JP7128509B2 - Channel chip for detecting plant substances. - Google Patents

Description

The present invention relates to a channel chip, a plant substance detection device, a plant substance detection method, a plant state determination method, and the like.

The growth of plants is inhibited by environmental stress such as nutrient deficiency and microbial infection. Leaving such environmental stress unattended leads to a decrease in crop productivity, so, for example, in cultivation sites, there is often a tendency to excessively apply fertilizers containing nutrients such as phosphorus. However, the excessive supply of fertilizer increases production costs and can lead to environmental burdens such as soil contamination. It is desirable to apply the appropriate amount of nutrients at the appropriate time while grasping the state of the plant, taking into account the presence or absence of

In addition, during the growth process, plants experience phenomena important for harvesting crops, such as growth and enlargement of stems and trunks, flowering and fruiting, fruit growth, and growth of roots such as tubers and tuberous roots. By grasping the forecast of the timing of these phenomena in advance, it is possible to optimize the timing and amount of fertilization and pesticide application, improve the production process, improve the completion and quality of crops, and reduce production costs. can be reduced. In addition, by grasping in advance the outlook for the timing of plant development and physiological phenomena, it is possible to artificially change and adjust the timing of each phenomenon by adjusting cultivation methods. It is possible to appropriately control the distribution volume of products and to appropriately match the growth stage of plants to the weather conditions of the year, so that safer and more effective agricultural production can be realized.

Patent Literature 1 discloses a technique for ascertaining the lack of nutrients by using changes over time in the outer diameter of plant stems, fruits, and the like as indicators. However, with this technique, it takes time to measure changes over time, and it is difficult to make a detailed diagnosis of which component among various nutritional components is lacking and how much. In addition, since the diagnosis is based on the fact that the morphological change in appearance has actually become apparent, it is impossible to avoid the damage to the crops that has been suffered by that time. In diagnosing the state of crops, there is a concern that, at production and cultivation sites, if, for example, some kind of damage is visually confirmed and then dealt with, it will be a reactive action, and the problem will not be solved. On the other hand, when such a visually impaired state is embodied, changes in biomolecule production rate and product accumulation, such as gene expression (RNA and protein) and metabolic changes, may occur in vivo before embodied. possible in principle. Information on such biomolecular groups can serve as biomolecular markers applicable to plant condition diagnosis. In diagnosing the state of a plant, it is desirable to grasp the biomolecular information as described above in a silent state in which diagnosis and judgment cannot be made visually. A technique that can appropriately deal with latent factors or prevent them in advance is desired.

In addition, with the recent rise of genome analysis and omics analysis, and the development of data analysis technology, it is thought that biomolecular and signal molecule information that link environmental factors and crop traits will be accumulated more and more in the future. Simple information detection technology can be a technology that leads to technological sophistication in various agricultural situations. In addition, biomolecular information can be useful information in breeding and breeding, and the technology to easily access it can be used in combination with selective breeding, and is positioned between conventional genotyping and phenotyping. It can be a new screening technology. From these points of view, it is not a general omics analysis that simply exhaustively identifies in vivo information, but a simple and efficient access to the number and amount of biomolecular information that meets the need/needs each time. A technology that can be used and collected is desired.

Existing biomolecule detection techniques include, for example, the RT-PCR method for detecting and quantifying miRNA and mRNA. Although the RT-PCR method has high sensitivity and high reliability, it requires a time-consuming cyclic amplification step in the detection process. In addition, in microarrays used for high-throughput detection of nucleic acids and proteins, the binding of targets and solid-phase probes is performed by free diffusion, so the reaction takes time and a large number of spots (all probe solid-phase sites) are produced. Analysis of low-dose samples is difficult because the sample needs to be spread over a large area. Furthermore, RNA sequencing enables high-throughput analysis of all transcripts, and has the advantage of being able to detect polymorphisms and minor mutations in novel target RNAs and similar molecules, but is expensive. , requires complicated sample pretreatment and adjustment. All of the above technologies require dedicated installation equipment and are premised on use at the laboratory level. Although there is a report on miRNA detection using a microfluidic chip device [Non-Patent Document 1], no attempt has been made to detect miRNA in a biological sample, regardless of whether it is a purified sample or a crudely purified sample. Moreover, in the field of plant science, there is no such technical report.

Japanese Patent Application Laid-Open No. 2008-271952 Arata H, Hosokawa K, Maeda M. Rapid sub-attomole microRNA detection on a portable microfluidic chip. Anal Sci. 2014;30(1):129-35.

INDUSTRIAL APPLICABILITY The present invention can be used to determine the state of plants, such as the presence or absence of abiotic stress such as environmental stress, biotic stress such as plant virus infection, and the prospect of plant development and physiological phenomena such as flowering. can be performed more easily and more efficiently, and if necessary, it can be used while cultivating crops, and if necessary, it is possible to determine the state on the spot at the cultivation site. The task is to provide

In the course of conducting research in view of the above problems, the present inventor focused on detecting plant substances that reflect the state of plants. Then, from the viewpoint of changing the cultivation method according to the judgment result after judging the state of the plant such as the degree of environmental stress and the prospect of occurrence of phenomena such as flowering, the judging technique is suitable for use at the cultivation site. I focused on the fact that it is desirable to have

As a result of further intensive research based on these points of interest, the present inventors have found that (A) a plant sample injection part, and (C) a plant sample injection part connected to the plant sample injection part A and immobilized with a plant substance detection probe. The inventors have found that the above problems can be solved by using a channel chip that includes channels having regions. Based on this finding, the inventors have further studied and completed the present invention.

That is, the present invention includes the following aspects:
Section 1. (A) a plant sample injection part, and (C) a channel connected to the plant sample injection part A and having a plant substance detection probe immobilization region,
a channel chip.

Section 2. (A) a plant sample injection unit;
(B) a plant sample discharge section, and (C) a channel connecting the plant sample injection section A and the plant sample discharge section B and having a plant substance detection probe immobilization region,
Item 1. The channel chip according to Item 1, comprising:

Item 3. Item 3. The channel chip according to Item 1 or 2, wherein the plant material is at least one selected from the group consisting of nucleic acids, proteins, peptides, sugar chains, bacteria, viruses, and low-molecular-weight compounds.

Section 4. Biomolecular groups, environmental response gene groups, organs/tissues that are directly encoded by the above-mentioned plant substances as indicators of growth state directly encoded by environmental response gene groups, organ/tissue/cell development/growth-related gene groups, stress response gene groups, etc. /In vivo molecular groups that are indicators of growth status indirectly generated by cell development and growth-related gene groups, stress response gene groups, etc., miRNAs such as miR399, miR395, miR172, miR156, siRNA, and other non-coding RNA, mRNA, FT protein, FT homolog protein (TSF protein, Hd3a protein, RFT1 protein, ZCN8 protein, etc., AFT protein, etc.), HY5 protein, CLAVATA3/ESR-related peptide, C-TERMINALLY ENCODED PEPTIDE peptide, CEP DOWNSTREAM protein, etc. A group consisting of a signal molecule group that is transmitted to the whole body through the sieve tube and the vessel, which is the vascular bundle of the plant, and a virus-derived RNA and protein group that infects through the plant vascular bundle such as the sieve tube and the vessel. Item 4. The channel chip according to any one of Items 1 to 3, which is at least one selected from the above.

