JP6785494B2 - Method of Inhibiting Receptor Function of GPR83 - Google Patents

Description

The present invention relates to a method of inhibiting the receptor function of GPR83 and a method of screening for a substance that inhibits the receptor function of GPR83.

SP is a peptide consisting of 11 amino acids, and its amino acid sequence is
Arg-Pro-Lys-Pro-Gln-Gln-Phe-Phe-Gly-Leu-Met-NH ₂ (SEQ ID NO: 21)
[In the formula, the carboxyl group of the C-terminal methionine is amidated. The same applies below]
Is.

On the other hand, peptide hemokinin-1 (HK-1) is a peptide consisting of 11 amino acids, and its amino acid sequence is
Arg-Ser-Arg-Thr-Arg-Gln-Phe-Tyr-Gly-Leu-Met-NH ₂ (SEQ ID NO: 22)
Is.

Both SP and HK-1 belong to tachykinin peptides. Here, the tachykinin peptide means a peptide having FXGLM-NH ₂ (where X is a hydrophobic amino acid) at the C-terminal.

The orphan receptor GPR83 is a type of G protein-coupled receptor (GPCR) that has 35% homology with the Substance P (SP) receptor (Neurokinin-1 receptor; NK1R). Although the ligand of GPR83 was once unknown, the present inventors disclosed in Patent Document 1 that the ligand of GPR83 is SP and peptide hemokinin-1 (HK-1) which is a family of SP.

In Patent Document 1, the present inventors further indicate that the binding of HK-1 to GPR83 is involved in the development of pain, inflammation and pruritus in vivo, and inhibits the binding of HK-1 to GPR83. It is disclosed that pain, inflammation and pruritus can be suppressed by doing so.

On the other hand, it has been reported that two N-glycosylation sites of NK1R are involved in the binding between NK1R and SP (Non-Patent Document 1). In GPR83, four asparagine residues are presumed to be N-glycosylation sites (Non-Patent Document 2), but the N-glycosylation sites in proteins are Asn-X-Ser (Asn indicates asparagine residues, X indicates an arbitrary amino acid residue, Ser indicates a serine residue) or Asn-X-Thr (Asn indicates an asparagine residue, X indicates an arbitrary amino acid residue, Thr indicates a threonine residue) It is known that it is an asparagine residue contained in the consensus sequence shown in), and is shown in Non-Patent Document 2. How these four asparagine residues are involved in the binding of GPR83 to the ligand has not been previously investigated.

WO2012 / 026526

Morris F. T., Charalabos P., Susan E. L. Functional consequences of alteration of N-linked glycosylation sites on the neurokinin 1 receptor. PNAS 104 (25), pp. 10691-10696, 2007. Wang D., Herman JP, Pritchard LM, Spitzer RH, Ahlbrand RL, Kramer GL, Petty F., Sallee FR, Richtand NM, Cloning, Expression, and Regulation of a Glucocorticoid-Induced Receptor in Rat Brain: Effect of Repetitive Amphetamine. J. of Neurosci 21 (22): 9027-9035, 2001.

Previously, the site involved in ligand binding in GPR83 had not been identified. Therefore, it has not been easy to effectively inhibit the receptor function of GPR83 and to screen for substances that inhibit the receptor function of GPR83.

Therefore, an object of the present invention is to provide a method for inhibiting the receptor function of GPR83 and a method for screening a substance that inhibits the receptor function of GPR83.

In order to achieve the above object, the present inventors have identified a site involved in binding to a ligand in GPR83, and based on that finding, have completed the following invention.
(1) In the amino acid sequence of GPR83, Asn-X-Ser (Asn indicates an asparagine residue, X indicates an arbitrary amino acid residue, Ser indicates a serine residue) or Asn-X-Thr (Asn indicates a serine residue) A method of inhibiting the receptor function of GPR83, which comprises the step of modifying at least one of the sequences shown by) indicating an asparagine residue, X indicating an arbitrary amino acid residue, and Thr indicating a threonine residue).
(2) The modification step is Asn-X-Ser (Asn indicates an asparagine residue, X indicates an arbitrary amino acid residue, Ser indicates a serine residue) or Asn- in the amino acid sequence of GPR83. In the step of modifying at least one of the asparagine residues contained in the sequence represented by X-Thr (Asn indicates an asparagine residue, X indicates an arbitrary amino acid residue, Thr indicates a threonine residue). Yes, the method described in (1).
(3) Test substance and the following (a) or (b):
(a) GPR83;
(b) In the amino acid sequence of GPR83, Asn-X-Ser (Asn indicates an asparagine residue, X indicates an arbitrary amino acid residue, Ser indicates a serine residue) or Asn-X-Thr (Asn indicates a serine residue) The test substance is contacted with a polypeptide consisting of a partial amino acid sequence containing the sequence shown by) indicating an asparagine residue, X indicating an arbitrary amino acid residue, and Thr indicating a threonine residue), and the test substance is referred to as (a). Or step 1 to confirm the presence or absence of interaction with at least one of the regions containing the sequence represented by Asn-X-Ser or Asn-X-Thr in the amino acid sequence of (b).
A method for screening a substance that inhibits the receptor function of GPR83, which comprises step 2 of selecting a test substance whose interaction has been confirmed in step 1 as a candidate for a substance that inhibits the receptor function of GPR83.

According to the invention of (1) or (2) above, it is possible to effectively inhibit the function of GPR83 as a receptor.

According to the invention of (3) above, it is possible to easily search for a substance that inhibits the function of GPR83 as a receptor.

