JP6613387B2 - Antitumor agents, foods and drinks for cancer prevention, and expression enhancers of cancer-suppressing microRNAs - Google Patents

Description

  The present invention relates to an antitumor agent, a food and drink for cancer prevention, and an agent that enhances the expression of a cancer-suppressing microRNA.

  MicroRNA is RNA whose base pair length is about 22 bases. It is known that resveratrol and pterostilbene, which are stilbene derivatives, promote or suppress the expression of a predetermined microRNA among such microRNAs (Non-patent Documents 1 and 2).

Scientific Reports, 2,314,2012 Oncotarget, 2015, 6, 29, pp. 27214-27226

  In recent years, the relationship between the abnormal expression level of microRNA (miRNA) and the occurrence of cancer has been known, and a compound capable of controlling (enhancing) the expression level of miRNA (for example, tumor suppressive miRNA) is an antitumor agent (cancer It is useful as a preventive agent). Furthermore, compounds that can exhibit an antitumor effect by oral administration can be easily used in foods, supplements, and the like.

  Accordingly, an object of the present invention is to provide a novel antitumor agent for oral administration.

  The present inventors have found that pterostilbene has an excellent antitumor effect by oral administration. The present invention is based on this novel finding.

That is, the present invention relates to the following inventions, for example.
(1) An antitumor agent for oral administration containing pterostilbene.
(2) The antitumor agent according to (1), further containing oils and fats.
(3) The antitumor agent according to (2), wherein the fat is vegetable oil.
(4) A food or drink for cancer prevention comprising the antitumor agent according to any one of (1) to (3).
(5) A tumor suppressor microRNA expression enhancer containing pterostilbene.
(6) The expression enhancer according to (5), which is for oral administration.
(7) Tumor-suppressing microRNAs from let-7a, let-7b, miR-26a, miR-107, miR-126, miR-185, miR-200c, miR-141, miR-34a and miR-193b The expression enhancer according to (5) or (6), comprising at least one selected from the group consisting of:
(8) The expression enhancer according to any one of (5) to (7), which is used for treatment or prevention of cancer.
(9) A method for treating or preventing cancer, comprising orally administering pterostilbene to a subject in need thereof.
(10) Use of pterostilbene for the production of an antitumor agent for oral administration.
(11) Pterostilbene for use in the treatment or prevention of cancer by oral administration.

  According to the present invention, a novel antitumor agent for oral administration is provided. According to the present invention, a food and drink for cancer prevention containing the antitumor agent is also provided.

It is a graph which shows the relationship between pterostilbene or resveratrol and the cell viability of a cancer cell. FIG. 1 (A) is a measurement result of cell viability when using breast cancer cells, FIG. 1 (B) is a measurement result of cell viability when using gastric cancer cells, and FIG. It is a graph which shows the measurement result of the cell survival rate at the time of using a cancer cell. It is a graph which shows the measurement result of the expression level of cancer inhibitory miRNA (let-7a, let-7b, miR-26a, miR-107, miR-126, miR-185). It is a graph which shows the measurement result of the expression level of cancer inhibitory miRNA (miR-200c, miR-141, miR-34a, miR-193b). FIG. 4 (A) is a photograph showing the results of tumor luminescence at 21 days after the start of administration. FIG. 4B is a graph showing the results of observation of light emission over time. It is a photograph or graph which shows the influence which intraperitoneal administration of pterostilbene has on the size of a tumor. FIG. 5 (A) is a photograph showing the excised tumor piece. FIG. 5B is a graph showing the weight of the extracted tumor. It is a graph which shows the influence which pterostilbene (intraperitoneal administration) has on the body weight of a mouse | mouth. FIG. 7 (A) is a photograph showing a tumor piece from which RNA has been extracted. FIG. 7B is a graph showing the expression levels of tumor-suppressing microRNAs (miR-200c and miR-141) in tumors. FIG. 8 (A) is a photograph showing the results of tumor luminescence when 21 days have elapsed since the start of administration. FIG. 8B is a graph showing the results of observation of the amount of light emitted over time. It is a graph which shows the influence which pterostilbene (oral administration) has on the body weight of a mouse | mouth. It is a graph which shows the influence which oral administration of a pterostilbene has on the size (weight) of a tumor.

