JP7245164B2 - Highly sensitive and quantitative genetic testing method, primer set, and test kit - Google Patents

Description

Application of Article 30, Paragraph 2 of the Patent Act September 5, 2017 76th Annual Meeting of the Japanese Cancer Society WEB version abstract collection "http://onlinelibrary.wiley.com/doi/10.1111/cas.13499/pdf ” announced.

Application of Article 30, Paragraph 2 of the Patent Act Presented at the 76th Annual Scientific Meeting of the Japanese Cancer Society held at Pacifico Yokohama on September 30, 2017.

The present invention relates to Allele Specific PCR, which not only detects DNAs of different sequences mixed together with ultra-high sensitivity at the same time, but also quantitatively measures them when amplifying genes using PCR. Since the method of the present invention is a PCR that provides quantification in an ultra-sensitive range, it is named Highly Quantitative Allele Specific PCR (HiQASP), and the name will be used hereinafter.

According to HiQASP, differences in DNA methylation, gene mutations, and the like between normal tissue and diseased tissue such as cancer can be examined quantitatively with ultrahigh sensitivity in liquid biopsy, tissue diagnosis, and the like. Here, the detection of nucleic acids present at a rate of 0.1% or less is defined as ultra-high sensitivity, and the detection of nucleic acids present at a rate higher than 0.1% and 5% or less is defined as high sensitivity. .

Elucidation of partial differences in gene sequences is particularly important in medical fields such as congenital anomalies and cancer. Congenital anomalies and cancer caused by differences in gene sequences can be diagnosed definitively and treatment strategies can be established by analyzing gene sequences. Further, by analyzing single nucleotide polymorphisms (SNPs), it is also possible to diagnose future risk factors such as susceptibility to specific diseases and prognosis. In addition to sequence differences, it has been reported that epigenomic abnormalities such as DNA methylation are deeply involved in various diseases such as cancer, metabolic diseases, and psychiatric and neurological disorders. , has become important in the examination of diseases.

In order to apply the differences in gene sequences and epigenomic abnormalities that have been clarified so far to general applications such as clinical examinations, it is essential to have a technology that can easily and reliably detect mutated gene regions. In order to detect differences in gene sequences, next generation sequencing technology (Next Generation Sequencing: NGS) that comprehensively analyzes the entire gene sequence, PCR (Polymerase Chain Reaction) that amplifies and analyzes specific gene regions, etc. technology has been developed.

For example, cancer is a typical disease caused by genetic abnormality. Genetic diagnosis, which reveals genetic abnormalities in cancer, is indispensable not only for diagnosing cancer but also for determining the effects of molecular-targeted drugs in treatment. Genetic diagnosis of cancer has been performed using surgical specimens of cancer tissue or biopsy tissue. In recent years, instead of tissue samples obtained by surgery or biopsy, liquid biopsy testing using body fluid samples such as peripheral blood and urine has been developed and has come to be used clinically (Non-Patent Document 1). .

Liquid biopsy is a cancer-derived DNA contained in body fluid samples circulating tumor DNA (circulating tumor DNA: ctDNA), cancer markers in exome, or blood circulating tumor cells contained in peripheral blood (Circulating Tumor This is a method for definitive diagnosis, prognosis prediction, and selection of treatment methods for cancer by detecting cancer cells called CTC (Cells: CTC). Conventionally, proteins that are specifically increased in body fluid samples of cancer patients have been used as tumor markers, but compared with these, information on genetic changes in cancer cells obtained by gene sequence analysis of ctDNA is highly specific and provides a large amount of information.

If genetic mutations in cancer cells can be detected by detecting ctDNA, appropriate treatment such as the use of molecular-targeted drugs can be performed. If genetic mutations occurring in cancer cells influence the effects of specific molecular-targeted drugs, companion diagnostics, which were conventionally performed on tumor tissue, can also be performed with liquid biopsy. In fact, kits for detecting epidermal growth factor receptor (EGFR) mutations in lung cancer in plasma are covered by health insurance and are used as companion diagnostic agents.

In addition, if treatment with molecular-targeted drugs is continued, new mutations may occur in cancer cells along with the treatment, resulting in resistance. If liquid biopsies can test for new genetic mutations over time, resistance can be detected quickly and treatment can be changed. Compared to conventional biopsies, in which tissue is collected, liquid biopsy places less of a burden on the patient, and can be used repeatedly.

However, body fluid samples used for liquid biopsy contain a large amount of nucleic acids and exomes derived not only from cancer cells but also from normal cells. Therefore, there is a need for a technology that can detect gene mutations in cancer cells with high sensitivity.

In addition, in terms of application to cancer diagnosis and treatment, not only gene mutations but also epigenomic abnormalities that are not accompanied by changes in gene sequences are important causes of canceration (Non-Patent Documents 2 and 3). In particular, if information on abnormal DNA methylation, such as hypermethylation occurring in CpG islands in promoter regions of cancer-related genes, can be obtained, various applications such as early diagnosis and prognosis of cancer can be expected.

A CpG island is a region in which a cytosine (C)-guanine (G) two-nucleotide sequence appears frequently via a phosphodiester bond (p), and is often present in the upstream promoter region of genes. Aberrant DNA methylation of CpG islands is known to be involved in carcinogenesis through the inactivation of tumor suppressor genes, etc., and it has been reported that cancers can be stratified by the degree of CpG island DNA methylation enhancement. (Non-Patent Document 4). However, since liquid biopsy samples contain not only cancer cells but also many normal cells, a highly sensitive detection method is required to obtain DNA methylation information of mixed cancer cells. be. In addition, it is necessary to obtain quantitative test results in order to examine changes in the state of the disease along with the course of treatment.

If a highly sensitive, quantitative, and simple test method is established, liquid biopsy samples can be used for early detection of cancer in medical checkups and mass screenings, as well as for hereditary tumor surveys. It can also be used for recurrence monitoring and companion diagnosis after cancer resection. In addition, as described above, the clarification of partial differences in gene sequences is not only useful in medical fields such as congenital anomalies and cancer, but also important in various fields. For example, highly sensitive and quantitative detection of differences in gene sequences is useful for DNA analysis in criminal investigations, identification of useful genes in agricultural products, identification of production areas, use of food materials derived from genetically modified crops (GMO), specific raw materials (allergens) ), the technology can be applied in many fields such as inspection.

