JP6533661B2 - Test diagnostic method using aptamer - Google Patents

Description

  The present invention relates to a detection method and a quantification method of an object to be detected.

  Conventionally, a latex agglutination method has been used as a method for detecting a detection target in a subject. In the latex agglutination method, when detecting an antigen in a fluid such as a biological sample, the degree of aggregation of the latex is determined by mixing the fluid with a latex supporting an antibody specifically binding to the antigen or a fragment thereof. It is a method of detecting or quantifying an antigen by measuring (see, for example, Patent Document 1).

  According to this latex agglutination method, an antigen added as a sample crosslinks a plurality of latex-bound antibodies to promote aggregation of the latex. Since the procedure is simple in this way, antigens can be detected easily and quickly. However, when the amount of the antigen is small, the crosslinking does not easily occur, so the latex does not aggregate sufficiently. For this reason, it was difficult to detect a trace amount of antigen.

  Therefore, methods using enzyme substrate reactions such as ELISA method and CLEIA method are widely adopted. In these methods, for example, a primary antibody that specifically binds to an antigen is bound to the antigen, and a secondary antibody having an enzyme is bound to the primary antibody. Here, a substrate for the enzyme is added, and the degree of reaction catalyzed by the enzyme is measured to detect or quantify the antigen.

  According to these methods, for example, when a luminescent reagent is used as a substrate, since the detection sensitivity of luminescence after substrate addition is high, a trace amount of antigen can also be detected.

Japanese Patent Publication Sho 58-ll 575

  However, in the method using an enzyme-substrate reaction, many special reagents such as a secondary antibody and a luminescent reagent are essential, and the operation cost is high.

  Further, this method comprises multiple steps such as a step of incubating the sample and each reagent, a step of washing, and a step of measuring luminescence, and the operation is complicated. Moreover, the time required for each step is extremely long and is not suitable for large scale processing.

  On the other hand, in the ophthalmology field in recent years, patients with age-related macular degeneration have significantly increased due to the aging of the population and the westernization of life. Age-related macular degeneration is thought to involve vascular endothelial growth factor (VEGF), and although VEGF inhibitors etc. are used for treatment, domestically approved VEGF inhibitors The risk of patients is also high due to the effects of drug efficacy and high prices. A rapid diagnostic method for VEGF is desired because the possibility of maintenance and improvement of visual function is increased because early detection enables effective treatment.

  The present invention has been made in view of the above-described circumstances, and an object of the present invention is to provide a detection method and a determination method of a detection object which can detect and quantify a detection object quickly, inexpensively, simply and accurately.

The present inventors have found that binding of a charged substance or a hydrophilic substance to a stimulus-responsive polymer inhibits or promotes aggregation of the stimulus-responsive polymer, and has completed the present invention.
Specifically, the present invention has the following configuration.

1. A method for detecting a detection target in a sample, comprising mixing the sample, an aptamer capable of binding to the detection target, and an aggregating substance containing a stimulus-responsive polymer, and obtaining the obtained mixture as the stimulus response The degree of aggregation of the aggregating substance containing the stimulus-responsive polymer is determined under conditions in which the functional polymer aggregates, and the degree of aggregation changes when compared to the absence of the analyte. A method of detecting a detection target, comprising the steps of determining that the detection target exists in a sample.
2. The method according to the above 1, wherein the aptamer capable of binding to the detection target is DNA or RNA.
3. 3. The method according to item 1 or 2, wherein the aggregating substance further comprises a particulate magnetic substance, and further comprising separating the aggregated magnetic substance by applying a magnetic force.
4. The method according to any one of items 1 to 3, wherein the change in the degree of aggregation is a change in which aggregation inhibition of the stimulus-responsive polymer is alleviated.
5. The method according to any one of the above 1 to 4, wherein the detection target is VEGF.
6. The method according to any one of the above 1 to 4, wherein the detection target is thrombin.
7. A method of quantifying a detection target in a sample, comprising mixing the sample, an aptamer capable of binding to the detection target, and an aggregating substance containing a stimulus-responsive polymer, and mixing the mixture with the stimulus-responsive polymer. A procedure of measuring the turbidity of the mixture under conditions in which c) aggregates and calculating the amount of the detection target in the sample based on the correlation equation between the amount of the detection target and the turbidity under the conditions Methods of quantifying the analyte, including:
8. The method according to item 7, wherein the aggregating substance further comprises a particulate magnetic substance, and further including separating the aggregated magnetic substance by applying a magnetic force.
9. A kit for detecting and / or quantifying a detection target, the kit comprising an aptamer capable of binding to the detection target, and an aggregating substance containing a stimulus-responsive polymer.