  Hereinafter, embodiments for carrying out the present invention will be described in detail. However, the present invention is not limited to the following embodiments.

<Features of the present invention>
(Anti-tumor agent)
The present invention is characterized by providing an antitumor agent for oral administration containing pterostilbene.

(Food and beverage for cancer prevention)
The present invention is also characterized by providing a food and drink for cancer prevention containing the antitumor agent.

(Tumor suppressive microRNA expression enhancer)
The present invention is further characterized by providing a tumor suppressor microRNA expression enhancer containing pterostilbene.

<Anti-tumor agent>
As used herein, “antitumor agent” refers to a cancer treatment or prevention agent, a cancer cell growth inhibitor, a cancer progression inhibitor, a cancer recurrence prevention (suppression) agent, a cancer metastasis inhibitor, a cancer invasion inhibitor. And an inhibitor of secretion of extracellular vesicles such as exosomes released from cancer cells.

<Pterostilbene>
Pterostilbene is a compound represented by the following formula (1).

<Pterostilbene content>
In the antitumor agent of this embodiment, the content of pterostilbene is 0.01% by mass or more, or 0.10% by mass or more, or 10% by mass or less, or 5% by mass or less, based on the total amount of the antitumor agent. It may be.

<How to obtain pterostilbene>
In the present embodiment, a commercially available product may be used as pterostilbene, or one obtained by chemical synthesis may be used.

<Oil and fat>
The antitumor agent of this embodiment may further contain fats and oils. In this case, the antitumor agent becomes even more suitable for oral administration.

<Types of fats and oils>
The fats and oils that may be contained in the antitumor agent of the present embodiment may be animal oils or vegetable oils. Examples of the fats and oils include corn oil, soybean oil, sesame oil, rapeseed oil, safflower oil, olive oil, castor oil, cottonseed oil, rice oil, sunflower oil, grape seed oil and wheat germ oil, and egg yolk oil, Examples thereof include animal oils such as fish oil, whale oil and liver oil, or refined oils (salad oil) thereof, and edible oils obtained by chemical or enzymatic treatment such as MCT (medium chain fatty acid triglyceride) and diglyceride. Fats and oils may be used alone or in combination of two or more.

<Oil content>
The content of fats and oils may be 0.1% by mass or more, or 1% by mass or more, or 10% by mass or less, or 8% by mass or less, based on the total amount of the antitumor agent.

<Additives>
The antitumor agent of this embodiment may further contain additives (except pterostilbene and fats and oils). Examples of the additive include an excipient, a binder, a lubricant, a disintegrant, an emulsifier, a surfactant, a base, a solubilizing agent, and a suspending agent.

<Formulation>
The antitumor agent of the present embodiment may be in any shape such as solid (for example, powder), liquid (water-soluble or fat-soluble solution or suspension), paste, and the like. Further, any dosage form such as powder, granule, tablet, capsule, liquid, suspension, syrup and the like may be used.

<Method for preparing antitumor agent>
The above-mentioned various preparations can be prepared by mixing pterostilbene and, if necessary, the above fats and additives, and if necessary, molding.
A suitable method for preparing the antitumor agent is described below. First, fats and oils heated to a product temperature of 50 to 90 ° C. are prepared. Pterostilbene is added to the heated oil and fat and dissolved. Thereafter, a mixture of pterostilbene and oil and fat and other components are mixed, and if necessary, a sterilization treatment or the like is performed to prepare a preparation containing pterostilbene.

<Administration method>
The antitumor agent of this embodiment is used for oral administration. Usually, a preparation that exhibits a desired effect by parenteral administration such as intraperitoneal administration does not necessarily have a desired effect even by oral administration. On the other hand, the antitumor agent of this embodiment exhibits an antitumor effect by oral administration in addition to the antitumor effect by parenteral administration. The dosage, administration timing, and administration period of the antitumor agent can be appropriately set.