Wan, J.C.M. et al., 2017, Nat. Rev. Cancer, Vol. 17(4), p.223-238. Dawson, M.A., 2017, Science, Vol.355 (6330), p.1147-1152. Garraway, L.A. & Lander, E.S., 2013, Cell, Vol.153 (1), p.17-37. Issa, J.-P., 2004, Nat. Rev. Cancer, Vol.4, p.988-993. Herman, J. G. et al., 1996, Proc. Natl. Acad. Sci. USA, Vol.93, p.9821-9826. Sadri, R. & Hornsby, P.J., 1996, Nucleic Acids Res., Vol.24, p.5058-5059. Xiong, Z. & Laird, P.W., 1997, Nucleic Acids Res., Vol.25, p.2532-2534. Ronaghi, M. et al., 1998, Science, Vol.281, p.363-365. Ronaghi, M., 2001, Genome Res., Vol.11, p.3-11. Huang, W-Y. et al., 2015, Nuc. Acid Res., Vol.43, D857-D861., doi:10.1096/narlgku1151 Gevaert, O. et al., 2015, Genome Biology, 16:17, DOI 10.1186/s13059-014-0579-8 Neidhart, M., 2016. “DNA METHYLATION AND COMPLEX HUMAN DISEASE”, ELSEVIER, p.9-22. Lofton-Day, C. et al., 2008, Clinical Chemistry, Vol.54:2, p.414-423. Grutzmann, R. et al., 2008, PLoS ONE, Vol.3, Issue 11, e3759 Provenzale D, et al., 2016, J. Natl. Compr. Canc. Netw. vol.14 (8), p.1010-1030. Dong A., et al., 2016, J. Cancer, Vol. 7 (11), p.1441-1451. Joosse, S. A. et al., 2010, Genes Chromosomes Cancer, Vol. 50 (2), p.71-81. Turner, N., et al., 2004, Nat. Rev. Cancer, Vol. 4 (10), p.814-819.

U.S. Pat. No. 5,786,146

As described above, there is a demand for highly sensitive and quantitative gene sequence analysis methods in various fields. development is desired. Therefore, development of a test method using simpler PCR is desired. However, even with regard to the method using PCR, a method that is simple, inexpensive, and accurate and quantitative in a high-sensitivity range has not yet been developed.

Ordinary real-time quantitative PCR (qPCR), for example, qPCR using an inexpensive intercalator such as SYBR Green, enables inexpensive and convenient quantitative PCR. However, although it has a wide dynamic range and is suitable for quantification in digits, it cannot quantify with high accuracy. In the field of clinical examination, etc., high sensitivity and precision that can detect differences several times are required.

For example, even if it is limited to DNA methylation abnormalities, it has been clarified that DNA methylation abnormalities are deeply involved in carcinogenesis. It is not widely used clinically as a cancer screening method.

As a method for analyzing methylated DNA, a hydrogen sulfite (bisulfite, bisulfite) reaction is used to determine the difference between unmethylated cytosine amplified by replacing thymine and methylated cytosine amplified as cytosine. Methods for detection by PCR have been developed. Such methods include the Methylation-Specific PCR (MSP) method (Patent Document 1, Non-Patent Document 5, Combined Bisulfite Restriction Analysis (COBRA) method (Non-Patent Documents 6 and 7).

The MSP method and the COBRA method are still widely used methylated DNA analysis methods in that they allow quantitative analysis of methylated DNA without special equipment. However, the use of electrophoresis for analysis and the additional restriction enzyme treatment required by the COBRA method require labor and time, and there is a risk of causing cross-contamination due to diffusion of PCR products. There is

Another methylated DNA analysis method is pyrosequencing (Non-Patent Documents 8 and 9). In this method, a PCR amplification product of bisulfite-treated DNA is subjected to pyrosequencing to detect methylated cytosine substituted with thymine. However, since pyrosequencing requires a dedicated sequencer and is a method of reading bases one by one, there is a problem that analysis takes time.

A highly sensitive, simple, inexpensive, and highly accurate quantitative test method for single-nucleotide mutations by PCR has not been developed so far. In general, when different genes are quantitatively analyzed in the same tube, competitive PCR analysis should be performed. When detecting differences in genetic information within the same region, PCR primers are designed to include a portion that recognizes the difference in sequence, and competitive PCR is performed to amplify different gene sequences while simultaneously competing with each other. . However, for samples in which one sequence is expected to be extremely small, such as sequences derived from cancer cells contained in liquid biopsy samples, highly sensitive PCR amplification is required, resulting in the problem of lack of quantification. was occurring.

If it is possible to amplify genes with different epigenomic information such as gene sequences and DNA methylation in the same tube using PCR and then analyze them without performing sequencing or electrophoresis, it will be a very simple test method. It is also desirable from the point of view of the spread of inspection. However, until now, genes with different gene sequences and different epigenomic information such as DNA methylation in the same region are amplified by PCR in the same tube, and analyzed quantitatively with high accuracy from the high sensitivity range to the ultra-high sensitivity range. there was no way to do it. If different genes in the same region can be amplified by PCR, and the amplified DNA can be separated and quantitatively analyzed, it will be a very simple method.

Digital PCR, a recently developed technique, provides simple and accurate quantification in the high-sensitivity range. However, digital PCR requires expensive dedicated equipment and high running costs. On the other hand, HiQASP can be used not only with widely used real-time PCR equipment, but also with high sensitivity and high precision without using expensive fluorescent probes. Therefore, it can be widely used for general purposes such as clinical examination. Another advantage is that the simple method of changing the ratio of primers enables setting of conditions that bring about high-precision quantification according to the desired sensitivity.

An object of the present invention is to provide a PCR method capable of not only detecting differences in genetic information with ultra-high sensitivity, but also detecting them quantitatively with high accuracy.

