JP6960577B2 - Primer set capable of identifying 3 subspecies of nontuberculous mycobacteria and method for identifying 3 subspecies of nontuberculous mycobacteria - Google Patents

Description

The present invention relates to a primer set capable of identifying three subspecies of nontuberculous mycobacteria and a method for identifying three subspecies of nontuberculous mycobacteria.

Acid-fast bacilli are roughly classified into three types: tubercle bacilli, leprosy bacteria, and nontuberculous acid-fast bacilli. More than 170 types of nontuberculous mycobacteria have been reported so far, and it is known that about 30 of them are pathogenic to humans. Among nontuberculous mycobacteriosis, Mycobacterium abscessus complex disease is not effective with existing antibacterial drugs and no effective treatment method has been established. Therefore, the number of patients is increasing and the number of severe cases is increasing. In Japan as well, the number of patients with pulmonary Mycobacterium abscessus complex disease is rapidly increasing. From the latest epidemiological survey, the prevalence is estimated to be 0.5 per 100,000, which is about five times higher than the previous survey.

The causative organism group, Mycobacterium abscessus complex, is composed of three subspecies, Mycobacterium abscessus subsp. Abscessus, Mycobacterium abscessus subsp. Massiliense, and Mycobacterium abscessus subsp. Bolletii. Since it has been reported that there are differences in resistance acquisition ability and treatment results, it is important to distinguish the three subspecies in selecting an appropriate treatment method.

However, the Mycobacterium abscessus complex cannot be differentiated at the subspecies level in the acid-fast bacillus species discrimination kit DDH Mycobacterium Far East, which is frequently used in clinical practice in Japan. In order to accurately and objectively distinguish the Mycobacterium abscessus complex 3 subspecies, phylogenetic analysis based on genomic information, housekeeping genes such as hsp65 gene and rpoB gene, and multilocus sequence analysis using spacer regions, or pulse field Although analysis by electrophoresis is required, these methods are labor-intensive and costly, and are not suitable for differentiating bacterial species in clinical practice in terms of speed.

Non-Patent Document 1 describes a method for discriminating between two species, Mycobacterium abscessus subsp. Abscessus and Mycobacterium abscessus subsp. Massiliense, using a multiplex PCR primer. However, the above-mentioned three subspecies have different therapeutic responsiveness, and a method capable of distinguishing one of the three subspecies is required.

Discrimination of Mycobacterium abscessus subsp. Massiliense from Mycobacterium abscessus subsp. Abscessusin Clinical Isolates by Multiplex PCR, Kazue Nakanaga, Journal of Clinical Microbiology, January 2014 Volume 52 Number 1

The present invention has been made in view of such problems, and is a primer capable of distinguishing three subspecies of nontuberculous mycobacteria, Mycobacterium abscessus subsp. Abscessus, Mycobacterium abscessus subsp. Massiliense, and Mycobacterium abscessus subsp. Bolletii. The purpose is to provide a set.

The primer set according to the present invention is a primer set capable of identifying three subspecies of Mycobacterium abscessus subsp. Abscessus, Mycobacterium abscessus subsp. Massiliense, and Mycobacterium abscessus subsp. Bolletii, which are nontuberculous mycobacteria.
The first primer consists of:
Forward Primer (Primer F) gttcggatcgcatggcgttgtgctg ... SEQ ID NO: 1
Reverse primer (Primer R) gggatgctgtgatcgaggtcggc ・ ・ SEQ ID NO: 2
The second primer is characterized by the following.
Forward Primer (Primer F) gagggcacgggagagaccaccggag ... SEQ ID NO: 3
Reverse primer (Primer R) ccatttcYctatcYcgcccg (Y is c or t) ... SEQ ID NO: 4

According to the present invention, three subspecies of Mycobacterium abscessus subsp. Abscessus, Mycobacterium abscessus subsp. Massiliense, and Mycobacterium abscessus subsp. Bolletii, which are nontuberculous mycobacteria, can be identified.

It is a figure which shows the result of the phylogenetic analysis of three subspecies of nontuberculous mycobacteria. It is an electrophoretic photograph which shows that the amplification reaction by a false positive does not occur about the primer set of SEQ ID NO: 1 and 2. FIG. 5 is an electrophoretic photograph showing that the amplification reaction due to false positives does not occur for the primer sets of SEQ ID NOs: 3 and 4. It is an electrophoretic photograph showing the detection of the standard strain and the clinical isolate of Mycobacterium abscessus complex by the primer for multiplex PCR.