<Subject of administration>
The living body to be administered with the antitumor agent of the present embodiment is preferably a mammal, more preferably a human.

<Dose>
As an example of a specific dose, for example, when administered to a human adult male (body weight 60 kg), the daily dose of the antitumor agent may be 0.01 mg to 5000 mg / day / person. 05 mg to 1000 mg / day / person, more preferably 0.1 mg to 500 mg / day / person, and even more preferably 0.5 mg to 250 mg / day / person. As long as the dose per day is within the above range, the antitumor agent may be administered once a day, or may be administered in a plurality of times (for example, twice or three times). The dose is a value based on the amount of the active ingredient (ie, pterostilbene) in the antitumor agent.

<Uses of antitumor agents>
The antitumor agent of this embodiment can be used as a component of products such as pharmaceuticals, quasi drugs, food and drink (beverages, foods), feed, feed additives and the like. Examples of the drink include water, soft drinks, fruit juice drinks, milk drinks, alcoholic drinks, sports drinks, and nutrition drinks. Examples of food include breads, noodles, rice, tofu, dairy products, soy sauce, miso, confectionery, creams, sauces, mayonnaise, dressings and the like. Moreover, the antitumor agent of this embodiment can also be used as components of health foods, functional indication foods, special-purpose foods, dietary supplements, supplements (for example, doctor's supplements), foods for specified health use, and the like.

<Food and beverage for cancer prevention>
The antitumor agent of this embodiment can be used as a component of food and drink. Therefore, as one embodiment of the present invention, a food and drink for cancer prevention (food composition for cancer prevention) containing the antitumor agent is provided.

<MicroRNA expression regulator>
The antitumor agent of this embodiment may exhibit an antitumor effect as a result of regulating the expression of microRNA. That is, the antitumor agent of this embodiment can also be regarded as a regulator of microRNA. The expression regulator of microRNA may be one that regulates the expression of microRNA, for example, by suppressing the expression of cancer-promoting microRNA or by enhancing the expression of tumor-suppressing microRNA.

<Cancer suppressive microRNA expression enhancer>
The antitumor agent of the present embodiment exhibits an antitumor effect as a result of enhancing the expression of tumor-suppressing microRNA. That is, one embodiment of the present invention provides a tumor suppressor microRNA expression enhancer containing pterostilbene. The tumor-suppressing microRNA expression enhancer may be for oral administration. In addition, in the tumor suppressor microRNA expression enhancer of this embodiment, the formulation form, dose, use, and the like may be the same as those in the antitumor agent. The cancer suppressor microRNA expression enhancer of the present embodiment may be used for the treatment or prevention of cancer. Here, the “tumor suppressive microRNA expression enhancer” means that the microRNA is increased from a state where the expression level of the cancer suppressive microRNA is reduced to the same expression level as that of a healthy person (healthy person). The expression level of the tumor-suppressing microRNA may be maintained at the same level as that of a healthy person. That is, the tumor suppressor microRNA expression enhancer can be rephrased as an expression regulator, expression control agent, or expression promoter of the tumor suppressive microRNA.

<Tumor suppressive microRNA>
In the present specification, the “cancer suppressive microRNA” is a microRNA in which the growth of cancer cells is suppressed by the increased expression. Examples of the tumor-suppressing microRNA include let-7a, let-7b, miR-26a, miR-107, miR-126, miR-185, miR-200c, miR-141, miR-34a, and miR-193b. Can be mentioned. In this embodiment, the tumor suppressive microRNA is from let-7a, let-7b, miR-26a, miR-107, miR-126, miR-185, miR-200c, miR-141 miR-34a and miR-193b. It may contain at least one selected from the group consisting of:

<Types of tumor-suppressing microRNA>
The above-described tumor suppressive microRNAs are mature single-stranded microRNAs, each having a sequence as shown below.
let-7a: UGAGGUAGUAGGUUGUAUAGUU (SEQ ID NO: 1)
let-7b: UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO: 2)
miR-26a: UUCAAGUAAUCCAGGAUAGGCU (SEQ ID NO: 3)
miR-107: AGCAGCAAUUGUACGGGCUAUCA (SEQ ID NO: 4)
miR-126: UCGUACCGUGAGUUAAUAUGCG (SEQ ID NO: 5)
miR-185: UGGAGAGAAAAGGCAGUCUCCUGA (SEQ ID NO: 6)
miR-200c: UAAUACUGCCGGGUAAUGAUGGA (SEQ ID NO: 7)
miR-141: UAACACUGUGUGGUAAAAUGUG (SEQ ID NO: 8)
miR-34a: UGGCAGUGUCUUAUGCUGUGUGU (SEQ ID NO: 9)
miR-193b: AACUGGCCCUCAAAGUCCCCGCU (SEQ ID NO: 10)

<Method of treating or preventing cancer>
One embodiment of the present invention can also be viewed as a method of treating or preventing cancer comprising orally administering pterostilbene to a subject in need thereof. In this method, the administration method, administration subject, dosage and the like may be the same as those in the antitumor agent. The subject is preferably a mammal, more preferably a human.

<Method for enhancing the expression of tumor-suppressing microRNA>
One embodiment of the present invention can also be viewed as a method of enhancing the expression of tumor suppressive microRNA, comprising orally administering pterostilbene to a subject in need thereof. In this method, the administration method, administration subject, dosage and the like may be the same as those in the antitumor agent. The subject is preferably a mammal, more preferably a human.

<Types of cancer>
Examples of the cancer include breast cancer, stomach cancer, colon cancer, colorectal cancer, ovarian cancer, lung cancer, oral cancer, esophageal cancer, hepatocellular carcinoma, pancreatic cancer, bile duct cancer, prostate cancer, bladder cancer, sarcoma, glioma and the like. It may be.

<Use of pterostilbene for the production of an antitumor agent for oral administration>
As one embodiment of the present invention, the use of pterostilbene for the manufacture of an antitumor agent for oral administration is provided. In addition, about the administration method in this embodiment, an administration object, dosage, etc., you may be the same as that in said antitumor agent.

<Pterostilbene for use in the treatment or prevention of cancer>
As one embodiment of the present invention, pterostilbene is provided for use in the treatment or prevention of cancer by oral administration. In addition, about the administration method in this embodiment, an administration object, dosage, etc., you may be the same as that in said antitumor agent.

  Hereinafter, the present invention will be described more specifically based on examples and the like. However, the present invention is not limited to the following examples.

(Statistical analysis)
In the following examples, statistical analysis was performed using multiple analysis (Tukey's HSD Test) after analysis of variance (One-Way ANOVA) using Kaleida Graph4.5 (HULINKS).

[Test Example 1: Evaluation of antitumor effect using cells]
1. Cell culture conditions (cells)
A breast cancer cell line (MDA-MB231-luc-D3H2LN), a gastric cancer cell line (MKN45), and a colon cancer cell line (HCT116) were used.

(reagent)
In cell culture, the following reagents were used.
RPMI1640 (Invitrogen)
McCoy 'medium 5A modified medium (Invitrogen)
Heat-inactivated Fetal Bovine Serum (FBS) (Invitrogen)
100X Antibiotic-Antimycotic (Invitrogen)
0.5% Trypsin-EDTA (Invitrogen)

(Cell culture method)
For breast cancer cell lines and gastric cancer cell lines, RPMI1640 supplemented with FBS and 100X Antibiotic-Antimycotic so that the final concentrations were 10% (v / v) and 1% (v / v), respectively, was used. . Culturing was performed in the dark at 37 ° C. and 5% CO ₂ . Cell detachment during the passage was performed using 0.05% Trypsin-EDTA.
In the colorectal cancer cell line (HCT116), the final concentrations of FBS and 100X Antibiotic-Antimycotic are 10% (v / v) and 1% (v / v), respectively, in McCoy 'medium 5A modified medium as the culture medium. What was added was used. Culturing was performed in the dark at 37 ° C. and 5% CO ₂ . Cell detachment during the passage was performed using 0.05% Trypsin-EDTA.

