JP6983395B2 - Anti-aging agent - Google Patents

Description

The present invention relates to an anti-aging agent characterized by containing Reishi. More specifically, age-related declines in immune function, IL-2 responsiveness, NK activity, cytokine production, IL-2 receptor production, granzyme production improvers, and additions. The present invention relates to a food composition having an action of improving functional deterioration with age.

With aging, many functions of humans decline. For example, deterioration of nerve and endocrine system functions, deterioration of sensory functions such as visual acuity and hearing, deterioration of physical functions such as muscle strength and range of motion of joints, deterioration of adaptability to environmental changes, deterioration of resistance to diseases, etc. Changes occur. Among them, the immune function, which is important for the formation of a defense mechanism against cancer and infectious diseases, is considered to show the greatest change with aging. In recent years, it has become clear that age-related changes in immune function affect the onset and pathophysiology of many age-related diseases such as metabolic diseases and chronic inflammation in various organs (Non-Patent Document 1). ..

The decline in immune function with aging leads to the morbidity of cancer and the development of infectious diseases, and the increase in mortality rate due to these diseases has become a medical and social problem. Cancer is the leading cause of death in Japan, and the number of deaths in 2016 will reach 370,000. It is said that there is a positive correlation between aging and the incidence of cancer, because the host side is involved in prolonged exposure to cancer progenitors, genetic changes associated with aging, and elimination of cancer cells. However, the biggest factor is the decrease in immune function in the host. In addition, since the resistance of elderly people to infection decreases, many elderly people die of pneumonia at the end of their life even if they suffer from cancer or cerebral infarction in facilities with many elderly people such as geriatric hospitals. These facts indicate that the immune function, which is the core of the biological defense mechanism, is significantly reduced in the elderly (Non-Patent Documents 2 to 4).

Furthermore, immune function is closely associated with many diseases such as heart disease, diabetes, kidney disease, chronic fatigue syndrome, and cognitive dysfunction, as well as cancer morbidity and infectious diseases. In addition, one-fourth of the 135 "intractable diseases (so-called intractable disease designation)" designated by the Ministry of Health, Labor and Welfare are involved in immunity, and one-third of the 56 "specific diseases" are immune. It is believed to be involved. In other words, age-related decline in immune function can lead to the onset and pathophysiology of a wide variety of diseases, and improving this can lead to a wide range of anti-aging, in addition to preventing cancer morbidity and infectious diseases. It is thought that it will lead to the effect.

One example of the decline in immune function with aging is the decline in the function of NK (natural killer) cells. NK cells are a type of lymphocytes that act as a major factor of the innate immune system, and have cytotoxic activity against cancer cells and virus-infected cells called NK activity. In the cytotoxic activity by NK cells, NK cells recognize and bind to target cells such as cancer cells and virus-infected cells, and send a protease called granzyme to the target cells through a channel formed by the polymerization of perforin, and the granzyme is used. It is known that it works by a mechanism that induces apoptosis in target cells by protease activity.

Although cytotoxic activity against target cells is brought about by NK cells, other lymphocytes, T cells, are also NK cells via cytokines such as IFNγ (interferon gamma) and TNFα (tumor necrosis factor alpha). Is involved in cytotoxic activity by activating.

IL-2 (interleukin-2) is known as a factor that activates lymphocytes such as NK cells and T cells, but the decline in immune function with aging is the responsiveness of lymphocytes to IL-2. It is believed that the decrease in the number of patients is a factor. Decreased responsiveness of lymphocytes to IL-2 means lymphocyte cell division and cytokines such as IFNγ and TNFα due to a decrease in IL-2 receptors in lymphocytes and abnormal signal transduction downstream of the receptors. It refers to the decrease or no reaction of cells evoked by IL-2 stimulation, such as production and granzyme production.

However, the decrease in IL-2 receptor due to aging, the decrease in gene expression thereof, and the decrease in affinity with IL-2 are not known in detail. Based on the above, in order to improve the decline in immune function associated with aging, it is said that the production of cytokines and granzymes is increased by improving the IL-2 responsiveness of lymphocytes and the production of IL-2 receptors. The method seems to be very effective.