Hereinafter, embodiments of the present invention will be specifically described with reference to the accompanying drawings, but the embodiments are for facilitating understanding of the principles of the present invention, and the scope of the present invention is as follows. The present invention is not limited to the embodiment, and other embodiments in which those skilled in the art appropriately replace the configurations of the following embodiments are also included in the scope of the present invention.

Pulmonary Mycobacterium abscessus complex disease is divided into three subspecies: Mycobacterium abscessus subsp. Abscessus, which is ineffective for treatment, Mycobacterium abscessus subsp. Bolletii, which is rare but equally intractable, and Mycobacterium abscessus subsp. A clear distinction from massiliense has become essential in clinical practice. It has been found that the cause of the difference in therapeutic responsiveness between variants is characterized by the presence or absence of resistance-inducing gene (erm gene) activity.

The present inventors have obtained genomic information of standard strains and clinical isolates of Mycobacterium abscessus subsp. Abscessus, Mycobacterium abscessus subsp. Massiliense, and Mycobacterium abscessus subsp. Analysis was performed. By this analysis, we found insertion / defect sites specific to each of the three subspecies belonging to the Mycobacterium abscessus complex.

The primer set according to the present invention is a primer set for multiplex PCR. Multiplex PCR is a method of simultaneously amplifying a plurality of gene regions by simultaneously using a plurality of primer pairs in one PCR reaction system.

The primer set according to the present invention comprises a first primer pair and a second primer pair.

The first primer consists of:
Forward primer gttcggatcgcatggcgttgtgctg ・ ・ ・ SEQ ID NO: 1
Reverse primer gggatgctgtgatcgaggtcggc ・ ・ ・ SEQ ID NO: 2
The second primer consists of:
Forward primer gagggcacgggagagaccaccggag ・ ・ ・ SEQ ID NO: 3
Reverse primer ccatttcYctatcYcgcccg (Y is c or t) ・ ・ ・ SEQ ID NO: 4
By nucleic acid amplification using these primer sets, three subspecies of nontuberculous mycobacteria, Mycobacterium abscessus subsp. Abscessus, Mycobacterium abscessus subsp. Massiliense, and Mycobacterium abscessus subsp. Bolletii can be identified. Multiplex PCR is used for nucleic acid amplification as described above.

Genome information of standard strains and clinical isolates of Mycobacterium abscessus complex 3 subspecies was obtained by DNA prepared from pure culture and next-generation sequencer (MiSeq (illumina)).

First of all, the genomic information of the obtained standard strain and clinical isolate of Mycobacterium abscessus complex and the sequence information of the standard strain already registered in NCBI (National Center for Biotechnology Information) (accession number NC_010397 (Mycobacterium abscessus subsp)). .Abscessus), NZ_AP014547 (Mycobacterium abscessus subsp. Massiliense), NZ_AHAS00000000 (Mycobacterium abscessus subsp. Bolletii)) were used for phylogenetic analysis, and the strains of Mycobacterium abscessus complex clinical isolates were differentiated at the subspecies level.

Next, the obtained genomic information was aligned with nucleic acid sequences using Mauve software (Darling et al. (2005)) to search for and discover insertion / deletion sites specific to each of the three subspecies. PCR primers complementary to the common sequences upstream and downstream of the site were prepared.

The first primer was:
Forward primer gttcggatcgcatggcgttgtgctg ・ ・ ・ SEQ ID NO: 1
Reverse primer gggatgctgtgatcgaggtcggc ・ ・ ・ SEQ ID NO: 2
The second primer was:
Forward primer gagggcacgggagagaccaccggag ・ ・ ・ SEQ ID NO: 3
Reverse primer ccatttcYctatcYcgcccg (Y is c or t) ・ ・ ・ SEQ ID NO: 4
First, a verification experiment was conducted to confirm whether the PCR primer set of the present invention can correctly amplify the amplification target region.

As a test method, it was confirmed that a correct amplification product could be obtained by carrying out an amplification reaction by the PCR method using a PCR reaction solution containing the PCR primer of the present invention and electrophoresing the amplification product. Specifically, each of the two types of primer sets will be described in Tests 1 and 2 below.