2. Cell viability measurement (reagents and kits)
The following reagents and kits were used.
Resveratrol (trans-Resveratrol, manufactured by Cayman Chemical)
Pterostilbene (Pterostilbene, manufactured by Cayman Chemical)
Cell Counting Kit-8 (manufactured by Dojin Chemical Laboratory)

(Evaluation methods)
The above breast cancer cells, gastric cancer cells, and colon cancer cells were seeded in a 96-well plate so that the number of cells per well was 2500. The day after sowing, resveratrol or pterostilbene was added to 12.5 μM, 25 μM, 50 μM, or 100 μM, respectively. After culturing for 3 days, the number of viable cells was measured by measuring absorbance at 450 nm using Cell Counting Kit-8 according to the conditions of the manufacturer's protocol. As a control (Mock), the number of viable cells was measured in the same manner as described above except that resveratrol or pterostilbene was not added. Synergy ^™ H4 Hybrid Microplate Reader (manufactured by BioTek) was used for measuring the absorbance at 450 nm. The cell viability of each group (resveratrol group or pterostilbene group) was a value when the number of viable cells in the control was 100%. The results are shown in FIG. 1A to 1C show the results of cell viability measurement when using breast cancer cells, gastric cancer cells, or colon cancer cells, respectively. In FIG. 1, error bars indicate standard errors.

  As shown in FIG. 1, the addition of resveratrol or pterostilbene decreased the cell viability in any cancer cell (compared to the control). When pterostilbene was added, cell viability was further reduced as compared to the case where resveratrol was added.

3. Quantification of tumor-suppressing microRNA (miRNA) (cells)
The above-mentioned breast cancer cell line (MDA-MB231-luc-D3H2LN) was used for quantification of tumor suppressive microRNA (miRNA).

(reagent)
The following reagents and kits were used.
Resveratrol (trans-Resveratrol, manufactured by Cayman Chemical)
Pterostilbene (Cayman Chemical)
miRNeasy (registered trademark) Mini Kit (QIAGEN)
TaqMan (registered trademark) MicroRNA assay (Applied Biosystems)
TaqMan (registered trademark) MicroRNA ReverseTranscriptionKit (Applied Biosystems)
TaqMan (registered trademark) Universal PCR Master Mix, NoAmpErase (registered trademark) UNG (Applied Biosystems)

(Quantitative analysis of tumor suppressive microRNA)
Let-7a, let-7b, miR-26a, miR-107, miR-126, miR-185, miR-200c, miR-141, miR-34a and miR-193b, known as tumor suppressor microRNAs Quantification was performed by the following method.
First, resveratrol or pterostilbene was added to the above breast cancer cells to a concentration of 25 μM. Two days later, RNA was extracted using miRNeasy (registered trademark) Mini Kit according to the manufacturer's recommended protocol. The extracted RNA was converted to complementary DNA (cDNA) using TaqMan (registered trademark) MicroRNA assay and TaqMan (registered trademark) MicroRNA ReverseTranscriptionKit according to the manufacturer's recommended protocol. Using the cDNA as a template, miRNA was quantitatively analyzed by StepOnePlus ^™ Real-Time PCR System (Applied Biosystems) using TaqMan (registered trademark) Universal PCR Master Mix, NoAmpErase (registered trademark) UNG. A control (Mock) was prepared by performing quantitative analysis of miRNA in the same manner as described above except that resveratrol or pterostilbene was not added. The results are shown in FIGS. 2 and 3, error bars indicate standard errors. In FIGS. 2 and 3, the data marked with * is p <0.05.

(Evaluation results)
As shown in FIGS. 2 and 3, it was shown that the addition of resveratrol or pterostilbene enhanced the expression of tumor suppressor miRNA compared to the control.

[Test Example 2: Evaluation of antitumor effect by intraperitoneal administration]
4-1. Pterostilbene intraperitoneal administration experiment (experimental animal)
As experimental animals, 5-week-old female nude mice (BALB / cAJc1-nu / nu) (CLEA Japan) were used.