Here, there are various reports on the pharmacological action of Reishi. Regarding immune function, foods that improve immune function through promotion of TNFα production (Patent Document 1), pharmaceuticals and foods by immunopotentiating action of Kasumi Reishi (Patent Document 2), macrophage phagocytosis activity and NK cell activity Disclosed are an immune system active substance by enhancement and a method for producing the same (Patent Document 3), an immune activity regulator containing an extract of a mycelium of a macrophage (Patent Document 4), and the like. However, nothing is known about its action on the decline of immune function with aging. The decline in immune function associated with aging is caused by a characteristic mechanism caused by a decrease in the responsiveness of IL-2 in lymphocytes and a decrease in IL-2 receptors. It cannot be solved with it. It is considered that an approach completely different from the previously disclosed pharmacological action of Reishi is required to improve the deterioration of immune function with aging.

Japanese Unexamined Patent Publication No. 2003-135028 Japanese Unexamined Patent Publication No. 2001-131083 Japanese Patent No. 3128147 Japanese Unexamined Patent Publication No. 2002-371004

Experimental Medicine 5, 2017, 35 (8), 1309-1315 Ken-ichi Isobe, Journal of the Japan Geriatrics Society, 2011, 48 (3), 205-210 Masaru Hirokawa, Journal of the Japan Geriatrics Society, 2003, 40 (6), 543-552 Tomio Arai, Journal of the Japan Geriatrics Society, 2010, 47 (5), 409-411

The present invention relates to an anti-aging agent characterized by containing Reishi. More specifically, age-related declines in immune function, IL-2 responsiveness, NK activity, cytokine production, IL-2 receptor production, granzyme production improvers, and additions. It is an object of the present invention to provide a food composition having an action of improving the functional deterioration with age.

As a result of diligent studies aimed at solving the above-mentioned problems, the present inventors improved the decrease in IL-2 responsiveness of lymphocytes with aging, and decreased the production of IL-2 receptor. It has been found that the improvement significantly enhances the action of IL-2, and has completed the present invention. Improving the responsiveness of IL-2 in lymphocytes and improving the production of IL-2 receptors is a completely different approach from the conventionally disclosed improvement in immune function, and the decrease in immune function with aging. It is thought that it will lead to a wide range of anti-aging effects, such as improvement of immune function and improvement of various diseases related to age-related changes in immune function.

The Ganoderma lucidum used in the present invention is a mushroom belonging to the genus Ganoderma of the Ganoderma genus, which is a reishi mushroom. , Ganoderma lucidum (Ganoderma lucidum), Ganoderma lucidum (Ganoderma lucidum), Ganoderma lucidum (Ganoderma lucidum), Ganoderma lucidum (Ganoderma lucidum) and Ganoderma lucidum (Ganoderma lucidum) are known. In the present invention, all mushrooms belonging to the family Ganoderma lucidum can be used, but Reishi, Black Reishi, Purple Reishi, Blue Reishi, Yellow Reishi, and White Reishi are preferable, and Reishi is more preferable. It is desirable to use (red turf, Ganoderma lucidum) or black reishi (black turf, Ganoderma sinensis, Ganoderma atrum).

The Reishi used in the present invention can be used regardless of fruiting bodies, spores, myceliums, natural products, cultivated products, cultures, etc., and those widely distributed in the Chinese and Japanese markets can be used. can. Further, if necessary, the as-is state, crushed matter, dried matter and the like can be appropriately selected and subjected to the extraction operation. Further, as a method for obtaining spores, examples thereof include atomization treatment, roll press treatment, grinding treatment, ultrahigh pressure microsteam treatment, and other mechanical methods usually used industrially.

The spirit turf used in the present invention contains water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.) and liquid polyhydric alcohols (1, 3) as extraction solvents. -Butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, petroleum ether, etc.), ethers (ethyl) Ether, tetrahydrofuran, propyl ether, etc.) and the like can be used. These solvents may be used alone or in admixture of two or more. Preferably, water, ethanol, or a mixture thereof is used.

