JP7082804B2 - Pharmaceutical composition for treating cancer containing RAGE aptamer - Google Patents

Description

The present disclosure relates to therapeutic uses for RAGE aptamers.

Advanced glycation end-products (AGEs) are high molecular weight substances produced by a non-enzymatic reaction (Maillard reaction) between a carbonyl group of a reducing sugar such as glucose and an amino group of a protein. When chronic hyperglycemia continues due to diabetes or the like, the production of AGEs is promoted in the circulating blood or in tissues. It has been suggested that AGEs are involved in various diabetes-related diseases and age-related diseases via its receptor, RAGE (Receptor for AGEs).

Aptamers are single-stranded short DNA or RNA oligonucleotides that can bind to a variety of targets with high affinity and specificity. So far, it has been reported that an aptamer that binds to RAGE and inhibits the binding of RAGE to its ligand is effective in treating diabetic complications and hypertensive nephropathy (Patent Document 1).

JP-A-2016-079184

The present disclosure is intended to provide novel therapeutic uses for RAGE aptamers.

The present disclosure relates, in certain embodiments, to pharmaceutical compositions for treating cancer comprising RAGE aptamers.

The present disclosure provides a therapeutic agent for cancer containing RAGE aptamer as an active ingredient.

[Γ- ^32P ] Biodistribution and temporal dynamics of ATP-labeled RAGE aptamers. [Γ- ^32P ] ATP-labeled RAGE aptamer was continuously injected into the abdominal cavity of 8-week-old Balb / c-nu / nu mice for 7 days. Then, blood, urine, and each organ were collected at the time shown in the figure. [Γ- ³² P] ATP-labeled RAGE aptamer was detected and measured by Cherenkov light measurement. The results are shown as the amount of pmol per 1 g of each tissue. N = 4 for each group. Effect of RAGE aptamers on tumor growth (A and B) and body weight (C) in nude mice. 2 × 10 ⁶ G361 cells were intradermally administered to the upper abdomen of 6-week-old female athymic nude mice (n = 14). RAGE aptamers (n = 6) or vehicles (n = 8) were continuously injected into the abdominal cavity of mice by an osmotic mini-pump. Then, tumor volume and body weight were measured twice a week. A is a typical photograph of a G361 tumor 42 days after administration. The arrowhead indicates a tumor. * And ** indicate p <0.05 and p <0.01, respectively, compared to the values of vehicle-treated mice. Effect of RAGE aptamers on immunostaining of 8-OHdG (A), AGEs (B), and RAGE (C) in G361 tumors. The photo on the left shows a representative photo of immunostaining, and the graph on the right shows quantitative data. RAGE for immunostaining of PCNA (A), cyclin D1 (B), p27 (C), VEGF (D), CD31 (E), MCP-1 (F), and Mac-3 (G) in G361 tumors. The effect of the aptamer. The photo on the left is a representative photo of immunostaining, and the graph in the center shows quantitative data. The graph on the right shows the mRNA levels of cyclin D1 (B), p27 (C), VEGF (D), and MCP-1 (F) in G361 tumors. Effect of RAGE aptamer on liver immunostaining (C) of AST (A), ALT (B), and melanA in nude mice. The upper photo of C is a representative photo of immunostaining, and the lower graph shows quantitative data. * And ** indicate p <0.05 and p <0.01, respectively, compared to the values of vehicle-treated mice. Effect of RAGE aptamer or NAC on ROS production (A) and cell proliferation (B and C) in G361 melanoma cells exposed to AGE-BSA. A: N = 6 for each group. B and C: N = 3 for each group. ** indicates that p <0.01 as compared with the control value by non-saccharified BSA alone. ## indicates that p <0.01 compared to AGE-BSA alone. Effect of RAGE aptamer or NAC on protein levels (D and E) of cyclins D1 and p27 in G361 melanoma cells exposed to AGE-BSA. The figures above D and E show bands for Western blot analysis of cyclins D1, p27 and β-actin. Quantitative data are shown in the graph below. Data were standardized by the intensity of β-actin-derived signals and shown as a ratio to the values obtained with non-glycated BSA alone. D: N = 5 for each group. E: N = 3 for each group. # And ## indicate p <0.05 and p <0.01 as compared to AGE-BSA alone. Effect of RAGE aptamer or NAC on mRNA levels of VEGF (F and G) and MCP-1 (H and I) in G361 melanoma cells exposed to AGE-BSA. FI: N = 9 for each group. # Indicates that p <0.05 as compared to AGE-BSA alone. MRNA levels of ROS production (A), cell proliferation (B), and VEGF (C), MCP-1 (D), and VCAM-1 (E) in HUVEC exposed to AGE-BSA, as well as to said HUVEC. Effect of RAGE aptamer on adhesion (F) of THP-1 cells. A: Superoxide production was evaluated by the fluorescence intensity of DHE staining. B: Cell proliferation was assessed by uptake of [ ³ H] thymidine into HUVEC. CE: Total RNA was transcribed and amplified by real-time PCR. Data were standardized by the intensity of β-actin-derived signals and shown as a ratio to the values obtained with non-glycated BSA alone. A: N = 3 for each group. B: N = 4 for each group. C: N = 6 for each group. D and E: N = 3 for each group. F: N = 6 for each group. * And ** indicate p <0.05 and p <0.01, respectively, compared to the values of AGE-BSA alone. Schedule of administration of G361 melanoma cells and RAGE aptamers to nude mice. The RAGE aptamer was administered for 1 week, followed by non-administration and administration every 3 days. The administration period of RAGE aptamer is shaded. Effect of RAGE aptamer on tumor growth (A and B) and body weight (C) in nude mice transplanted with G361 melanoma cells. 2 × 10 ⁶ G361 cells were subcutaneously administered to the upper abdomen of 6-week-old female thymic nude mice (n = 14). Two weeks later, RAGE aptamer (n = 6) or vehicle (n = 7) was started near the tumor and administered according to the administration schedule shown in FIG. Then, tumor volume and body weight were measured twice a week. A is a typical photograph of a G361 tumor 113 days after subcutaneous injection of G361, that is, 99 days after continuous administration of RAGE aptamer. The arrowhead indicates a tumor. * And ** indicate p <0.05 and p <0.01, respectively, compared to the values of vehicle-treated mice. Effect of RAGE aptamers on immunostaining of CML (A), RAGE (B), nitrotyrosine (C), VEGF (D), CD31 (E), and VWF (F) in G361 tumors. The photo on the left shows a representative photo of immunostaining, and the graph on the right shows quantitative data. N = 6 in the vehicle-administered group and N = 5 in the RAGE aptamer-administered group. Effect of RAGE aptamer on the binding affinity of CML and RAGE using QCM. Only CML (A) or RAGE aptamer was added to the pre-fixed RAGE, and then CML (B) was added. A, B: N = 3 for each group. Effect of RAGE aptamer on ROS production in G361 melanoma cells exposed to CML. ROS production was evaluated by treating G361 cells with carboxy-H ₂ DFFFDA for 1 hour and then measuring fluorescence intensity 40 minutes after initiation of stimulation with CML. N = 6 for each group (N = 9 for 1 μg / ml CML only). * Indicates that p <0.05 as compared with the control value of the vehicle alone. # And ## indicate p <0.05 and p <0.01, respectively, as compared to CML alone.