Item 5. Item 5. The channel chip according to any one of Items 1 to 4, wherein the plant material is 1 to 4000 types of plant material.

Item 6. Item 6. The channel chip according to any one of Items 1 to 5, which is used for determining the state of plants.

Item 7. Item 7. A plant sample injection device comprising the channel chip according to any one of items 1 to 6.

Item 8. Item 7. A plant substance detection device comprising the channel chip according to any one of items 1 to 6.

Item 9. Item 7. A plant state determination device comprising the channel chip according to any one of items 1 to 6.

Item 10. A plant substance detection kit comprising the channel chip according to any one of Items 1 to 6 and/or the plant sample injection device according to Item 7.

Item 11. A plant substance detection kit comprising the channel chip according to any one of Items 1 to 6 and/or the plant substance detection device according to Item 8.

Item 12. Item 9. A plant condition determination kit comprising the channel chip according to any one of Items 1 to 6 and/or the plant condition determination device according to Item 9.

Item 13. (a) the step of bringing a plant sample into contact with the plant substance detection probe-immobilized region of the channel chip according to any one of items 1 to 6; and (b) detecting a signal on the plant substance detection probe-immobilized region. process,
A method for detecting plant matter, comprising:

Item 14. (a) a step of contacting a plant sample with the plant substance detection probe-immobilized region of the channel chip according to any one of Items 1 to 6;
(b) a step of detecting a signal on the plant substance detection probe-immobilized region; and (c) a step of determining the state of the plant using the signal value as an indicator;
A method for determining the state of a plant, including

Item 15. (a) a step of contacting a plant sample with the plant substance detection probe-immobilized region of the channel chip according to any one of Items 1 to 6;
(b) detecting a signal on the plant substance detection probe-immobilized region;
(c) a step of determining the state of the plant using the signal value as an index; and (d) a step of adjusting plant cultivation conditions based on the result of the determination;
A method of growing plants, including

INDUSTRIAL APPLICABILITY According to the present invention, it is possible to provide a channel chip, a device, a kit, etc. that can be used for detecting plant substances and determining the state of plants. By using these, it is possible to more easily and efficiently detect plant substances and determine the state of plants. If necessary, this plant matter detection and plant state determination can be performed at the crop cultivation site while the crops continue to grow.

Furthermore, according to the present invention, crop production risk can be reduced and crop productivity can be further improved by adjusting cultivation conditions based on the results of plant state determination.

a to c are flow path chips of the present invention, each including a plant sample injection part A (circle (white)), a plant sample discharge part B (gray area or curved part), and a flow path C (straight line). 1 shows an embodiment of d shows an embodiment of the channel chip of the present invention including one plant sample injection part A (circle (white)) and one channel C (straight line). Rectangles (black) indicate plant substance detection probe immobilization regions. b indicates a form in which the discharge part is a wide space, c indicates a form in which the discharge part is linear, and a indicates a form in which the discharge part is not particularly limited. a is the flow of the present invention, which includes one plant sample injection part A (circle (white)), one plant sample discharge part B (circle (gray)), and a plurality of flow paths C (straight lines) connecting them. 4 illustrates one embodiment of a road chip. Rectangles (black) indicate plant substance detection probe immobilization regions. b is a modified form of a, showing a form in which the probe-immobilized region extends over a plurality of channels. a shows two plant sample injection parts A (circle (white)), one plant sample discharge part B (circle (gray)) placed between them, and one channel C (straight line) connecting them. 1 shows one embodiment of the channel chip of the present invention, including one. b is a modified form of a, and plant sample injection part A (circle (white)) shows four forms. c is a modified form of a, showing a form in which there is one plant sample injection part A (circle (white)) and four plant sample discharge parts B (circle (gray)). Rectangles (black) indicate plant substance detection probe immobilization regions. a includes one plant sample injection part A (circle (white)), one plant sample discharge part B (circle (gray)), and one channel C (straight line). 1 shows an embodiment of the channel chip of the present invention in which a plant sample purification section (rectangle (gray)) is arranged between A and a plant substance detection probe immobilization region (rectangle (black)). b is a modified form of a, showing a form in which the plant sample purification section is arranged before the injection section. Plant sample injection part A (circle (white)), plant sample discharge part B (circle (gray)), and channel C (straight line) are included. 1 shows an embodiment of the channel chip of the present invention, in which a plant sample purification section (rectangle (gray)) is arranged on a channel D branched from a substance detection probe immobilization region (rectangle (black)). . 1 shows an embodiment of the channel chip of the present invention, comprising a plurality of units (ellipse) including directly or indirectly connected plant sample injection part A, plant sample discharge part B, and channel C. FIG. FIG. 1 shows a state in which a PDMS device for immobilizing a DNA probe is mounted on an amino-group-introduced slide glass, and the channel design (Example 1-1). Fig. 2 shows a state in which a detection device made of PDMS is mounted on a DNA probe-immobilized slide glass, and the channel design (Example 1-2). Fig. 2 shows a state in which the tube tip of a syringe pump is fixed to the liquid suction port of the PDMS device for detection (Example 1-2). 1 is a schematic diagram showing the principle of miRNA detection in Example 2. FIG. The results of detection of synthetic miRNA are shown (Example 2). The detection results of synthetic miR399 in tomato (micro-tom) leaf extract are shown (Example 3). This result is obtained when the final concentration of total protein in the extract is 0.45 mg/ml. The detection results of synthetic miR399 in tomato (micro-tom) leaf extract are shown (Example 3). These results are obtained when the final concentration of total protein in the extract is 0.45 mg/ml and 0.2 mg/ml. The detection results of synthetic miR399 in Arabidopsis thaliana aerial part extract are shown (Example 4). Fig. 3 shows detection results of miR399 from different volumes of detection samples containing the same number of RNA molecules (Example 5). The results of detecting a target molecule (miR399) from total RNA are shown (Example 6). These results are obtained using total RNA prepared by method 1 (using Trizol reagent). The results of detecting a target molecule (miR399) from total RNA are shown (Example 6). These results are obtained using total RNA prepared by method 2 (miRNeasy manual). The results of detecting a target molecule (miR399) from total RNA are shown (Example 6). These results are obtained using total RNA prepared by method 3 (modified miRNeasy method). Fig. 2 shows the detection results of the target molecule (miR399) in total RNA from cucumber phloem fluid (Example 7). Results of specific detection of each target molecule from a sample containing multiple target molecules (miR399 and miR156) are shown (Example 8). Fluorescent images obtained when each target molecule was specifically detected from a sample containing multiple target molecules (miR399 and miR156) are shown (Example 8). Fig. 2 shows the detection results of plant viruses (Example 10).

As used herein, the expressions "contain" and "include" include the concepts "contain", "include", "consist essentially of" and "consist only of".

1. In one aspect of the present invention, the channel chip comprises (A) a plant sample injection part, and (C) a channel connected to the plant sample injection part A and having a plant substance detection probe immobilization region. (In this specification, it may be referred to as the “channel chip of the present invention”). This will be explained below.

The channel chip of the present invention can be appropriately set according to the type of the probe, detection means, etc., as long as the plant substance detection probe can be immobilized and the plant sample can be delivered into the channel. is preferably A glass substrate or the like is suitable for solid phase formation, and a polymer resin or the like is suitable for channel shaping for plant sample delivery. is. Among polymer resin substrates, those having high transparency, for example, PDMS resin substrates, COC resin substrates, PMMA resin substrates, etc. are preferably used. In addition, inorganic substrates such as glass and metal can also be used.