The present invention relates to the following methods for highly sensitive and quantitative gene sequence testing, and primer sets and test kits for use in these methods.
(1) A method for examining different gene sequences mixed in the same gene region by PCR, wherein different gene sequences in the same region are simultaneously amplified using two or more primer sets, and the two or more primer sets A method to quantitatively test for the presence of different gene sequences in a sample by amplifying with varying ratios of .
(2) The inspection method according to (1), wherein the presence of different gene sequences in a sample is quantitatively inspected by melting curve analysis.
(3) The test method according to (1) or (2), wherein a primer set for detecting methylated DNA and unmethylated DNA, or wild-type and mutant-type genes is mixed and quantitatively detected. Method.
(4) The inspection method according to any one of (1) to (3), wherein at least one primer of a set of PCR primers is tagged.
(5) The inspection method according to (4), wherein the tag is DNA, RNA, PNA, or LNA.
(6) The inspection method according to (4) or (5), wherein the tag is added to increase the difference in Tm values of PCR products.
(7) The inspection method according to (6), wherein the tag raises the Tm value of the PCR product by at least 2°C.
(8) A PCR primer set used for testing different gene sequences mixed in the same gene region, wherein the PCR product amplified by one set of primers is compared with the PCR product amplified by the other primer set. A primer set characterized by having different Tm values.
(9) A primer set according to (8), wherein the primer set is for quantitatively detecting methylated DNA and unmethylated DNA, or wild-type and mutant genes.
(10) The primer set according to (8) or (9), wherein a tag is attached to the pair of primer sets.
(11) The primer set detects methylated DNA and unmethylated DNA, and quantitatively detects methylated DNA and unmethylated DNA in the promoter region of MLH1, BRCA1, SEPT9, or TSPYL5. The primer set according to (9) or (10).
(12) The primer set according to (11), consisting of the sequences shown in SEQ ID NOs: 3-6, SEQ ID NOs: 9-12, SEQ ID NOs: 20-23, or SEQ ID NOs: 24-27.
(13) A kit for detecting methylated DNA and unmethylated DNA, comprising the primer set according to any one of (8) to (12), PCR amplification reagents, and necessary reagents.

It enables highly sensitive and quantitative analysis of gene sequence differences and epigenomic abnormalities. In particular, it is possible to quantitatively and highly sensitively detect gene mutations and epigenomic abnormalities mixed with normal genes in minute amounts in cancer tissues and liquid biopsy samples.

The figure which shows the example of the melting-curve analysis in MLH1 promoter region analysis. The result of examination by changing the amount of template unmethylated DNA. The figure which shows the example of the melting-curve analysis in MLH1 promoter region analysis. The result of examination by changing the amount of template methylated DNA. FIG. 10 is a diagram showing quantifiable regions according to primer ratios in MLH1 promoter region analysis. FIG. 3(A) shows the calibration curve determined from the melting curve analysis shown in FIG. 1, and FIG. 3(B) shows the calibration curve determined from the melting curve analysis shown in FIG. The figure which shows the example of the melting curve analysis in BRCA1 promoter region analysis. The result of examination by changing the amount of template unmethylated DNA. The figure which shows the example of the melting curve analysis in BRCA1 promoter region analysis. The result of examination by changing the amount of template unmethylated DNA. The figure which shows the example of the melting curve analysis in BRCA1 promoter region analysis. The result of examination by changing the amount of template methylated DNA. FIG. 10 is a diagram showing quantifiable regions based on primer ratios in BRCA1 promoter region analysis. Figure 7 (A) is the calibration curve obtained from the melting curve analysis shown in Figure 4, Figure 7 (B) is the calibration curve obtained from the melting curve analysis shown in Figure 5, Figure 7 (C) , shows the calibration curve determined from the melting curve analysis shown in FIG. FIG. 4 shows a study of changes in the Tm value depending on the length of the tag attached to the primer. The figure which shows the detection result of methylation of SEPT9 in colorectal cancer and breast cancer DNA. The figure which shows the detection result of the methylation of TSPYL5 in colorectal cancer and breast cancer DNA.

A method for detecting DNA methylation abnormalities among epigenomic abnormalities in cancer cells is mainly described below. Needless to say, types and the like can be similarly detected with high sensitivity. In addition, as described above, it is possible to detect genes quantitatively and with high sensitivity in samples containing a mixture of genes with different sequences, such as various DNA tests, genetically modified crops and allergen tests in the agricultural field. can.

Genes reported to have abnormal DNA methylation in cancer include MethHC (A database of Methylation and gene expression in Human Cancer, http://methhc.mbc.nctu.edu.tw/php/index.php). A number of genes have been reported, including the genes listed (eg, Non-Patent Documents 10-12). DNA methylation abnormalities in these genes can be detected by HiQASP.

Furthermore, it has been reported that SEPT9 is specifically methylated in colorectal cancer (Non-Patent Documents 13 and 14), and diagnostic agents for detecting methylation of SEPT9 DNA in blood are commercially available. In addition, it has been reported that genes such as TAC1, EYA4, TMEFF2, NGFR, ADAMTS2, ADAMTS16 and TSPYL5 are also methylated in colon cancer. Colorectal cancer can also be specifically detected by detecting methylation of these genes.

It can also be applied to detect treatment-resistant mutations caused by molecular targeted drugs such as EGFR tyrosine kinase inhibitors (EGFR-TKI).

HiQASP is a method for performing quantitative analysis by changing the ratio of primers when different gene sequences are amplified as PCR products with different base compositions or chain lengths using two or more sets of primers. Here, the method of amplifying PCR products with different Tm values and quantifying them by melting curve analysis will be mainly described. Separate analysis is also possible.

The Tm value (melting temperature) is defined as the temperature at which 50% of the double-stranded nucleic acid is melted by heating. If the amplified PCR products have different Tm values, the PCR products can be quantitatively analyzed by melting curve analysis. Therefore, any PCR instrument capable of performing melting curve analysis may be used. For example, the abundance ratio of amplified PCR products can be quantified using melting curve analysis software attached to real-time PCR equipment. Any melting curve analysis software attached to the real-time PCR instrument may be used. As shown in the examples, the present method only requires melting curve analysis of the obtained PCR product, and does not require subsequent analysis by electrophoresis, sequencing, etc., so it is not only convenient, but also prevents contamination. It has the advantage of being risk-free.