Unless otherwise specified, the terms used herein have the meaning generally understood by those of skill in the art in the fields of organic chemistry, medicine, pharmacy, molecular biology, microbiology and the like. The following are definitions of some terms used herein, but these definitions supersede the general understanding herein.

"RAGE" (Receptor for AGEs) are transmembrane proteins that function as receptors for advanced glycation end products (AGEs), including CML (Nε- (carboxymethyl) lysine). As the ligand of RAGE, various AGEs including AGE-2 derived from glyceraldehyde, HMGB-1 (High Mobility Group Box 1), LPS and the like are known.

An "aptamer" is a single-stranded DNA or RNA that has the ability to specifically bind to a target substance, has various three-dimensional structures, and binds to a protein or compound to exert an antibody-like function. As used herein, the term "RAGE aptamer" means a single-stranded DNA or RNA that binds to RAGE and inhibits the binding of RAGE to its ligand.

The RAGE aptamer can be prepared by the SELEX (Systematic Evolution of Ligands by EXponential enrichment) method. The outline of the SELEX method using single-stranded DNA as a library source will be described below. First, a template DNA containing a random sequence of an appropriate length sandwiched between two arbitrary primer sequences is synthesized. In the present invention, the length of the random sequence is appropriately 35 to 120 bases. This template DNA is amplified by PCR (Polymerase Chain Reaction) to obtain a random DNA aptamer pool. The random DNA aptamer pool is then associated with the target material, the unbound DNA is removed, and the bound DNA aptamer is extracted. The obtained DNA aptamer is amplified by PCR using the above primer sequence. At this time, PCR is performed in the presence of 5 to 8 mM Mg ²⁺ to reduce the accuracy of replication and facilitate the introduction of mutations, so that new DNA that does not exist in the DNA aptamer pool before association with the target substance is present. A DNA aptamer pool containing aptamers is obtained. The new DNA aptamer may have stronger binding force, i.e., the DNA aptamer may evolve. By repeating the above series of operations for 5 to 15 rounds on this evolved DNA aptamer pool, a DNA aptamer that binds to the target substance can be obtained. After the final round, the resulting DNA aptamer pool is cloned and then sequenced by procedures routinely performed by those of skill in the art. Operations such as template DNA synthesis, PCR, and cloning and sequencing in this SELEX method are performed by methods commonly used by those skilled in the art. The RAGE aptamer can be chemically synthesized by a method usually used by those skilled in the art based on the sequence thus determined.

The RAGE aptamer may be composed of modified nucleotides to increase its stability. For example, the RAGE aptamer may be a phosphorothioate-type (S-modified) oligonucleotide in which an oxygen atom is replaced with a sulfur atom in some or all of the phosphate groups in the binding site between nucleotides.