  According to the present invention, when the detection target is present in the sample, the aptamer and the detection target are bound, and when the complex approaches the aggregating substance containing the stimulus-responsive polymer, the stimulus-responsive polymer is aggregated. Under the conditions, the aggregation inhibition of the stimulus-responsive polymer by the aptamer is alleviated or promoted under the influence of the charge moiety or hydrophobic moiety to be detected. Therefore, the presence or absence of the detection target can be detected by observing the presence or absence of this aggregation inhibition. In addition, the detection target can be quantified by measuring the degree of aggregation inhibition.

  The above procedure is accomplished using only the aggregating substance containing the aptamer and the stimulus-responsive polymer, and is performed without using a special reagent or device, so it is inexpensive and easy. In addition, since the system only measures the degree of aggregation inhibition and is not a system utilizing a reaction catalyzed by an enzyme, it can be carried out rapidly.

FIG. 1 is a schematic block diagram of a method according to an embodiment of the present invention. FIG. 2 is a schematic view showing the determination of the presence or absence of a detection target in the method according to the embodiment. FIG. 3 is a photograph showing an aspect of a measuring cell and magnetic force application of a method according to an embodiment of the present invention. FIG. 4 is a graph showing the correlation between reaction time and turbidity in the method according to Example 1 of the present invention. FIG. 5 is a graph showing the correlation between reaction time and turbidity in the method according to Example 2 of the present invention.

  Hereinafter, an embodiment of the present invention will be described with reference to the drawings.

First Embodiment Detection Method (Mixing and Aggregation)
In the detection method of the present invention, the aptamer and the sample are mixed, and the obtained mixture is mixed with the aggregating substance containing the stimulus-responsive polymer, and the mixture is placed under conditions where the stimulus-responsive polymer is aggregated. In the absence of the detection target, the aggregation of the stimulus-responsive polymer remains inhibited, whereas in the presence of the detection target, the degree of aggregation of the stimulus-responsive polymer changes more than in the absence of the detection target. Specifically, for example, the aggregation inhibition of the stimulus-responsive polymer is alleviated, and conversely, the aggregation inhibition of the stimulus-responsive polymer is further promoted. Preferably, aggregation inhibition is mitigated under the influence of the charge or hydrophobic moiety to be detected.

(Aptamer)
The aptamer may be an aptamer that recognizes a specific site to be detected, or may be a mixture of aptamers that recognize different sites to be detected. The aptamer used here may be any type of aptamer, and may be a DNA aptamer forming a Hairpin-loop, a G-quadruplex structure or the like, or an RNA aptamer . Also, bivalent type two molecules were ligated by a linker of aptamers that recognize specific sites to be detected, even aptamers two recognize different sites for detected a bispecific type ligated with a linker Good. By using an aptamer, a target to be detected is specifically recognized. For example, compared to the case of using an antibody, DNA aptamers are easy to modify variously at the 5 'end and 3' end such as biotin label, and even after such processing, they have the ability to bind to an antigen. Hold high. In addition, since it is easy to design a DNA aptamer having high binding ability and specificity (a dissociation constant lower than that of an antibody) to an antigen, detection can be performed with high sensitivity and in a short time.

(Cohesive substance)
The cohesive material used in the present invention contains a stimulus responsive polymer. This stimulus-responsive polymer is a polymer that can undergo structural change in response to external stimuli and can control aggregation and dispersion. The stimulus may be various physical or chemical signals such as, but not limited to, temperature, light, acid, base, pH or electricity.

  In particular, in the present invention, as the stimulus responsive polymer, a temperature responsive polymer which can be aggregated and dispersed by temperature change can be used. In addition, as a temperature-responsive polymer, a polymer having a lower critical solution temperature (hereinafter, also referred to as LCST) or a polymer having an upper critical solution temperature can be mentioned.

  As a polymer having a lower critical solution temperature used in the present invention, for example, N-n-propyl acrylamide, N-isopropyl acrylamide, N-ethyl acrylamide, N, N-dimethyl acrylamide, N-acryloyl pyrrolidine, N-acryloyl piperidine , N-acryloyl morpholine, N-n-propyl methacrylamide, N-isopropyl methacrylamide, N-ethyl methacrylamide, N, N-dimethyl methacrylamide, N-methacryloyl pyrrolidine, N-methacryloyl piperidine, N-methacryloyl morpholine, etc. Polymer comprising N-substituted (meth) acrylamide derivative; hydroxypropyl cellulose, polyvinyl alcohol partial acetate, polyvinyl methyl ether, (polyoxyethylene-polyoxy Polypropylene) block copolymer, polyoxyethylene alkylamine derivative such as polyoxyethylene lauryl amine; polyoxyethylene sorbitan ester derivative such as polyoxyethylene sorbitan laurate; (polyoxyethylene nonyl phenyl ether) acrylate, (polyoxyethylene octyl phenyl (Polyoxyethylene alkyl phenyl ether) (meth) acrylates such as ether) methacrylate; and (polyoxyethylene alkyl ether) (meth) acrylate such as (polyoxyethylene lauryl ether) acrylate, (polyoxyethylene oleyl ether) methacrylate And polyoxyethylene (meth) acrylic acid ester derivatives and the like. Furthermore, for example, copolymers of these polymers and at least two of these monomers can be mentioned. Also, for example, copolymers of N-isopropyl acrylamide and N-t-butyl acrylamide can be used, but it can be mentioned. When a polymer containing a (meth) acrylamide derivative is used, the copolymer may be copolymerized with other copolymerizable monomers in a range having a lower critical solution temperature. In the present invention, among others, N-n-propyl acrylamide, N-isopropyl acrylamide, N-ethyl acrylamide, N, N-dimethyl acrylamide, N-acryloyl pyrrolidine, N-acryloyl piperidine, N-acryloyl morpholine, N-n- At least one monomer selected from the group consisting of propyl methacrylamide, N-isopropyl methacrylamide, N-ethyl methacrylamide, N, N-dimethyl methacrylamide, N-methacryloyl pyrrolidine, N-methacryloyl piperidine, N-methacryloyl morpholine Or a copolymer of N-isopropyl acrylamide and N-t-butyl acrylamide is preferably used.