In the Asn-X-Ser or Asn-X-Thr described above, X typically represents any amino acid residue except proline, but may be a proline residue.

According to the present invention, it is possible to inhibit the receptor function of GPR83 and to screen for a substance that inhibits the receptor function of GPR83.

FIG. 1A shows changes in intracellular calcium ion concentration when different concentrations of Substance P (SP) were administered to wild-type GPR83-expressing cells and wild-type NK1R-expressing cells by changes in fluorescence intensity with a calcium ion fluorescent probe. Is. Figure 1B shows changes in intracellular calcium ion concentration when different concentrations of Hemokinin-1 (HK-1) were administered to wild-type GPR83-expressing cells and wild-type NK1R-expressing cells, and changes in fluorescence intensity by a calcium ion fluorescent probe. It is a figure shown by. Figure 1C shows the changes in intracellular calcium ion concentration when Wild-type GPR83-expressing cells and wild-type NK1R-expressing cells were administered with ^10-9 M concentrations of Substance P (SP) and Hemokinin-1 (HK-1). It is a figure which shows by the change of the fluorescence intensity by the calcium ion fluorescent probe. Figure 2A shows Substance P (SP) and Hemokinin-1 (HK-1) at concentrations of ^10-9 M in cells expressing wild-type GPR83 and mutant GPR83 GPR83 N1, GPR83 N2, GPR83 N3, and GPR83 N4, respectively. ) Is shown by the change in the fluorescence intensity of the calcium ion fluorescent probe. * In the figure indicates a significant difference of p <0.05 by t-test. Figure 2B shows cells expressing wild-type NK1R, mutant NK1R lacking the glycosylation site, NK1R-A, at concentrations of ^10-9 M Substance P (SP) and Hemokinin-1 (HK-1). It is a figure which shows the change of intracellular calcium ion concentration at the time of administration by the change of fluorescence intensity by a calcium ion fluorescent probe. * In the figure indicates a significant difference of p <0.05 by t-test.

1. GPR83
The GPR83 used in the present invention is not particularly limited as long as it is a polypeptide having HK-1 receptor activity or SP receptor activity. Having HK-1 receptor activity means having activity of binding to HK-1 and stimulating cells by binding to extracellular HK-1 in cells expressing GPR83 (for example, intracellular). It means that it has the activity of liberating Ca ⁺⁺ . The same applies to SP receptor activity. As for the receptor activity of GPR83, the HK-1 receptor activity is superior to the SP receptor activity.
The origin of GPR83 is not particularly limited, and it may be of natural origin isolated from a living body expressing GPR83, a biological sample (organ, tissue, etc.), cells, etc., or artificially derived by a genetic engineering method or a synthetic method. It may be prepared for the purpose.

GPR83 consists of the entire amino acid sequence in wild GPR83 or a variant thereof and may be a polypeptide having HK-1 receptor activity or SP receptor activity, or the amino acid sequence in wild GPR83 or a variant thereof. It may be a polypeptide consisting of a partial sequence of HK-1 receptor activity or SP receptor activity, or contains a partial sequence of an amino acid sequence in wild-type GPR83 or a variant thereof, and has HK-1 receptor activity. Alternatively, it may be a polypeptide having SP receptor activity.

The term "polypeptide" in the present invention also includes salts of polypeptides, and further includes those having no sugar chain and those having been chemically modified such as addition of a sugar chain.

Specifically, the GPR83 in the present invention includes the following:
(i) SEQ ID NO: 1 (human, Homo sapiens), SEQ ID NO: 2 (rat, Rattus norvegicus), SEQ ID NO: 3 (mouse, Mus musculus), SEQ ID NO: 4 (dog, Canis lupus familiaris) and SEQ ID NO: 5 (cow, A polypeptide consisting of an amino acid sequence represented by one of Bos taurus);
(ii) Containing a partial sequence of the amino acid sequence represented by any of SEQ ID NOs: 1 to 5 (preferably consisting of a partial sequence of the amino acid sequence represented by any of SEQ ID NOs: 1 to 5) and HK- 1 Polypeptide having receptor activity or SP receptor activity;
(iii) A polypeptide containing the amino acid sequence represented by any of SEQ ID NOs: 1 to 5 and having HK-1 receptor activity or SP receptor activity;
(iv) In the amino acid sequence of any of the polypeptides (i) to (iii), 1 to 10, preferably 1 to 7, more preferably 1 to 4, more preferably 1 to 3, most Preferably, a polypeptide consisting of an amino acid sequence in which one or two amino acids are deleted, substituted, and / or added, and has HK-1 receptor activity or SP receptor activity; or
(v) Includes an amino acid sequence having at least 90%, preferably at least 95%, more preferably at least 98% sequence identity with the amino acid sequence of any of the polypeptides (i)-(iii) (preferably). (Consists of an amino acid sequence having at least 90%, preferably at least 95%, more preferably at least 98% sequence identity with the amino acid sequence of any of the polypeptides (i)-(iii)) and HK-1 receptor. A polypeptide having body activity or SP receptor activity.

In (iv) above, the amino acid substitution is preferably a conservative amino acid substitution. “Conservative amino acid substitution” refers to a substitution between amino acids having similar properties such as charge, side chain, polarity, and aromaticity. Amino acids with similar properties include, for example, basic amino acids (arginine, lysine, histidine), acidic amino acids (aspartic acid, glutamic acid), uncharged polar amino acids (glycine, asparagine, glutamine, serine, threonine, cysteine, tyrosine), non-polar amino acids. It can be classified into sex amino acids (leucine, isoleucine, alanine, valine, proline, phenylalanine, tryptophan, methionine), branched amino acids (leucine, valine, isoleucine), aromatic amino acids (phenylalanine, tyrosine, tryptophan, histidine), etc. it can.