The intake amount of Reishi used in the present invention varies depending on the dosage form, purpose of use, age, body weight, etc., but is 1 to 20000 mg / day, preferably 10 to 10000 mg / day, more preferably 50 to 50 to dry matter. It can be orally administered once to several times a day in the range of 5000 mg / day. In some cases, a smaller amount than the above dose range may be sufficient, and in other cases, it may be necessary to administer beyond the range. Further, the method of adding the medicinal ingredient in the formulation may be added in advance or may be added during the production, and may be appropriately selected in consideration of workability.

The anti-aging agent of the present invention can be used for any of foods, quasi-drugs or pharmaceuticals. The dosage forms include powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids, emulsions and the like for oral use. It can also be used as an injection, a suppository, or the like for parenteral use.

The anti-aging agent of the present invention may be used as it is, and as long as the effect is not impaired, the excipients and stabilizers used in ordinary pharmaceuticals, non-pharmaceutical products or foods are used as needed. , Preservatives, binders, disintegrants, hydrocarbons, fatty acids, alcohols, esters, pH regulators, preservatives, fragrances and the like.

The anti-aging agent of the present invention can significantly enhance the action of IL-2 by improving the decrease in IL-2 responsiveness of lymphocytes and the decrease in IL-2 receptor production associated with aging. .. Thereby, the improvement of the decrease in immune function can be achieved by improving the decrease in NK activity, the decrease in cytokine production, and the decrease in granzyme production with aging.

Hereinafter, examples will be given to explain the present invention in detail, but the present invention is not limited thereto.

Production Example 1 Reishi Hot Water Extract Add 400 mL of purified water to 20 g of dried Reishi (Ganoderma lucidum), extract at 95-100 ° C for 2 hours, filter, concentrate the filtrate, and freeze-dry. 1.4 g of Reishi hot water extract was obtained.

Production Example 2 Reishi Ethanol Extract 900 mL of ethanol is added to 100 g of dried Reishi (Ganoderma lucidum), extracted at room temperature for 7 days, filtered, and the filtrate is concentrated to dryness to extract Reishi ethanol. Was obtained in an amount of 1.6 g.

Production Example 3 Black Reishi Hot Water Extract
400 mL of purified water is added to 20 g of a dried product of Ganoderma sinensis, extracted at 95 to 100 ° C. for 2 hours, filtered, the filtrate is concentrated, and freeze-dried to obtain a hot water extract of Ganoderma lucidum. Was obtained in an amount of 1.1 g.

Production Example 4 Black Reishi Ethanol Extract
900 mL of ethanol was added to 100 g of a dried product of Ganoderma sinensis, extracted at room temperature for 7 days, filtered, and the filtrate was concentrated to dryness to obtain 1.4 g of black Reishi ethanol extract. ..

Production Example 5 Reishi spore hot water extract 20 g of dried spores of Reishi (Ganoderma lucidum) is atomized, 400 mL of purified water is added, and the mixture is extracted at 95 to 100 ° C. for 2 hours, filtered, and the filtrate thereof. Was concentrated and dried by freezing to obtain 1.2 g of Reishi spore hot water extract.

Production Example 6 Reishi spore ethanol extract 100 g of dried spores of Reishi (Ganoderma lucidum) is atomized, 900 mL of ethanol is added, extracted for 7 days at room temperature, filtered, and the filtrate is concentrated to dryness. Then, 1.5 g of Reishi spore ethanol extract was obtained.

In the following formulation examples,% indicates weight%.

Prescription example 1 Soft capsule <Prescription>
Ingredient content (%)
1. 1. Reishi hot water extract (Production Example 1) 30.0
2. 2. Rice germ oil 60.0
3. 3. Beeswax 7.0
4. Vitamin E 3.0
<Manufacturing method>
Ingredients 1 to 4 are mixed, 250 mg is filled in a film composed of gelatin, glycerin, and caramel color, and after drying, a soft capsule is obtained.
<Usage>
Take 4 tablets per day.