The size of the channel chip of the present invention is not particularly limited, but a small size is preferable in order to facilitate easy and simple handling at a cultivation site or the like. It is usually 1 to 20 cm long and 1 to 20 cm long, preferably 1 to 5 cm long and 1 to 5 cm wide. For example, the size of about the size of a slide glass is preferable.

The thickness of the channel chip of the present invention can be appropriately set in consideration of the shaping method of the channel chip, the depth of the channel described later, and the like.

The plant sample is not particularly limited as long as it is a sample prepared from a plant and can be used as it is or after being purified as appropriate to detect plant substances. Samples can be taken. Examples of plant samples include extracts of plant tissues such as buds, leaves, stems, flowers, roots and fruits, phloem sap, vascular sap, tree sap, and aqueous fluids from drainage tissues.

The plant sample injection part A is a part arranged on the channel chip of the present invention, and is a part used for introducing a plant sample into the channel described below. Although the shape and structure of the plant sample injection part A are not particularly limited, it is usually well-shaped. The number of plant sample injection parts A included in the channel chip of the present invention may be one or plural.

The channel chip of the present invention preferably further includes a plant sample discharge section B. The plant sample discharge part B is a region arranged on the channel chip of the present invention, and is a region used for discharging the plant sample from the channel described below. Although the shape and structure of the plant sample discharge part B are not particularly limited, it is usually well-shaped. The plant sample discharge portion B may have a shape that discharges the solution to the outside of the channel chip, or may have a shape that does not discharge the solution so as not to discharge the solution to the outside of the channel chip. When the shape is such that the solution is discharged to the outside, a structure into which a tube or the like is inserted may be prepared so that the solution is discharged to the outside through the tube or the like. In the case of adopting a shape that does not discharge the solution to the outside, for example, by providing an internal space of a certain size in the plant sample discharge part B and making the internal space a vacuum state or a negative pressure state in advance, It is also possible to discharge the plant sample solution, buffer solution, etc. from the channel C into the internal space and then retain it in the internal space. In that case, the plant sample discharge part B does not necessarily have to open to the outside. Further, for example, by preparing a thin path connecting to the outside in a part of the internal space of the plant sample discharge part B and connecting it to a pump or the like, the internal space can be made negative pressure in advance, or the flow path chip can be used. By applying a negative pressure during the operation, the solution from the channel C may be discharged into the internal space of the plant sample discharge part B and stopped, even if the solution is not discharged to the outside of the channel chip. Alternatively, the plant sample discharge portion B may be shaped to open to the outside. The number of the plant sample outlets B included in the channel chip of the present invention may be one or plural.

The channel C is arranged on the channel chip of the present invention and connected to the plant sample injection part A. That is, the plant sample injection part A and the channel C are arranged in a state in which they are connected or can be adjusted so that the plant sample introduced from the plant sample injection part A passes through the channel C. . As an example of the latter case, for example, a channel switching section is provided on the channel C, and the plant sample injection section A and the channel C are connected or disconnected by the channel switching section. For example, the state can be switched.

In one embodiment of the channel C, the channel C connects the plant sample injection part A and the plant sample discharge part B. That is, the plant sample injection part A, the plant sample discharge part B, and the flow path C are connected so that the plant sample introduced from the plant sample injection part A can reach the plant sample discharge part B through the flow path C. or arranged in an adjustable state so that they can be connected. As an example of the latter case, for example, a channel switching section is provided on the channel C, and the plant sample injection section A, the plant sample discharge section B, and the channel C are connected by the channel switching section. There is a case where it is possible to switch between a non-connected state and a connected state.

The number of channels C included in the channel chip of the present invention may be one or plural.

Channel C can exist in a chip in various ways. For example, grooves formed on the chip surface can be used as channels. Furthermore, a tubular channel formed inside the chip can be used as the channel.

The shape of the channel C is not particularly limited, and the cross-sectional shape of the surface perpendicular to the flow of the sample in the channel may be, for example, a circle, a semicircle (with the chord at the top), a square (with one side at the top), and a triangle (with one side at the top). one side is the upper part). A semi-circular shape or a rectangular shape is preferable in consideration of the ease of manufacturing and processing the flow channel, the ease of manufacturing the detection area of the flow channel, and the like.

The shape of the channel axis of the channel C is not particularly limited as long as the flow of the sample does not become stagnant when the sample is passed through the channel. is preferred. This is because the flow of the sample is least likely to be stagnated. The channel axis means the axis in the flow direction of the fluid (sample) in the channel. It is also possible to branch the channel axis from the plant sample injection part A into a plurality of branches, prepare detection sites at the ends of the branches, and perform detection at a plurality of points in parallel. By repeating the detection reaction several times in this manner, highly reproducible results can be obtained.

Although the size of the flow channel C is not particularly limited, it usually has a width of several μm or more and several thousand μm or less and a depth of several μm or more and several thousand μm or less. Channel C is preferably a microchannel. The width and height of the flow channel C can be appropriately set within the above ranges depending on the purpose and the like. The width of the channel is, for example, 10-2000 μm, preferably 100-1000 μm, more preferably 300-700 μm, still more preferably 400-600 μm. Moreover, the height of the channel is 1 to 200 μm, 5 to 100 μm, 10 to 50 μm, and 15 to 25 μm.

Channel C has a plant substance detection probe immobilization region on the channel. In this region, the plant substance detection probe is directly or indirectly immobilized on the inner wall of the channel. The number of plant substance detection probe-immobilized regions included in one channel C may be one, or may be plural. At the time of probe immobilization, probe immobilization may be performed only in a specific region using a probe immobilization device, and an alignment mark may be provided on the device as an index to grasp the probe immobilization position. . In addition, the number of immobilized plant substance detection probes included in one channel C may be one or may be plural.

The plant substance to be detected is not particularly limited as long as it is a substance that can be contained in a plant and can be detected using a probe. Examples include nucleic acids (e.g., mRNA, miRNA), proteins, peptides, sugar chains , bacteria, viruses, and low-molecular-weight compounds, preferably nucleic acids, proteins, peptides, and the like. Among these, it is preferable from the viewpoint that it is particularly useful as a marker for determining the state of plants, and from the viewpoint that it is desirable to employ carefully selected plant substances so that they can be handled easily and simply at cultivation sites. is directly encoded by environmental response genes, organ/tissue/cell development/growth-related genes, stress response genes, etc., and is directly encoded by biomolecules, environmental response genes, and organs/tissues/cells. Examples include in vivo molecular groups that are indirectly generated by developmental growth-related gene groups, stress response gene groups, and the like and serve as indicators of the growth state. ), miR172 (produced during flowering (transition from vegetative growth to reproductive growth)), miR156 (produced during tuber formation), small RNAs such as intra-individual long-distance migratory mRNAs, FT protein (flower growth (as a florigen), tuber formation (as a tuberigen), growth of dormant buds, etc.), TSF protein (a homologous protein of FT and has the same properties and functions as FT), Hd3a protein (rice FT homologous protein), RFT1 protein (rice FT homologous protein), ZCN8 protein (maize FT homologous protein), AFT protein (antiflorigen suppressing flowering), HY5 protein, CLAVATA3/ESR-related (CLE) peptide (bean C-TERMINALLY ENCODED PEPTIDE (CEP) peptide (in response to nitrogen deficiency), CEP DOWNSTREAM (CEPD) protein (in response to nitrogen deficiency) signal molecules that migrate to the whole body via sieve tubes and ducts, which are vascular bundles of plants, such as in response to cytotoxicity), and virus-derived nucleic acids and proteins from the viewpoint of pathological diagnosis. The plant substances to be detected by the channel chip of the present invention may be of one type alone, or may be a combination of two or more types. From the viewpoint that it is desirable to employ carefully selected plant substances so that they can be easily and simply handled at cultivation sites, etc., the number of plant substances to be detected by the channel chip of the present invention is, for example, 1 to 4000, preferably. is 1 to 200, more preferably 1 to 100, even more preferably 1 to 20.

