to float.

Histological Analysis Tissue blocks obtained on day 84 (for serum-containing medium) or day 104 (for serum-free medium) after initiation of bioreactor culture were subjected to histological analysis. Tissue blocks were fixed with 4% paraformaldehyde and embedded in paraffin blocks. Semi-serial sections were prepared and subjected to hematoxylin/eosin (HE) staining and safranin O staining (safranin O/fast green/iron hematoxylin staining). In addition, immunostaining was performed using an antibody. Detection of the primary antibody was performed using the CSA II Biotin-free Tyamide Signal Amplification System Kit (Agilent Technologies, CA, USA) and developed with DAB.

Determination of Glycosaminoglycans Glycosaminoglycans were obtained at 13-14 weeks (for serum-containing medium) or 104 days (for serum-free medium) after the start of culture in the bioreactor. was used for quantification. Glycosaminoglycans are one of the major extracellular matrices present in cartilage tissue. The samples were dried, weighed, and ground with a Multi Beads Shocker (Yasui Kikai). The amount of glycosaminoglycan in the pulverized sample was measured using the Blyscan Glycosaminoglycan Assay Kit (Biocolor). The amount of glycosaminoglycan was divided by the dry weight.

Expression analysis of cartilage-specific genes It was subjected to gene expression analysis. RNA for performing RT-PCR was recovered from each tissue block using the RNeasy Mini Kit (Qiagen) according to the manufacturer's protocol. The obtained total RNA was converted to cDNA using ReverTra Ace (TOYOBO). Real-time PCR was performed by Step One system (ABI) using KAPA SYBR FAST qPCR kit Master Mix ABI prism (KAPA BIOSYSTEMS). The primers used for PCR are shown below.
SOX9 F AGACCTTTGGGCTGCCTTAT (SEQ ID NO: 1)
SOX9 R TAGCCTCCCTCACTCCAAGA (SEQ ID NO: 2)
COL1A1 F GTCGAGGGCCAAGACGAAG (SEQ ID NO: 3)
COL1A1 R CAGATCACGTCATCGCACAAC (SEQ ID NO: 4)
COL2A1 F TTTCCCAGGTCAAGATGGTC (SEQ ID NO: 5)
COL2A1 R CTTCAGCACCTGTCTCACCA (SEQ ID NO: 6)
AGGRECAN F TGAGGAGGGCTGGAACAAGTACC (SEQ ID NO: 7)
AGGRECAN R GGAGGTGGTAATTGCAGGGAACA (SEQ ID NO: 8)

1-2 Results
Histological analysis
FIG. 1 shows the results of HE staining and Safranin O staining of tissue masses obtained using a serum-containing chondrogenesis medium and a serum-free chondrogenesis medium, respectively. Both the serum-containing chondrogenic medium and serum-free chondrogenic medium induced masses had a structure in which cells were scattered in an extracellular matrix stained red with safranin O, and exhibited a cartilage-like histology.

FIG. 2 shows the results of immunostaining for type II collagen and PRG4 in tissue masses obtained using serum-containing chondrogenesis medium and serum-free chondrogenesis medium. Figures 1 and 2 are stained semi-serial sections of the same sample. Both serum-containing and serum-free chondrogenesis medium-induced masses contained type II collagen in their extracellular matrix, suggesting that they were cartilage. Expression of lubricin (also called PRG4) was also observed, suggesting that it has cartilage properties.

Quantification of Glycosaminoglycans FIG. 3 shows the results of quantification of glycosaminoglycans in tissue masses obtained using serum-containing chondrogenic differentiation medium and serum-free chondrogenic differentiation medium. Both serum-containing and serum-free chondrogenesis medium-induced masses contained more than 100 mg/g of glycosaminoglycans and had a composition similar to cartilage.

Expression analysis of cartilage-specific genes SOX9, type I collagen (COL1A1), type II collagen (COL2A1) and aggrecan (ACAN) in tissue masses obtained using serum-containing and serum-free chondrogenesis media, respectively. FIG. 4 shows the results of measuring the expression by RT-PCR. The clots induced by serum-containing chondrogenesis medium and serum-free chondrogenesis medium showed markedly increased expression of COL2A1 gene and ACAN gene compared to iPS cells, suggesting that they were differentiated into cartilage. The expression of the COL2A1 gene in the mass induced in the serum-free chondrogenesis medium was lower than that in the serum-containing chondrogenesis medium, suggesting the possibility that the degree of cartilage differentiation was immature.