In the high-sensitivity quantitative PCR method described below, the optimal quantification range can be adjusted by performing PCR with different primer ratios. Therefore, even a quantitative difference of several percent can be detected. Compared to the real-time quantitative PCR method, which has a wide dynamic range and can quantify large differences over a wide range, even small differences can be detected. Also, compared to conventional competitive PCR methods, it can provide quantification in the high-sensitivity region.

In addition, although the digital PCR method is a quantitative and highly sensitive detection method, it cannot detect the generation of unintended PCR products. HiQASP can detect the production of unintended PCR products by detecting products with different Tm values by melting curve analysis. Therefore, it is possible to confirm whether the obtained results are accurate. DNA from tissues or liquid biopsy samples are likely to contain various contaminants. Therefore, it is important to be able to verify that the results obtained reflect the mutation of interest. Moreover, since it is not necessary to use internal probes to increase specificity, there is the advantage that additional costs are not required.

1. DNA Extraction Method In this example, DNA incorporated into a plasmid was used as a template for the model experiment, but in reality, nucleic acids extracted from all sorts of things such as clinical samples such as blood and tissues, and agricultural products can be used. A DNA extraction method assuming liquid biopsy using a blood sample will be described below, but biopsy tissue samples and other samples can also be purified and analyzed according to this method.

NucleoSnap (trademark) DNA Plasma kit (Macharei Nagel), EZ1 ccfDNA kit (Qiagen), and MagMAX Cell-Free DNA Isolation kit (Thermo Fisher Scientific) were used to extract fresh EDTA blood samples. Peripheral blood circulating DNA (Cell free DNA; cfDNA) was extracted and purified. The above kit is an example, and any similar kit may be used.

2. PCR
The StepOne & StepOnePlus™ real-time PCR system (Thermo Fisher Scientific Co., Ltd.) is used here as the PCR device for melting curve analysis, but any similar device may be used. can be analyzed. Such devices include, for example, LightCycler™ 480 system (Roche Diagnostics Co., Ltd.), Thermal Cycler Dice™ Real Time System III (Takara Bio Inc.), CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.). It is an advantage of this inspection method that it is possible to use devices that are already in widespread use.

Reagents used for PCR amplification include MeltDoctor (trademark) HRM Master Mix, Fast SYBR (trademark) Green Master Mix, PowerUpSYBR (trademark) Green Master Mix, Luminaris Color HRM Master Mix (these are Thermo Fisher Scientific Co., Ltd.), KAPA HRM FAST PCR Kit (KAPABIO SYSTEMS), SsoFast EvaGreen Supermix (Bio-Rad Laboratories, Inc.) and the like can be used.

In the following examples, the primers of one primer set are tagged in order to widen the difference in Tm value between two sets of PCR products to be amplified. A tag may be attached to either the Forward or Reverse primer, or in some cases to both.

Any tag may be used as long as it causes a difference in Tm value and does not inhibit hybridization with the target nucleic acid. Specifically, DNA, RNA, PNA (peptide nucleic acid), LNA (Locked nucleic acids) using nucleotide analogs, and the like can be used. In addition, if the Tm values of the sequences of two PCR products to be amplified are significantly different and can be separated by melting curve analysis, primers can be designed without tagging.

It is essential that the Tm values of the amplified PCR products are capable of peak separation in melting curve analysis, but there is preferably a difference of at least 2°C or more, preferably 3°C or more, more preferably 5°C or more. . Also, depending on the peak shape and required sensitivity in melting curve analysis, the difference is preferably 6°C or more, more preferably 7°C or more.

3. Method for detecting DNA methylation In order to detect abnormal DNA methylation by PCR, as described above, it is preferable to use a method of treating DNA with bisulfite (sodium hydrogen sulfite) and utilizing base substitution. Bisulfite treatment generally converts the cytosine base (C) to a thymine base in DNA, but not the methylated modified cytosine base at the 5-position carbon. It makes a difference in the gene sequence.

For bisulfite treatment, the purified DNA is treated with EpiTect Bisulfite kit (Qiagen), EZ DNA Methylation kit (ZYMO RESEARCH), MethylEasy (trademark) Xceed Rapid DNA Bisulphite Modification kit (Human Genetic Signatures), or the like. bisulfite conversion of C is performed. If C in the DNA sequence is unmethylated, deamination converts it to a uracil (U) base, and if C is methylated at position 5, no conversion to U occurs. Subsequent PCR replaces the U position with a thymine base (T) and thus a C to T conversion is observed.

Aberrant DNA methylation often occurs in extensive regions where CpG sequences are present. Therefore, since the surrounding CpG sequences are usually abnormal at the same time, both Forward and Reverse primers can be set on the sequence where DNA methylation is abnormal. As a result, it is possible to detect aberrantly methylated DNA mixed at 0.01% or less. Therefore, DNA methylation abnormalities can be quantified with very high sensitivity compared to gene mutations such as point mutations. In general, different sequences can be detected with high sensitivity by designing the primers so that the different base sequences are included at the positions one to several bases from the 3' side of the primers.

4. EXAMPLES The present invention will be described in more detail with reference to Examples, but it is needless to say that various mutations other than those shown in Examples can be detected as described above.

[Example 1] Analysis of MLH1 promoter region MLH1 is one of a group of proteins that work in the mismatch repair system, and has been identified as a causative gene of Lynch syndrome along with MSH2, MSH6, and PMS2. Lynch syndrome is one of hereditary tumors, and patients with it are known to frequently develop colon cancer, endometrial cancer, and the like (Non-Patent Document 15). A germline mutation in the MLH1 gene is found in Lynch syndrome patients. On the other hand, about 5-10% of sporadic colorectal cancers have abnormalities in the MLH1 gene, which is associated with acquired aberrant methylation in the promoter region, and it is clinically important to distinguish between the two. is.