Prescription example 2 Hard capsule <Prescription>
Ingredient content (%)
1. 1. Reishi hot water extract (Production Example 1) 20.0
2. 2. Cornstarch 72.0
3. 3. Sucrose fatty acid ester 8.0
<Manufacturing method>
Ingredients 1 to 3 are mixed and 250 mg of No. 2 hard capsule is filled to obtain a capsule.
<Usage>
Take 4 tablets per day.

Prescription example 3 Beverage <Prescription>
Ingredient content (%)
1. 1. Black Reishi Hot Water Extract (Production Example 3) 1.0
2. 2. Citric acid 6.0
3. 3. Sucrose 10.0
4. Fragrance 1.0
5. Water 82.0
<Manufacturing method>
Ingredients 1 to 4 are stirred and dissolved in a part of water of ingredient 5. Next, the remaining water of component 5 is added and mixed, and the sterilized product is used as a beverage.
<Usage>
Ingest 50 mL per day.

Prescription example 4 Granules <Prescription>
Ingredient content (%)
1. 1. Reishi Ethanol Extract (Production Example 2) 8.0
2. 2. Lactose 80.0
3. 3. Cellulose 12.0
<Manufacturing method>
Ingredients 1 to 3 are granulated by a dry method to obtain granules.
<Usage>
Take 1g per day.

Prescription example 5 Tablets <Prescription>
Ingredient content (%)
1. 1. Reishi spore hot water extract (Production Example 5) 11.0
2. 2. Lactose 60.0
3. 3. Reduced maltose starch syrup 25.0
4. Sucrose fatty acid ester 4.0
<Manufacturing method>
Ingredients 1 to 4 are mixed and tableted to obtain 0.5 g of tablets.
<Usage>
Take 2 tablets per day.

Prescription example 6 Jelly <Prescription>
Ingredient content (%)
1. 1. Black Reishi Ethanol Extract (Production Example 4) 0.001
2. 2. Carrageenan 2.0
3. 3. Gelatin 1.0
4. Sugar 28.5
5. Purified water 68.499
<Manufacturing method>
Ingredients 1 to 5 are mixed, boiled down while heating, poured into a jelly mold, and cooled.
<Usage>
Ingest 1 piece (100 g) per day.

Next, using the Reishi shown in Example 1, an experimental example and the result regarding improvement of IL-2 responsiveness of lymphocytes are shown.

Experimental Example 1 NK activity test and cytokine production test using mouse lymphocytes The spleen was removed from young mice (ICR mice 12 weeks old) and aged mice (ICR mice 64 weeks old), and NK was removed from each mouse. Lymphocytes containing cells, T cells, etc. were prepared. The cells were seeded on a 24-well plate, and IL-2 was added (final concentration 20 U / mL) and IL-2 was not added, and Reishi of Production Example 1 or Production Example 5 was added (final concentration). 2 μg / mL), and the cells were cultured. After culturing, the cells and the culture supernatant were collected, and the cells were co-cultured with the target cancer cell YAC-1 for 24 hours to measure the NK activity. For the culture supernatant, the amount of IFNγ produced and the amount of TNFα produced were measured using ELISA. Furthermore, the cells after measuring the NK activity were collected and the gene expression analysis of Granzyme A and B was performed. The primers used for gene expression analysis are as follows.

Primer set for Granzyme A CACTGTAACGTGGGAAAGAG (SEQ ID NO: 1)
GTGAAGGATAGCCACATTTCTG (SEQ ID NO: 2)
Primer set for Granzyme B CTGCTAAAAGCTGAAGAGTAAGG (SEQ ID NO: 3)
TTTAAAGTAGGACTCACACTCCC (SEQ ID NO: 4)

The test results are shown in Table 1-1 and Table 1-2. As the numerical value, the value of the sample-free group in the young mouse when IL-2 was added was set to 100%, and the other values showed relative values to it.