(Test 1)
First, a PCR primer was set, and one provided with a primer consisting of the nucleotide sequences shown in SEQ ID NOs: 1 and 2 was used. The region to be amplified is the downstream region of the membrane transporter proteins (MAB_2613, MMASJCM_RS12825, MBOL_24380) common to the genomic DNA of each of the three Mycobacterium abscessus subspecies. In this downstream region, 81 bp sequence deletion is observed in Mycobacterium abscessus subsp. Massiliense compared to Mycobacterium abscessus subsp. Abscessus, and 781 bp sequence insertion is observed in Mycobacterium abscessus subsp. Bolletii. Therefore, the amplification products are 503 bp for Mycobacterium abscessus subsp. Abscessus, 422 bp for Mycobacterium abscessus subsp. Massiliense, and 1204 bp for Mycobacterium abscessus subsp. Bolletii.

As the PCR reaction solution, the one having the following composition was used. Primers were synthesized by Sigma-Genosys LP. Others are manufactured by applied biosystems.
・ Mixed solution of buffer solution, nucleic acid synthesis substrate and nucleic acid synthase 2 × AmpliTaq Gold 360 Master Mix 10 μl
・ PCR enhancer 10 × GC enhancer 2 μl
・ Primer F (10 ng / μl, final conc. 10 ng) 1 μl
・ Primer R (10 ng / μl, final conc. 10 ng) 1 μl
・ Sample DNA 1 μl
・ Sterile water 5 μl
(Total amount 20 μl)
In addition, the sample DNA contained the genomic DNAs of the test strains or clinical isolates of the acid-fast bacilli shown in the following 1 to 13 separately, and PCR was performed individually.
1. 1. Mycobacterium abscessus subsp. Abscessus ATCC 19977
2. Mycobacterium abscessus subsp. 5 clinical isolates of abscessus 3. Mycobacterium abscessus subsp. Massiliense JCM 15300
4. 6. Clinical isolates of Mycobacterium abscessus subsp. Massiliense 5. Mycobacterium abscessus subsp. Bolletii JCM 15297
6. Three clinical isolates of Mycobacterium abscessus subsp. Bolletii 7. Mycobacterium chelonae JCM 6388
8. Mycobacterium conceptionense JCM 15299
9. Mycobacterium fortuitum ATCC 6841
10. Mycobacterium houstonense JCM 15656
11. Mycobacterium salmoniphilum ATCC 13758
12. Mycobacterium senegalense ATCC 35796
13. Mycobacterium smegmatis ATCC 700084
14. Negative Cont.
Strains of these acid-fast bacilli were distributed from the following institutions.
・ ATCC American Type Culture Collection
・ JCM Japan Collection of Microorganisms
The clinical isolates of Mycobacterium abscessus subsp. Abscessus, Mycobacterium abscessus subsp. Massiliense and Mycobacterium abscessus subsp. Bolletii were sold by the Tuberculosis Research Institute of the Tuberculosis Prevention Association. These clinical isolates were subjected to genome sequencing and then phylogenetic analysis was performed together with the test strains 1, 3 and 5 to confirm which subspecies they were classified into. The result of phylogenetic analysis is shown in FIG.

A test using a PCR reaction solution containing acid-fast bacilli of the test strains 7 to 13 was carried out to confirm a false positive reaction with respect to the PCR primer set of the present embodiment. In the 14th test, the same amount of sterilized water was added to the PCR reaction solution instead of the sample DNA.

A master cycler gradient (manufactured by Eppendorf) or PCR Thermal Cycler Dice (manufactured by Takara) was used for gene amplification by the PCR method. The PCR conditions were as follows.
(1) 95 ° C. 2 minutes (2) 95 ° C. 40 seconds (3) 62 ° C. 40 seconds (4) 72 ° C. 1 minute (2) to (4) for 30 cycles (5) 75 ° C. 5 minutes Next, PCR method The product of the above was run on each amplification target region by agarose gel electrophoresis, and it was confirmed whether or not the correct amplification product was obtained. Electrophoresis was performed using Mupid-2 plus (manufactured by Takara). The result is shown in FIG.

In FIG. 2, each band shows the result of electrophoresis of the PCR product performed using the PCR reaction solution containing the DNA of each sample. The same applies to Test 2.

The PCR primer set of Test 1 includes primers consisting of the base sequences shown in SEQ ID NOs: 1 and 2, and the region to be amplified is the downstream region of the membrane transporter gene common to the Mycobacterium abscessus 3 subspecies, and is amplified. The products are 503 bp for Mycobacterium abscessus subsp. Abscessus, 422 bp for Mycobacterium abscessus subsp. Massiliense, and 1204 bp for Mycobacterium abscessus subsp. Bolletii.