Aberrant methylation of the MLH1 promoter region has been extensively analyzed due to its association with Lynch syndrome. Therefore, a region in which hypermethylation occurs in the MLH1 promoter region was synthesized as a template. When treated with bisulfite, methylated cytosines remain cytosines, whereas unmethylated cytosines are converted to uracils, which are further replaced by thymines in the PCR stage and amplified. Therefore, as a template sequence for experimental analysis of methylation/non-methylation, an oligo DNA was synthesized using a sequence in which cytosine was replaced with thymine as a template for the non-methylation sequence.

An oligo DNA is synthesized together with a complementary strand, and after making a double strand, it is incorporated into a plasmid and transformed into E. coli. After confirming the sequence by sequencing, the plasmid DNA is used as a template in the following experiments. As a primer set for amplifying the plasmid, primers with the following sequences were used.

(a) Artificial gene template Unmethylation template sequence (SEQ ID NO: 1, L1_162nt_Um), methylation template sequence (SEQ ID NO: 2, L1_162nt_Met), promoter region (NG_007109.2, positions 4,860 to 5,021) 162 nt of each were prepared separately as artificial genes, and those mixed at various ratios were used as templates for amplification. In both the methylation template sequence and the unmethylation template sequence, artificial genes were created by replacing all sequences in which cytosine was replaced with thymine by bisulfite treatment. All gene sequences below are written in the direction from 5' to 3'.

Template sequence for unmethylation: GGTATTTTTGTTTTATTGGTTGGATATTTTGTATTTTTTGAGTTTTTTAAAATGAATTAATAGGAAGAGTGGATAGTGATTTTTAATGTGTAAGTGTATATTTTTTTAGGTAGTGGGTAGTAGTTGTTTTTAGGGAGGGATGAAGAGATTTAGTA (sequence number 1)
Template sequence for methylation: GGTATTTTTGTTTTATTGGTTGGATATTTCGTATTTTTCGAGTTTTTTAAAACGAATTAATAGGAAGAGCGGATAGCGATTTTTAACGCGTAAGCGTATATTTTTTTAGGTAGCGGGTAGTAGTCGTTTTAGGGAGGGGACGAAGAGATTTAGTAGTAGTAG (sequence number 2)

In addition, a primer set (SEQ ID NOS: 3 and 4) for detecting unmethylated sequences and a primer set (SEQ ID NOS: 5 and 6) for detecting methylated sequences were synthesized. A tag sequence was added to the forward primer for methylation sequence detection, and designed to widen the difference in the Tm values of the PCR products.

(b) Primer set L1_U_F1 for detecting unmethylated sequences: GAATTAATAGGAAGAGTGGATAGT (SEQ ID NO: 3)
L1_U_R3: TCTTCATCCCTCCCTAAACA (SEQ ID NO: 4)
(c) Primer set L1_M_F1 for detecting methylated sequences: ccccccccccgccccTAATAGGGAAGAGCGGATAGC (SEQ ID NO: 5)
L1_M_R3: TCGTCCCTCCCCTAAACG (SEQ ID NO: 6)

In the primer set, F indicates Forward primer and R indicates Reverse primer. Also, U indicates a primer for detecting an unmethylated sequence, and M indicates a primer for detecting a methylated sequence. Also, lower case letters indicate tag sequences.

A primer set in which equal amounts of L1_U_F1 and L1_U_R3 are mixed is used for analysis as an unmethylated sequence detection primer set (FR_U of MLH1), and a primer set in which equal amounts of L1_M_F1 and L1_M_R3 are mixed is used as a methylation sequence detection primer set (FR_M of MLH1). board. Each primer set will amplify the promoter region from position 4,914 to 5,005 of NG — 007109.2 for unmethylated DNA and from position 4,918 to 5002 for methylated DNA.

Forward and reverse primers for detecting unmethylated and methylated DNA were adjusted to have a constant concentration. PCR was performed and analyzed by changing the quantitative ratio of the unmethylated DNA detection primer to the methylated DNA detection primer. Even when amplified at different quantitative ratios, the forward and reverse primer concentrations were set to 0.15 μM on average, ie, the total concentration of the four types of primers was 0.6 μM.

MeltDoctor (trademark) HRM Master Mix (ThermoFisher) was used as a PCR reagent, and StepOnePlus (Thermo Fisher Scientific Co., Ltd.) was used as a PCR device. PCR conditions and melting curve analysis conditions are as follows. A melting curve analysis is automatically performed immediately after PCR amplification.

PCR conditions: 95 ° C., 10 minutes → (95 ° C., 10 seconds → 59 ° C., 25 seconds) 45 cycles Melting curve analysis conditions; 95 ° C., 15 seconds → 65 ° C. 1 minute to 85 ° C. (15 seconds), ramp rate Set to 0.3% and analyzed.

In FIG. 1, the mixture ratio of unmethylated (FR_U) and methylation detection primer set (FR_M) is set to 7:1, 5:1, and 3:1, and the ratio of unmethylated sequence DNA to template DNA is set to 0. , 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 25, 50, 75, 90, 100%. The mixing ratio of FR_U and FR_M was 1:3, 1:2, 1:1, and the proportion of DNA for methylation sequence in template DNA was 0, 0.001, 0.005, 0.01, 0.05, 0. 1, 0.5, 1, 5, 10, 25, 50, 75, 90, and 100%, PCR amplification was performed, and the results of melting curve analysis are shown. The X-axis indicates the temperature, and the Y-axis indicates the Derivative reporter (-R') value. The results of analysis performed in duplicate are shown.

The template mixing ratio indicates that each well contains the number of molecules of each template DNA shown in Table 1. By performing PCR by changing the mixing ratio of the primers, as shown in FIGS. It can be said that this is a highly sensitive detection method.