As shown in Table 1-1, when IL-2 was added, the NK activity, IFNγ production amount, and TNFα production amount were all clearly decreased with aging, but the addition of Reishi was extremely significant improvement. Was recognized. On the other hand, in the case where IL-2 was not added, the changes in these immune indicators due to aging and the improvement by the addition of Reishi were extremely limited. From the above results, it was considered that Reishi works more strongly to enhance the IL-2 action than to directly activate lymphocytes such as NK cells and T cells.

Next, the results of gene expression analysis of Granzyme A and B are shown in Table 1-2. When IL-2 was added, the gene expression of Granzyme A and B was clearly decreased with aging, but the addition of Reishi showed a remarkable improvement. On the other hand, in the case where IL-2 was not added, the change in the gene expression of Granzyme A and B with aging and the improvement by the addition of Reishi were extremely limited.

Further, in Black Reishi of Production Example 3, similar improvement effects were observed on NK activity, IFNγ production amount, TNFα production amount, and gene expression of Granzyme A and B.

Experimental Example 2 Efficacy test using naturally aged mice A 12-week-old HR-1 hairless mouse was bred with a feed containing 2% of Reishi of Production Example 1 for 12 months. For comparison, a group in which the mice were fed with normal feed for 12 months and a group of young mice (12 weeks old) were set. The spleen was removed to prepare lymphocytes, IL-2 was added (final concentration 20 U / mL), and NK activity was measured by co-culturing with the target cancer cell YAC-1 for 24 hours. For the culture supernatant, the amount of cytokines (IFNγ, TNFα, IL-2, IL-12) produced was measured using ELISA. Furthermore, cells after NK activity measurement were collected and various gene expression analyzes were performed.

Table 2 shows the measurement results of NK activity and cytokine production. As for the numerical values, the value of the young mouse group of the normal diet was set to 100%, and the others showed relative values to it. Comparing young and aged mice, NK activity, IFNγ production, and TNFα production were all clearly reduced in the aged mice, and a decrease in immune function due to aging, that is, a decrease in IL-2 responsiveness was observed. Was done.

When bred with a feed containing Reishi, NK activity, IFNγ production, and TNFα production were significantly improved, and Reishi decreased NK activity due to a decrease in IL-2 responsiveness with aging. It exhibited excellent effects in improving the above, and improving the decrease in IFNγ production and TNFα production. IL-2 and IL-12 were also measured as cytokines involved in NK cell activation, but both were below the detection limit of ELISA. This result indicates that simply increasing the production of IL-2 cannot improve the decline in immune function due to aging.

Next, gene expression analysis of IL-2 responsiveness-related factors was performed. The primers used for gene expression analysis are as follows.

Primer set for IL-2 receptor α TCCTAAACTGTGAATGCAAGAG (SEQ ID NO: 5)
ATTTGTCTAGGGGAGTTGCTG (SEQ ID NO: 6)
Primer set for IL-2 receptor β CCTTTGACAACCTTCGCCTG (SEQ ID NO: 7)
AGCATCTCCAAGAAGAGCCA (SEQ ID NO: 8)
Primer set for IL-2 receptor γ GCTGAAAACGAGAATCCTTCC (SEQ ID NO: 9)
CGTTCCAACCAACAGTACAC (SEQ ID NO: 10)
Primer set for Myc ATCAGCAACAACCGCAAGTG (SEQ ID NO: 11)
GTGTCCGCCTCTTGTCGTTT (SEQ ID NO: 12)
Primer set for Bcl-2 CCGGGAGATACGTGATAGAGT (SEQ ID NO: 13)
ATCTCCAGCATCCCACTCGTA (SEQ ID NO: 14)
Primer set for Jun AAACAGAGCATGAACCTTGAACC (SEQ ID NO: 15)
GTCGGTGTAGTGGTGATGTG (SEQ ID NO: 16)
Primer set for Fos CAAAGTAGAGCAGCTACTCCT (SEQ ID NO: 17)
CAGACCTCCAGTCAAATCCA (SEQ ID NO: 18)
Primer set for p16 TGATGATGATGGGGCAAGTT (SEQ ID NO: 19)
TCGAACTTGCACCGTAGTTGAG (SEQ ID NO: 20)
Primer set for p21 CCGAGAACGGTGGAACTTTG (SEQ ID NO: 21)
AACGCCGTCCCCAGACGAA (SEQ ID NO: 22)
Primer set for p53 CGACCATTCCTTACCATCATCACA (SEQ ID NO: 23)
GGCACAAAACCGAACCCAA (SEQ ID NO: 24)

