JP6619152B2 - Chimeric protein with flavin adenine dinucleotide-dependent glucose dehydrogenase activity - Google Patents

Description

  The present invention relates to a chimeric protein having flavin adenine dinucleotide-dependent glucose dehydrogenase activity, a gene encoding the chimeric protein, a recombinant vector containing the gene, a transformant containing the gene, the gene or the transformation The present invention relates to a method for producing a flavin adenine dinucleotide-dependent glucose dehydrogenase using a body, a glucose sensor using the chimeric protein, a glucose concentration measuring method, and a biofuel cell.

  Blood glucose self-measurement is important for diabetics to grasp their normal blood glucose level and use it for treatment. An enzyme using glucose as a substrate is used for a sensor used for blood glucose self-measurement.

  Glucose oxidase (EC 1.1.3.4) has been used for a long time as an enzyme for blood glucose sensors, and has an advantage of high specificity for glucose and excellent thermal stability. However, in the measurement using glucose oxidase, there is a problem that dissolved oxygen in blood affects the measured value.

  On the other hand, as an enzyme not affected by dissolved oxygen, for example, nicotinamide adenine dinucleotide (NAD) -dependent or nicotinamide adenine dinucleotide phosphate (NADP) -dependent glucose dehydrogenase (GDH) (NAD (P) GDH: EC1.1.1.17) and pyrroloquinoline quinone (PQQ) -dependent GDH (PQQGDH: EC1.1.5.2) are known as enzymes for blood glucose sensors. However, NAD (P) GDH has a drawback that it is poor in stability and requires the addition of a coenzyme, and PQQGDH has a disadvantage that it has poor substrate specificity and also acts on sugars other than glucose. .

  Therefore, a flavin adenine dinucleotide-dependent glucose dehydrogenase (FADGDH: EC 1.1.9.10.10) is an enzyme that is not affected by dissolved oxygen, does not require the addition of a coenzyme, and has excellent substrate specificity. Is attracting attention. FADGDH is an enzyme that catalyzes an oxidation reaction from glucose to D-glucono-1,5-lactone using flavin adenine dinucleotide (FAD) as a coenzyme, and has been discovered from psychrophilic filamentous fungi such as Aspergillus oryzae and Aspergillus terreus. Yes.

  FADGDH obtained by culturing and purifying Aspergillus oryzae or a wild strain of Aspergillus terreus has a certain degree of thermal stability. However, in the process of preparing the glucose sensor reagent, the enzyme used in the glucose sensor has high thermal stability because it may be subjected to heat drying treatment or the environmental temperature during storage may be high. It is desirable.

  Therefore, in Patent Document 1, in order to improve the thermal stability of FADGDH, FADGDH produced in a wild strain is expressed by expressing mutant FADGDH in Escherichia coli using a structural gene of FADGDH to which a specific mutation is added. It is disclosed that a mutant FADGDH having a thermal stability equivalent to that of the product can be obtained. Patent Document 2 discloses the use of FADGDH derived from thermophilic filamentous fungi such as Talaromyces emersonii and Thermoascus crustaceus as FADGDH having further excellent thermal stability.

International Publication No. 2009/119728 International Publication No. 2014/045912

  Although the mutant FADGDH disclosed in Patent Document 1 is excellent in enzyme activity, it cannot be said that the thermal stability is as high as that of the thermophilic filamentous fungus-derived FADGDH disclosed in Patent Document 2. On the other hand, although FADGDH derived from a thermophilic filamentous fungus disclosed in Patent Document 2 has extremely high thermal stability, the enzyme activity is specified other than thermophilic filamentous fungi such as Aspergillus oryzae such as FADGDH disclosed in Patent Document 1. It is not as high as FADGDH derived from Aspergillus sp.

  The present invention is not affected by dissolved oxygen, does not require the addition of a coenzyme, and maintains the excellent characteristics of FADGDH, which is excellent in substrate specificity, while maintaining both enzyme activity and thermal stability. It is an object to provide a protein having FADGDH enzyme activity which is further improved.

[1]
Aspergillus terreus var. Having flavin adenine dinucleotide-dependent glucose dehydrogenase activity. a specific amino acid sequence of aureus-derived protein or Aspergillus oryzae-derived protein is substituted with an amino acid sequence corresponding to the specific amino acid sequence of a thermophilic filamentous fungus-derived protein having flavin adenine dinucleotide-dependent glucose dehydrogenase activity A chimeric protein comprising
The specific amino acid sequence corresponds to a polypeptide encoded by exon 2 of the thermophilic filamentous fungus-derived DNA base sequence encoding the thermophilic filamentous fungus-derived protein among the thermophilic filamentous fungus-derived proteins. 1 polypeptide,
A chimeric protein, wherein the first polypeptide is substituted with a polypeptide encoded by the exon 2 derived from the thermophilic filamentous fungus.
[2]
The specific amino acid sequence corresponds to a polypeptide encoded by exon 3 of the thermophilic filamentous fungus-derived DNA base sequence encoding the thermophilic filamentous fungus-derived protein among the thermophilic filamentous fungus-derived proteins. The chimeric protein according to [1], which does not include the polypeptide of 2.
[3]
Aspergillus terreus var. The aureus-derived protein consists of the amino acid sequence shown in SEQ ID NO: 1 or the amino acid sequence obtained by removing at least a part of the signal peptide from the amino acid sequence shown in SEQ ID NO: 1,
The Aspergillus oryzae-derived protein consists of the amino acid sequence shown in SEQ ID NO: 2 or the amino acid sequence shown in SEQ ID NO: 2 from which at least a part of the signal peptide is removed, [1] or [2] Chimeric protein.
[4]
The thermophilic filamentous fungus-derived protein is the chimeric protein according to any one of [1] to [3], which is a protein derived from Talaromyces emersonii or a protein derived from Thermoascus crusaceus.
[5]
The protein derived from the Talaromyces emersonii comprises an amino acid sequence represented by SEQ ID NO: 3, or an amino acid sequence obtained by removing at least a part of a signal peptide from the amino acid sequence represented by SEQ ID NO: 3,
The Thermoascus crustaceus-derived protein is the chimeric protein according to [4], comprising the amino acid sequence set forth in SEQ ID NO: 4 or the amino acid sequence set forth in SEQ ID NO: 4 from which at least a part of the signal peptide has been removed.
[6]
The chimeric protein according to any one of [1] to [5], to which a sugar chain is added.
[7]
[1] A chimeric gene encoding the chimeric protein according to any one of [5].
[8]
(A) A chimeric DNA obtained by introducing a mutation that replaces at least the 344th to 939th base sequence with exon 2 of the base sequence described in SEQ ID NO: 7 or 8 with respect to the base sequence described in SEQ ID NO: 5, or ,
A chimeric DNA obtained by introducing a mutation that replaces at least the 347 to 942 base sequence with exon 2 of the base sequence described in SEQ ID NO: 7 or 8 with respect to the base sequence described in SEQ ID NO: 6;
(B) DNA consisting of a base sequence obtained by removing at least part of the base sequence encoding the signal peptide from the base sequence of the DNA of (A) above, and
(C) DNA comprising the base sequence of the above DNA (A) or (B) and an intron
A gene consisting of any one of the above DNAs.
[9]
A recombinant vector comprising the gene according to [7] or [8].
[10]
[7] A transformant comprising the gene according to [8].
[11]
A method for producing a flavin adenine dinucleotide-dependent glucose dehydrogenase using the gene according to [7] or [8].
[12]
[10] A method for producing a flavin adenine dinucleotide-dependent glucose dehydrogenase using the transformant according to [10].
[13]
A glucose concentration measurement reagent comprising the chimeric protein according to any one of [1] to [6].
[14]
A glucose sensor using the chimeric protein according to any one of [1] to [6].
[15]
[1] A glucose concentration measurement method using the chimeric protein according to any one of [6].
[16]
A biofuel cell using the chimeric protein according to any one of [1] to [6].

  According to the present invention, both the enzyme activity and the thermal stability are maintained while maintaining the excellent characteristics of FADGDH that are not affected by dissolved oxygen, do not require the addition of a coenzyme, and are excellent in substrate specificity. Can provide a protein having FADGDH enzyme activity, which is improved compared to conventional methods. Furthermore, the substrate affinity of a protein having FADGDH enzyme activity can be increased (Km value can be decreased).