The plant substance detection probe is not particularly limited as long as it has a binding property (preferably a specific binding property) to the plant substance, and may consist of a single molecule. In the case of miRNA or the like, it may be a complex composed of a plurality of molecules designed to cover the entire family gene group. Alternatively, a single molecule may be used to simultaneously detect multiple target molecules. For example, if a single molecule is designed to recognize a particular molecular structure or a particular nucleic acid sequence, and multiple target molecules have such molecular features in portions of the entire molecule, then a single molecular probe can Multiple types of plant biomolecules can be detected. Furthermore, in that case, if you want to distinguish and detect multiple types of plant biomolecules, for example, in the channel C or the plant sample purification region arranged in front of the plant substance detection probe immobilization region, substances can be detected according to the molecular size and charge. A plurality of target molecules may be discriminated and detected by providing a mechanism to change the mobility and separate the substances. At that time, if the plant substance detection probe immobilization region is lengthened, the detection positions of the plurality of target molecules separated by the difference in mobility can be set to different positions of the plant substance detection probe immobilization region. Multiple target molecules can also be discriminated and detected simultaneously with a probe. The term "having binding properties" means capable of reversibly or irreversibly binding to a test substance. The bonding force is not particularly limited, and examples thereof include hydrogen bonding, electrostatic force, van der Waals force, hydrophobic bonding, covalent bonding, coordinate bonding and the like. Specific examples of plant substance detection probes include nucleic acids, antibodies, antigens, receptors, ligands that bind to receptors, aptamers, and the like. The plant substance detection probes immobilized on the channels of the channel chip of the present invention may be of one type alone, or may be a combination of two or more types. A plurality of probes may be arranged one-dimensionally or two-dimensionally. From the viewpoint that it is desirable to employ carefully selected plant substances so that they can be easily and simply handled at a cultivation site or the like, the plant substance detection probe immobilized on the channel of the channel chip of the present invention is preferably is 1 to 200, more preferably 1 to 100, even more preferably 1 to 20.

As used herein, the term "antibody" includes not only immunoglobulins such as polyclonal antibodies, monoclonal antibodies, and chimeric antibodies, but also fragments thereof having variable regions, such as Fab fragments, F(ab')2 fragments, and Fv fragments. , minibodies, scFv-Fc, scFv, diabodies, triabodies, and tetrabodies.

As used herein, the term "nucleic acid" includes not only DNA and RNA, but also those to which known chemical modifications have been applied, as exemplified below. Substitution of the phosphate residue of each nucleotide with a chemically modified phosphate residue such as phosphorothioate (PS), methylphosphonate, phosphorodithionate, etc. to prevent degradation by hydrolases such as nucleases can be done. In addition, the hydroxyl group at the 2nd position of the sugar (ribose) of each ribonucleotide is -OR (R is, for example, CH3 (2'-O-Me), CH2CH2OCH3 (2'-O-MOE), CH2CH2NHC(NH)NH2, CH2CONHCH3, CH2CH2CN, etc.). Furthermore, the base moiety (pyrimidine, purine) may be chemically modified, for example, introduction of a methyl group or cationic functional group to the 5-position of the pyrimidine base, or substitution of the carbonyl group at the 2-position with thiocarbonyl. is mentioned. Further examples include, but are not limited to, those in which the phosphate moiety or hydroxyl moiety has been modified with biotin, an amino group, a lower alkylamine group, an acetyl group, or the like. In addition, BNA (LNA), etc., in which the conformation of the sugar portion is fixed to the N-type by bridging the 2' oxygen and 4' carbon of the sugar portion of a nucleotide, can also be preferably used.

One embodiment of the channel chip of the present invention includes a form including one each of a plant sample injection part A, a plant sample discharge part B, and a channel C, as shown in FIGS. 1a to 1c.

As one embodiment of the channel chip of the present invention, as shown in FIG. A configuration including one each of the plant sample discharge part B and the flow path C is exemplified.

One embodiment of the channel chip of the present invention includes a form including one plant sample injection part A and one channel C, as shown in FIG. 1d.

As an embodiment of the channel chip of the present invention, as shown in FIG. 2a, there is a form including one each of a plant sample injection part A and a plant sample discharge part B, and a plurality of channels C connecting them. be done. Moreover, as shown in FIG. 2b, the probe immobilization region may extend over a plurality of channels.

As one embodiment of the channel chip of the present invention, as shown in FIGS. , and one or more channels C connecting them.

As an embodiment of the channel chip of the present invention, as shown in FIG. A form including one channel C that connects these is exemplified.

The channel chip of the present invention may include parts and channels other than the plant sample injection part A, the plant sample discharge part B, and the channel C. Other sites include, for example, the plant sample purification section. Normally, the plant sample purification section is arranged on the channel C, particularly between the plant sample injection section A and the plant substance detection probe immobilization region, as shown in FIG. 4a. Also, as shown in FIG. 4b, the plant sample purification section may be arranged before the injection section. Alternatively, as shown in FIG. 5, the plant sample purification section may be arranged on the channel C, particularly on the channel D branched from between the plant sample injection section A and the plant substance detection probe immobilization region. good. In this case, the branch point of the flow path D is appropriately provided with flow path switching means. The plant sample purification part is not particularly limited as long as the plant sample can be purified.

The channel chip of the present invention comprises a unit (for example, the units shown in FIGS. 1 to 5) including directly or indirectly connected plant sample injection part A, plant sample discharge part B, and channel C. As shown in 6, a plurality may be provided.

A method for manufacturing the channel chip of the present invention is not particularly limited, and a method according to a known method can be adopted. For example, a known method used for microfabrication of solid phase substrates, such as injection molding, can be used. If the channel is a groove existing on the chip surface, the groove may be formed on the substrate surface by such a known method. In addition, when the channel is formed into a pipe-like shape existing inside the chip, it is possible to cut the inside of the substrate into a pipe-like shape by cutting or the like. Alternatively, for example, a channel can be formed inside the chip by first forming a groove on the substrate surface and then covering (coating) the opening of the groove with a cover member such as a film or a separately prepared substrate. . In this way, it is also possible to prepare two or more substrates or members and then bond them together to form one substrate. Immobilization of the plant substance detection probe is also carried out according to a known method, for example, by dissolving the plant substance detection probe in a liquid (for example, phosphate buffer, PBS, etc.) that can keep the structure of the probe as stable as possible, and dissolving it in the channel. It can be carried out by introducing into and incubating for a certain period of time.