(reagent)
The following were used as reagents.
Pterostilbene (Cayman Chemical)
Dimethyl sulfoxide (DMSO) (Merck)
ECM Gel from Engelbreth-Holm-Swam murine sarcoma (Invitrogen)
Escaine (registered trademark) inhalation anesthetic solution (manufactured by Pfizer)
Beetle Luciferin, Potassium Salt (Promega)
Propylene glycol (Sigma-Aldrich)

(Breeding method)
The above experimental animals were raised in an environment maintained under conditions of a temperature of 20 to 25 ° C. and a humidity of 40 to 60%.

(Test method)
Five-week-old female nude mice (BALB / cAJc1-nu / nu) were acclimated to the environment for about one week before the start of the experiment. MM-231-luc-D3H2LN was used as a cancer cell transplanted into a mouse. The cancer cells are suspended in phosphate buffered saline (PBS), and the resulting suspension is mixed with Matrigel (ECM Gel from Engelbreth-Holm-Swammurine sarcoma) at a ratio of 1: 1 for suspension for transplantation. A suspension (cell number: 1 × 10 ⁷ cells / ml) was prepared.

In this test example, 1 × 10 ⁶ cells of cancer cells were transplanted into the mammary gland of a mouse under anesthesia with isoflurane (Escaine (registered trademark) inhalation anesthetic solution) (the above suspension for transplantation (number of cells: 1). X10 ⁷ cell / ml) was introduced (100 μl). Confirmation that cancer cells have been transplanted is allowed to stand for a while after being transplanted by the above method, and then 15 mg / ml luciferin solution (Beetle Luciferin, Potassium Salt, Promega) is intraperitoneally injected in an amount of 150 mg / kg. About 10 minutes after administration, luminescence (luciferase activity) derived from cells transplanted with IVIS Spectrum (Perkin Elmer) was measured. After breeding for 2 days after transplantation, cell-derived luminescence was measured again. Based on the measurement results, the number of test mice was 5 per group, and the mice were divided into the following three groups (i) to (iii).
(I) Control group (solvent administration group, dose: 0 mg / kg / day)
(Ii) Pterostilbene group A (dose: 12.5 mg / kg / day)
(Iii) Pterostilbene group B (dose: 25 mg / kg / day)

  Intraperitoneal administration was performed for each group of mice (i) to (iii). The intraperitoneal administration was continued for 21 days from 2 days after the cancer cells were transplanted into the mice (administration start date). As a solvent, a PBS solution containing DMSO and propylene glycol (DMSO content: 10% (v / v), propylene glycol content: 10% (v / v)) was used. For administration of pterostilbene, a solution in which pterostilbene was dissolved in the above solvent was used. The dose is a value based on the amount of pterostilbene.

  In each group of mice, the body weight was measured in a timely manner, and luminescence was timed using an IVIS spectrum every other week. The measurement result of the luminescence derived from the transplanted cells is shown in FIG. FIG. 4 (A) shows the results of tumor luminescence at 21 days after the start of administration. FIG. 4B shows the results of observation of the amount of light emitted over time. FIG. 6 shows the measurement results of body weight.

  After the end of administration (21 days after the start of administration), the tumor was removed under isoflurane anesthesia and euthanized. FIG. 5 shows the effect of intraperitoneal administration of pterostilbene on tumor size. FIG. 5A shows the excised tumor piece, and FIG. 5B shows the weight of the excised tumor. The tumor removed after the administration was used for miRNA expression analysis described later.

(Evaluation results)
As shown in FIGS. 4 and 5, in the group to which pterostilbene was intraperitoneally administered, tumor growth was suppressed as compared with the control group. It was shown that tumor growth was suppressed in a dose-dependent manner with pterostilbene. In addition, it was shown that intraperitoneal administration of pterostilbene does not significantly affect the body weight of mice (see FIG. 6).

4-2. Tumor-suppressing miRNA expression analysis in human-derived tumors Tumor-suppressed miRNA expression analysis was performed using tumor tissue formed by xenotransplantation in the nude mice. The expression levels of miR-200c and miR-141, which are tumor suppressor miRNAs, were measured.