In FIG. 2, a band of around 500 bp can be seen in the test strain 1 and the clinical isolate 2 using the genomic DNA of Mycobacterium abscessus subsp. Abscessus as the sample DNA. Similarly, a band is observed at around 420 bp in the test strain 3 and the clinical isolate 4, and a band is observed at around 1200 bp in the test strain 5 and the clinical isolate 6. No band was found in the vicinity of the other co-test strains 7 to 13.

Based on the above, strains 1 to 6 using the genomic DNAs of Mycobacterium abscessus subsp. Abscessus, Mycobacterium abscessus subsp. Massiliense and Mycobacterium abscessus subsp. Bolletii as sample DNA were classified into Mycobacterium abscessus 3 subspecies by the primer set of Test 1. It can be judged that the downstream region of the common membrane transporter gene is correctly amplified.

On the other hand, when referring to the lanes of the test strains 7 to 13 using other genomes as the DNA of the sample, the amplification of the non-target region is such that the downstream region of the membrane transporter gene is mistakenly amplified. I couldn't see it.

As a result, it was confirmed that the downstream region of the membrane transporter common to the Mycobacterium abscessus 3 subspecies can be specifically amplified by using a primer set for PCR including the primers consisting of the nucleotide sequences shown in SEQ ID NOs: 1 and 2. rice field.

(Test 2)
The experiment was carried out in the same manner as in Test 1 except that a primer consisting of the nucleotide sequences shown in SEQ ID NOs: 3 and 4 was used as a set as a primer for PCR. The result is shown in FIG.

The amplification target region of the PCR primer set in Test 2 is the downstream region of the ATP-binding cassette transporter gene (MAB_1655, MMASJCM_RS08315, MBOL_16200) common to the Mycobacterium abscessus 3 subspecies. In this downstream region, a 361 bp sequence loss is observed in Mycobacterium abscessus subsp. Massiliense and a 200 bp sequence loss is observed in Mycobacterium abscessus subsp. Bolletii as compared with Mycobacterium abscessus subsp. Abscessus. Therefore, the amplification products are 652 bp for Mycobacterium abscessus subsp. Abscessus, 291 bp for Mycobacterium abscessus subsp. Massiliense, and 452 bp for Mycobacterium abscessus subsp. Bolletii.

In FIG. 3, a band near 650 bp can be seen in the test strain 1 and the clinical isolate 2 using the genomic DNA of Mycobacterium abscessus subsp. Abscessus as the sample DNA. Similarly, a band is observed at around 450 bp in the test strain 3 and the clinical isolate 4, and a band is observed at around 290 bp in the test strain 5 and the clinical isolate 6. No band was found in the vicinity of the other co-test strains 7 to 13.

Therefore, in strains 1 to 6 using the genomic DNAs of Mycobacterium abscessus subsp. Abscessus, Mycobacterium abscessus subsp. Massiliense and Mycobacterium abscessus subsp. Bolletii as sample DNA, the ATP common to the Mycobacterium abscessus 3 subspecies was determined by the primer set of Test 2. It can be determined that the downstream region of the binding cassette transporter gene is correctly amplified.

On the other hand, when referring to the lanes of the test strains 7 to 13 using other genomes as the DNA of the sample, the downstream region of the ATP-binding cassette transporter gene is misunderstood as amplified. No amplification was seen.

As a result, the downstream region of the ATP-binding cassette transporter gene common to the Mycobacterium abscessus 3 subspecies can be specifically amplified by using a primer set for PCR including the primers consisting of the nucleotide sequences shown in SEQ ID NOs: 3 and 4. Was confirmed.

As described above, it was confirmed that when the PCR primer sets of the present embodiment are used alone, the amplification reaction due to false positives does not occur with respect to the genomic DNA of other acid-fast bacilli that are not the amplification targets of the primer set. Was done.

Next, it was verified whether the target region could be specifically amplified when these PCR primer sets were used at the same time. The results will be described in the following examples.

First, as a PCR primer set, an experiment was conducted using all the primer sets used in Test 1 and Test 2. That is, the PCR reaction solution of this example contained all the primers consisting of the nucleotide sequences shown in SEQ ID NOs: 1 to 4.