FIG. 3 shows the results of the above-mentioned melting curve analysis, in which the unmethylated and methylated PCR products were quantified and analyzed for quantification. FIGS. 3(A) and 3(B) are diagrams plotting the results of the melting curve analysis of FIGS. 1 and 2, respectively. The maximum value of the peak near 78°C is taken as the value of the methylated DNA, and the maximum value of the peak around 71°C as the value of the unmethylated DNA PCR product. 74 ° C., which is the temperature stably showing horizontality, is subtracted as a background, and the sum of the Derivative reporter (-R') values of both methylated and unmethylated peaks is taken as 100%, and the template DNA concentration It shows the correlation. Duplicate analysis results were combined into one, and an approximated curve was created by calculating the average value of the duplicate results.

All ^R2 values were greater than or equal to 0.95 and correlated very well with the template concentration, indicating a quantitative analysis. In particular, in the data for unmethylated template sequence DNA with a primer ratio of 7:1 (see Fig. 1) and in the data for methylated template sequence DNA with a primer ratio of 1:3 (see Fig. 2), both of the less template It was confirmed that even if the amount of DNA contained was as low as 0.001%, it could be detected with good quantification by changing the ratio of the primers.

As shown in FIG. 3, the present inventors found that optimizing the primer ratio enabled quantification in the ultra-high sensitivity region. In addition, HiQASP is a simple, inexpensive, and rapid method because it can automatically analyze and quantify the PCR product while it is installed in the same device without taking out the PCR product by using melting curve analysis.

[Example 2] Analysis of BRCA1 promoter region BRCA1 is one of tumor suppressor genes and is a gene identified as a causative gene for familial breast cancer. It is known to cause genetic instability and cause breast and ovarian cancer. Mutations in BRCA1 are rarely observed in sporadic breast cancer, and it is known that hypermethylation of the promoter region of the BRCA1 gene results in decreased expression of the BRCA1 protein (Non-Patent Documents 16 to 18). Recently, genetic testing for BRCA1 has attracted attention as a companion diagnostic for PARP inhibitors, which are molecular target drugs. It would be of great clinical significance if the indication of PARP inhibitors was expanded not only to germline pathogenic mutations but also to methylation cases in the promoter region as a diagnosis of BRCA1 dysfunction.

In the same manner as in Example 1, oligo-DNA was synthesized using, as a template, an unmethylated sequence in which cytosine was replaced with thymine. A complementary strand was synthesized in the same manner as in Example 1, incorporated into a plasmid, and used as a template after confirming the sequence by sequencing.

(a) Artificial gene template As a template sequence for unmethylation (SEQ ID NO: 7, B1_157nt_Um) and a template sequence for methylation (SEQ ID NO: 8, B1_157nt_Met), the promoter region (positions 92,508 to 92,664 of NG_00005905.2) 157 nt of each were synthesized and mixed at various ratios and used as templates for amplification.

A primer set (SEQ ID NOS: 9 and 10) for detecting unmethylated sequences and a primer set (SEQ ID NOS: 11 and 12) for detecting methylated sequences were synthesized. A tag sequence was added to the forward primer for detecting the methylated sequence, and was designed to widen the difference in Tm value of the PCR product.

非メチル化用鋳型配列：ＧＡＴＴＴＴＧＴＡＴＴＴＴＧＡＧＡＧＧＴＴＧＴＴＧＴＴＴＡＧＴＧＧＴＡＧＴＴＴＴＴＴＧＧＴＴＴＴＴＧＴＧＧＴＡＡＴＧＧＡＡＡＡＧＴＧＴＧＧＧＡＡＴＴＡＴＡＧＡＴＡＡＡＴＴＡＡＡＡＴＴＧＴＧＡＴＴＧＴＧＴＧＧＴＧＴＧＡＧＴＴＴＧＴＴＧＡＧＡＴＴＴＴＴＴＧＧＡＴＧＧＧＧＧＡＴＡＧＧＴＴＧＴＧＧＧＧＴＴＴＴＴＴＡＧＡＴ（配列番号７）
Template sequence for methylation: GATTTCGTATTTTGAGAGGTTGTTGTTTAGCGGTAGTTTTTTGGTTTTCGTGGTAACGGAAAGCGCGGGAATTATAGATAAATTAAAATTGCGATTGCGCGGCGTGGAGTTCGTTGAGATTTTTTTGGACGGGGATGATAGGTTGTGTGTGTGTGTGTGTGTGTGTG8 (sequence number)
(b) Primer set B1_U_F4 for detecting unmethylated sequences: TTTTTTGGTTTTTGTGGTAAT (SEQ ID NO: 9)
B1_U_R2: AAATCTCACAAAACTCACA (SEQ ID NO: 10)
(c) Primer set B1_M_F4 for detecting methylated sequences: gccgccgccgccgccTTTGGTTTTTCGTGGTAAC (SEQ ID NO: 11)
B1_M_R4: AATCTCAACGAACTCACG (SEQ ID NO: 12)

Each primer set will amplify the promoter region from positions 92,544 to 92,630 of NG_005909.2 for unmethylated DNA and from positions 92,547 to 92,628 for methylated DNA. As in Example 1, lowercase letters indicate tag sequences.

As in Example 1, the forward and reverse primers for detecting unmethylated and methylated DNA were adjusted to have a constant concentration. PCR was performed by changing the quantitative ratio of the unmethylated DNA detection primer and the methylated DNA detection primer and analyzed. The results shown in FIGS. 4 and 6 show that the forward and reverse primer concentrations were adjusted to an average of 0.15 μM when mixed at any ratio, and the results shown in FIG. 5 were 0.225 μM. I am doing the analysis in this way.

The results shown in FIGS. 4 and 6 were obtained using the same PCR conditions as in Example 1. The results shown in FIG. 5 are the results of analysis using the following PCR conditions.
PCR conditions: 95°C, 10 minutes → (95°C, 15 seconds → 61°C, 25 seconds) 45 cycles Melting curve analysis conditions: 95°C, 15 seconds → 68°C 1 minute to 85°C (15 seconds), ramp rate Set to 0.3% and analyzed.

Figure 4 shows the unmethylated (FR_U) and methylated detection primer set (FR_M) at a mixture ratio of 6:1, 4:1, and 3:1, and Figure 5 shows a mixture ratio of 10:1 and 7:1. 1, 3: 1, and the proportion of unmethylated DNA in the template DNA is 0, 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 25 , 50, 75, 90 and 100%, FIG. 001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 25, 50, 75, 90, 100% PCR amplification and melting curve analysis Here are the results. The results of analysis performed in duplicate are shown.