The RAGE aptamer may be either single-stranded DNA or single-stranded RNA, but is preferably single-stranded DNA. The RAGE aptamer consists of at least 35 bases, preferably 35 to 120 bases, more preferably 35 to 70 bases, and even more preferably 35 to 50 bases.

In some embodiments, the RAGE aptamer is a single-stranded DNA comprising any of the following SEQ ID NOs: 1-10 sequences.

CCTGATATGGTGTCACCGCCGCCTTAGTATTGGTGTCTAC (SEQ ID NO: 1)
TCTGTTCAGGTTGGTACGGTGGAAGGTGTGATTCACGAGG (SEQ ID NO: 2)
CTTGGGTTGTTTATGTCGACCGCCAGTTTTGTGTTCAGCA (SEQ ID NO: 3)
CATTCTTAGATTTTTGTCTCACTTAGGTGTAGATGGTGAT (SEQ ID NO: 4)
TTGGTTCTCTTGCCCTCTTCTATTTTGTACGATGTTTCCT (SEQ ID NO: 5)
TTCCACTGAGTGCCGCGGACTGTTGTTGGGAGGTGGTGTG (SEQ ID NO: 6)
ATGGGGAGGAGGGGTGTCGTGGGGGGTGGGGGAGTGGGGA (SEQ ID NO: 7)
CTGGGGATGACTCGGATAGGATGTACGAGTTTGATGTGTA (SEQ ID NO: 8)
TTTGATCGAGCTGCGCCCTCCTCGCCGTAGAAGAGTGTGT (SEQ ID NO: 9)
TTTGGGGTGGAGTTAGGGGTGGATCAAGCGGGATTGTGTA (SEQ ID NO: 10)

The RAGE aptamer has 70% or more, preferably 80% or more, more preferably 85% or more, still more preferably 90% or more, and most preferably 95% or more sequence identity with any of the sequences of SEQ ID NOs: 1-10. It may be a single-stranded DNA containing a sequence having the above, which binds to RAGE and inhibits the binding of RAGE to its ligand. In addition, the RAGE aptamer contains a sequence in which 1, 2, or 3 bases are deleted, substituted, or added in any of the sequences of SEQ ID NOs: 1 to 10, and binds to RAGE to form RAGE and its ligand. It may be a single-stranded DNA that inhibits the binding of the DNA.

"Sequence identity" means the degree of sequence similarity between two oligonucleotides, and the two are aligned to the optimum state (the state where the sequence match is maximized) over the region of the base sequence to be compared. Determined by comparing sequences. The sequence identity number (%) determines the number of matching sites by determining the same base present in both sequences, then dividing the number of matching sites by the total number of bases in the sequence region to be compared. , Calculated by multiplying the obtained value by 100. Algorithms for obtaining optimal alignment and sequence identity include various algorithms commonly available to those of skill in the art (eg, BLAST algorithm, FASTA algorithm, etc.). The sequence identity of the base sequence is determined by using sequence analysis software such as BLAST or FASTA.

Whether or not the RAGE aptamer binds to RAGE and inhibits the binding of RAGE to its ligand can be investigated by, for example, ELISA or QCM (quartz crystal microbalance) method. In the case of ELISA, the V domain (v-RAGE) of RAGE that binds to AGE is pre-reacted with the RAGE aptamer, and this reaction mixture is added to the ELISA plate on which the ligand of RAGE (eg, AGE or HMGB1) is immobilized. RAGE bound to the ligand in the plate is detected with an anti-RAGE antibody. Alternatively, v-RAGE may be immobilized on an ELISA plate, a RAGE aptamer and its ligand may be added, and the ligand bound to v-RAGE may be detected by an antibody. In the QCM method, v-RAGE may be immobilized on a QCM sensor plate, a ligand of RAGE may be added in the presence or absence of a RAGE aptamer, and the binding of the ligand to v-RAGE may be monitored.

In a preferred embodiment, the RAGE aptamer is a single-stranded DNA comprising any of the sequences of SEQ ID NOs: 1-10, and more preferably a single-stranded DNA comprising any of the sequences of SEQ ID NOs: 1-10. In another preferred embodiment, the RAGE aptamer is a single-stranded DNA comprising the sequence of CCTGATATGGTGTCACCGCCGCCTTAGTATTGGTGTCTAC (SEQ ID NO: 1), more preferably a single-stranded DNA comprising the sequence of SEQ ID NO: 1.

In a further embodiment, the RAGE aptamer is a single-stranded DNA comprising any of the sequences of SEQ ID NOs: 1-10 or consisting of any of the above sequences and comprising a phosphorothioate binding at the position shown in Table 1 in that sequence.

RAGE aptamers can be used to treat cancer. Examples of cancer include melanoma, pancreatic cancer, breast cancer, lung cancer, renal cell carcinoma, colon cancer, liver cancer and the like. In a preferred embodiment, the cancer is melanoma. Treatment of cancer includes suppression of cancer growth, suppression of metastasis, and suppression of recurrence. In some embodiments, RAGE aptamers are used in the treatment of cancer as a cancer metastasis inhibitor or as an angiogenesis inhibitor.