In (v) above, "sequence identity" of amino acid sequences means that two amino acid sequences are aligned and gaps are introduced as necessary so that the degree of amino acid matching between the two is the highest. The ratio (%) of the same amino acid residues to the total number of amino acid residues of the polypeptide of any of (i) to (iii). The sequence identity of the amino acid sequence can be calculated using a protein search system by BLAST or FASTA (Karlin, S. et al., 1993, Proc. Natl. Acad. Sci. USA, 90: 5873-5877). Altschul, S.F. et al., 1990, J. Mol. Biol., 215: 403-410; Pearson, WR et al., 1988, Proc. Natl. Acad. Sci. USA, 85: 2444-2448).

As shown in the examples, the present inventors have found that the asparagine residue contained in a specific sequence in the amino acid sequence of GPR83 contributes to the HK-1 receptor activity or SP receptor activity of GPR83. It was. Both the GPR83 before modification in the present invention and the GPR83 used in the screening method include a partial sequence represented by Asn-X-Ser or Asn-X-Thr as its specific amino acid sequence.

The asparagine residues 37, 46, 67 and 134 in the amino acid sequence shown in SEQ ID NO: 1 and the 38th, 45th, 66th and 66th in the amino acid sequence shown in SEQ ID NO: 2 The 133 asparagine residue is the 38th, 46th, 67th and 134th asparagine residues in the amino acid sequence shown in SEQ ID NO: 3, and the 37th and 37th asparagine residues are in the amino acid sequence shown in SEQ ID NO: 4. Asparagine residues 45, 66 and 133, and asparagine residues 30, 38, 59 and 126 in the amino acid sequence shown in SEQ ID NO: 5 are Asn-X-, respectively. It is an asparagine residue contained in the consensus sequence represented by Ser or Asn-X-Thr.

The polypeptide such as GPR83 used in the present invention can be prepared by various methods such as a genetic engineering method and a synthetic method. In the genetic engineering method, a gene (DNA or RNA) encoding a target polypeptide is introduced into an appropriate host biological cell in the form of a recombinant vector inserted into an appropriate vector as needed, and the cell is introduced. The desired polypeptide can be produced by culturing. Bacteria, yeast and the like can be used as the host biological cell.

2. Method of Inhibiting Receptor Function of GPR83 The present invention first comprises a step of modifying at least one of the sequences represented by Asn-X-Ser or Asn-X-Thr in the amino acid sequence of GPR83. , On how to inhibit the receptor function of GPR83.

In the present invention, "modifying the sequence" means disrupting the consensus sequence, preferably disrupting the consensus sequence of the N-glycosylation site so that the N-linked sugar chain cannot bind to the side chain. Means that. For example, modifying (eg, substituting or deleting) at least one of the asparagine residues contained in the sequence represented by Asn-X-Ser or Asn-X-Thr, Asn-X. -Replace or delete X in the sequence indicated by Ser or Asn-X-Thr with a proline residue, preferably with a proline residue, indicated by Asn-X-Ser or Asn-X-Thr. This includes substituting or deleting a proline residue or a threonine residue in the above sequence with another amino acid residue, preferably substituting with another amino acid.

In the present invention, the preferred step of modifying the sequence is to modify at least one of the asparagine residues contained in the sequence represented by Asn-X-Ser or Asn-X-Thr, for example, Asn-X-Ser. Alternatively, one of the asparagine residues contained in the sequence represented by Asn-X-Thr is replaced with an amino acid residue other than the asparagine residue, preferably a serine or cysteine residue.

The present inventors modified (substituted) one of the asparagine residues contained in the sequence represented by Asn-X-Ser or Asn-X-Thr in the amino acid sequence of GPR83 into a serine residue. In type GPR83, it has been confirmed in Examples that the HK-1 receptor activity is inhibited.

By modifying the sequence as described above, the HK-1 receptor activity or SP receptor activity of GPR83 can be inhibited. In the present invention, "inhibition" does not only mean that the HK-1 receptor activity or SP receptor activity of GPR83 is completely lost, and the receptor of GPR83 after modification is compared with that before modification. It refers to reducing function, specifically HK-1 receptor activity or SP receptor activity.

Here, the receptor function of GPR83 before or after modification can be evaluated by the following means. First, the polynucleotide encoding the polypeptide of GPR83 before or after modification is incorporated into an appropriate vector such as a plasmid vector as needed, and transfection (lipofection, calcium phosphate co-precipitation method, DEAE-dextran treatment method, electroporation). It can be introduced into living cells, for example, Chinese hamster ovary-derived cells (CHO cells), by transformation (which can be performed by a poration method or the like). Subsequently, in a state where the GPR83 before or after the modification is expressed in the cells, a ligand for GPR83 (for example, HK-1) is imparted, and the change in the intracellular calcium ion concentration at that time is used as an index before or after the modification. The receptor function of GPR83 later can be evaluated. Changes in intracellular calcium ion concentration can be measured using a commercially available intracellular calcium ion measurement kit containing a calcium fluorescent probe, such as Calcium Kit II --Fluo 4 (Dojin Kagaku).