The channel chip of the present invention can be used as a channel chip for detecting a plant substance, a channel chip for determining the state of a plant, or the like, by using, for example, the method of the present invention described later ("4. Method"). be able to.

2. Apparatus The present invention, in one aspect thereof, relates to an apparatus (also referred to herein as the "apparatus of the present invention") comprising the channel chip of the present invention. This will be explained below.

The device of the present invention preferably includes various devices, parts, etc. used for detecting plant samples in addition to the channel chip of the present invention. Such devices include, for example, a reservoir for liquid (e.g., buffer solution, washing solution, etc.), a tube for moving the liquid from the reservoir to the channel chip or the like of the present invention, a vacuum pump, an imaging section, a plant sample collection section, A plant sample crushing unit, a plant sample preparation unit, a plant sample purification unit, a temperature controller, a voltage/current controller, a magnetic force controller and the like can be mentioned.

The device of the present invention can be used, for example, as a plant sample injection device, a plant substance detection device, a plant state determination device, etc., by using, for example, the method of the present invention described later ("4. Method"). can.

3. Kit In one aspect, the present invention relates to a kit (herein sometimes referred to as "the kit of the present invention") containing the channel chip of the present invention and/or the device of the present invention. This will be explained below.

The kit of the present invention preferably comprises various reagents, instruments, etc. used for detecting plant substances. Examples of such reagents include buffer solutions, washing solutions, equipment for preparing plant samples, reagents for preparing plant samples, equipment for purifying plant samples, reagents for purifying plant samples, A labeling substance (e.g., labeled nucleic acid, labeled secondary antibody) having a binding property (preferably a specific binding property) to a plant substance, a reagent necessary for detecting the labeling of the labeling substance, and detecting the labeling of the labeling substance Equipment necessary for denaturing unnecessary components, reagents necessary for denaturing unnecessary components, equipment necessary for denaturing unnecessary components, and the like.

The kit of the present invention can be used, for example, as a plant substance detection kit, a plant state determination kit, or the like, by using, for example, the method of the present invention described later ("4. Method").

Four. In one aspect of the method of the present invention, the steps of (a) contacting a plant sample with a plant substance detection probe immobilization region of the channel chip of the present invention, and (b) a signal on the plant substance detection probe immobilization region A method (also referred to herein as the "method of the present invention"), comprising the step of detecting This will be explained below.

In step a, there is no particular limitation on the manner in which the plant sample is brought into contact with the plant substance detection probe-immobilized region. Typically, the plant sample is introduced into the channel C by injecting the plant sample from the plant sample injection part A, and by providing the plant substance detection probe immobilization region in the channel C with free diffusion or flow velocity, By contact, it is carried out in a low dose and in a short time.

Although the method of injecting the plant sample into the plant sample injection part A is not particularly limited, a pipette, a micropipette, a syringe, or the like, which is preferable for injecting a small amount of solution sample, or a device shaped on a device corresponding to these structures. This can be done using the same site.

The method of introducing the injected plant sample into the channel C is not particularly limited, but it can be carried out, for example, by manipulating air pressure, capillary action, centrifugal force, voltage, current, osmotic pressure, magnetism, or the like. As a specific method, for example, when operating the air pressure, for example, adjusting the air pressure with a vacuum pump attached to the channel C or the plant sample discharge part B, or adjusting the air pressure in the space including the channel C in advance. For example, when using capillary action, for example, the size of the flow path C is set to a size that causes capillary action. For example, when using centrifugal force, for example, the Examples include centrifuging the channel chip with a centrifuge. For example, when operating the voltage, for example, adjusting the voltage between the plant sample injection part A and the channel C or the plant sample discharge part B can be mentioned. For example, when operating an electric current, for example, an electric current is passed between the plant sample injection part A and the channel C or between the plant sample discharge part B. For example, when operating the osmotic pressure, for example, the plant sample injection part A For example, when manipulating magnetism, for example, between plant sample injection part A and channel C or plant sample discharge part B Adjustment of the magnetism by suspending the magnetic material can be mentioned.

The plant sample that has passed through the channel C directly reaches the plant sample discharge part B on the channel C (for example, the terminal part on the side opposite to the plant sample injection part on the channel C). The plant sample that has arrived can remain there as it is, for example, or can be appropriately collected thereafter, reused, discarded, or the like. The recovery method is not particularly limited, but may be carried out using a device such as a pipette, a micropipette, a syringe, or the like, which is preferable for the recovery of a small amount of solution sample. Alternatively, in the case where the plant sample discharge part B is formed into a shape having a certain wide internal space, the plant sample delivered through the flow path C is discharged to the plant sample discharge part B, and then Part or all may remain inside the device.

After step a, the channel C, particularly the plant substance detection probe-immobilized region, is washed as necessary. For washing, for example, water, a buffer solution, or the like is introduced into the channel C in the same manner as described above, and then discharged from the plant sample discharge section B to the outside, or discharged into the internal space of the plant sample discharge section B. It is done by

The mode of detecting the signal in step b is not particularly limited. For example, if the detection target (plant substance) in the plant sample is previously labeled, the signal derived from the label may be detected. If the detection target (plant substance) in the plant sample is not labeled in advance, after step a, label the plant substance on the plant substance detection probe immobilization region, and then detect the signal derived from the label. do it. Labeling can be carried out according to known methods depending on the type of label. Labeling may be performed by directly binding the label to the plant material, or indirectly by binding the label to the plant material via another substance.

Examples of labels include fluorescent labels, peroxidase labels, alkaline phosphatase labels, β-galactosidase labels, glucose oxidase labels, urease labels, biotin labels, streptavidin labels, magnetic particle labels, gold/gold colloid labels, radioactive substance labels, Quantum dot labels and the like are included. As the fluorescent substance used for fluorescent labeling, for example, fluorescent compounds sold by reagent companies such as phycobiliproteins, various fluoresceins, various cyanine dyes, etc., as well as fluorescent proteins such as GFP can be appropriately selected and used.

A plant substance can be detected by the method of the present invention including the above steps a and b.

Furthermore, when the method of the present invention includes step c: (c) the step of determining the state of the plant using the value of the signal as an index, the state of the plant can also be determined.

The state of a plant includes not only the present state but also past and future states. Examples of the state of the plant to be determined include deficiency of nutritional components (e.g., phosphorus, sulfuric acid, nitrogen, etc.), disease infection, flowering time, tuber formation time, growth time of dormant buds, degree of rhizobia symbiosis, and the like. be done.

Specifically, the state can be determined, for example, by comparing the value of the signal with a cutoff value. The cut-off value can be appropriately set by those skilled in the art from the viewpoint of sensitivity, specificity, positive predictive value, negative predictive value, etc. Based on the signal value in a control plant sample such as a plant sample, it can be a value determined each time or a predetermined value. The cut-off value can be set based on, for example, the signal value of a control plant sample, or the average value, median value, or the like in the case of a plurality of subjects.

Furthermore, the method of the present invention can also be a method for cultivating a plant, which includes, in addition to the step c, a step d: (d) adjusting plant cultivation conditions based on the result of the determination.

As for the adjustment of the cultivation conditions, for example, if it is determined that the nutritional component such as phosphorus is deficient as a result of the step c, a fertilizer containing the nutritional component is applied or the amount of application is increased. Or, if infection with a disease is determined, the application of pesticides such as fungicides, partial removal of infected parts from individuals, or removal of infected individuals from the community. to prevent the spread of As a result, the cultivation and production of crops can be more stabilized, and the productivity of crops can be further improved.