A pharmaceutical composition containing a RAGE aptamer mixes the RAGE aptamer with a pharmaceutically acceptable carrier to form a solid formulation (eg, tablet, capsule, granule, powder, etc.) or a liquid formulation (eg, syrup, injection). Etc.) can be manufactured. The pharmaceutical composition may be a lyophilized preparation used by dissolving it before use. Pharmaceutically acceptable carriers include, for example, excipients (eg, lactose, sucrose, dextrin, hydroxypropyl cellulose, polyvinylpyrrolidone, etc.), disintegrants (eg, starch, carboxymethyl cellulose, etc.), lubricants (eg, starch). , Magnesium stearate, etc.), surfactants (eg, sodium lauryl sulfate, etc.), solvents (eg, water, saline, soybean oil, etc.), preservatives (eg, p-hydroxybenzoic acid ester, etc.), etc. However, it is not limited to these.

The administration method of the pharmaceutical composition is appropriately selected depending on the age, body weight, health condition and the like of the administration subject. The pharmaceutical composition may be administered either systemically or by topical administration. For example, in the case of melanoma, local administration is preferable. Examples of the administration method include oral administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, and transdermal administration. The dose of the composition of the present invention is also appropriately selected depending on the administration method, the age, body weight, health condition and the like of the administration subject. For example, the amount of RAGE aptamer per adult per day can be, for example, 0.2 to 100 mg, but is not limited to this.

The present disclosure is a method of treating cancer, comprising administering an effective amount of RAGE aptamer to a patient in need thereof, and a RAGE aptamer for the manufacture of a pharmaceutical agent for treating cancer. Provide use of. The method and use can be carried out according to the description regarding the pharmaceutical composition.

Aptamers have the advantages of lower immunogenicity, easier production, higher thermal stability and chemical modification as compared to antibodies. In addition, if RAGE, which is a receptor, is inhibited, the action of RAGE ligands other than AGEs can also be inhibited, and a high therapeutic effect can be expected. Therefore, RAGE aptamers are useful as therapeutic agents for cancer.

Exemplary embodiments of the present disclosure are set forth below.

1. 1. A pharmaceutical composition for treating cancer, comprising a RAGE aptamer.
2. 2. The pharmaceutical composition according to 1 above, wherein the cancer is selected from the group consisting of melanoma, pancreatic cancer, breast cancer, lung cancer, renal cell carcinoma, colon cancer, and liver cancer.
3. 3. The pharmaceutical composition according to 2 above, wherein the cancer is melanoma.
4. The pharmaceutical composition according to any one of 1 to 3 above, which is a cancer metastasis inhibitor.
5. The pharmaceutical composition according to any one of 1 to 4, which is an angiogenesis inhibitor.
6. The pharmaceutical composition according to any one of 1 to 5 above, wherein the RAGE aptamer is selected from the group consisting of the following:
(1) Single-stranded DNA containing any of the sequences of SEQ ID NOs: 1 to 10;
(2) A single-stranded DNA that contains a sequence having 90% or more sequence identity with any of SEQ ID NOs: 1 to 10 and binds to RAGE to inhibit the binding of RAGE to its ligand;
(3) In any of the sequences of SEQ ID NOs: 1 to 10, a sequence in which 1, 2, or 3 bases are deleted, substituted, or added is contained, and it binds to RAGE to bind RAGE to its ligand. Single-stranded DNA that inhibits.
7. The pharmaceutical composition according to any one of 1 to 6 above, wherein the RAGE aptamer comprises any of the sequences of SEQ ID NOs: 1-10.
8. The pharmaceutical composition according to any one of 1 to 7 above, wherein the RAGE aptamer comprises the sequence of SEQ ID NO: 1.
9. The pharmaceutical composition according to any one of 1 to 8 above, wherein the RAGE aptamer comprises any of the sequences of SEQ ID NOs: 1 to 10.
10. The pharmaceutical composition according to any one of 1 to 9 above, wherein the RAGE aptamer comprises the sequence of SEQ ID NO: 1.
11. The pharmaceutical composition according to any one of 1 to 10 above, wherein the RAGE aptamer is a phosphorothioate-type oligonucleotide.
12. A method of treating cancer that comprises administering an effective amount of RAGE aptamer to a patient in need thereof.
13. Use of RAGE aptamers for the manufacture of drugs to treat cancer.

Hereinafter, the present invention will be further described with reference to Examples, but the present invention is not limited thereto.

1. 1. METHODS: Bovine serum albumin (BSA) (fatty acid and globulin-free, lyophilized powder), D-glyceraldehyde, Dulbecco's modified Eagle's medium (DMEM), and N-acetylcysteine (NAC) are Sigma-Aldrich (St. Louis,). Purchased from MO, USA). Monochrome-nal anti-hydroxy-2'-deoxyguanosine (8-OHdG) antibody (Ab) was obtained from the Japan Institute for the Control of Aging, NIKKEN SEIL Co., Ltd. (Shizuoka, Japan). Polyclonal antibodies against RAGE, vascular endothelial growth factor (VEGF), CD31, and β-actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Mouse monoclonal and rabbit polyclonal antibodies against cyclins D1 and p27 were obtained from Cell Signaling Technology (Beverly, MA, USA). Rabbit polyclonal antibody against PCNA (proliferation cell nuclear antigen), MCP-1 (monocyte chemoattractant protein-1), and CD107b (Mac-3), and rabbit monoclonal antibody against melanA were obtained from Abcam Ltd (Cambridge, United Kingdom). .. Carboxy-H ₂ DFFFDA (5- (and-6) -carboxy-2', 7'-dihydrofluorescein diacetate) was purchased from Thermo Fisher Scientific (Sab Jose, CA, USA).