The step of modifying at least one of the sequences represented by Asn-X-Ser or Asn-X-Thr in the amino acid sequence of GPR83 can be performed by a site-specific mutagenesis method. Techniques for introducing site-specific amino acid mutations into polypeptides are well known to those skilled in the art. For example, in a polynucleotide (DNA or RNA) encoding GPR83, a nucleotide sequence modification that causes a desired modification to an amino acid is performed site-specifically to prepare a polynucleotide encoding mutant GPR83, and then A polynucleotide encoding a mutant GPR83 can be introduced into a suitable biological cell, and the mutant GPR83 polypeptide with the desired modification can be expressed and produced in the biological cell.

When the amino acid sequence of GPR83 contains a plurality of sequences (referred to as N) represented by Asn-X-Ser or Asn-X-Thr, one or more of them, more preferably two or more, more preferably N. It is preferable to modify a closer number, most preferably N. The amino acid sequence of wild-type GPR83 generally contains four sequences represented by Asn-X-Ser or Asn-X-Thr, in which case one or more, more preferably two. Modify one or more, more preferably three or more, more preferably four.

The method according to the present invention for inhibiting the receptor function of GPR83 is typically performed in vitro, especially when GPR83 is human GPR83.

The present invention also provides a mutant GPR83 polypeptide in which at least one of the sequences represented by Asn-X-Ser or Asn-X-Thr in the amino acid sequence of GPR83 is modified to inhibit receptor function. The preferred embodiment of the modification of the sequence is as described above.

The present invention also comprises a polynucleotide encoding a mutant GPR83 polypeptide in which at least one of the sequences represented by Asn-X-Ser or Asn-X-Thr has been modified in the amino acid sequence of GPR83 to inhibit receptor function. Provided are cells expressing the mutant GPR83 polypeptide introduced. The preferred embodiment of the modification of the sequence is as described above. The method for introducing the polynucleotide into the cell and the preferred embodiment of the host cell are as described above.

3. Screening method for inhibitors of receptor function of GPR83 The present invention secondly describes the test substance and the following (a) or (b):
(a) GPR83;
(b) In the amino acid sequence of GPR83, a polypeptide consisting of a partial amino acid sequence including the sequence represented by Asn-X-Ser or Asn-X-Thr is brought into contact with the test substance and the test substance (a) or (b). Step 1 to confirm the presence or absence of interaction with at least one of the regions containing the sequence represented by Asn-X-Ser or Asn-X-Thr in the amino acid sequence of
The present invention relates to a method for screening a substance that inhibits the receptor function of GPR83, which comprises the step 2 of selecting the test substance whose interaction has been confirmed as a candidate for the substance that inhibits the receptor function of GPR83 in the step 1.

In the present invention, "interaction" means that the test substance and the region containing the sequence represented by Asn-X-Ser or Asn-X-Thr in the amino acid sequence of (a) or (b) are hydrogen-bonded or ionized. It refers to bonding to each other by various bonds such as bond, water bond, covalent bond, and coordinate bond.

Here, "the interaction between the test substance and at least one of the regions containing the sequence represented by Asn-X-Ser or Asn-X-Thr in the amino acid sequence of (a) or (b)" is typical. Specifically, the interaction between the test substance and at least one of the asparagine residues contained in the sequence represented by Asn-X-Ser or Asn-X-Thr in the amino acid sequence of (a) or (b). However, the present invention is not limited to this, and other amino acid residues contained in the sequence represented by Asn-X-Ser or Asn-X-Thr, or the sequence represented by Asn-X-Ser or Asn-X-Thr. 1 or more amino acid residues contained in a region containing (for example, a region consisting of 10 or less consecutive amino acid residues, preferably 6 or less amino acid residues including the sequence represented by Asn-X-Ser or Asn-X-Thr). It may be an interaction with the test substance.

Such interactions result in changes in post-translational modifications of the GPR83 protein, specifically the sequence represented by Asn-X-Ser or Asn-X-Thr, which loses its function as an N-glycosylation site and is a ligand. This is because it is presumed that there is a change in the binding to (HK-1 or SP), or a change in the translocation (trafficking) of the receptor from the cell surface caused by the binding of the ligand to the receptor.

3.1. Process 1
The GPR83 in (a) above is as described in "1. GPR83".
The polypeptide (b) is not particularly limited as long as it is a polypeptide consisting of a partial amino acid sequence including the sequence represented by Asn-X-Ser or Asn-X-Thr in the amino acid sequence of GPR83, but is preferable. The total number of amino acid residues including the sequence represented by Asn-X-Ser or Asn-X-Thr is 5 or more, preferably 6 or more, more preferably 7 or more, and the upper limit is not particularly limited, but is, for example, 50 or less, preferably 30. Hereinafter, it is more preferably a polypeptide consisting of a partial amino acid sequence of GPR83 of 15 or less.

At this time, the (a) or (b) does not need to be used alone, and may be in the form of a cell expressing the (a) or (b), or the (a) or (b). It may be in the form of a cell membrane containing b). Furthermore, the above (a) or (b) may be in a form immobilized on a support carrier for immobilization or the like, or a form labeled with a labeling reagent or the like.

The test substance used in step 1 can be an organic low molecular weight compound, a polypeptide having a relatively low molecular weight (for example, 20 or less amino acid residues), an antibody, a fragment containing the Fab region of the antibody, or the like. The candidate substance may also be in a form immobilized on a support carrier for immobilization or the like, or a form labeled with a labeling reagent or the like.

In step 1, the presence or absence of interaction between the test substance and at least one of the regions containing the sequence represented by Asn-X-Ser or Asn-X-Thr in the amino acid sequence of (a) or (b) is confirmed. The means for doing so is not particularly limited, and appropriate means can be used.