FIG. 7 shows the results of the melting curve analysis, which was performed in the same manner as in Example 1, by quantifying the non-methylated and methylated PCR products and analyzing whether there is quantification. Figures 7(A), (B) and (C) are diagrams plotting the results of the melting curve analysis of Figures 4, 5 and 6, respectively. The maximum value of the peak near 81°C is the value of the methylated DNA, and the maximum value of the peak near 71.5°C is the value of the unmethylated DNA PCR product, and the Tm values of the methylated and unmethylated PCR products. A value of 74° C., which is the temperature showing a stable horizontality between the two, is subtracted as background. All ^R2 values are 0.90 or more, and 0.95 or more except for 3 graphs, showing a strong correlation with the template concentration, indicating that the analysis is quantitative. In addition, when the unmethylated sequence was used as the template DNA, the primer ratio was 10:1 (FR_U:FR_M), and when the methylated sequence was used, the primer ratio was 1:2, resulting in a very small amount of 0.001%. The missing template DNA could be detected quantitatively.

[Example 3] Examination of PCR primers By using PCR primers, it is possible to amplify and separate PCR products having different Tm values even in the same region. Therefore, the Tm value and the separation of peaks were investigated. By adding a tag to the forward primer for methylation detection, it was designed so that products with greatly different Tm values would be amplified. Although the tag is attached to the forward primer for methylation detection here, it may be attached to the reverse primer. The PCR primers of SEQ ID NOs: 13 to 19 shown below are designed to increase the Tm value of the PCR product amplified from the template DNA for methylation detection by increasing the length of the tag. Lower case letters indicate tag sequences. The following sequences were used as primers.

L1_M_F2: ccccTAATAGGAAGAGCGGATAGC (SEQ ID NO: 13)
L1_M_F3: ccgccccTAATAGGAAGAGCGGATAGC (SEQ ID NO: 14)
L1_M_F4: cccccgccccTAATAGGAAGAGCGGATAGC (SEQ ID NO: 15)
L1_M_F5: ccccccccgccccTAATAGGAAGAGCGGATAGC (SEQ ID NO: 16)
L1_M_F1: ccccccccccgccccTAATAGGAAGAGCGGATAGC (SEQ ID NO: 5)
L1_M_F6: cccccccgccccccccTAGGAAGAGCGGATAGCG (SEQ ID NO: 17)
L1_M_F7: ccccccccccgcccccATAGGAAGAGCGGATAGCG (SEQ ID NO: 18)
L1_M_F8: ccccccccgccccccccccGAAGAGCGGATAGCGA (SEQ ID NO: 19)

In addition, L1_U_F1 (SEQ ID NO: 3) was used as the forward primer for unmethylation detection, L1_U_R3 (SEQ ID NO: 4) as the reverse primer, and L1_M_R3 (SEQ ID NO: 6) as the reverse primer for methylation detection.

Template DNA for methylation detection was obtained by mixing equal amounts of EpiScope™ Methylated HCT116 gDNA, which is DNA derived from cell line HCT116, and EpiScope™ Unmethylated HCT116 DKO gDNA (Takara Bio Inc.), each treated with bisulfite. Using. PCR was performed under the same conditions as in Example 1 with a primer ratio of 1:1. The results are shown in FIG.

Since the template DNA used in Example 3 is cell line-derived DNA, it contains sequences of other regions of the human genome, like clinical materials. Therefore, it is an analysis under conditions very similar to clinical materials such as liquid biopsy. It shows that methylation and non-methylation can be clearly distinguished and detected even when a large amount of DNA in other regions is contained.

Even though the difference in Tm values is as close as 3.8° C. (FIG. 8, L1_M_F2 primer), both methylated and unmethylated peaks are separated and it is possible to calculate the ratio. When the peak shape of the melting curve is sharper, even a difference of about 2° C. can be sufficiently distinguished and quantified.

The greater the difference in the Tm values of the amplified PCR products, the easier it is to distinguish between the two peaks. However, the lengthening of the tag sequence may affect the efficiency of PCR amplification and may cause problems in quantification. In general, if the difference in Tm value between amplified PCR products is about 4°C to 10°C, ultrahigh sensitivity and quantitative analysis can be performed.

Since the DNA analyzed by HiQASP has a difference in the sequence itself of the template DNA, it is possible to quantitatively detect the Tm value even without attaching a tag in some cases. However, tagging can increase the Tm value of the PCR product and ensure peak separation, regardless of the template sequence.

[Example 4] Detection of colorectal cancer by methylation (SEPT9)
The number of patients and the number of deaths from colorectal cancer are increasing year by year. Colorectal cancer screening consists of primary screening with a fecal occult blood test in asymptomatic populations, and in those with high suspicion of colorectal cancer, diagnosis is often made using colonoscopy. However, the fecal occult blood test has many false positives and false negatives, and it is difficult to say that it is a reliable test.

In recent years, it has become clear that SEPT9 (Septin9) is highly methylated in colorectal cancer patients. A liquid biopsy test for detecting colorectal cancer by detecting methylation of SEPT9 in blood has already been approved by the FDA (US Food and Drug Administration).

Therefore, HiQASP was used to examine whether the methylation of SEPT9 can be detected using DNA from colorectal cancer patients. The samples used were colon cancer-derived DNA commercially available from BioChain, and breast cancer-derived DNA and healthy human peripheral blood-derived DNA for comparison.

The primer sequences used are shown below.
(a) Primer set S3R_U_f1 for detecting unmethylated sequences: AGTTTAGTATTTTATTTTTGAAGTTT (SEQ ID NO: 20)
S3R_U_r1: CCATCATATCAAACCCCA (SEQ ID NO: 21)
(b) Primer set S3R_S15M_f1 for detecting methylated sequences: gccgccgccgccgccTTTAGTATTATTTTTCGAAGTTC (SEQ ID NO: 22)
S3R_M_r1: CATCATATCGAACCCCCG (SEQ ID NO: 23)

PCR conditions: 95 ° C., 10 minutes → (95 ° C., 15 seconds → 55 ° C., 30 seconds) 45 cycles Melting curve analysis conditions; 95 ° C., 15 seconds → 65 ° C. 1 minute to 88 ° C. (15 seconds), ramp rate Set to 0.3% and analyzed.