Preparation of AGEs BSA (25 mg / ml) was incubated with 0.1 M D-glyceraldehyde for 1 week under sterile conditions. The unbound sugar was then removed by dialysis against phosphate buffered saline. The obtained saccharified BSA (also referred to as AGE-BSA in the present specification) was used as AGEs in the following experiments. The control non-saccharified BSA was prepared under the same conditions except that D-glyceraldehyde was not added. In addition, mouse monoclonal antibodies against AGEs were prepared using AGE-BSA as an antigen.

Preparation of RAGE Aptamer As described in JP-A-2016-079184, the following sequences of SEQ ID NOs: 1 to 10 were selected as the aptamer to be bound to RAGE by the SELEX method. Based on these sequences, the aptamers # 1 to # 10 in Table 2 in which the oxygen atom of the phosphate group at the binding site between nucleotides was replaced with a sulfur atom were synthesized. In the following experiments, RAGE # 1 was used as a RAGE aptamer.

CCTGATATGGTGTCACCGCCGCCTTAGTATTGGTGTCTAC (SEQ ID NO: 1)
TCTGTTCAGGTTGGTACGGTGGAAGGTGTGATTCACGAGG (SEQ ID NO: 2)
CTTGGGTTGTTTATGTCGACCGCCAGTTTTGTGTTCAGCA (SEQ ID NO: 3)
CATTCTTAGATTTTTGTCTCACTTAGGTGTAGATGGTGAT (SEQ ID NO: 4)
TTGGTTCTCTTGCCCTCTTCTATTTTGTACGATGTTTCCT (SEQ ID NO: 5)
TTCCACTGAGTGCCGCGGACTGTTGTTGGGAGGTGGTGTG (SEQ ID NO: 6)
ATGGGGAGGAGGGGTGTCGTGGGGGGTGGGGGAGTGGGGA (SEQ ID NO: 7)
CTGGGGATGACTCGGATAGGATGTACGAGTTTGATGTGTA (SEQ ID NO: 8)
TTTGATCGAGCTGCGCCCTCCTCGCCGTAGAAGAGTGTGT (SEQ ID NO: 9)
TTTGGGGTGGAGTTAGGGGTGGATCAAGCGGGATTGTGTA (SEQ ID NO: 10)

Animal experiments G361 cells (American Type Culture Collection, Manassas, VA, USA) (2 x ¹⁰⁶ ), which are melanoma cells, were placed in the upper abdomen of 6-week-old female thymic nude mice (Japan Clea, Tokyo, Japan). Intradermal injection (n = 14). RAGE aptamers (38.4 pmol / day / g body weight, n = 6) or vehicles (n = 8) are continuously infused into the abdominal cavity of mice by osmotic mini pumps (Alzet osmotic pumps, model 1004, Cupertino, CA, USA). did. The minimum and maximum diameter and body weight of the tumor were measured twice a week and the tumor volume was calculated by the following formula: volume (mm ³ ) = ((minimum diameter) ² x (maximum diameter)) / 2. After 42 days of continuous infusion of RAGE aptamer or vehicle, mice were killed and the levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT), which are markers of liver damage, were measured by a chemical analyzer (FUJI DRI-CHEM 4000V; Fujifilm). Co., Tokyo, Japan). G361 melanoma and liver were harvested for immunohistochemical analysis.

Distribution and kinetics of [γ- ³² P] ATP-labeled RAGE aptamer [γ- ³² P] ATP-labeled RAGE aptamer (38.4 pmol / day / g body weight) was infiltrated into 8-week-old female Balb / c-nu / nu mice. Continuous infusion was performed with a pressure pump, and the mice were killed and blood was killed before the start of infusion (day 0), on the 1st, 3rd and 7th days after the start of infusion, and on the 3rd and 7th days after the infusion was stopped. And the organs were collected. The half-life of RAGE aptamer was defined as the time required for the amount of aptamer in the skin to be halved after injection for 7 days.

Immunohistochemical analysis G361 melanoma specimens were fixed with 4% paraformaldehyde, embedded in paraffin and sectioned at 4 μM intervals. Inhibits endogenous peroxidase activity and slices sections with antibodies against 8-OHdG, AGEs, RAGE, PCNA, cyclin D1, p27, VEGF, CD31, MCP-1, CD107b (Mac-3), and melanA at 4 ° C. Incubated overnight. Reactions other than cyclin D1 were visualized with Histofine Simple Stain MAX-PO (MULTI) (Nichirei Co., Tokyo, Japan), and expression of cyclin D1 was expressed by VECTOR MOM immunodetection Kit (Vector Lab., Inc., Burlingame). , CA, USA). Immune responses in five different fields for each sample were measured by microcomputer-assisted ImageJ.