(Reagents, kits and laboratory equipment)
The following were used as reagents, kits and experimental instruments.
3ml crushing tube (manufactured by Yasui Instruments Co., Ltd.)
Metal cone (made by Yasui Kikai Co., Ltd.)
miRNeasy (registered trademark) Mini Kit (QIAGEN)
TaqMan (registered trademark) MicroRNA assay (Applied Biosystems)
TaqMan (registered trademark) MicroRNA ReverseTranscriptionKit (Applied Biosystems)
TaqMan (registered trademark) Universal PCR Master Mix, NoAmpErase (registered trademark) UNG (Applied Biosystems)

(Test method)
The tumor piece tissue was cut into a size of about 3 mm square and placed in a 3 ml crushing tube together with a metal cone. While cooling with liquid nitrogen, it was crushed with Multi Bead Shocker (registered trademark) (Yasui Kikai Co., Ltd.). Thereafter, RNA was extracted using the miRNeasy (registered trademark) Mini Kit according to the manufacturer's recommended protocol. The obtained RNA was converted to complementary DNA (cDNA) using TaqMan (registered trademark) MicroRNA assay and TaqMan (registered trademark) MicroRNA ReverseTranscriptionKit according to the manufacturer's recommended protocol. Using cDNA as a template, miRNA was quantitatively analyzed by StepOnePlus ^™ Real-Time PCR System (Applied Biosystems) using TaqMan (registered trademark) Universal PCR Master Mix, NoAmpErase (registered trademark) UNG.

  The results of the tumor suppressor miRNA are shown in FIG. For RNA extraction, the circles in FIG. 7A were used. FIG. 7B shows the measurement results of the expression levels of miR-200c and miR-141, respectively.

(Evaluation results)
As shown in FIG. 7 (B), in the pterostilbene group (intraperitoneal administration), the expression of tumor-suppressing miRNA (miR-200c and miR-141) was enhanced as compared with the control group.

[Test Example 3: Evaluation of antitumor effect by oral administration]
5. Oral administration experiment of pterostilbene (powder feed for test)
The following reagents were used for the preparation of the test powder feed.
Casein (Oriental Yeast Co., Ltd.)
DL-methionine (Wako Pure Chemical Industries, Ltd.)
β-corn starch (Oriental Yeast Co., Ltd.)
Sucrose (KH1 refined white sugar) (Wada Sugar Co., Ltd.)
Cellulose powder (Oriental Yeast Co., Ltd.)
Corn oil (blessed corn oil of germ) (J-Oil Mills Co., Ltd.)
Mineral mix (AIN-93G mineral mix) (Oriental Yeast Co., Ltd.)
Vitamin Mix (AIN-93 Vitamin Mix) (Oriental Yeast Co., Ltd.)
Choline bitartrate (Wako Pure Chemical Industries, Ltd.) (Lot. No .: PDQ0575, CTK0241)
90% Pterostilbene (Sylbitol) (Sabinsa Japan Corporation)

(Preparation of powder feed containing pterostilbene)
A test feed (pterostilbene-containing powder feed) was prepared by the following method. That is, first, 50 g of corn oil was weighed and heated to 70 ° C. Pterostilbene was added and dissolved in warm corn oil. Reagents (other reagents) other than corn oil and pterostilbene were ground in a mortar and mixed. Corn oil in which pterostilbene was dissolved was added to a mixture of other reagents, and the mixture was thoroughly ground in a mortar and mixed. Then, it further mixed for about 30 minutes with the stirrer, and prepared the feed for a test. The composition of the various components contained in the test feed is as shown in Table 1. The test feed was placed in a plastic bag and sterilized with Kaga Isotope Co., Ltd., and then used for animal experiments described below. In addition, a conditioned food having the composition shown in Table 1 (content of pterostilbene: 0% by mass) was prepared.

(Experimental animal)
As experimental animals, 5-week-old female nude mice (BALB / c-nu / nu, CAnN.Cg-Foxn1 <nu> / CrlCjlj) (Charles River Japan) were used.