4 is a photograph showing the results of agarose gel electrophoresis of the degenerate PCR product in Reference Example 1. A. terreus var. It is a figure which shows the base sequence of the DNA fragment containing the whole region of aureus origin FADGDH gene. Aspergillus terreus var. It is a schematic diagram which shows the structure of the exon in the base sequence derived from aureus. A. terreus var. It is a figure which shows the base sequence of ORF of an Aureus origin FADGDH gene, and the amino acid sequence deduced from the base sequence. Ta. It is a figure which shows the base sequence of the DNA fragment containing the whole region of Emersonii origin FADGDH gene. Ta. Shown in FIG. It is a schematic diagram which shows the structure of the exon in the base sequence derived from emersonii. Ta. It is a figure which shows the base sequence of ORF of emersonii origin FADGDH gene, and the amino acid sequence deduced from the base sequence. A. terreus var. aureus-derived FADGDH amino acid sequence and Ta. It is a figure which compares and shows the amino acid sequence of emersonii origin FADGDH. It is a table | surface which shows the measurement results, such as the structure of the chimeric protein C1te-C14te of Test Example 1, and FADGDH of Comparative Examples 1 and 2, and the enzyme activity, Km, and Tm in an evaluation test. It is a figure which shows the result of SDS-PAGE in the confirmation test of C1te-C14te of the comparative examples 1 and 2 and the test example 1. FIG. A. As shown in SEQ ID NO: 2. It is a schematic diagram which shows the structure of the exon in the base sequence derived from oryzae. A. It is a figure which shows the base sequence of ORF of an oryzae origin FADGDH gene, and the amino acid sequence deduced from the base sequence. A. oryzae-derived FADGDH amino acid sequence and Ta. It is a figure which compares and shows the amino acid sequence of emersonii origin FADGDH. 6 is a table showing the structures of chimeric proteins C3oe, C4oe, C7oe and Comparative Examples 3 and 2 in an evaluation test, and measurement results of enzyme activity, Km, Tm and the like in the evaluation test. It is a figure which shows the result of SDS-PAGE of a part of test example 2 (C3oe, C4oe, C7oe), the comparative example 3, and the comparative example 2 in the confirmation test of the test example 2.

  Hereinafter, embodiments of the present invention will be described. In addition, each embodiment is an illustration, and it cannot be overemphasized that the partial substitution or combination of the structure shown by different embodiment is possible. In the second and subsequent embodiments, description of matters common to the first embodiment is omitted, and only different points will be described. In particular, the same operation effect by the same configuration will not be sequentially described for each embodiment.

(Embodiment 1)
The invention of this embodiment is an Aspergillus terreus var. Having flavin adenine dinucleotide-dependent glucose dehydrogenase activity. a specific amino acid sequence of an aureus-derived protein or an Aspergillus oryzae-derived protein is substituted with an amino acid sequence corresponding to a specific amino acid sequence of a thermophilic filamentous fungus-derived protein having flavin adenine dinucleotide-dependent glucose dehydrogenase activity A chimeric protein comprising:
The specific amino acid sequence is a polypeptide corresponding to a polypeptide encoded by exon 2 (second exon from the 5 ′ end) of the DNA base sequence derived from the thermophilic filamentous fungus that encodes the protein derived from the thermophilic filamentous fungus. Comprising a peptide (first polypeptide),
A chimeric protein characterized in that the first polypeptide is substituted with a polypeptide encoded by exon 2 from a thermophilic filamentous fungus.

  Aspergillus terreus var. The aureus-derived protein preferably consists of the amino acid sequence shown in SEQ ID NO: 1 or an amino acid sequence obtained by removing at least a part of the signal peptide from the amino acid sequence shown in SEQ ID NO: 1. Aspergillus terreus var. Aureus-derived FADGDH has FADGDH activity by the present inventors, and has been confirmed to have high enzyme activity. SEQ ID NO: 1 is “an amino acid sequence of FADGDH derived from wild-type Aspergillus terreus var. Aureus” and also includes a signal peptide.

  The signal peptide is an indispensable structure for transporting a protein biosynthesized in a cell to an appropriate place in the process of biosynthesis of a protein molecule by a filamentous fungus or the like. The signal peptide portion is synthesized once based on the information of a gene that encodes an “amino acid sequence including a signal peptide” such as SEQ ID NO: 1, for example. Part is excised (mature protein).

  Further, the Aspergillus oryzae-derived protein preferably consists of the amino acid sequence shown in SEQ ID NO: 2 or the amino acid sequence obtained by removing at least a part of the signal peptide from the amino acid sequence shown in SEQ ID NO: 2. As a result of this test example of the present inventors, FADGDH derived from Aspergillus oryzae has FADGDH activity and high enzyme activity in Patent Document 1 and the like. SEQ ID NO: 2 is “an amino acid sequence of FADGDH derived from wild-type Aspergillus oryzae” and includes a signal peptide.

  The thermophilic filamentous fungus is not particularly limited as long as it has FADGDH activity and produces a protein having excellent heat stability, but the optimum growth temperature is 35 ° C or higher, or the growth limit temperature. A filamentous fungus having a temperature of 50 ° C. or higher is preferred.

  Specific thermophilic filamentous fungi include, for example, Talaromyces emersonii (Ta. Emersonii: NBRC 31232), Thermoascus crusaceus (Th. Crutusus: NBRC9129, 9816), Thermoasus aurusus 66, Nurboas 67.

  In addition, Aspergillus terreus var. aureus, Aspergillus oryzae, and the above-mentioned thermophilic filamentous fungi can be purchased from the National Institute of Biotechnology, Bioresources Division (NBRC).

  A specific example of the above thermophilic filamentous fungus is a thermophilic filamentous fungus that has been confirmed to produce FADGDH, an amino acid sequence, and the like by the present inventors. emersonii and Th. For thermophilic filamentous fungi other than crutusus, such knowledge is not known at the time of filing of the present application.

  From the results of the study by the present inventors, among the amino acid sequences constituting the thermophilic filamentous fungus-derived FADGDH, the sequence (first polypeptide) encoded by exon 2 of the gene encoding the FADGDH improves the thermal stability. It is thought that it has the function to make it. Therefore, Aspergillus terreus var. By substituting a polypeptide derived from aureus-derived protein or a protein derived from Aspergillus oryzae with a polypeptide encoded by exon 2 of thermophilic filamentous fungus-derived FADGDH, both high activity and high thermostability are achieved. A combined chimeric protein (chimeric FADGDH) can be obtained.

  In addition, from the examination results of the present inventors, it is known that the chimeric protein (chimeric FADGDH) of the present embodiment has a tendency to unexpectedly have a high substrate affinity (low Km value), This is also advantageous.

  The specific amino acid sequence does not include a polypeptide (second polypeptide) corresponding to the polypeptide encoded by exon 3 of the DNA base sequence derived from the thermophilic filamentous fungus that encodes FADGDH derived from the thermophilic filamentous fungus. It is preferable. The second polypeptide is, for example, A. shown in FIG. terreus var. A part of the amino acid sequence of Aureus, indicated by E3, or A. This is the part represented by E3 in the amino acid sequence of oryzae. In other words, it is preferable that the portion of the second polypeptide is not replaced with a polypeptide derived from a thermophilic filamentous fungus.

  This second polypeptide is an Aspergillus terreus var. Aureus-derived protein or Aspergillus oryzae-derived protein is considered to play a role in enhancing enzyme activity, and this second polypeptide has higher enzyme activity when not substituted with a polypeptide derived from a thermophilic filamentous fungus. This is because it can be maintained. Therefore, in this case, a chimeric FADGDH having both extremely high activity and thermal stability can be obtained more reliably.

  From the results of the study by the present inventors, it has been found that the chimeric protein of this embodiment has a tendency to have a high substrate affinity (low Km value), which is also advantageous in this respect.

  The protein (enzyme) of the present invention preferably has a sugar chain added thereto. This is because, in general, a protein with a sugar chain added is often superior in thermal stability or the like than a protein with a sugar chain added. The thermal stability is determined by measuring the FADGDH activity of the enzyme after heat treatment at a predetermined temperature and time, and determining the ratio to the FADGDH activity value before the heat treatment. Km value and FADGDH activity can be measured by various known methods.

(Embodiment 2)
The invention of this embodiment is a gene encoding the chimeric protein of the first embodiment. Specifically, for example, (A) a mutation that replaces at least the 344th to 939th base sequence with exon 2 of the base sequence described in SEQ ID NO: 7 or 8 is introduced into the base sequence described in SEQ ID NO: 5 A chimeric DNA, or
A chimeric DNA obtained by introducing a mutation that replaces at least the 347 to 942 base sequence with exon 2 of the base sequence described in SEQ ID NO: 7 or 8 with respect to the base sequence described in SEQ ID NO: 6;
(B) DNA comprising a base sequence obtained by removing at least part of the base sequence encoding the signal peptide from the base sequence of the DNA of (A) above, and
(C) DNA comprising the base sequence of the above DNA (A) or (B) and an intron
The gene which consists of any one of these is mentioned.