G361 melanoma cells and human umbilical vein endothelial cells (HUVEC)
G361 cells were maintained in DMEM supplemented with 10% fetal bovine serum. In cell proliferation, RT-PCR, and Western blotting experiments, G361 cells were treated with 1 mg / ml non-glycated BSA or AGE-BSA for 24 hours in the presence or absence of various concentrations of RAGE aptamer or NAC. .. Experiments with G361 cells were performed in medium containing 1% fetal bovine serum.

HUVEC was obtained from Lonza Group Ltd. (Basel, Switzerland). In dihydroethidium (DHE) staining and RT-PCR analysis experiments, HUVEC was treated with 50 μg / ml non-glycated BSA or AGE-BSA in the presence or absence of 100 nM RAGE aptamer for 4 hours. HUVEC experiments were performed in media containing 2% fetal bovine serum, human fibroblast growth factor, and heparin.

Measurement of intracellular reactive oxygen species (ROS) production in G361 cells The intracellular production of ROS was detected by the fluorescent label carboxy-H ₂ DFFD. G361 cells were incubated with 10 μM carboxy H ₂ DFFDA or without carboxy H ₂ DFFDA for 1 hour. The cells were then treated with 1 mg / ml non-glycated BSA or AGE-BSA in the presence or absence of 1, 10, 100 nM RAGE-aptamers. After 24 minutes, intracellular superoxide production was measured. ROS production was calculated by subtracting the fluorescence of cells not treated with Carboxy H ₂ DFFDA from the fluorescence of cells treated with Carboxy H ₂ DFFDA.

G361 Cell Proliferation Assay G361 cell proliferation was measured by colorimetric analysis based on WST-1 according to the manufacturer's instructions (Roche Applied Science, Indianapolis, IN, USA).

ROS-produced HUVEC HUVEC was incubated with phenol red-free minimum essential medium containing 3M of DHE (Molecular Probes Inc., Eugene, OR, USA). After 30 minutes, images were obtained with a confocal laser scanning microscope. ROS production was assessed by fluorescence intensity in 5 different fields of each sample and analyzed by microcomputer-assisted ImageJ.

[ ³ H] thymidine uptake into HUVEC HUVEC was treated with 50 μg / ml non-saccharified BSA or AGE-BSA for 20 hours in the presence or absence of 100 nM RAGE aptamer. After further incubation with [ ^3H ] thymidine for another 4 hours, the uptake of [ ^3H ] thymidine into the cells was measured.

Western Blot Analysis The membrane was stained with antibodies against cyclin D, p27, and β-actin, and then immune complexes were visualized by the ECL detection system (Amersham Bioscience, Buckinghamshire, United Kingdom).

Real-time RT-PCR
Total RNA was extracted from G361 melanoma specimens, cultured G361 cells, or HUVEC using the NucleoSpin RNA XS kit (Takara Bio Inc., Shiga, Japan) according to the supplier's instructions. Quantitative real-time RT-PCR was performed by TaqMan 5 fluorogenic nuclease chemistry (Applied Biosystems, San Francisco, CA, USA).

Evaluation of THP-1 Cell Adhesion to HUVEC HUVEC was treated with 50 μg / ml non-glycated BSA or AGE-BSA for 24 hours in the presence or absence of 100 nM RAGE aptamer, followed by BCECF-AM labeling. Incubated with THP-1 cells for 4 hours. After incubation, the fluorescence intensity of the adhered THP-1 cells was measured.

Statistical analysis All values are shown with mean ± SD. Statistical comparisons between the two groups of animals were made by Student's t-test. Multiple comparisons were performed with One-way ANOVA and Tukey's test, Dunnett's test, Steel-Dwass test, or Student's t-test.

2. 2. Results Biodistribution and kinetics of RAGE aptamers As shown in FIG. 1A, when RAGE aptamers were continuously administered for 7 days, they were mainly distributed in adipose tissue, skin, muscles and kidneys. When the infusion was stopped, RAGE aptamer levels gradually decreased, but were detected in the skin and liver 7 days after removal of the osmotic pump (FIG. 1B). The elimination half-life of RAGE aptamers on the skin was approximately 3.7 ± 1.1 days.

Effect of RAGE aptamer on tumor growth and body weight in nude mice As shown in FIGS. 2A and 2B, G361 melanoma cells formed fast-growing tumors in nude mice, the size of which reached 400 mm ³ after 42 days. Continuous injection of RAGE aptamer into the abdominal cavity showed a significant decrease in tumor volume from day 31 and this tumor growth inhibitory effect was maintained until day 42. At the end of the experiment, the volume of G361 tumor in RAGE aptamer-treated mice was 1/3 of the volume of vehicle-treated mice (FIG. 2B). From the 17th day after the start of treatment, the body weight of the RAGE aptamer-treated mice was significantly heavier than that of the vehicle-treated mice (Fig. 2C).