(reagent)
The following were used as reagents.
ECM Gel from Engelbreth-Holm-Swam murine sarcoma (Invitrogen)
Escaine (registered trademark) inhalation anesthetic solution (Pfizer)
Beetle Luciferin, Potassium Salt (Promega)
Propylene glycol (Sigma-Aldrich)

(Breeding method)
The above experimental animals were raised in an environment maintained under conditions of a temperature of 20 to 25 ° C. and a humidity of 40 to 60%. As the feeder, a hanging type feeder was used.

(Examination group)
As an examination of the effect on cancer cells by oral administration of pterostilbene-containing powdered feed, 8 or 10 animals per group, (i) control group (0% (w / w) pterostilbene group, n = 18), And (ii) 0.25% (w / w) pterostilbene group (n = 18), two test groups were set.

(Test method and evaluation results)
First, a 5-week-old female nude mouse was acclimated to the environment for about one week before the start of the experiment.
As an examination of the effect on cancer cells by oral administration of pterostilbene-containing powdered feed, first, a control diet (acclimated diet) was given for about 1 week in a hanging type feeder, then (i) a control group, and (ii) They were divided into two groups of 0.25% (w / w) pterostilbene group. In the control group, the conditioned food was orally administered, and in the pterostilbene group, pterostilbene-containing powdered feed (pterostilbene content: 0.25% by mass) was orally administered.

One week after the grouping, cancer cell transplantation experiments were performed on mice in each group. In the cancer cell transplantation experiment, first, the cancer cell to be transplanted (MM-231-luc-D3H2LN) is suspended in phosphate buffered saline (PBS), and Matrigel (ECM Gel from Engelbreth-Holm-Swammurine sarcoma) and 1 A suspension for transplantation (cell number: 1 × 10 ⁵ cells / ml) was prepared by mixing at a ratio of 1: 1. Subsequently, under anesthesia with isoflurane (Escaine (registered trademark) inhalation anesthetic solution), 1 × 10 ⁴ cells of cancer cells were transplanted into the mammary gland of mice (the above-mentioned suspension for transplantation (cell number: 1 × 10 ^5). cell / ml) was introduced at 100 μl). Confirmation that the cancer cells have been transplanted is allowed to stand for a while after the transplantation, and 15 mg / ml luciferin solution (Beetle Luciferin, Potassium Salt, Promega) is administered intraperitoneally in an amount of 150 mg / kg. Later, cell-derived luminescence (luciferase activity) was measured by IVIS Spectrum (Perkin Elmer). Test diet and mouse conditions were managed appropriately daily. The mouse body weight was measured in a timely manner. The administration start date (day 0) was the day when cancer cells (tumor) were transplanted. And luminescence was time-measured with IVIS spectrum every other week from the administration start date. The measurement results of tumor luminescence are shown in FIG. FIG. 8 (A) shows the results of tumor luminescence at 21 days after the start of administration. FIG. 8B shows the results of observation of the light emission over time. The measurement results of the body weight of the mice in each group are shown in FIG.

  After the administration was completed, the tumor was excised and euthanized under isoflurane anesthesia. FIG. 10 shows the measurement results of the size (weight) of the extracted tumor in each group (control group or pterostilbene group). In this test example, an independent test was repeated twice.

  In FIG. 10, error bars indicate standard errors. In FIG. 10, data marked with * is P <0.05, and data marked with ** is P <0.01.

(Evaluation results)
As shown in FIGS. 8 and 10, tumor growth was suppressed in the group (pterostilbene group) to which pterostilbene was orally administered compared to the control group. In addition, it was shown that oral administration of pterostilbene does not significantly affect the body weight of mice (see FIG. 9).

Claims (2)

Containing pterostilbene,
In a microRNA expression enhancer,
The microRNA comprises at least one selected from the group consisting of let-7a, let-7b, miR-26a, miR-107, miR-126, miR-185, miR-34a and miR-193b;
An expression enhancer for oral administration. In the expression enhancer according to claim 1 ,
An expression enhancing agent used for treatment or prevention of cancer.