As the means, for example
(I) The polypeptide of (a) or (b) is brought into contact with the test substance, the presence or absence of binding is confirmed, and if a complex is formed by the binding, the amount thereof is quantified.
(Ii) A mutant and a test substance obtained by modifying at least one of the sequences represented by Asn-X-Ser or Asn-X-Thr in the amino acid sequence of the polypeptide of (a) or (b) above. Contact, check for binding, and if binding forms a complex, quantify the amount.
(Iii) When the two are compared and there is a difference in the presence or absence of binding or the amount of the complex, the region containing the test substance and the sequence indicated by Asn-X-Ser or Asn-X-Thr (for example, of the sequence). It can be concluded that the asparagine residue) is interacting.

Alternatively, the polypeptide of (a) or (b) is brought into contact with the test substance, and after the contact, the structure of the polypeptide of (a) or (b) is analyzed, and the test substance and Asn-X- It may be a means for confirming the binding state with the region containing the sequence represented by Ser or Asn-X-Thr (for example, the asparagine residue of the sequence).

As another means
(I) A cell expressing a variant in which at least one of the sequences represented by Asn-X-Ser or Asn-X-Thr in the amino acid sequence of the polypeptide of (a) or (b) is modified. The prepared ligand is added to an arbitrary concentration, and the intracellular calcium ion concentration associated with the binding to this ligand is measured.
(Ii) The cell expressing the polypeptide of (a) or (b) is brought into contact with the test substance, a ligand prepared at the same concentration as in (i) is added, and intracellular calcium associated with the binding to this ligand is added. Measure the ion concentration.
(Iii) Comparing the two, if there is no or small difference in the measured intracellular calcium ion concentration (for example, if there is no significant difference), the test substance and Asn-X-Ser or Asn-X-Thr It can also be concluded that the region containing the sequence indicated by (eg, the asparagine residue of the sequence) interacts.

3.2. Step 2
In step 2, the test substance whose interaction with at least one of the regions containing the sequence represented by Asn-X-Ser or Asn-X-Thr in the amino acid sequence of (a) or (b) was confirmed to be GPR83. Selected as a candidate for an inhibitor of the receptor function of.

The selected test substances are not only useful as candidates for inhibitors of the receptor function of GPR83, but also candidates for therapeutic agents, preventive agents or inhibitors of pain, inflammation or pruritus in which the binding of the ligand to GPR83 is involved. It is also useful as.

3.3. Further Steps The screening method of the present invention preferably further includes step 3 for confirming that the test substance selected in step 2 inhibits the receptor function of GPR83.

The following can be exemplified as the step 3. That is, the polynucleotide encoding GPR83 is incorporated into an appropriate vector such as a plasmid vector as needed, and then transfection (lipofection, calcium phosphate co-precipitation method, DEAE-dextran treatment method, electroporation method, etc.) is used. It can be introduced into living cells, such as Chinese hamster ovary-derived cells (CHO cells), by transformation. A test substance and a ligand of GPR83 (for example, HK-1) are applied to the cells in a state where GPR83 is expressed, and changes in intracellular calcium ion concentration are measured. As a control experiment, the change in intracellular calcium ion concentration when the ligand of GPR83 is applied to the cells without the test substance in the state where GPR83 is expressed is measured. When the change in intracellular calcium ion concentration in the experiment in which the test substance and the ligand of GPR83 were applied in the state where GPR83 was expressed in the cells was significantly smaller than the change in intracellular calcium ion concentration in the control experiment. , Conclude that the test substance can inhibit the receptor function of GPR83. Changes in intracellular calcium ion concentration can be measured using a commercially available intracellular calcium ion measurement kit containing a calcium fluorescent probe, such as Calcium Kit II --Fluo 4 (Dojin Kagaku).

1. Preparation of receptor-expressing cells
1.1. Preparation of plasmid
1.1.1. Preparation of plasmids GPR83 / pcDNA3.1 and NK1R / pcDNA3.1
A cDNA was prepared from total RNA obtained from the brain tissue of SD rats (18th day of embryonic development), and using this cDNA as a template, the following primer set for GPR83 or the primer set for NK1R was used as a primer set, and a commercially available PCR enzyme. The PCR reaction solution was prepared according to the specified protocol using KOD-Plus-Neo (Toyo Boseki), and PCR was performed to amplify the DNA base sequence encoding rat GPR83 (SEQ ID NO: 2) (SEQ ID NO: 23). An amplified product containing the product and the DNA base sequence (SEQ ID NO: 24) encoding rat NK1R (SEQ ID NO: 6) was obtained. Each of the obtained amplification products was inserted into a restriction enzyme-treated plasmid expression vector pcDNA3.1 (invitrogen) to obtain GPR83 / pcDNA3.1 and NK1R / pcDNA3.1.
Primer set for GPR83
GPR83 sense; TCGAGTCCAGGTTCCCTCTGTG (SEQ ID NO: 7)
GPR83 reverse; TTCCGACACCTTGAGTCTGGTC (SEQ ID NO: 8)
Primer set for NK1R
NK1R sense; TGCAACAAGGTCCTGCGGCAAG (SEQ ID NO: 9)
NK1R reverse; AGCAACACAAGATGGGCTAGAGGC (SEQ ID NO: 10)

1.1.2. Preparation of site-specific mutagenesis plasmid The plasmids obtained above were prepared by partially substituting the amino acids of GPR83 / pcDNA3.1 and NK1R / pcDNA3.1, respectively.