EXAMPLES The present invention will be described in detail below based on examples, but the present invention is not limited by these examples.

Example 1. Production of miRNA detection channel chip <Example 1-1. Immobilization of DNA Probe>
A PDMS plate (for solid-phase DNA probes) equipped with two liquid inlets, a channel connecting them (channel width: 500 µm, channel height: 20 µm), and a liquid inlet (syringe pump connection) on the channel A DNA probe was immobilized on an amino group-introduced slide glass (DNA microarray coated slide glass TYPE 1 high-density amino group-introduced type, MATSUNAMI) using a PDMS device). Specifically, it was carried out as follows.
(1) A PDMS device for DNA probe immobilization was mounted on an amino-group-introduced slide glass and deaerated for 15 minutes. Fig. 7 shows the mounted state. Furthermore, the tube tip of a syringe pump was fixed to the liquid inlet of the PDMS device for DNA probe immobilization. Introduction and passage of the liquid into the channel can be performed by introducing the liquid into the input port with a pipette and sucking the liquid from the suction port with a syringe pump.
(2) A 10% glutaraldehyde solution was introduced into the channel and incubated at room temperature for 60 minutes.
(3) Water was introduced into the channel (syringe pump: 3.0 μl/min, 10 to 15 minutes) to wash the channel.
(4) Amino group-modified DNA probe (aminated probe DNA (Ami-DNA-miR399)
: [Am-C6]-TTTTTTTTTTTTTTTCAGGGCAACT (SEQ ID NO: 1)) solution (2 μM) was introduced into the channel (syringe pump: 1.5 μl/min, 5 minutes) and incubated overnight at 4°C.
(5) Introduce water into the channel (syringe pump: 3.0 μl/min, 10-15 minutes) to wash the channel, or introduce washing buffer (0.5 x SSC, 0.1% SDS) into the channel (syringe pump: 3.0 µl/min for 10 minutes) and introduction of water into the channel (syringe pump: 3.0 µl/min for 10 minutes) to wash the channels.

<Example 1-2. Preparation of flow path chip>
(6) The PDMS device for DNA probe immobilization was peeled off from the slide glass, and excess water was blown off with a blower. At this time, the line on which the DNA probe was immobilized on the slide glass was marked with a marker from the back of the slide glass.
(7) A PDMS plate (detection PDMA device) was mounted on the DNA probe-immobilized slide glass and degassed for 15 minutes. At this time, the line on which the DNA probe was immobilized and the flow path of the PDMA device for detection were mounted so as to be perpendicular to each other, based on the mark made before peeling. The mounted state is shown in FIG. Furthermore, the tube tip of the syringe pump was fixed to the liquid suction port of the detection device made of PDMA. This state is shown in FIG.
(8) A blocking solution (1 x blocking solution (DIG wash and block buffer set, Roche)) was introduced into the channel and incubated at room temperature for 60 minutes.
(9) Water was introduced into the channel (syringe pump: 3.0 μl/min, 5 minutes) to wash the channel.

Example 2. Detection of Synthetic miRNA Arabidopsis thaliana-derived miR399 (miR399b/c) was detected using the channel chip of Example 1 according to the detection principle shown in FIG. Specifically, it was carried out as follows.
(1) sample solution (composition: miR399 (UGCCAAAGGAGAGUUGCCCUG (SEQ ID NO: 2)) (0 nM (blank), 0.01 nM, 0.1 nM, 1 nM, 10 nM, or 100 nM), biotinylated DNA probe (CTCCTTTGGCA-[biotin] (SEQ ID NO: 3)) (0.4 μM), Streptavidin-Alexa (Streptavidin Alexa Flour 555 conjugate, Thermo Fisher) (500 x), buffer (1 x TE, 1 x PBS)) were prepared in tubes and incubated at room temperature for 30 minutes. Incubate for 1 minute.
(2) 10 μl of the sample solution was introduced into the channels of the channel chip and hybridized (syringe pump: ~0.5 µl/min, 30 minutes).
(3) The channel was washed (syringe pump: 1.5 μl/min, 10-15 minutes) with washing buffer (1 x washing buffer (DIG washing and blocking buffer set, Roche).
(4) Using a fluorescence microscope (using image analysis software MetaMorph), a fluorescence image of the channel chip was acquired (exposure time: 4 seconds).
(5) The amount of fluorescence was quantified from the fluorescence image (image analysis software Image J, National Institutes of Health, USA).

The results are shown in FIG. Compared to the blank (0 nM) sample value, miR399 could be detected with a significant difference (p < 0.05) in the range of 0.1 nM to 100 nM.

Example 3. Detection of synthetic miR399 in tomato (Micro-Tom) leaf extract Tomato (Micro-Tom) leaf discs were freeze-crushed with a pestle, suspended in 300-500 μl of 1 x TE, and centrifuged (15000 rpm, 4°C, 5 minutes). )did. The supernatant was used as an extract (the total protein concentration was measured by the Bradford method, and the concentration was adjusted with TE before use). Subsequently, sample solution (composition: miR399 (0 nM (blank) or 1 nM), biotinylated DNA probe (0.4 μM), Streptavidin-Alexa (500 x), buffer solution (0.7 x TE, 1 x PBS) or extraction A solution containing RNase inhibitor (RNaseOUT, Thermo Fisher) (40 units) was prepared in a tube and incubated at room temperature for 30 minutes.The final concentration of total protein in the extract was 0.45 mg/ml. , was detected in the same manner as in Example 2. The results are shown in FIG.

Subsequently, the same test was performed using sample solutions with extract total protein final concentrations of 0.45 mg/ml and 0.2 mg/ml. The results are shown in FIG.

We were able to detect miR399 with a significant difference (p < 0.05) in the background of plant (Microtom leaf) extract, which is thought to be affected by endogenous RNases and competitive/inhibitory factors in the detection system.

Example 4. Detection of synthetic miR399 in Arabidopsis thaliana aerial part extract Aerial parts of Arabidopsis thaliana were freeze-crushed with a pestle, suspended in 300 µl of 1 x TE, and centrifuged (15000 rpm, 4°C, 5 minutes). The supernatant was used as an extract (total protein concentration was determined (Bradford method) and adjusted with 1 x TE). Subsequently, sample solution (composition: miR399 (0 nM (blank) or 1 nM), biotinylated DNA probe (0.4 μM), Streptavidin-Alexa (500 x), buffer solution (0.8 x TE, 1 x PBS) or extraction A solution (containing Rnase inhibitor (40 units)) was prepared in a tube and incubated at room temperature for 30 minutes.The final extract total protein concentration was 0.2 mg/ml.This sample solution was used in the same manner as in Example 2. The results are shown in FIG.

miR399 could be detected with a significant difference (p < 0.01) in the background of plant (Arabidopsis thaliana aerial part) extract, which is thought to be affected by endogenous RNase and competitive/inhibitory factors in the detection system.

Example 5. miR399 detection sample solutions from different volumes of detection samples containing the same number of RNA molecules (composition: miR399 (0 nM (blank), or 1 nM, or 0.1 nM), biotinylated DNA probe (0.4 μM, or 0.04 μM), Streptavidin-Alexa (500x or 5000x) and buffer solution (1x PBS or 0.1x PBS) were prepared in a tube and incubated at room temperature for 30 minutes.When using 10 µl of sample solution in addition to when using 100 µl The test was performed in the same manner as in Example 2, except that the test was also performed, and the results are shown in FIG.