The results of gene expression analysis of the IL-2 receptor are shown in Table 3-1. The IL-2 receptor is composed of three types, α, β, and γ. As a result of the test, the gene expression of IL-2 receptor α and IL-2 receptor γ decreased with aging and improved by administration of Reishi. Although IL-2 receptor β did not decrease with age, administration of Reishi showed more than 2-fold promotion of gene expression.

Since the signal from the IL-2 receptor leads to the production of granzyme via its downstream factor, gene expression analysis of the downstream factors Myc, Bcl2, Jun, and Fos of the IL-2 receptor signal was performed. From the results shown in Table 3-2, there was no effect of aging-related gene expression decrease or Reishi administration on Fos, but the downstream factors of IL-2 receptor signal other than Fos were due to aging. There was a marked improvement in expression and administration of Reishi.

The results of gene expression analysis of Granzyme A and B are shown in Table 3-3. The gene expression of Granzyme A and B was clearly decreased with aging, and a remarkable improvement was observed by the administration of Reishi. From the results of Table 3-1 and Table 3-2, it was clarified that Reishi ameliorated the decrease in responsiveness of IL-2 with aging.

The results of gene expression analysis of general cellular senescence markers are shown in Table 3-4. As a result, in all of the genes p16, p21, and p53, an increase in expression due to aging and suppression of expression due to administration of Reishi were observed.

Further, also in the black spirit turf of Production Example 3, NK activity, IFNγ production amount, TNFα production amount, Granzyme A and B gene expression, IL-2 receptor α, β and γ gene expression, cellular senescence marker p16, Similar improvement effects were observed for p21 and p53 gene expression.

In order to search for factors that play a more important role in the exertion of the NK activity improving effect by Reishi, the NK activity of each individual and Table 3-1 and Table 3 for the mice in the Reishi administration group in Experimental Example 2 -2, Correlation analysis with the gene expression shown in Table 3-3 and Table 3-4 was performed. For IFNγ and TNFα, correlation analysis was performed with the ELISA measurement values shown in Table 2.

Table 4 shows the correlation coefficient between NK activity and gene expression or ELISA measurement. The correlation coefficient takes a value from -1 to 1, and the larger the absolute value, the stronger the correlation between the two types of data (in this case, the NK activity and the gene expression or ELISA measurement value). If the value is positive, it is judged to be a positive correlation (when one value increases, the other value tends to increase). As a result of the analysis, it was revealed that the NK activity has a very strong correlation with the gene expression of Granzyme A and B. That is, it is very important to improve the gene expression of granzyme in order to improve the decrease in NK activity with aging, and Reishi can exert an excellent effect on the improvement of the gene expression of granzyme with aging. It became clear.

From the above results, Reishi was found to have the effect of improving the decline in immune function associated with aging. Reishi was found to improve overall immune function decline by improving IL-2 responsiveness, IL-2 receptor production, and granzyme production.

The anti-aging agent comprising the Reishi of the present invention is effective against age-related decreased immune function, decreased NK activity, decreased IL-2 responsiveness of lymphocytes, decreased cytokine production and decreased granzyme production. It showed an excellent improvement effect. The fundamental improvement of the decline in immune function associated with aging leads to the improvement of various age-related diseases related to immune function such as metabolic diseases and chronic inflammation, and can be widely used as pharmaceuticals, quasi-drugs, and foods. ..

Claims (2)

An IL-2 responsiveness improving agent (excluding anti-aging agents and immune function lowering improving agents), which is characterized by containing Reishi. A food composition for improving IL-2 responsiveness, which is characterized by containing Reishi (excluding anti-aging food composition and food composition for improving immune function deterioration).