Effect of RAGE Aptamer on AGE-RAGE Oxidative Stress in G361 Tumors of Nude Mice As shown in FIGS. 3A-C, immunohistochemical analysis revealed oxidative stress markers 8-OHdG, AGEs, in G361 tumors of nude mice. And it was revealed that the expression level of RAGE was significantly reduced by the treatment of RAGE aptamer.

Effect of RAGE Aptamer on Tumor Growth, Angiogenesis, and Macrophage Infiltration in Nude Mice By immunohistochemical detection of proliferating cells, the ratio of PCNA-positive cell nuclei to total nuclei is significant in G361 melanoma of nude mice treated with RAGE aptamer. It became clear that it was low (Fig. 4A). In addition, treatment with RAGE aptamer results in levels of mRNA and protein in tumors of cyclin D1, one of the G1 cyclins that promotes G1 progression, and p27, a cyclin-dependent kinase inhibitor that results in G1 cessation. Decreased (FIGS. 4B and C). In addition, as shown in FIG. 4D-G, treatment with RAGE aptamer for 42 days in tumors of VEGF, MCP-1, and CD31 and Mac-3, which are markers of endothelial cells and macrophages, respectively, in nude mice. The level has decreased. These results indicate that the RAGE aptamer directly suppressed the proliferation of G361 cells, and that the RAGE aptamer suppressed angiogenesis and macrophage infiltration into the tumor.

Effect of RAGE aptamer on liver metastasis of G361 tumor in nude mice Treatment of RAGE aptamer significantly inhibited the increase of AST and ALT in nude mice and attenuated liver metastasis of G361 tumor (Fig. 5). Melanoma, a marker of melanoma, was not detected in normal non-cancerous mice.

Effect of RAGE aptamer on ROS production, cell proliferation, VEGF and MCP-1 gene expression in G361 melanoma cells exposed to AGE-BSA As shown in FIGS. 6-1-6-3, AGE-BSA is G361. ROS production, cell proliferation, cyclin D1 and p27 expression, and VEGF and MCP-1 mRNA levels were significantly increased in melanoma cells, all of which were suppressed by concentration-dependent treatment with RAGE aptamers. The action of the antioxidant NAC was similar to the RAGE aptamer, with 3 mM NAC significantly diminishing these effects of AGE-BSA on G361 cells. These results suggest that the suppression of tumor growth by RAGE aptamers is due to the inhibition of the AGE-RAGE-oxidative stress system in G361 cells.

Effect of RAGE aptamers on ROS production, cell proliferation, and inflammatory response in HUVEC exposed to AGE-BSA As with G361 cells, AGE-BSA produces superoxide in HUVEC, [ ³ H] thymidin uptake. Significantly stimulated cell proliferation as measured by, and gene expression of VEGF, VCAM-1 and MCP-1, and adhesion of THP-1 macrophages to HUVEC, all of which were inhibited by RAGE aptamers (FIG. 7). ). 100 nM RAGE aptamers did not affect ROS production, VEGF, MCP-1, or VCAM-1 mRNA levels in HUVEC exposed to non-glycated BSA (data not presented). These results suggest that RAGE aptamers inhibit the AGE-RAGE system in vascular endothelial cells and suppress angiogenesis and macrophage infiltration.

1. 1. Method Reagent CML was purchased from Iris (Trischenreuth, Bavaria, Germany). Others used the same reagents as in Example 1. Mouse monoclonal antibodies against CML were obtained from Trans Genic Inc (Fukuoka, Japan). Mouse monoclonal antibodies against nitrotyrosine were obtained from Stress Marq Biosciences Inc (Victoria, British Columbia, Canada). Mouse monoclonal antibodies against VWF were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Preparation of RAGE aptamer Similar to Example 1, RAGE # 1 (Table 2) was used as the RAGE aptamer in the following experiments.

Animal experiments G361 cells (American Type Culture Collection, Manassas, VA, USA) (2 x ¹⁰⁶ ), which are melanoma cells, were placed in the upper abdomen of 6-week-old female thymic nude mice (Japan Clea, Tokyo, Japan). Subcutaneous injection (n = 14). From day 15, RAGE aptamer (RAGE # 1) (38.5 pmol / day / g body weight, n = 6) or vehicle (n = 7) was administered directly near the tumor by injection. Tumor volume and body weight were measured in the same manner as in Example 1. G361 melanoma was harvested for immunohistochemical analysis.

Immunohistochemical analysis A specimen of G361 melanoma was sectioned in the same manner as in Example 1, and the sections were incubated overnight with antibodies against CML, RAGE, nitrotyrosine, VEGF, CD31 and VWF at 4 ° C. Expression of CML, nitrotyrosine, VEGF and VWF was detected by VECTOR MOM immunodetection Kit (Vector Lab., Inc., Burlingame, CA, USA), and others were Histofine Simple Stain MAX-PO (MULTI) (Nichirei Co., The reaction was visualized in Tokyo, Japan). Immune responses in five different fields for each sample were measured by microcomputer-assisted ImageJ.