In sample solutions with different volumes containing the same number of molecules, miR399 could be detected with a significant difference (p < 0.05) even if the sample volume was changed, although a decrease in the detection value was observed with a large volume (100 μl). .

Example 6. Detection of target molecule (miR399) from total RNA
miR399 is known as a phosphorus-deficient marker whose expression increases under phosphorus-deficient conditions. Therefore, an attempt was made to detect this increase in expression. Specifically, it was carried out as follows.

Total RNA was prepared by the following three methods from Arabidopsis thaliana aerial parts cultivated in a normal medium and Arabidopsis thaliana aerial parts cultivated in a phosphorus-deficient medium for 7 days.
(Method 1) Trizol reagent (Thermo Fisher) (in isopropanol precipitation, a double amount of isopropanol was used) to prepare total RNA.
(Method 2) Prepared according to the manual of miRNeasy (Qiagen).
(Method 3) modified miRNeasy method; no phenol/chloroform): RLT buffer (300 μl) was added to the cryo-ruptured sample and passed through a QIA shredder column. The flow-through was transferred to a new tube and 100% ethanol (final concentration 60%) was added. It was then eluted with water according to the miRNeasy protocol.

A sample solution was prepared and tested in the same manner as in Example 2, except that total RNA was used instead of the buffer solution. FIG. 16 shows the results when using total RNA obtained by method 1, FIG. 17 shows the results when using total RNA obtained by method 2, and using total RNA obtained by method 3 FIG. 18 shows the results in the case of

The target molecule, miR399, was detected with a significant difference (p < 0.05) in total RNA extracted from the aerial parts of Arabidopsis thaliana grown in the p-deficient condition.

Example 7. Detection of target molecule (miR399) from cucumber sieve sap The sieve sap of cucumbers hydroponically cultivated in a greenhouse was collected, and target miR399 was detected from adjusted total RNA.

Regarding the phloem sap of cucumbers, there was a normal cultivation area where the cucumber was continuously grown under nutrient-rich conditions in hydroponics, and a normal cultivation area under nutrient-rich conditions in hydroponics for about two months. Phosphorus-deficient cultivation plots were prepared by cultivating for 3 days under replacement conditions, and the stems of cucumber grown in each cultivation plot were cut. The phloem sap obtained from cut cucumber stems was added to the collection buffer (100 mM Tris-HCl (pH 7.5), 10 mM EDTA, 5 mM EGTA, 10% glycerol, 1% (143 mM) β-ME) in the collection buffer and the sieve. Tubing fluid volumes were sampled in a one-to-one ratio.

Total RNA was prepared using Trizol LS (Thermo Fisher) and extracted by partially modifying the method described in the manual. The samples were then concentrated and conditioned by alcohol precipitation.

Detection was performed in the same manner as in Example 2 by mixing prepared total RNA, buffer solutions, each detection reagent, and biotinylated anti-streptavidin antibody (Vector laboratories, Burlingame, Calif.).

The results are shown in FIG.

We tried to detect the target miR399 in total RNA prepared from cucumber phloem sap cultivated under phosphorus-deficient conditions and cucumber sieve sap cultivated in the normal cultivation area of the target plot. The target miR399 could be detected significantly (p < 0.05) in the phosphorus-deficient condition compared to the normal cultivation.

In addition, this example is a test using a sample collected in a state before some damage that can be visually confirmed such as poor growth caused by phosphorus deficiency becomes apparent, and compared with a normal cultivation area. This is the result of detecting a significant increase in the expression level of miR399, which is a marker molecule in response to phosphorus deficiency, under phosphorus deficiency conditions.

In other words, this result indicates that the main channel chip can determine the presence or absence of environmental stress in plants at an early stage that cannot be detected by visual changes in traits. This is an example showing that if the subsequent cultivation conditions are adjusted, for example, the risk of crop productivity decline can be reduced, and crop productivity can be maintained in an optimal state during the cultivation period.

Example 8. Detection of multiple target miRNA molecules (miR399 and miR156) Using artificially synthesized miR399 (SEQ ID NO: 2) and miRNA156 (UGACAGAAGAGAGUGAGCAC) (SEQ ID NO: 4) as multiple target molecules, samples containing only one target molecule and multiple targets An attempt was made to specifically detect each individual target molecule in a sample containing the molecules.

Specifically, it was carried out as follows.

Immobilization of the probes and production of the channel chip were carried out in the same manner as in Example 1.

As for the PDMS device for DNA probe immobilization, a device was used in which one more lane was added in parallel to the DNA probe immobilization lane in the PDMS device for DNA probe immobilization shown in FIG. As for the PDMS device for detection, a device with a longer flow path distance than the PDMS device for detection shown in FIG. 8 was used in consideration of the two DNA probe solid-phase lanes.

Ami-DNA-miR399:[Am-C6]-TTTTTTTTTTTTTTTCAGGGCAACT (SEQ ID NO: 1) shown in Example 1 was used as an amino group-modified DNA probe for detection of miR399. Ami-DNA-miR156 ([Am-C6]]-TTTTTTTTTTTTTTTGGCTCACT (SEQ ID NO: 5)) was used as an amino group-modified DNA probe for detection of miR156.

Detection of miRNA was performed in the same manner as described in Example 2.

SEQ ID NO: 3 (CTCCTTTGGCA-[biotin]) was used as the biotinylated DNA probe for the detection of miR399, and SEQ ID NO: 6 (CTCTTCTGTCA-[biotin]) was used as the biotinylated DNA probe for the detection of miR156.

The results of detection are shown in FIG. FIG. 21 shows a fluorescence image obtained by quantifying the amount of fluorescence.

The corresponding target miRNAs could be specifically detected in the immobilized DNA probe regions respectively provided for different target miRNAs. Moreover, from a sample containing multiple target miRNAs, each target miRNA could be detected simultaneously in each immobilized DNA probe region.

Example 9. Preparation of protein detection channel chip <Example 9-1. Immobilization of coating/capture antibody>
(1) In the same manner as in Example 1-1, the DNA probe/capture antibody immobilized PDMS device (Fig. 7) was mounted on an amino-group-introduced slide glass, degassed for 15 minutes, and then the DNA probe was / The tip of the syringe pump tube was fixed to the liquid inlet of the PDMS device for capture antibody immobilization.
(2) A 10% glutaraldehyde solution was introduced into the channel and incubated at room temperature for 60 minutes.
(3) Water was introduced into the channel (syringe pump: 3.0 μl/min, 15 minutes) to wash the channel.
(4) Introduce capture antibody (Cucumber mosaic virus (CMV) detection antibody, ELISA complete kit, Bioreba) diluted 1000 times with carbonate/bicarbonate buffer (pH 9.6) (ELISA complete kit, Bioreba) into the channel (20 μl) , syringe pump: 1.5 μl/min for 10 minutes).
(5) incubated overnight at 4°C; At this time, the wells were covered with PDMS pieces to prevent drying and evaporation.
(6) The channel was washed with a washing buffer (ELISA complete kit, Bioreba) (syringe pump: 3.0 μl/min, 15 minutes).