The PCR reaction solution of this example was the same as in Test 1 except for the primer, the DNA of the sample, and sterilized water, and the one having the following composition was used.
・ Mixed solution of buffer solution, nucleic acid synthesis substrate and nucleic acid synthase 2 × AmpliTaq Gold 360 Master Mix 10 μl
・ PCR enhancer 10 × GC enhancer 2 μl
・ Primer F (SEQ ID NO: 1, 10 ng / μl, final conc. 10 ng) 1 μl
・ Primer R (SEQ ID NO: 2, 10 ng / μl, final conc. 10 ng) 1 μl
・ Primer F (SEQ ID NO: 3, 10 ng / μl, final conc. 10 ng) 1 μl
・ Primer R (SEQ ID NO: 4, 10 ng / μl, final conc. 10 ng) 1 μl
・ Sample DNA 1 μl
・ Sterilized water 3 μl
(Total amount 20 μl)
In addition, the sample DNA contained the genomic DNAs of the test strains or clinical isolates of the acid-fast bacilli shown in the following 1 to 6 separately, and PCR was performed individually.
1. 1. Mycobacterium abscessus subsp. AbscessusATCC 19977
2. Mycobacterium abscessus subsp. 5 clinical isolates of abscessus 3. Mycobacterium abscessus subsp. Massiliense JCM 15300
4. 6. Clinical isolates of Mycobacterium abscessus subsp. Massiliense 5. Mycobacterium abscessus subsp. Bolletii JCM 15297
6. 3 clinical isolates of Mycobacterium abscessus subsp. Bolletii
For gene amplification by the PCR method, Master Cycler Gradient (manufactured by Eppendorf) or PCR Thermal Cycler Dice (manufactured by Takara) was used as in Test 1. The PCR conditions were as follows.
(1) 95 ° C. 2 minutes (2) 95 ° C. 40 seconds (3) 62 ° C. 40 seconds (4) 72 ° C. 1 minute (2) to (4) for 30 cycles (5) 75 ° C. 5 minutes Next, PCR method The product of the above was run on each amplification target region by agarose gel electrophoresis, and it was confirmed whether or not the correct amplification product was obtained. Electrophoresis was performed using Mupid-2 plus (manufactured by Takara). The result is shown in FIG.

In FIG. 4, each band shows the result of electrophoresis of the PCR product performed using the PCR reaction solution containing the DNA of each sample.

In FIG. 4, bands around 500 bp and 650 bp can be seen in the test strain 1 and the clinical isolate group 2 using the genomic DNA of Mycobacterium abscessus subsp. Abscessus as the sample DNA. Similarly, bands are observed in the vicinity of 420 bp and 290 bp in the test strain 3 and the clinical isolate group 4, and bands are observed in the vicinity of 1200 bp and 450 bp in the test strain 5 and the clinical isolate group 6.

Each of these is close to the base sequence of the theoretical amplification product, and it is considered that the amplification target region of each target acid-fast bacillus can be specifically amplified by the PCR primer set of the present embodiment. ..

It can be used to identify three subspecies of nontuberculous mycobacteria.

SEQ ID NOs: 1-4: Primers

Claims (3)

A primer set capable of distinguishing three subspecies of nontuberculous mycobacteria, Mycobacterium abscessus subsp. Abscessus, Mycobacterium abscessus subsp. Massiliense, and Mycobacterium abscessus subsp. Bolletii.
The first primer consists of:
Forward primer gttcggatcgcatggcgttgtgctg ・ ・ ・ SEQ ID NO: 1
Reverse primer gggatgctgtgatcgaggtcggc ・ ・ ・ SEQ ID NO: 2
The second primer consists of the following forward primer gagggcacgggagagaccaccggag ・ ・ ・ SEQ ID NO: 3
Reverse primer ccatttcYctatcYcgcccg (Y is c or t) ・ ・ ・ SEQ ID NO: 4
A set of identification primers for three subspecies of nontuberculous mycobacteria. A nontuberculous mycobacteria characterized by identifying three subspecies of Mycobacterium abscessus subsp. Abscessus, Mycobacterium abscessus subsp. Massiliense, and Mycobacterium abscessus subsp. Bolletii by nucleic acid amplification using the primer set according to claim 1. Method for identifying 3 subspecies of Mycobacterium. The method for identifying three subspecies of nontuberculous mycobacteria according to claim 2, wherein the nucleic acid amplification uses multiplex PCR.

Images