Binding analysis Whether or not the RAGE aptamer binds to RAGE and inhibits the binding between RAGE and its ligand was investigated by the QCM (quartz crystal microbalance) method. V-RAGE was immobilized on a QCM sensor plate and CML was added in the presence or absence of a RAGE aptamer to monitor ligand binding to v-RAGE.

G361 melanoma cells G361 cells were maintained in DMEM supplemented with 10% fetal bovine serum. In RT-PCR experiments, G361 cells were treated with 0, 0.1, 1, 5 μg / ml CML for 4 hours in the presence or absence of RAGE aptamers. Experiments with G361 cells were performed in medium containing 1% fetal bovine serum.

Measurement of intracellular reactive oxygen species (ROS) production in G361 cells The intracellular production of ROS was detected by the fluorescent label carboxy-H ₂ DFFD as in Example 1. G361 cells were incubated with 10 μM carboxy H ₂ DFFDA or without carboxy H ₂ DFFDA for 1 hour. The cells were then treated with 0, 0.1, 1, 5 μg / ml CML. Alternatively, it was treated with 0, 1, 10, 100 nM RAGE aptamers in the presence or absence of 1 μg / ml CML. After 40 minutes, intracellular superoxide production was measured. ROS production was calculated by subtracting the fluorescence of cells not treated with Carboxy H ₂ DFFDA from the fluorescence of cells treated with Carboxy H ₂ DFFDA.

Real-time RT-PCR
Total RNA was extracted from cultured G361 cells using the NucleoSpin RNA Plus kit (Takara Bio Inc., Shiga, Japan) according to the supplier's instructions. Quantitative real-time RT-PCR was performed by TaqMan 5 fluorogenic nuclease chemistry (Applied Biosystems, San Francisco, CA, USA).

2. 2. Results Effect of direct administration of RAGE aptamer on the proliferation of human melanoma transplanted into nude mice G361 cells (2 × 10 ⁶ cells) were subcutaneously injected into the upper abdomen of 6-week-old female aptamer nude mice (n = 14). From day 15, RAGE aptamer (RAGE # 1) (38.5 pmol / day / g body weight, n = 6) or vehicle (n = 7) was directly administered by injection near the tumor (FIG. 8). As a result, the tumor volume in the RAGE aptamer-treated group was significantly reduced as compared with the vehicle-treated group (FIGS. 9A and 9B). In addition, administration of RAGE aptamer significantly suppressed body weight loss (Fig. 9C).

Effect of direct administration of RAGE aptamer on AGE-RAGE oxidative stress and angiogenesis in G361 tumor of nude mice As shown in FIGS. 10A-F, it is one of AGEs in G361 tumor of nude mice by immunohistochemical analysis. It was revealed that the expression levels of CML, RAGE, nitrotyrosine as an oxidative stress marker, VEGF as an angiogenic factor, CD31 and VWF (von Willebrand factor) as markers for angiogenesis were significantly reduced by treatment with RAGE aptamer. became. These results indicate that the RAGE aptamer suppressed AGE-RAGE oxidative stress and angiogenesis.

Effect of RAGE aptamer on the binding affinity of CML and RAGE The effect of RAGE aptamer on the binding affinity of CML and RAGE was investigated using QCM (Quarts Crystal Microbalance). As a result of adding CML to v-RAGE fixed to the crystal plate as a host molecule in advance, the vibration frequency decreased and the bond between RAGE and CML was confirmed (FIG. 11A). In a similar experimental system, when RAGE aptamer was administered in advance before CML was added, RAGE aptamer and RAGE tended to bind to each other, and the subsequent binding to CML tended to be inhibited (FIG. 11B).

Effect of RAGE aptamer on ROS production in G361 melanoma cells exposed to CML Addition of CML to G361 melanoma cells significantly increased ROS production, with 1 μg / ml of CML producing the most ROS (FIG. 12A). When RAGE aptamer was added to the G361 melanoma cell culture system supplemented with 1 μg / ml of CML, the amount of ROS produced was significantly reduced as compared with the group to which only CML was administered (FIG. 12B). These results indicate that CML induced oxidative stress and RAGE aptamers suppressed it.

SEQ ID NO: 1: Aptamer SEQ ID NO: 2: Aptamer SEQ ID NO: 3: Aptamer SEQ ID NO: 4: Aptamer SEQ ID NO: 5: Aptamer SEQ ID NO: 6: Aptamer SEQ ID NO: 7: Aptamer SEQ ID NO: 8: Aptamer SEQ ID NO: 9: Aptamer SEQ ID NO: 10: Aptamer

Claims (3)

A pharmaceutical composition comprising a RAGE (Receptor for AGEs) aptamer for treating cancer, wherein the RAGE aptamer is a single-stranded DNA containing the sequence of SEQ ID NO: 1 and the cancer is melanoma . The pharmaceutical composition according to claim 1 , wherein the RAGE aptamer comprises the sequence of SEQ ID NO: 1. The pharmaceutical composition according to claim 1 or 2 , wherein the RAGE aptamer is a phosphorothioate-type oligonucleotide.

Images