<Example 9-2. Preparation of flow path chip>
(7) The PDMS device for DNA probe/capture antibody solid phase was peeled off from the slide glass, and excess water was blown off with a blower. At this time, the line on which the capture antibody was immobilized on the slide glass was marked with a marker. Subsequently, a detection PDMS device that had been degassed (for 15 minutes) in advance was mounted on the antibody-immobilized slide glass.
(8) A blocking solution (0.1 M lysine/1 x PBS buffer background) was introduced into the channel and incubated at room temperature for 30 minutes.
(9) The channel was washed with a washing buffer (syringe pump: 3.0 μl/min, 5 minutes).
(10) A blocking solution (1% BSA/1x PBS buffer) was introduced into the channel (syringe pump: 1.5 µl/min, 10 minutes) and incubated at room temperature for 60 minutes.
(11) The channel was washed with a washing buffer (syringe pump: 3.0 μl/min, 5 minutes).

Example 10. Detection of plant virus (Cucumber mosaic virus (CMV))
<Example 10-1. Preparation of sample solution>
(1) Leaf pieces (less than 1 cm square) of uninfected tobacco leaves or CMV-infected tobacco leaves were freeze-crushed and homogenized in an extraction buffer (ELISA complete kit, Bioreba). At this time, crushed leaf pieces:extraction buffer=1:20 (w/v).
(2) Centrifugation (6000 rpm, 5 min, 4°C) was carried out to sink residue such as plant tissue.
(3) The total protein concentration of the supernatant was measured (Bradford method), adjusted to 0.67 mg/ml with an extraction buffer, and used as a sample solution (antigen).

<Example 10-2. Incubation of sample solution>
(4) Remove the washing buffer from the wells of the channel chip of Example 9, apply ~20 µl of the sample solution to the wells, and introduce the sample solution into the channel (syringe pump: 0.2-1.0 µl/min, 30- 60 minutes).
(5) incubated overnight at 4°C; At this time, the wells were covered with pieces of PDMS to prevent drying.
(6) The channel was washed with washing buffer (syringe pump: 3.0 μl/min, 15 minutes).

<Example 10-3. Incubation of alkaline phosphatase (AP)-labeled antibody>
(7) An AP-labeled antibody diluted 1000-fold with a conjugate buffer (ELISA complete kit, Bioreba) was introduced into the channel (20 μl, syringe pump: 1.0 μl/min, 15 minutes).
(8) Incubated at room temperature for 2.5 hours. At this time, the wells were covered with pieces of PDMS to prevent drying.
(9) The channel was washed with a washing buffer (syringe pump: 3.0 μl/min, 15 minutes).

<Example 10-4. Measurement of fluorescence signal over time>
(10) After removing the washing buffer, 15 μl of AP substrate solution (1 mM AttoPhos, Promega) was introduced into the channel (syringe pump: 5.0 to 7.0 μl/min, 2 minutes).
(11) Fluorescence signals were measured over time using a fluorescence microscope (using image analysis software MetaMorph). Conditions are as follows:
*Measured over 30 minutes every 5 minutes *Exposure time: 500 ms to 1 sec
* U-FBVW (Olympus) was used as the fluorescence filter. ).

FIG. 22 shows the amount of change (inclination) in the fluorescence signal value. CMV virus was detected significantly (p<0.05) from the CMV-infected tobacco leaf extract sample by comparing the amount of change (slope) in the fluorescence signal value.

Claims (15)

(A) a plant sample injection part, and (C) a channel directly connected to the plant sample injection part A and having a plant substance detection probe immobilization region,
and
The channel chip, wherein the plant sample is at least one selected from the group consisting of crushed plant tissue fluid, phloem fluid, vascular fluid, tree sap, and aqueous fluid from drainage tissue . (A) a plant sample injection unit;
(B) a plant sample discharge section; and (C) a channel directly connecting the plant sample injection section A and the plant sample discharge section B and having a plant substance detection probe immobilization region;
The channel chip according to claim 1, comprising: 3. The channel chip according to claim 1, wherein the plant material is at least one selected from the group consisting of nucleic acids, proteins, peptides, sugar chains, bacteria, viruses, and low-molecular-weight compounds. Biomolecular groups, environmental response gene groups, organs/tissues that are directly encoded by the above-mentioned plant substances as indicators of growth state directly encoded by environmental response gene groups, organ/tissue/cell development/growth-related gene groups, stress response gene groups, etc. /In vivo molecular groups that are indicators of growth status indirectly generated by cell development and growth-related gene groups, stress response gene groups, etc., miRNAs such as miR399, miR395, miR172, miR156, siRNA, and other non-coding RNA, mRNA, FT protein, FT homolog protein (TSF protein, Hd3a protein, RFT1 protein, ZCN8 protein, etc., AFT protein, etc.), HY5 protein, CLAVATA3/ESR-related peptide, C-TERMINALLY ENCODED PEPTIDE peptide, CEP DOWNSTREAM protein, etc. A group consisting of a signal molecule group that is transmitted to the whole body through the sieve tube and the vessel, which is the vascular bundle of the plant, and a virus-derived RNA and protein group that infects through the plant vascular bundle such as the sieve tube and the vessel. The channel chip according to any one of claims 1 to 3, which is at least one selected from the above. The channel chip according to any one of claims 1 to 4, wherein the plant matter is 1 to 4000 kinds of plant matter. The channel chip according to any one of claims 1 to 5, which is used for judging the condition of plants. A plant sample injection device comprising the channel chip according to any one of claims 1 to 6. A plant substance detection device comprising the channel chip according to any one of claims 1 to 6. A plant condition determination device comprising the channel chip according to any one of claims 1 to 6. A plant substance detection kit comprising the channel chip according to any one of claims 1 to 6 and/or the plant sample injection device according to claim 7. A plant substance detection kit comprising the channel chip according to any one of claims 1 to 6 and/or the plant substance detection device according to claim 8. A plant state determination kit comprising the channel chip according to any one of claims 1 to 6 and/or the plant state determination device according to claim 9. (a) the step of bringing a plant sample into contact with the plant substance detection probe-immobilized region of the channel chip according to any one of claims 1 to 6; and (b) detecting a signal on the plant substance detection probe-immobilized region. the process of
and
A method for detecting a plant substance , wherein the plant sample is at least one selected from the group consisting of crushed plant tissue fluid, phloem fluid, vascular fluid, tree sap, and aqueous fluid from drainage tissue . (a) contacting a plant sample with the plant substance detection probe-immobilized region of the channel chip according to any one of claims 1 to 6;
(b) a step of detecting a signal on the plant substance detection probe-immobilized region; and (c) a step of determining the state of the plant using the signal value as an indicator;
and
A method for determining the state of a plant , wherein the plant sample is at least one selected from the group consisting of crushed plant tissue fluid, phloem fluid, vascular fluid, tree sap, and aqueous fluid from drainage tissue . (a) contacting a plant sample with the plant substance detection probe-immobilized region of the channel chip according to any one of claims 1 to 6;
(b) detecting a signal on the plant substance detection probe-immobilized region;
(c) a step of determining the state of the plant using the signal value as an index; and (d) a step of adjusting plant cultivation conditions based on the result of the determination;
and wherein the plant sample is at least one selected from the group consisting of crushed plant tissue fluid, phloem fluid, vascular fluid, tree sap, and aqueous fluid from drainage tissue .

Images