  SEQ ID NO: 5 is a "base sequence of a gene encoding FADGDH derived from wild-type Aspergillus terreus var. Aureus", which is a 1779-base sequence consisting only of exons from which introns have been deleted, and a base sequence encoding a signal peptide Contains the sequence and contains the stop codon.

  SEQ ID NO: 6 is a “base sequence of a gene encoding FADGDH derived from wild-type Aspergillus oryzae”, which is a sequence of 1782 bases consisting only of exons from which introns have been deleted, including a base sequence encoding a signal peptide And contains a stop codon.

  SEQ ID NO: 7 is a “base sequence of a gene encoding FADGDH derived from wild-type Ta. Emersonii”, which is a 1782 base sequence consisting only of exons from which introns have been deleted. Contains a stop codon.

  SEQ ID NO: 8 is a “base sequence of a gene encoding FADGDH derived from wild-type Thermoascus crustaceus”, which is a 1755-base sequence consisting only of exons from which introns have been deleted, including a base sequence encoding a signal peptide And contains a stop codon.

  “DNA containing the DNA sequence of (A) or (B) and an intron” means that the DNA sequence of (A) or (B) is an exon, and an intron sequence in the middle of the exon sequence. Is intervening DNA.

  The base sequence of the gene of the present embodiment is not limited to these specific examples, and any gene may be used as long as it encodes the protein (amino acid sequence) of Embodiment 1, and the codon appearance frequency ( The base sequence etc. which changed Codon usage) are also included.

(Embodiment 3)
The invention of this embodiment is a recombinant vector comprising the gene of embodiment 2. The gene of Embodiment 2 is introduced into a host microorganism as, for example, a recombinant vector linked to a plasmid vector, and the host becomes a transformant that produces FADGDH.

  As a method for introducing the recombinant vector into the host, for example, when the host is yeast, a spheroplast method, a lithium acetate method, or the like is used. Further, an electroporation method or the like may be used. When the host is a filamentous fungus, a protoplastized cell or the like is used. When the host is a microorganism belonging to Escherichia coli, a method of introducing recombinant DNA in the presence of calcium ions can be employed. Further, an electroporation method may be used. Furthermore, a commercially available competent cell (for example, TaKaRa Competent Cell BL21; Takara Bio) may be used.

(Embodiment 4)
The invention of this embodiment is a transformant containing the gene of Embodiment 2. As a host of the transformant, various hosts such as yeast, filamentous fungus, E. coli, animal cells, insect cells and the like can be used. In order to produce a protein having a sugar chain added, It is preferable to use eukaryotes derived from microorganisms such as yeast and filamentous fungi. Among eukaryotes, yeast has many industrial uses, and for example, Pichia pastoris (P. pastoris), Saccharomyces cerevisiae, Schizosaccharomyces pombe can be used.

  Specific examples of this embodiment include yeast transformed with the recombinant vector of Embodiment 3.

(Embodiment 5)
The invention of this embodiment is a method for producing FADGDH using the gene of Embodiment 2. In the present embodiment, for example, FADGDH can be produced by using the transformant of the fourth embodiment. Specifically, for example, it can be manufactured by the following procedure.

  The DNA having the desired FADGDH genetic information (the gene of Embodiment 2) is introduced into the host as a recombinant vector linked to a plasmid vector. The host is the same as that described in the fourth embodiment.

  The microorganism which is the transformant thus obtained can stably produce a large amount of FADGDH by being cultured in a nutrient medium. The culture form of the host microorganism, which is a transformant, may be selected in consideration of the nutritional physiological properties of the host. Usually, the culture is performed in liquid culture, but industrially, aeration and agitation culture is performed. Is advantageous.

  As a nutrient source of the medium, those commonly used for culturing microorganisms are widely used. Any carbon compound that can be assimilated may be used as the carbon source. For example, glucose, sucrose, lactose, maltose, molasses, pyruvic acid and the like are used. The nitrogen source may be any nitrogen compound that can be used. For example, peptone, meat extract, yeast extract, casein hydrolyzate, soybean cake alkaline decomposition product, and the like are used. In addition, phosphates, carbonates, sulfates, salts such as magnesium, calcium, potassium, iron, manganese, and zinc, specific amino acids, specific vitamins, and the like are used as necessary.

  The medium temperature can be appropriately changed within the range in which microorganisms grow and produce FADGDH. However, when the host is yeast, it is preferably 20 ° C. or higher and 35 ° C. or lower, and when the host is Escherichia coli, preferably 20 ° C. or higher and 42 ° C. It is as follows. Although the culturing time varies depending on the culturing conditions, the culturing may be terminated at an appropriate time in anticipation of the time when FADGDH reaches the maximum yield, and the culturing time is usually 6 hours or more and 72 hours or less. The medium pH can be appropriately changed within a range in which the bacteria grow and produce FADGDH, but is preferably pH 5.0 or more and 9.0 or less.

  Although the culture solution containing the microorganism that produces FADGDH can be collected and used as it is, generally, when FADGDH is present in the culture solution, the solution containing the protein and the microorganism are separated by filtration, centrifugation, or the like. It will be used later. On the other hand, when FADGDH is present in the body of the microorganism, the microorganism is collected from the obtained culture by a technique such as filtration or centrifugation, and then the microorganism is enzymatically obtained using a mechanical method or lysozyme. Destroy with the method. If necessary, a chelating agent such as EDTA, a surfactant or the like is added to a liquid containing microorganisms to solubilize FADGDH, and FADGDH is separated and collected as a solution.

  Methods for recovering FADGDH from the FADGDH-containing solution thus obtained include, for example, vacuum concentration, membrane concentration, salting-out treatment using ammonium sulfate, sodium sulfate, or the like, or a hydrophilic organic solvent (for example, methanol, ethanol, etc.). , Acetone). Heating treatment and isoelectric point treatment are also effective purification means. FADGDH can also be purified by gel filtration using an adsorbent or a gel filter, adsorption chromatography, ion exchange chromatography, or affinity chromatography.

  FADGDH production is not limited to such a method. For example, FADGDH can be produced by a cell-free protein translation system using the gene of Embodiment 2.

(Embodiment 6)
The invention of this embodiment is a glucose sensor using the glucose concentration measurement reagent containing the protein of Embodiment 1.

  The glucose concentration measuring reagent contains FADGDH produced by the method of Embodiment 5 in an amount sufficient for at least one measurement. In addition to the FADGDH, the glucose concentration measurement reagent may include, for example, a buffer solution necessary for the assay, a mediator, and a glucose standard solution for preparing a calibration curve. The form of the glucose concentration measurement reagent is not particularly limited, but may be provided in various forms suitable for a glucose sensor (for example, a freeze-dried reagent or a solution in an appropriate storage container).

  Although the electrode used for a glucose sensor is not specifically limited, A carbon electrode, a gold electrode, a platinum electrode, etc. can be used. For example, the protein of the present invention (enzyme: FADGDH) is immobilized on this electrode.

  Immobilization methods include a method using a crosslinking reagent, a method of encapsulating in a polymer matrix, a method of coating with a dialysis membrane, a photocrosslinkable polymer, a conductive polymer, a redox polymer, etc., or ferrocene or a derivative thereof. It may be fixed in a polymer or adsorbed and fixed on an electrode together with a representative electron mediator, or a combination thereof may be used. Typically, a method is used in which glutaraldehyde is used to immobilize the protein of the present invention (FADGDH) on a carbon electrode, and then is treated with a reagent having an amine group to cross-link glutaraldehyde.

(Embodiment 7)
The invention of this embodiment is a glucose concentration measurement method using the protein of Embodiment 1. The measurement of glucose concentration can be performed as follows, for example.

  Put buffer in constant temperature cell and maintain at constant temperature. As the mediator, potassium ferricyanide, phenazine methosulfate, or the like can be used. An electrode on which the protein (FADGDH) of Embodiment 1 is immobilized is used as a working electrode, and a counter electrode (for example, a platinum electrode) and a reference electrode (for example, an Ag / AgCl electrode) are used. After a constant voltage is applied to the carbon electrode and the current becomes steady, a sample containing glucose is added and the increase in current is measured. The glucose concentration in the sample can be calculated according to a calibration curve prepared with a standard concentration glucose solution.

(Embodiment 8)
The invention of this embodiment is a biofuel cell using the protein (FADGDH) of Embodiment 1. FADGDH catalyzes the dehydrogenation reaction of glucose, and electrons generated by this reaction are supplied as electric power.