A plasmid containing a nucleotide sequence encoding a mutant GPR83 in which one of asparagine (N38, N45, N66, N133) in four specific consensus sequences of rat GPR83 was replaced with serine (S) was prepared by the following procedure. did. Mutants with N38 replaced with S are called GPR83 N1, mutants with N45 replaced with S are called GPR83 N2, mutants with N66 replaced with S are called GPR83 N3, and mutants with N133 replaced with S are called GPR83 N4. .. Using GPR83 / pcDNA3.1 100 ng as a template, prepare the PCR reaction solution according to the specified protocol using KOD-Plus-Neo (Toyobo), and use a thermal cycler (94 ° C for 2 minutes, 98 ° C 10). PCR was performed 18 times at 60 ° C for 1 minute and 68 ° C for 8 minutes. The following were used as primer sets to introduce each mutation in PCR.
Primer set for GPR83 N1 (N38S)
GPR83 N1 Sense: CTGACCGGAGCCAGTGCCTCGCATTTC (SEQ ID NO: 11)
GPR83 N1 Reverse: GAAATGCGAGGCACTGGCTCCGGTCAG (SEQ ID NO: 12)
Primer set for GPR83 N2 (N45S)
GPR83 N2 Sense: CATTTCTGGGCCAGCTACACTTTCTC (SEQ ID NO: 13)
GPR83 N2 Reverse: GAGAAAGTGTAGCTGGCCCAGAAATG (SEQ ID NO: 14)
Primer set for GPR83 N3 (N66S)
GPR83 N3 Sense: GCTGAGTCCCAGAGCCCCACAGTGAAA (SEQ ID NO: 15)
GPR83 N3 Reverse: TTTCACTGTGGGGCTCTGGGACTCAGC (SEQ ID NO: 16)
Primer set for GPR83 N4 (N133S)
GPR83 N3 Sense: GTCCGCTTTGTGAGCAGCACATGGGTG (SEQ ID NO: 17)
GPR83 N3 Reverse: CACCCATGTGCTGCTCACAAAGCGGAC (SEQ ID NO: 18)

In addition, a plasmid containing a base sequence encoding the mutant NK1R in which asparagine (N14, N18) at two glycosylation sites of NK1R was simultaneously replaced with S (serine) was prepared by the following procedure. A mutant in which both N14 and N18 are replaced with S is called NK1R-A. PCR was performed in the same procedure as when preparing GPR83 N1 / pcDNA3.1 to GPR83 N4 / pcDNA3.1 above, except that NK1R / pcDNA3.1 was used as a template and the following was used as a primer set.
Primer set for NK1R-A (N14,18S)
NK1R-A Sense: CTCTTCCCCAGCATCTCCACCAACATCTCCACCAGCACCTCTGAGTCT (SEQ ID NO: 19)
NK1R-A Reverse: AGACTCAGAGGTGCTGGTGGAGATGTTGGTGGAGATGCTGGGGAAGAG (SEQ ID NO: 20)

The target GPR83 N1 / pcDNA3.1 to GPR83 N4 / pcDNA3.1 and NK1R-A / pcDNA3.1 were obtained from each of the above PCR reaction solutions by the following procedure. That is. A restriction enzyme (Dpn I) was added to each of the above PCR reaction solutions, and the mixture was allowed to stand at 37 ° C. for 24 hours to decompose the mutation-free template plasmid to obtain a solution containing the plasmid into which the desired mutation was introduced. .. The E. coli competent cells were then transformed with this solution. A solution containing transformed Escherichia coli was seeded on an LB plate medium and allowed to stand at 37 ° C for 24 hours. Then, using a Macherey-Nagel kit (Plasmid DNA purification), plasmid DNA was recovered and purified from the transformed Escherichia coli by the plasmid miniprep method (miniprep method) by alkali lysis, and the target was obtained by sequence analysis. The presence or absence of the plasmid was confirmed. A colony of transformed E. coli in which the desired plasmid was confirmed was added to 200 ml of LB liquid medium supplemented with antibiotics, stirred at 37 ° C for 24 hours, and then the transformed E. coli was recovered by pelleting, and the same as above. The plasmid DNA was recovered using a Macherey-Nagel kit (Plasmid DNA purification).

1.2 Preparation of transient GPR83 or NK1R expressing cells Chinese hamster cultivated 4 μg (1 μg / μl) of each of the two plasmids GPR83 / pcDNA3.1 and NK1R / pcDNA3.1 obtained in 1.1.1. Above in a 10 cm dish. It was administered to ovary-derived cells (CHO cells). 8 μl of lipofectamine 2000 (sigma) was used as a transfection reagent. By this method, the DNA of GPR83 or NK1R is introduced into CHO cells to obtain transient GPR83 and NK1R expressing cells. The cells were cultured in a CO ₂ incubator for 24 hours. One day after the administration of the plasmid, the number of cells was adjusted to 3 × ^10-5 cells / ml, and the cells were placed in a 96-well plate (100 μl / well), and the intracellular Ca ⁺⁺ change was measured 2 days after the administration of the plasmid. For CHO cells, MEM Alpha (1 ×) (life technologies) containing 10% fetal bovine serum (SAFC Biosciences) and 10% Penicillin Streptomicin (life technologies) was used as a medium. Furthermore, the cells were cultured in a 5% CO ₂ incubator at 37 ° C.