With each primer set, the unmethylated DNA detection primer set is a human genome standard sequence (UCSC genome reference hg19) chr17: 75, 369, 575 to 75, 369, 648 74 bp methylated region converted to bisulfite The primer set for DNA detection will amplify the 71 bp CpG site of chr17: 75,369,576 to 75,369,646 in which cytosine is methylated and bisulfite converted.

FIG. 9 shows the results of analysis at a ratio of 1:1.5 between the primer set for unmethylation detection and the primer set for methylation detection. Methylated SEPT9 promoter region DNA was detected in all 39 amplifiable cases among 40 cases of commercially available colorectal cancer DNA (indicated by CT in the figure). On the other hand, in the peripheral blood DNA of healthy subjects (indicated by BN in the figure), only unmethylated DNA was detected in all eight cases, and methylated DNA was not detected. In addition, some breast cancer DNAs (indicated by BT in the figure) were detected to be methylated and some were not. Therefore, the methylation of the promoter region of SEPT9 is considered to differ depending on the cancer type, and to be specifically methylated in colorectal cancer. Therefore, by using HiQASP, it is possible to detect the methylation of SEPT9 more simply and with high accuracy.

[Example 5] Detection of colorectal cancer by methylation (TSPYL5)
Furthermore, TSPYL5 was also analyzed in the same manner. TSPYL5 is a gene for which aberrant DNA methylation has not been reported for colorectal cancer.

The template sequences and primer sequences used are shown below.
(a) Primer set T1_U_f2 for detecting unmethylated sequences: GATGTTAGTTTTTGGTTGGGATTGAGT (SEQ ID NO: 24)
T1_U_r2: CCAAACACATCACATCCTCTCACA (SEQ ID NO: 25)
(c) Primer set T1_C15M_f2 for detecting methylated sequences: ccccccccccccccccTTTCGGTCGGGATCGAGC (SEQ ID NO: 26)
T1_M_r2: GCATCACGTCCTTCCGCG (SEQ ID NO: 27)

In addition, it is as under PCR conditions and melting curve analysis conditions.
PCR conditions: 95 ° C., 10 minutes → (95 ° C., 10 seconds → 54 ° C., 15 seconds → 60 ° C., 10 seconds) 45 cycles Melting curve analysis conditions: 95 ° C., 15 seconds → 60 ° C. 1 minute to 95 ° C. (15 seconds ), set the ramp rate to 0.3% and analyze.

With each primer set, unmethylated DNA is a human genome standard sequence (UCSC genome reference hg19) chr8: 98,290,122 to 98,290,221 100 bp bisulfite converted region, methylated DNA is chr8: The cytosine at the 85 bp CpG site from 98,290,131 to 98,290,215 is methylated and will amplify the bisulfite converted region.

The results are shown in FIG. The ratio of unmethylated primers to methylated primers was 1:1. Methylation of TSPYL5 DNA was detected in all 23 amplifiable cases among 24 commercially available colon cancer DNA (CT) cases. On the other hand, almost no methylated DNA was detected in breast cancer DNA (BT), and only unmethylated DNA was detected in all 8 cases of normal peripheral blood DNA (BN), and no methylated DNA was detected.

As shown above, it is possible to detect genes with different sequences with very high sensitivity by setting the Tm values of the PCR products to be different for each gene and analyzing the melting curves. Since DNA methylation or non-methylation can be detected with high sensitivity in a short period of time as shown in the examples, it can be applied to liquid biopsy and used for diagnosis of cancer and the like. Moreover, since it is possible to detect not only DNA methylation but also DNA with a sequence difference of several bases, it can be applied to various fields.

Claims (11)

A method for examining methylated DNA mixed in the same gene region by PCR,
A set of two or more sets of primers with different sequences designed to contain different parts of the base sequences at the 3′ positions of the primers , wherein at least one set of primers is tagged so that the Tm values are different. simultaneously amplifying different gene sequences in the same region using the set ;
A method of quantitatively inspecting the presence of methylated DNA in a sample by amplifying the two or more sets of primer sets at different quantitative ratios. The inspection method according to claim 1, wherein by melting curve analysis,
A method to quantitatively examine methylated DNA by the presence of different gene sequences in a sample. The inspection method according to claim 1 or 2,
A testing method in which primer sets for detecting methylated DNA and unmethylated DNA are mixed and quantitatively detected. the tag is
2. The test method according to claim 1, wherein the test is DNA, RNA, PNA, or LNA. 2. The inspection method according to claim 1 , wherein said tag is added to increase the difference in Tm values of PCR products. 6. The test method according to claim 5 , wherein the tag raises the Tm value of the PCR product by at least 2[deg.]C. A PCR primer set used for testing methylated DNA mixed in the same gene region,
Designed so that the 3' position of the primer contains a different part of the base sequence,
A primer set characterized in that a PCR product amplified by one set of primers differs in Tm value from a PCR product amplified by another primer set having a different sequence due to a tag attached thereto. The primer set according to claim 7 ,
A primer set for quantitative detection of methylated DNA and unmethylated DNA. The primer set is a primer set for detecting methylated DNA and unmethylated DNA,
9. The primer set according to claim 8 , which quantitatively detects methylated DNA and unmethylated DNA in the promoter region of MLH1, BRCA1, SEPT9, or TSPYL5. 10. The primer set according to claim 9, consisting of the sequences represented by SEQ ID NOs: 3-6, SEQ ID NOs: 9-12, SEQ ID NOs: 20-23, or SEQ ID NOs: 24-27. A kit for detecting methylated DNA and unmethylated DNA, comprising the primer set according to any one of claims 7 to 10, PCR amplification reagents, and necessary reagents.

Images