  EXAMPLES Hereinafter, although an Example is given and this invention is demonstrated in detail, this invention is not limited to these.

(Reference Example 1)
Purchased from the Bioresources Division (NBRC), Biotechnology Headquarters, National Institute of Technology and Evaluation. terreus var. The FADGDH gene was screened for Aureus (NBRC30536) by the same method as in Example 1 of Patent Document 2.

  The purchased filamentous fungi were cultured aerobically using potato dextrose medium (Difco Laboratories) or malt extract medium (2% malt extract, 2% glucose, 0.1% peptone). Genomic DNA was extracted from the cultured filamentous fungi using Wizard Genomic DNA Purification Kit (Promega).

  In addition, it is practically difficult to search for a protein having FADGDH activity by analyzing a protein produced by a filamentous fungus because the production amount of FADGDH is very small. For this reason, the present inventors pay attention to the common part of the primary structure (amino acid sequence) of FADGDH derived from a thermophilic filamentous fungus (Aspergillus genus filamentous fungus) known to produce FADGDH. By using a primer corresponding to a base sequence encoding a specific amino acid sequence of the above, performing degenerate PCR (polymerase chain reaction) using the filamentous fungal genomic DNA as a template, and analyzing the PCR product. Was producing a protein having FADGDH activity.

  The specific amino acid sequence of the common part of the amino acid sequence of the psychrophilic filamentous fungus-derived FADGDH is preferably YDYIVVGGGTSGL, QVLRGKALGGTSTINGMAYTRAEDVQID, RSNFHPVGTAAMM, or NVRVVDASVLPFQVCGHLVSTLAVA.

  In this reference example, as a primer for degenerate PCR, a filamentous fungal genomic DNA is used by using the following primer which is a primer containing a base sequence encoding at least a part of these amino acid sequences or a base sequence complementary thereto: A degenerate PCR (polymerase chain reaction) was carried out using as a template.

As a sense primer for degenerate PCR,
Primer A (5′-TAYGAYTAYATCGTTTYTYGGAGGCGG-3 ′: SEQ ID NO: 9),
Primer B (5′-CAAGTKCTNCGTGCCRGGRAAGGCCCCTGG-3 ′: SEQ ID NO: 10), or
Primer C (5′-ACSCGCGCGGAGATGTCCCAGAT-3 ′: SEQ ID NO: 11)
Was used.

As an antisense primer,
Primer D (5'-CATCATGGCAGCMGTKCCGACGGGRTTGGAAGTT-3 ': SEQ ID NO: 12), or
Primer E (5′-GTGCTMACCAARTGGCCGCARACCTGGAA-3 ′: SEQ ID NO: 13)
Was used.

  The primers A to E include mixed bases (K, N, M, R, S, and Y) in the sequence, but each of the primers A to E has a plurality of different base sequences at the position of the mixed base. It means a mixture of seed primers.

  Using the genomic DNA obtained from the above filamentous fungi as a template, 6 types of degenerate PCR were performed using a combination of any of the above three types of sense primers and any of the above two types of antisense primers. The obtained PCR product was subjected to agarose gel electrophoresis (1.2% agarose gel), and the gel after the electrophoresis was stained with ethidium bromide to confirm the presence of the PCR product.

  As a result, A. terreus var. For the PCR product obtained using the aureus (NBRC30536) genome as a template, a DNA band was detected in the range of about 1.3 to 2.0 kb (FIG. 1). In FIG. 1, lane M is a marker, lane 1 is a combination of primers A and D, lane 2 is a combination of primers A and E, and lane 3 is a combination of primers B and D. Lane 4 shows the case of using a combination of primers B and E, lane 5 shows the case of using a combination of primers C and D, and lane 6 shows the case of using a combination of primers C and E. .

  A DNA fragment amplified by degenerate PCR was ligated to pCR-Blunt-II-TOPO (Life Technologies) and then subcloned into E. coli DH5α (Takara Bio). As a result of base sequence analysis of the inserted DNA fragment, amplification of a gene fragment having high homology with the previously reported FADGDH gene derived from Aspergillus spp. Was confirmed. From this, A. terreus var. It was suggested that the FADGDH gene exists in the genome of Aureus.

(Comparative Example 1: Wild type)
In this comparative example, Aspergillus terreus var. Wild type FADGDH from Aureus (A. terreus var. aureus) was produced using Pichia pastoris (P. pastoris) yeast. Details will be described below.

(1) A. terreus var. Cloning of the FADGDH gene from Aureus (NBRC 30536) terreus var. Southern hybridization analysis of genomic DNA was performed using the aureus-derived FADGDH gene partial fragment as a probe. A. terreus var. Aureus genomic DNA was cleaved with various restriction enzymes (New England BioLabs) and subjected to agarose gel electrophoresis. After the electrophoresis, the DNA fragment contained in the gel was transferred to a nylon membrane (Hybond-N +; GE Healthcare) by a capillary method using 20 × SSC (3M NaCl, 0.3M trisodium citrate, pH 7.0). . The nylon membrane after transfer and digoxigenin labeled probe DNA (DIG DNA Labeling and Detection Kit; Roche) were mixed and hybridized at 65 ° C. The DNA fragment hybridized with the probe was detected using an alkaline phosphatase-labeled anti-DIG antibody (DIG DNA Labeling and detection Kit; Roche).

  As a result, a DNA band hybridizing with the probe was detected at a position of about 4.5 kb from the XhoI lane. Since the open reading frame (ORF) of the FADGDH gene from the Aspergillus filamentous fungus already reported is about 1.8 kb, this about 4.5 kb XhoI fragment that hybridizes with the probe is A. terreus var. It was considered to cover the entire region of the Aureus-derived FADGDH gene.

  Next, A.A. terreus var. An attempt was made to clone a 5'-flanking area containing the region near the start codon of the Aureus-derived FADGDH gene and a 3'-flanking region containing the region near the start codon. A. cut with XhoI. terreus var. Aureus genomic DNA was subjected to preparative agarose gel electrophoresis, and a DNA fragment of about 4.5 kb was recovered. This DNA fragment was circularized with T4 ligase (Takara Bio) and used as a template for Inverse PCR.

  A. terreus var. Using the primer 30536GSP3 (5′-GTTGTCTCACTCGATCTGAGTGAAAGC-3 ′) and the primer 30536GSP5 (5′-CCCGATGTTCTACGAGTCTTCGCGCGACGAA-3 ′) designed based on the internal sequence of the Aureus-derived FADGDH gene, 3.5 Inverse results were obtained. A single DNA fragment was detected at position.

  Subcloning of this DNA fragment and base sequence analysis were conducted. terreus var. It was found that the 5'- and 3'-adjacent regions of the Aureus-derived FADGDH gene were successfully amplified.

  Next, using primers 30536GSP9 (5'-CTCGAGAATAAATATACCTGGGATGCGTTTT-3 ') and 30536GSP10 (5'-GTCGACGTTTTAGCTGACCGTTGGTGCAGGG-3') designed based on the sequences of 5'-flanking region and 3'-flanking region. terreus var. PCR was performed using aureus-derived genomic DNA as a template. As a result, amplification of a single DNA fragment of about 2.5 kb was confirmed. terreus var. It was found to contain the entire region of the Aureus-derived FADGDH gene.

(2) A. terreus var. Nucleotide sequence analysis of Aureus-derived FADGDH gene terreus var. The nucleotide sequence of the DNA fragment containing the entire region of the Aureus-derived FADGDH gene was determined by the primer walking method. A. terreus var. The base sequence of the DNA fragment containing the entire region of the Aureus-derived FADGDH gene is shown in FIG.

  A. terreus var. The Aureus-derived FADGDH gene contained a 1776 bp ORF consisting of three exons (exon 1; 343 bp, exon 2; 1218 bp, exon 3; 215 bp) (encoding 592 amino acids; 1779 bp when including the stop codon). (See the underlined portion in FIG. 2 and FIG. 3).

  In FIG. terreus var. The base sequence (1779 bp including the stop codon) of the ORF (FADGDH coding region) of the Aureus-derived FADGDH gene and the amino acid sequence inferred from the base sequence are shown.

  For the amino acid sequence shown in FIG. 4, the presence or absence of the signal peptide and the signal peptide cleavage site were estimated by the signal peptide prediction server SignalP4.0 (http://www.cbs.dtu.dk/services/SignalP/). As a result, the sequence from methionine (Met1) to the 16th alanine (Ala16) derived from the start codon was identified as a signal peptide. Further, in the amino acid sequence shown in FIG. 4, the FAD binding motif (Gly-Gly-Gly-Thr-Ser-Gly) important for FAD binding was completely conserved.