1.3 Preparation of GPR83 or NK1R stable expression cells
GPR83 or NK1R stable expression cells were prepared by administering a linearized DNA strand of the plasmid obtained in 1.1.1. To CHO cells. Specifically, 4 μg of a linear plasmid obtained by cutting each plasmid with a restriction enzyme was administered to CHO cells cultured in a 10 cm dish. 8 μl of lipofectamine 2000 (sigma) was used as a transfection reagent. One week after administration, Hygromin B (Invitrogen) was added to the medium, and Hygromin B-resistant cells, that is, cells expressing GPR83 or NK1R, were selected. In this way, stable expression cells of GPR83 or NK1R were obtained. The number of cells obtained was adjusted to 3 × ^10-5 cells / ml, placed in a 96-well plate (100 μl / well), and used for analysis of intracellular Ca ⁺⁺ changes due to the addition of ligand.

2. changes in the Ca ⁺⁺ in cells with the addition of the measurement method ligand changes in intracellular Ca ⁺⁺ may be quantified by the value of the fluorescence intensity using a fluorescence probe.

Specifically, using the Calcium Fluorescent Probe Kit Calcium Kit II --Fluo 4 (Dojin Kagaku), add 5% Pluronic F-127 80 μl and 250 nmol / l Procenecid 50 μl to the recording medium included in the kit, respectively. A 10 ml loading buffer was prepared by adding a solution of Fluo-4 AM in 45 μl DMSO. Next, loading buffer was added to the cells from which the medium had been removed (100 μl / well), and the cells were allowed to stand in a CO ₂ incubator for 1 hour. One hour later, 50 μl of 250 nmol / l Procenecid was added to the recording medium included in the kit to make a 10 ml recording buffer, and this recording buffer was added to the cells (100 μl / well).

Incubation was performed at 37 ° C. for 10 minutes in a microplate fluorescence spectrophotometer (FLEX Station 3 (Molecular Device)) to measure changes in intracellular Ca ⁺⁺ . In the calcium flux assay mode, the fluorescence intensity of each well was measured at the fluorescence wavelength (excitation wavelength 495 nm, fluorescence wavelength 518 nm) for 140 seconds after the addition of the ligand.

3. The peptide used in the ligand preparation experiment is a peptide with the following amino acid sequence.
Substance P (SP): RPKPQQFFGLM-NH ₂ (SEQ ID NO: 21)
Hemokinin-1 (HK-1): RSRTRQFYGLM-NH ₂ (SEQ ID NO: 22)

A ^10-2 M concentration solution of each of these ligand peptides was prepared using sterile distilled water, dispensed into 10 μl each and stored at -30 ° C.

When measuring intracellular Ca ⁺⁺ , dilute with sterile distilled water to a concentration of 10 ^-15 M to 10 ^-5 M, respectively, and place a peptide solution of each concentration in a 96-well plate every 8 wells (100). μl / well), heated at 37 ° C. for 30 minutes.

4. Evaluation of ligand-receptor binding
4.1 GPR83 and NK1R changes in intracellular Ca ⁺⁺ by stably expressing cells
To the cells stably expressing GPR83 and NK1R, SP and HK-1 diluted with sterile distilled water at 10 ^-15 M to 10 ^-5 M were added to the cells, and the change in intracellular Ca ⁺⁺ concentration due to the addition was measured. did.

As a result, the change in intracellular Ca ⁺⁺ associated with the addition of HK-1 did not show a significant difference in the concentration curve of any receptor-expressing cells at HK-1 concentrations of 10 ^-15 M to 10 ^-5 M. However, the GPR83-expressing cell test group had higher fluorescence intensity at all HK-1 concentrations than the NK1R-expressing cell test group (Fig. 1B). On the other hand, in the experiment using SP, no difference was observed between the two curves, but it was shown that the NK1R-expressing cell test group had higher fluorescence intensity at all SP concentrations (Fig. 1A). From this, it was considered that HK-1 was superior to SP as the ligand of GPR83.

Further, FIG. 1A, the results of B, 10 ^-9 when showing the result of SP and HK-1 fluorescence intensity by the addition of M as a bar graph, 10 ^-9 M towards NK1R expressing cells test group in the SP GPR83 expressing cells tested The fluorescence intensity was higher than that of the group, and in ^10-9 M HK-1, the fluorescence intensity of the GPR83-expressing cell test group was higher than that of the NK1R-expressing cell test group (Fig. 1C). This result suggests that HK-1 is superior to SP as the ligand for GPR83.

4.2 Examination of intracellular Ca ⁺⁺ changes associated with HK-1 or SP addition using cells expressing GPR83 N1 to GPR83 N4 or NK1R-A
Experiments using stable-expressing cells of GPR83 and NK1R showed that HK-1 was superior to SP as a ligand for GPR83.

Furthermore, in order to clarify which site of GPR83 is important for binding to the ligand, GPR83 N1 / is a plasmid DNA obtained by mutating asparagine (Asn; N) obtained in 1.1.2. Above. Transiently expressing cells of GPR83 N1 to GPR83 N4 or NK1R-A by introducing pcDNA3.1 to GPR83 N4 / pcDNA3.1 and NK1R-A / pcDNA3.1 into CHO cells in the same procedure as in 1.2. Above. Was produced. The binding of the ligand to GPR83 N1 to GPR83 N4 or NK1R-A was examined using the cells.

Based on the results shown in Fig. 1, changes in intracellular Ca ⁺⁺ associated with the addition of ^10-9 M peptide were investigated. The concentration of 10 ^-9 M is proximal to EC ₅₀ .