[Example 2: Transplantation of human iPS cell-derived cartilage tissue to nude rats]
2-1 Materials and methods
Implantation of articular cartilage defects in nude rats
Female nude rats (F344/NJc1-rnu rnu/rnu, CLEA Japan, Inc.) were used. The skin and joint capsule of both knee joints of 4-week-old nude rats were opened. One osteochondral defect was created in each knee by drilling a hole 1 mm in diameter and 0.5 mm deep in the femoral groove. A human iPS cell-derived cartilage tissue (one piece) produced in a serum-free medium according to the production method of the present invention was trimmed and transplanted to the defect site. The cartilage tissue used was obtained 105 days after starting the culture in the bioreactor. Post-implantation joint capsule and skin were closed, rats were euthanized and knee samples were collected after 1 and 6 months.

Histological Analysis Knee samples were fixed in 4% paraformaldehyde and embedded in paraffin blocks. Semi-serial sections were prepared and stained with hematoxylin/eosin (HE) or safranin O (safranin O/fast green/iron hematoxylin staining).

Immunohistochemical analysis Paraffin-embedded sections were deparaffinized and antigen-retrieved by incubation in 1 mM EDTA buffer (pH 8.0) at 80°C for 15 minutes. Sections were then treated with 10 mg/ml hyaluronidase for 40 minutes at room temperature. After blocking peroxidase and proteins with a 3% hydrogen peroxide solution in buffer and serum-free proteins, sections were incubated with primary antibodies overnight at 4°C.
The primary antibodies used were mouse anti-COL2 antibody (Thermo Scientific, 1:1000), goat anti-COL1 antibody (Southern Biotech, 1:1500), mouse anti-COL10 antibody (Invitrogen, 1:1000), mouse anti-LUBRICIN antibody (anti PRG4 antibody) (Millipore, 1:500) and rabbit anti-human vimentin antibody (Abcam, 1:200). Primary antibodies were detected using the CSA II Biotin-Free Tyamide Signal Amplification System Kit (Agilent Technologies, CA, USA) and DAB as chromagen. Secondary antibodies conjugated to Alexa Fluor 488 or 546 (Life Technologies, 1:1000) were used for immunofluorescence staining. Fluoroshield Mounting Medium (Abcam) containing DAPI was used. TRAP staining was performed using a TRAP staining kit (Cosmo Bio). BZ-X analyzer (KEYENCE) or ImageJ ver1.51 was used for analysis.

2-2 Results
1 month after transplant
FIG. 5 shows the histological analysis results of knee samples collected one month after transplantation. It was shown that human vimentin-positive human-derived cartilage was filling the defect site. Compared to rat articular cartilage, the transplanted tissue had slightly lower safranin O staining, but the type II collagen was expressed at the same level. Lubricin was expressed in the superficial layer of the graft tissue.

Six months post- implantation Histological analysis of knee samples harvested one month post-implantation are shown in FIGS. It was shown that human vimentin-positive human-derived cartilage was filling the defect site. Compared to rat articular cartilage, the transplanted tissue had at least the same degree of safranin O staining, the same degree of type II collagen expression, and the same low type I collagen expression, and had cartilage characteristics. In addition, lubricin was expressed in the superficial layer of the transplanted tissue, and type X collagen was expressed in the deep layer, and the structure of articular cartilage was acquired.

Claims (7)

A method for producing cartilage tissue from pluripotent stem cells , comprising:
(i) a step of suspension culture in a culture medium in which pluripotent stem cells can be cultured in an undifferentiated state;
(ii) the cells obtained in step (i) are adhered in a serum-free culture medium containing one or more substances selected from the group consisting of BMP2, TGFβ and GDF5 and an HMG-CoA reductase inhibitor; and (iii) culturing the cells obtained in step (ii) above, containing one or more substances selected from the group consisting of BMP2, TGFβ and GDF5 and an HMG-CoA reductase inhibitor, and serum Step of culturing under suspension conditions in a culture medium that does not contain
including
The method, wherein the culture medium used in steps (ii) and (iii) further contains serum albumin, fatty acid, PDGF and cholesterol. 2. The method according to claim 1 , wherein the culture medium used in steps (ii) and (iii) contains BMP2, TGFβ, GDF5 and an HMG-CoA reductase inhibitor and is serum-free. 3. The method of claim 1 or 2 , wherein the HMG-CoA reductase inhibitor is an agent selected from the group consisting of mevastatin, atorvastatin, pravastatin, rosuvastatin, fluvastatin and lovastatin. 4. The method of claim 3 , wherein the HMG-CoA reductase inhibitor is rosuvastatin. 5. The method according to any one of claims 1 to 4 , wherein the step (iii) is a step of subjecting the cells obtained in the step (ii) to suspension culture without using a separation solution. 6. The method according to any one of claims 1 to 5 , wherein the cells obtained in step (i) are in the form of cell aggregates. 7. The method of any one of claims 1-6 , wherein the cartilage tissue is a tissue mass comprising chondrocytes and extracellular matrix.

Images