(3) A. terreus var. Preparation of Aureus-derived FADGDH gene expression type plasmid terreus var. The coding region of the Aureus-derived FADGDH gene was synthesized by overlap extension PCR.

  First, each exon was PCR amplified. For PCR amplification of exon 1, 30536GSP11 (5'-GCCATGTTGGAACACTTTCATTCCTCAGT-3 ') and 30536E1A (5'-CGCCATGCCGTTGATAGTGTCTGGTTCCGCC-3') were used as primers. For PCR amplification of exon 2, 30536E2S (5'-ATCAACGGCATGGCGTATACGCCGCGCCGAA-3 ') and 30536E2A (5'-AGAGCGATAGTTCTTGTCAAAAGACCCATTC-3') were used as primers. For the PCR amplification of exon 3, 30536E3S (5'-AAGAACTATCGCCTCACTACTCCACCCCTCTCTC-3 ') and 30536GSP12 (5'-TGTCTAACGACGGAGCAGCGTCGGCCCTTGAT-3') were used as primers.

  Amplified exon 1 and exon 2 were ligated by overlap-extension PCR. Further, the ligated DNA fragment and exon 3 were ligated by overlap extension PCR. terreus var. The coding region of the Aureus-derived FADGDH gene was synthesized.

  Next, A. terreus var. Using the Aureus-derived FADGDH gene coding region as a template, primers 30536Pic1 (5'-AAAGAAATTCGGCACCTTTGTCCAACTCCACCG-3 ') and 30536Pic2 (5'-TTTGCGGCGCTGTGGGTGTGTGTGGTGGTGTGTGTGGTGGTGTGTGTGTGTGTGTG The gene encoding mature FADGDH was amplified. A histidine codon (CAC) for fusing a histidine tag is added to the C-terminal side of the gene encoding the amplified mature FADGDH.

  After the amplified DNA fragment was digested with EcoRI and NotI, P.P. by ligation to the same restriction enzyme site of the secretory expression vector pPIC9 (Life Technologies) for pastoris (Pichia pastoris). terreus var. Aureus-derived FADGDH gene secretion expression type plasmid was prepared. By ligating a gene encoding mature FADGDH to pPIC9, a yeast signal sequence is fused upstream of the gene encoding mature FADGDH. In this way, A.I. terreus var. Aureus-derived FADGDH gene secretion expression type plasmid was prepared.

(4) A. terreus var. Expression of Aureus-derived FADGDH gene in yeast and purification of recombinant enzyme terreus var. aureus-derived FADGDH secretion expression plasmid pastoris GS115 strain (Life Technologies). The GS115 strain introduced with the secretory expression plasmid was cultured in BMG medium (100 mM potassium phosphate buffer: pH 6.0, 1.34% yeast nitrogen base, 4 × 10 ⁻⁵ % biotin, 1% glycerol) for 2 days. (Pre-culture). Bacteria obtained by preculture is inoculated into BMM medium (100 mM potassium phosphate buffer: pH 6.0, 1.34% yeast nitrogen base, 4 × 10 ⁻⁵ % biotin, 0.5% methanol), Cultured aerobically at 30 ° C. for about 5 days.

  The culture supernatant after culture was collected and dialyzed against PBS buffer. The culture supernatant after dialysis was applied to a Ni-NTA Agarose (QIAGEN) column (diameter 2.0 cm, height 2.0 cm) equilibrated with PBS buffer. After washing the column with PBS buffer, the adsorbed protein was eluted with 20 mM Hepes-NaOH buffer (pH 7.5) containing 200 mM imidazole. The elution fraction was desalted using Amicon Ultra-15 MWCO10 (Merck Millipre). terreus var. A FADGDH purified sample containing Aureus-derived FADGDH was obtained.

(Comparative Example 2: Wild type)
This comparative example is a wild-type FADGDH derived from Talaromyces emersonii (NBRC3232) (Ta. Emersonii), and is a purified FADGDH product produced using yeast (Pichia pastoris) in the same manner as in Example 6 of Patent Document 2. is there.

  Ta. FIG. 5 shows the nucleotide sequence of a DNA fragment containing the entire region of emersonii-derived FADGDH gene. This Ta. The Emersonii-derived FADGDH gene contained a 1779 bp ORF (encoding 593 amino acids) composed of four exons (exon 1; 346 bp, exon 2; 598 bp, exon 3; 614 bp, exon 4; 221 bp) (FIG. 5). Underlined portion and FIG. 6).

  In FIG. The nucleotide sequence of the ORF (FADGDH coding region) of the FADGDH gene derived from emersonii (1782 bp including the stop codon) and the amino acid sequence inferred from the nucleotide sequence are shown. These are disclosed in detail in Patent Document 2 together with their cloning and analysis methods.

  Ta. Expression of the Emersonii-derived FADGDH gene in yeast and purification of the recombinant enzyme were performed in the same manner as in Comparative Example 1, and Ta. A purified FADGDH preparation containing FADGDH derived from emersonii was obtained.

[Test Example 1]
In this test example, A. terreus var. Some polypeptides of Aureus-derived FADGDH were synthesized using Ta. A chimeric protein was prepared by substituting with a polypeptide corresponding to the exon unit of emersonii-derived FADGDH.

  In this test example, A.E shown in FIG. terreus var. The base sequence of the coding region of the Aureus-derived FADGDH gene is Ta. Secretory expression plasmids of 14 types of chimeric FADGDH genes having the structure shown in the table of FIG. 9 replaced with at least one of exons 1 to 4 of the FADERDH gene derived from emersonii were prepared. In this test example, chimeric proteins having 14 types of structures shown in the table of FIG. 9 are denoted as C1te to C14te, respectively. C represents the initial of Chimera, and the last two characters represent the initial of terreus and emersonii.

  First, according to the protocol of Gibson Assembly Master Mix (New England Biolabs), Ta. each exon (E1 to E4) of the FADGDH gene derived from Emersonii, and Ta. which corresponds to the base sequence of each exon of the FADGDH gene derived from emersonii. terreus var. Primers for amplifying each base sequence (defined as E1 to E4) of the Aureus-derived FADGDH gene were prepared, and PCR amplification was performed using KOD-Plus-Neo (Toyobo).

  Next, the PCR amplified exon fragments corresponding to the structures of the 14 types of chimeric proteins shown in FIG. 9 and the pPIC9 vector cleaved with EcoRI and NotI were ligated with Gibson Assembly Master Mix to obtain the chimeric FADGDH gene. A secretory expression plasmid was prepared. The sequence of the prepared gene was confirmed by DNA sequence analysis.

The 14 primers used for PCR amplification are shown below:

(1) CPicG1 (5′-AAAAGAGAGGCTGAAGCTTACGTAGAATTC-3 ′)
(2) CPicG2 (5′-CATGTCTAAGGCGAATTAATTCGCGGCCGC-3 ′)
(3) C1teE1A (5′-AGGCCATTCCGTTGATAGTGCTGGTTCCGC-3 ′)
(4) C1teE2S (5'-CTATCAACGGAATGGCCTATACGCGCGCCC-3 ')
(5) C1teE3A (5′-TAGAGCGATATGTCTCCTTCAGCCACGCCT-3 ′)
(6) C1teE4S (5′-AGGAGACATATCGCTCTAACTTCCACCCCG-3 ′)
(7) C4teE2A (5′-AAGAACGCTTGGATTCCCAACCCCAGAGAG-3 ′)
(8) C4teE3S (5′-GGGAATCCAAGCGTTCTTCAAAAGTTCAAC-3 ′)
(9) C5teE2A (5′-CAGAATGCTGGGGTTGCCAATCCCGGAAAG-3 ′)
(10) C5teE3S (5′-GGCAACCCCAGCATTCTGAACAAATACAAC-3 ′)
(11) C6teE1A (5′-ACGCCATGCCATTGATCGTGCTCGTGCCTC-3 ′)
(12) C6teE2S (5′-CGATCAATGGCATGGCGTATACGCGCGCCG-3 ′)
(13) C6teE3A (5′-TCGACCGATAGTTCTTGTCAAAGACCCATT-3 ′)
(14) C6teE4S (5′-ACAAGAACTATCGGTCGAATTTCCATCCCG-3 ′)

CPicG1 is an A.I. terreus var. aureus and Ta. It is a sense primer that can be used in common for exon 1 amplification of emersonii-derived FADGDH. CPicG2 is an A.I. terreus var. aureus and Ta. It is an antisense primer that can be commonly used for amplification of exon 4 of FADERDH derived from emersonii. C1teE1A is an antisense primer for amplifying exon 1 corresponding to C1te. C1teE2S is a sense primer for amplifying exon 2 corresponding to C1te. The remaining C4teE2A to C6teE4S primers shown above are similarly antisense (or sense) primers for amplifying exons 1 to 4 corresponding to C4te to C6te.