^10-9 M of SP and HK-1 were added to the GPR83 (wild-type) transiently expressing cells prepared in 1.2 above, and the fluorescence intensity was measured in the same procedure as in the experiments on stable expressing cells (Fig. 2A). GPR83). Next, the increase in fluorescence intensity when 10 ^-9 M SP and HK-1 were added to transiently expressing cells of GPR83 N1, GPR83 N2, GPR83 N3, and GPR83 N4 increased wild-type GPR83 transiently expressing cells. The values were smaller than those used (Fig. 2A GPR83 N1, GPR83 N2, GPR83 N3 and GPR83 N4). This suggests that four specific sites in GPR83 play important roles in the binding of ligands SP and HK-1 to GPR83, respectively.

In addition, when examining the changes in Ca ⁺⁺ associated with the addition of ^10-9 M SP and HK-1 to cells expressing wild-type NK1R and mutant NK1R-A in which two glycosylation sites were simultaneously deleted, the mutations were examined. change in fluorescence intensity upon addition of 10 ^-9 M SP on the type NK1R-a expressing cells (increase), from the change in fluorescence intensity upon addition of 10 ^-9 M SP wild type NK1R expressing cells (increase) Was also confirmed to be significantly smaller. On the other hand, no such significant difference was observed when ^10-9 M HK-1 was added (Fig. 2B NK1R-A). This suggests that the two glycosylation sites of NK1R are involved in the binding to SP.

From the above results, it is recognized that the asparagine residue at a specific site of GPR83 is a site that plays an important role in binding to the ligand. It can be presumed that a substance that interacts with the asparagine residue at a specific site of GPR83 is useful as an inhibitor of the receptor function of GPR83.

The present invention can be used in the fields of biochemical reagents, pharmaceuticals and the like.

Claims (5)

In the amino acid sequence of GPR83, Asn-X-Ser (Asn indicates an asparagine residue, X indicates an arbitrary amino acid residue, Ser indicates a serine residue) or Asn-X-Thr (Asn indicates an asparagine residue). A method of inhibiting the receptor function of GPR83, which comprises the step of modifying at least one of the sequences shown in (X indicates an arbitrary amino acid residue and Thr indicates a threonine residue). The modification step is Asn-X-Ser (Asn indicates an asparagine residue, X indicates an arbitrary amino acid residue, Ser indicates a serine residue) or Asn-X-Thr in the amino acid sequence of GPR83. (Asn indicates an asparagine residue, X indicates an arbitrary amino acid residue, Thr indicates a threonine residue), which is a step of modifying at least one of the asparagine residues contained in the sequence represented by the claim. Item 1. The method according to Item 1. The method according to claim 1 or 2, wherein in the amino acid sequence of GPR83, X in the sequence represented by Asn-X-Ser or Asn-X-Thr indicates any amino acid residue other than proline. The test substance and the following (a) or (b):
(a) GPR83;
(b) In the amino acid sequence of GPR83, Asn-X-Ser (Asn indicates an asparagine residue, X indicates an arbitrary amino acid residue, Ser indicates a serine residue) or Asn-X-Thr (Asn indicates a serine residue) The test substance is contacted with a polypeptide consisting of a partial amino acid sequence containing the sequence shown by) indicating an asparagine residue, X indicating an arbitrary amino acid residue, and Thr indicating a threonine residue), and the test substance is referred to as (a). Or step 1 to confirm the presence or absence of interaction with at least one of the regions containing the sequence represented by Asn-X-Ser or Asn-X-Thr in the amino acid sequence of (b).
In the step 1, a test substance that said interaction is confirmed, viewed contains a step 2 of selection as a candidate for an inhibitor of receptor function GPR83,
In step 1, the following 1- (i) to 1- (iii):
1- (i): Contact the polypeptide of (a) or (b) with the test substance, confirm the presence or absence of binding, and if a complex is formed by binding, quantify the amount.
1- (ii): Tested with a mutant of the polypeptide of (a) or (b) above, in which at least one of the sequences represented by Asn-X-Ser or Asn-X-Thr in the amino acid sequence was modified. Contact the substance, check for the presence or absence of binding, and if a complex is formed by binding, quantify the amount, and
1- (iii): When the two are compared and there is a difference in the presence or absence of binding or the amount of the complex, the test substance and the region containing the sequence indicated by Asn-X-Ser or Asn-X-Thr are found. To conclude that they are interacting
including,
Or,
In step 1, the polypeptide of (a) or (b) is brought into contact with the test substance, and after the contact, the structure of the polypeptide of (a) or (b) is analyzed, and the test substance and Asn are analyzed. -Including checking the binding state with the region containing the sequence indicated by X-Ser or Asn-X-Thr,
Or,
In step 1, the following 2- (i) to 2- (iii):
2- (i): Expresses a variant of the polypeptide of (a) or (b) above, in which at least one of the sequences represented by Asn-X-Ser or Asn-X-Thr in the amino acid sequence is modified. To add a ligand prepared to an arbitrary concentration and measure the intracellular calcium ion concentration associated with the binding to this ligand.
2- (ii): The cell expressing the polypeptide of (a) or (b) is brought into contact with the test substance, a ligand prepared at the same concentration as 2- (i) is added, and the ligand is combined with this ligand. Measuring the intracellular calcium ion concentration associated with binding, and
2- (iii): A region containing the test substance and the sequence indicated by Asn-X-Ser or Asn-X-Thr when the measured intracellular calcium ion concentration is the same or small when the two are compared. Conclude that is interacting with
Including that
A method for screening substances that inhibit the receptor function of GPR83. The method according to claim 4, wherein in the amino acid sequence of GPR83, X in the sequence represented by Asn-X-Ser or Asn-X-Thr indicates an arbitrary amino acid residue other than proline.

Images