  For example, when a pPIC9 plasmid ligated with the C1te gene is prepared, each exon can be PCR-amplified with the combination of the template plasmid and the primer shown in Table 1, and ligated with a pPIC9 vector cleaved with EcoRI and NotI using Gibson Assembly Master Mix. The template plasmid contains wild type A.I. terreus var. aureus or wild type Ta. Any of pPIC9 (pPIC9_30536 and pPIC9_31232) linked to the FADGDH gene derived from emersonii is used.

  Also, when preparing a pPIC9 plasmid ligated with the C11te gene, each exon can be PCR amplified with the combination of template plasmid and primer shown in Table 2, and ligated with a pPIC9 vector cleaved with EcoRI and NotI by Gibson Assembly Master Mix.

  In this way, 14 types of chimeric FADGDH gene secretory expression type plasmids were prepared using the 14 types of primers shown above. In addition, exon 1 of the produced chimeric FADGDH contains A.I. terreus var. aureus or Ta. The nucleotide sequence encoding the signal sequence of emersonii-derived FADGDH protein is not included.

  Expression of the produced chimeric FADGDH gene in yeast and purification of the recombinant enzyme were carried out in the same manner as in Comparative Example 1.

  In this manner, A.E shown as E1 to E4 in FIG. terreus var. At least one of the four polypeptides constituting the Aureus-derived FADGDH is a Ta. Emersonii-derived polypeptides (polypeptides encoded by exons 1 to 4 of the DNA base sequence encoding Ta. emersonii-derived protein) having 14 structures having the structure shown in the table of FIG. A purified sample of the chimeric protein (FADGDH) was obtained.

  8, E1 to E4 indicate sequences corresponding to amino acid sequences (polypeptides) encoded by exons 1 to 4 of thermophilic filamentous fungi (Ta. Emersonii), respectively. As described above, A.I. terreus var. The gene that encodes Aureus-derived FADGDH consists of three exons (FIG. 3), and E1 to E4 in FIG. 8 do not match the structure of this exon.

(Confirmation test of Test Example 1)
Next, the FADGDH purified standards obtained in Test Example 1, Comparative Example 1 and Comparative Example 2 were subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE). First, the protein concentration in the FADGDH purified sample was measured. The protein concentration was measured by the BCA method using a commercially available protein quantification kit (Pierce BCA Protein Assay Reagent; Thermo Fisher Scientific Co., Ltd.). In this kit, bovine serum albumin is used as the standard protein.

  Based on the obtained concentration measurement value, a purified sample containing 5 μg of FADGDH was subjected to SDS-PAGE. SDS-PAGE was performed according to the Laemmli method. As the SDS-polyacrylamide gel, “e-PAGE 10-20%” (Ato) was used. The gel after electrophoresis was stained with a CBB (Coomassie Brilliant Blue) -based staining solution “GelCode Blue Safe Protein Stain” (Thermo Fisher Scientific). As a protein marker, “Unstained Protein Ladder Broad Range (10-250 kDa)” (New England BioLabs) was used.

  The result of SDS-PAGE is shown in FIG. The left lane of each FADGDH lane is a protein marker. As shown in FIG. 10, a band was observed at a position of about 80 to 250 kDa for any FADGDH.

  In FIG. terreus var. aureus-derived FADGDH, Ta. The number of N-type sugar chain addition sites deduced from the amino acid sequences of emersonii-derived FADGDH and each chimeric FADGDH is shown. A. terreus var. aureus-derived FADGDH has 9 locations, Ta. In Emersonii-derived FADGDH, there are twelve putative glycosylation sites, but the result of SDS-PAGE is that there are few glycosylation sites. terreus var. Aureus-derived FADGDH has a higher molecular weight, and a proportional relationship cannot be found between the estimated number of glycosylation sites and the molecular weight on SDS-PAGE. However, Ta. When the chimeric protein contains the amino acid sequence of a polypeptide encoded by exon 3 of Emersonii-derived FADGDH, the A. coli corresponding to the same position is around 80 to 150 kDa. terreus var. When the amino acid sequence of Aureus-derived FADGDH is contained in the chimeric protein, there is a tendency that a main band appears in the vicinity of 150 to 250 kDa.

(Comparative Example 3)
This comparative example is a wild-type FADGDH derived from Aspergillus oryzae (A. oryzae) T1 strain, and basically the Example of Patent Document 2 except that the FADGDH gene secretion expression plasmid prepared as follows is used. 6 is a purified preparation of FADGDH produced using yeast (Pichia pastoris) in the same manner as in FIG. Hereinafter, preparation of the plasmid used in this comparative example will be described.

  A. described in SEQ ID NO: 41 of Patent Document 1. The base sequence of the FADGDH gene derived from oryzae T1 strain was prepared by artificial synthesis. A. The nucleotide sequence including the entire region of the FADGDH gene derived from the oryzae T1 strain is known (see, for example, SEQ ID NO: 41 of Patent Document 1), encodes a 1779 bp ORF (593 amino acids), and includes a termination codon of 1782 bp. It is known. FIG. The base sequence of ORF (FADGDH coding region) of the FADGDH gene derived from oryzae (1782 bp including the stop codon) and the amino acid sequence inferred from the base sequence are shown.

  The base sequence of the gene is represented by A.A. A BLAST search in the oryzae RIB40 strain and the like revealed that most A. The oryzae strain has a gene having a homology of about 99%, all of which are composed of four exons and are presumed to contain three introns at a common position. From this result, A. It was speculated that the FADGDH gene derived from oryzae T1 strain was composed of four exons, exon 1; 346 bp, exon 2; 598 bp, exon 3; 620 bp, exon 4; 215 bp (see FIG. 11).

  Next, A. Using the oryzae-derived FADGDH gene coding region as a template, the primers AOPic1 (5′-AAAGAAATTCTCACCCGGCTGGACGGGGCCAAGCTGPCR) using the AOPic1 (5′-TTTGCGGCGCTGCTGCTGTCTGTCGCTGTCGTCTGC The gene to be amplified was amplified. A histidine codon (CAC) for fusing a histidine tag is added to the C-terminal side of the gene encoding the amplified mature FADGDH.

  After the amplified DNA fragment was digested with EcoRI and NotI, P.P. by ligation to the same restriction enzyme site of the secretory expression vector pPIC9 (Life Technologies) for pastoris (Pichia pastoris). An oryzae-derived FADGDH gene secretion expression type plasmid was prepared. By ligating a gene encoding mature FADGDH to pPIC9, a yeast signal sequence is fused upstream of the gene encoding mature FADGDH. In this way, A.I. An oryzae-derived FADGDH gene secretion expression type plasmid was prepared.

[Test Example 2]
In this test example, A. Some polypeptides of oryzae-derived FADGDH are labeled with Ta. A chimeric protein was prepared by substituting with a polypeptide corresponding to the exon unit of emersonii-derived FADGDH.

  In this test example, A.E shown in FIG. The base sequence of the coding region of the oryzae-derived FADGDH gene is Ta. having the structure shown in the table of FIG. 9 (here, the gene for FADGDH from A. oryzae rather than A. terreus var. aureus), replaced with at least one of exons 1 to 4 of the FADGDH gene from emersonii, Fourteen types of secreted expression plasmids of chimeric FADGDH genes were prepared. In this test example, the chimeric proteins having 14 types of structures are denoted as C1oe to C14oe, respectively. C represents the initial of Chimera, and the last two characters represent the initials of oryzae and emersonii.

Except for the primers used in the test, 14 types of secreted expression plasmids of chimeric FADGDH gene were prepared in the same manner as in Test Example 1. The 14 primers used for PCR amplification are shown below:

(1) CPicG1 (5′-AAAAGAGAGGCTGAAGCTTACGTAGAATTC-3 ′)
(2) CPicG2 (5′-CATGTCTAAGGCGAATTAATTCGCGGCCGC-3 ′)
(3) C1oeE1A (5′-AGGCCATTCCATTGATTGTACTGGTTCCTC-3 ′)
(4) C1oeE2S (5′-CAATCAATGGAATGGCCTATACGCGCGCCC-3 ′)
(5) C1oeE3A (5′-TGGAACGATATGTCTCCTTCAGCCACGCCT-3 ′)
(6) C1oeE4S (5′-AGGAGACATATCGTTCCAACTTCCACCCCG-3 ′)
(7) C4oeE2A (5′-GAGGATGGTTGGATTCCCAACCCCAGAGAG-3 ′)
(8) C4oeE3S (5′-GGGAATCCAACCATCCTCAAAAAGAACAAC-3 ′)
(9) C5oeE2A (5′-CAGAATGCTTGGGTTTCCAACTCCTGAAAG-3 ′)
(10) C5oeE3S (5′-GGAAACCCAAGCATTCTGAACAAATACAAC-3 ′)
(11) C6oeE1A (5′-AGGCCATTCCATTGATCGTGCTCGTGCCTC-3 ′)
(12) C6oeE2S (5′-CGATCAATGGAATGGCCTATACCCGCGCAG-3 ′)
(13) C6oeE3A (5′-TCGACCGATAGTTAGCCTTGAGCCATTCAA-3 ′)
(14) C6oeE4S (5′-AGGCTAACTATCGGTCGAATTTCCATCCCG-3 ′)

CPicG1 is an A.I. oryzae and Ta. This is a sense primer that can be commonly used for amplification of exon 1 of FADGDH derived from emersonii. CPicG2 is an A.I. oryzae and Ta. It is an antisense primer that can be used in common for exon 4 amplification of FADGDH derived from emersonii. C1oeE1A is an antisense primer for amplifying exon 1 corresponding to C1oe. C1oeE2S is a sense primer for amplifying exon 2 corresponding to C1oe. Similarly, the remaining C4oeE2A to C6oeE4S primers described above are antisense (or sense) primers for amplifying exons 1 to 4 corresponding to C4oe to C6oe.

  For example, when a pPIC9 plasmid ligated with the C3oe gene is prepared, each exon can be PCR-amplified with a combination of the template plasmid and the primer shown in Table 3, and ligated with a pPIC9 vector cleaved with EcoRI and NotI using Gibson Assembly Master Mix. The template plasmid contains wild type A.I. oryzae or wild type Ta. Any of pPIC9 (pPIC9_AO and pPIC9_31232) to which the FADGDH gene derived from emersonii is linked is used.

  In this way, 14 types of chimeric FADGDH gene secretory expression type plasmids were prepared using the 14 types of primers shown above. In addition, exon 1 of the produced chimeric FADGDH contains A.I. oryzae or Ta. The nucleotide sequence encoding the signal sequence of emersonii-derived FADGDH protein is not included.

  Expression of the produced chimeric FADGDH gene in yeast and purification of the recombinant enzyme were carried out in the same manner as in Comparative Example 1.

  In this manner, in the same manner as in Test Example 1, A.E shown as E1 to E4 in FIG. at least one of the four polypeptides constituting oryzae-derived FADGDH corresponds to Ta. Purified samples of three types of chimeric proteins (FADGDH) described in FIG. 14 having a structure substituted with a polypeptide encoded by each of exons 1 to 4 of the DNA base sequence encoding the protein derived from emersonii were obtained. . In this test example, the chimeric proteins having these three types of structures are denoted as C3oe, C4oe, and C7oe, as in Test Example 1 (table in FIG. 9). The last two characters represent the initials of oryzae and emersonii.

(Confirmation test of Test Example 2)
Next, the FADGDH purified standard obtained in Test Example 2 (C3oe, C4oe, C7oe: see FIG. 14), Comparative Example 3 (derived from A. oryzae) and Comparative Example 2 (derived from Ta. Emersonii) was used as Test Example 1 above. As in the confirmation test, the sample was subjected to SDS-PAGE.

  The result of SDS-PAGE is shown in FIG. The left lane of each FADGDH lane is a protein marker. As shown in FIG. 15, a band was observed at a position of about 80 to 250 kDa for any FADGDH. In FIG. oryzae-derived FADGDH, Ta. It shows the number of N-type sugar chain addition sites estimated from the amino acid sequences of emersonii-derived FADGDH and each chimeric FADGDH. A. Oryzae-derived FADGDH has 9 locations, Ta. Emersonii-derived FADGDH has 12 putative number of glycosylation sites, but the result of SDS-PAGE shows that the number of glycosylation sites is small. Oryzae-derived FADGDH has been detected to a higher molecular weight, and a proportional relationship cannot be found between the estimated number of glycosylation sites and the molecular weight on SDS-PAGE.

[Evaluation test]
Regarding the FADGDH purified samples obtained in Test Examples 1 and 2 (chimeric protein) and Comparative Examples 1 to 3 (wild type), the following various characteristics (enzyme activity, Km value, temperature stability, substrate) regarding the enzyme activity of FADGDH An evaluation test on specificity was conducted. The principle of enzyme activity measurement, definition of enzyme activity, and activity measurement method in this evaluation test are as follows.

(Principle of enzyme activity measurement)
D-glucose + 1-methoxyPMS + FADGDH
→ D-glucono-1,5-lactone + 1-methoxyPMS (reduced type)
+ FADGDH (oxidized type)
1-methoxyPMS (reduced type) + DCPIP
→ 1-methoxyPMS + DCPIP (reduced type)
The amount of reduced DCPIP produced by reduction of 2,6-dichlorophenolindphenol (DCPIP) with reduced 1-methoxyphenazine methosulphate (1-methoxyPMS) is measured by measuring the absorbance at 600 nm using a spectrophotometer. Measured. Moreover, in examination of substrate specificity, D-glucose was changed into other saccharides and the enzyme activity with respect to each saccharide (substrate) was measured.

(Definition of enzyme activity)
The enzyme activity (FADGDH activity) is defined as 1 unit of the amount of FADGDH that forms 1 micromole of reduced DCPIP per minute under the conditions of 37 ° C. and pH 7.0.

Specifically, FADGDH activity is determined by the following equation from the absorbance change described later (ΔOD _TEST, ΔOD _BLANK).

FADGDH activity (U / mL)
= [(ΔOD _TEST −ΔOD _BLANK ) × 3.1] / (16.3 × 0.1 × dilution rate)

Each constant in the formula is
3.1: Volume of reaction solution after mixing FADGDH solution (mL)
16.3: millimolar molecular extinction coefficient of DCPIP ^{(mM -1} · ^cm -1)
0.1: Volume of FADGDH solution (mL)
It is.

(Activity measurement method)
(1) Mix the reaction solution with the following composition in the cuvette.
0.1M potassium phosphate buffer (pH 7.0) 1.5mL
0.9 mL of 1M glucose solution
1.75mM 2,6-Dichlorophenolindophenol (DCPIP) 0.12mL
20 mM 1-Methoxy-5-methylphenazium methylsulfate (1-mPMS) 0.021 mL
10% TritonX-100 0.06mL
H ₂ O 0.399 mL
(2) Pre-incubate at 37 ° C. for 10 minutes.
(3) Add 0.1 mL of FADGDH solution, mix by inverting, and react at 37 ° C. During this time, the absorbance at 600 nm is recorded using an absorptiometer, and the change in absorbance per minute (ΔOD _TEST ) is calculated.
(4) As a control, instead of the enzyme solution (the solution obtained by adding the FADGDH solution to the above reaction solution), 0.01% TritonX was added to an equal volume of enzyme dilution solution (50 mM potassium phosphate buffer (pH 7.0)). As for (Liquid to which −100 is added), the change in absorbance is recorded in the same manner as in (3), and the change in absorbance per minute (ΔOD _BLANK ) is calculated.

<Enzyme activity, Km>
Here, enzyme activity (reaction rate) was examined. Specifically, the enzyme activity of the FADGDH purified sample was measured by changing the concentration of the glucose solution to 0 to 2 M in the same manner as in the above activity measurement method.

  The activity when the concentration of glucose solution (substrate concentration) is 300 mM is shown in the table of FIG. 9 (Test Example 1, Comparative Examples 1 and 2) and the table of FIG. 14 (Test Example 2 (C3oe, C4oe, C7oe), Comparative Example Shown in 3 and 2). In the tables of FIGS. 9 and 14, the activity (U / mg) is the activity per 1 mg of enzyme, and the activity (U / μmol-FAD) is per 1 μmol of FAD (hololase) bound to the enzyme. Active.

  Furthermore, based on the said measurement result, the eddy-Hofstay plot (Eadie-Hofstay plot) was created about each of the FADGDH refinement | purification sample. In addition, Km can also be calculated | required by a Lineweaver-Burke plot (Lineweaver-Burke plot). In the line weaver bark plot, the X intercept of the straight line is -1 / Km, so Km can be obtained from the graph. As a result of performing the above two plots in this evaluation test, a Km value with a relatively high accuracy was obtained with the eddy-Hofstay plot. Therefore, the Km value obtained by the eddy-Hofstay plot is shown. Km is the Michaelis constant, and Vmax is the maximum speed when the enzyme is saturated with the substrate.

  Table 4 shows C4te of Test Example 1 and FADGDH Km values and Vmax of Comparative Examples 1 and 2 obtained from the eddy Hofsty plot. In addition, the Km value and Vmax of Test Example 2 (C3oe, C4oe, C7oe) and Comparative Examples 3 and 2 are shown in the table of FIG.

<Temperature stability>
Here, the temperature stability of the enzyme activity was evaluated. First, the enzyme activity was measured by the above-mentioned activity measurement method for the FADGDH purified sample obtained in the examples. Based on these measured values, the enzyme was adjusted so as to contain a final concentration of 50 mM citrate buffer, pH 5.0, 1 × 10 ⁻³ wt% Triton X-100, and enzyme activity of 10 U / mL. A solution (FADGDH solution) was prepared. )
This FADGDH solution was dispensed into microtubes and heated for 15 minutes at a predetermined temperature in the range of 5 ° C. to 70 ° C. using a PCR machine. The enzyme activity before and after heating was measured, the ratio of the enzyme activity after heating to the enzyme activity before heating (residual activity rate) was determined, and the temperature (Tm) at the midpoint of denaturation was calculated. ) The results are shown in the table of FIG. 9 (Test Example 1, Comparative Examples 1 and 2) and the table of FIG. 14 (Part of Test Example 2 (C3oe, C4oe, C7oe), Comparative Examples 3 and 2).

  In the Tm results shown in the table of FIG. 9, the chimeric protein in which the polypeptide of E2 (first polypeptide) shown in FIG. All show that Tm is higher than Comparative Example 1 (FADGDH derived from A. terreus var. Aureus), and that all other chimeric proteins have Tm equal to or lower than that of Comparative Example 1. The same tendency is shown in the results of Tm shown in the table of FIG. From this, it is considered that the polypeptide encoded by exon 2 of the gene encoding FADGDH has a function of improving the thermal stability among the amino acids constituting thermophilic filamentous fungus-derived FADGDH.

  In addition, in the result of the activity shown in the table of FIG. 9, the chimeric protein in which the polypeptide of E3 (second polypeptide) shown in FIG. 8 is replaced with a polypeptide derived from a thermophilic filamentous fungus has low activity, It can be seen that the chimeric protein in which the polypeptide of E3 is not substituted tends to have higher activity. In addition, the same tendency is shown also in the result of the activity shown in the table of FIG. From this fact, the second polypeptide (E3) was isolated from Aspergillus terreus var. Aureus-derived protein or Aspergillus oryzae-derived protein is considered to play a role in enhancing enzyme activity, and this second polypeptide has higher enzyme activity when not substituted with a polypeptide derived from a thermophilic filamentous fungus. It can be maintained.

  Further, from the results of Km shown in Table 4 and the table of FIG. 14, the Km values of the chimeric FADGDH of C4te (Test Example 1) and C4oe (Test Example 2) are surprisingly the wild type FADGDH of Comparative Examples 1-3. It turns out that it is low with respect to any of these. In addition, it means that the substrate affinity of an enzyme is so high that Km value of an enzyme is small.

<Substrate specificity>
Here, for the wild type FADGDH of Comparative Examples 1 to 3, and the chimeric FADGDH of C4te (Test Example 1), C4oe (Test Example 2) and C7oe (Test Example 2), the substrate specificity (sugars other than glucose and glucose) Whether or not to be used as a substrate).

  Specifically, first, each enzyme solution (FADGDH solution) was prepared at an enzyme concentration at which sufficient enzyme activity was obtained when the glucose concentration was 40 mM. About these FADGDH solutions, the said activity measuring method was prepared so that the density | concentration of the saccharide | sugar in the said reaction liquid might be 40 mM, and the enzyme activity was measured. In addition, the case where an enzyme was not included was made into the control | contrast and the control was taken with respect to each saccharide | sugar. With respect to glucose, the relative activity of other saccharides when the measured enzyme activity was 100 (%) was calculated, and the results are summarized in Table 5. In addition, it was judged that there was no activity about the thing whose change amount of DCPIP light absorbency is not significant compared with a control | contrast, and described with "ND" (Not detected).

  From the results shown in Table 5, it can be seen that the chimeric proteins (C4te, C4oe, C7oe) have a high substrate specificity for glucose, like the wild type FADGDH of Comparative Examples 1-3.

  It should be understood that the embodiments and examples disclosed herein are illustrative and non-restrictive in every respect. The scope of the present invention is defined by the terms of the claims, rather than the description above, and is intended to include any modifications within the scope and meaning equivalent to the terms of the claims.

Claims (14)

Aspergillus terreus var. Having flavin adenine dinucleotide-dependent glucose dehydrogenase activity. a specific amino acid sequence of aureus-derived protein or Aspergillus oryzae-derived protein is substituted with an amino acid sequence corresponding to the specific amino acid sequence of a thermophilic filamentous fungus-derived protein having flavin adenine dinucleotide-dependent glucose dehydrogenase activity A chimeric protein comprising
Aspergillus terreus var. The aureus-derived protein consists of the amino acid sequence shown in SEQ ID NO: 1 or the amino acid sequence obtained by removing at least a part of the signal peptide from the amino acid sequence shown in SEQ ID NO: 1,
The Aspergillus oryzae-derived protein consists of the amino acid sequence shown in SEQ ID NO: 2 or the amino acid sequence shown in SEQ ID NO: 2 from which at least a part of the signal peptide is removed,
The thermophilic filamentous fungus-derived protein consists of the amino acid sequence shown in SEQ ID NO: 3 or the amino acid sequence shown in SEQ ID NO: 3 by removing at least a part of the signal peptide,
The specific amino acid sequence includes a first polypeptide corresponding to a polypeptide encoded by exon 2 of a DNA base sequence derived from the thermophilic filamentous fungus encoding the thermophilic filamentous fungus-derived protein;
A chimeric protein, wherein the first polypeptide is substituted with a polypeptide encoded by the exon 2 derived from the thermophilic filamentous fungus.   The specific amino acid sequence does not include a second polypeptide corresponding to a polypeptide encoded by exon 3 of a DNA base sequence derived from the thermophilic filamentous fungus encoding the thermophilic filamentous fungus-derived protein. 2. The chimeric protein according to 1. The thermophilic filamentous fungus-derived protein is Talaromyces emersonii derived protein, a chimeric protein of claim 1 or 2. The chimeric protein according to any one of claims 1 to 3 , wherein a sugar chain is added. A chimeric gene encoding the chimeric protein according to any one of claims 1 to 3 . (A) A chimera obtained by introducing a mutation that replaces at least the 344 to 939th base sequence with the 347 to 944th base sequence of the base sequence described in SEQ ID NO: 7 with respect to the base sequence described in SEQ ID NO: 5 DNA or
Against the nucleotide sequence set forth in SEQ ID NO: 6, a chimeric DNA obtained by introducing a mutation to replace at 347-944 th nucleotide sequence of the nucleotide sequence set forth in SEQ ID NO: 7 of at least 347 to 942 th nucleotide sequence,
(B) DNA consisting of a base sequence obtained by removing at least part of the base sequence encoding the signal peptide from the base sequence of the DNA of (A) above,
(C) the base sequence of the DNA of the above (A) or (B) in which the base sequence described in SEQ ID NO: 5 is substituted ;
Introns consisting of the nucleotide sequence of GTTTGTATAACAGTCCACGAGTTCCACCGGCGCAGCTAACAGTCGATTTCAACCGTAG to be inserted after the 343 th base of the base sequence described in SEQ ID NO: 5, and the nucleotide sequence of GTAAGTTTCATTGCGTTTACCTATTATGATGCCGGACCAGAACTAATTCTCTGCTTAG to be inserted after the 1561 th base of the base sequence described in SEQ ID NO: 5 DNA comprising at least one city of introns consisting of
Either DNA Tona is, that encoding a protein having a flavin adenine dinucleotide dependent glucose dehydrogenase activity gene. A recombinant vector comprising the gene according to claim 5 or 6 . A transformant comprising the gene according to claim 5 or 6 . A method for producing a flavin adenine dinucleotide-dependent glucose dehydrogenase using the gene according to claim 5 or 6 . A method for producing a flavin adenine dinucleotide-dependent glucose dehydrogenase using the transformant according to claim 8 . A glucose concentration measurement reagent comprising the chimeric protein according to any one of claims 1 to 4 . A glucose sensor using the chimeric protein according to any one of claims 1 to 4 . A glucose concentration measuring method using the chimeric protein according to any one of claims 1 to 4 . A biofuel cell using the chimeric protein according to any one of claims 1 to 4 .