  As the polymer having the upper critical solution temperature used in the present invention, for example, a polymer comprising at least one monomer selected from the group consisting of acroylglycinamide, acroylnipecotamide, acryloyl asparagine amide, acryloyl glutamine amide and the like Can be mentioned. Moreover, the copolymer which consists of these at least 2 types of monomers may be sufficient. Among these polymers, acrylamide, acetyl acrylamide, biotinol acrylate, N-biotinyl-N'-methacroyl trimethylene amide, acroyl sarcosine amide, methacryl sarcosine amide, acroyl methyl uracil etc. and other copolymerizations The possible monomers may be copolymerized in the range with the upper critical solution temperature.

In the present invention, a pH-responsive polymer that can be aggregated and dispersed by pH change can be used as the stimulus-responsive polymer.
As such a pH responsive polymer, for example, a polymer containing a group such as carboxyl, phosphoric acid, sulfonyl and amino as a functional group can be mentioned. More specifically, for example, acrylic acid, methacrylic acid, maleic acid, vinylsulfonic acid, vinylbenzenesulfonic acid, phosphorylethyl (meth) acrylate, aminoethyl methacrylate, aminopropyl (meth) acrylamide, dimethylaminopropyl (meth) The polymer which contains acrylamide or these salts as a copolymerization component is mentioned.

  The aggregating substance preferably further contains a particulate magnetic substance in that the detection accuracy can be improved by the addition of a magnetic force described later. Such magnetic substance may be composed of polyhydric alcohol and magnetite.

  The polyhydric alcohol is not particularly limited as long as it is an alcohol structure having at least two hydroxyl groups in a constituent unit and capable of binding to iron ions, and examples thereof include dextran, polyvinyl alcohol, mannitol, sorbitol and cyclodextrin. For example, Japanese Patent Application Laid-Open No. 2005-82538 discloses a method of producing a particulate magnetic substance using dextran. Further, a compound having an epoxy, such as a glycidyl methacrylate polymer, which forms a polyhydric alcohol structure after ring opening can also be used.

  The fine particle magnetic material (magnetic fine particles) prepared using such polyhydric alcohol preferably has an average particle diameter of 0.9 nm or more and less than 1000 nm so as to have good dispersibility. The average particle size is preferably 2.9 nm or more and less than 200 nm in order to increase the detection sensitivity of the target detection object.

(Binding of aptamer and aggregating substance)
The method for binding the aptamer to the aggregating substance is not particularly limited. For example, substances having affinity with each other (for example, biotin and streptavidin or both on the aptamer side and the aggregating substance side (eg, stimulus-responsive polymer portion)) Avidin) is coupled, and the aptamer and aggregating substance are bound via these substances.

  Specifically, as described in WO 01/09141, biotin is attached to a stimulus-responsive polymer by adding biotin or the like to a polymerizable functional group such as methacryl or acrylic, and addition polymerization is possible. As a monomer, it is carried out by copolymerizing with other monomers, to which streptavidin is immobilized. Also, labeling of aptamers with biotin or the like is carried out according to a conventional method, and labeled at the 5 'side or 3' side at the time of oligo DNA synthesis. When the biotin-labeled aptamer and the streptavidin-immobilized stimulus-responsive polymer are mixed, the aptamer and the stimulus-responsive polymer are bound through the binding of biotin and streptavidin.

  In the present specification, a material in which a stimulus-responsive polymer and a particulate magnetic material are bonded is referred to as a stimulus-responsive magnetic particle, and when the stimulus is a temperature, it is referred to as a temperature-responsive magnetic particle.

  The bonding between the particulate magnetic substance and the stimulus-responsive polymer is carried out via a reactive functional group, or a polymerizable unsaturated bond is introduced to the active hydrogen or polyhydric alcohol on the polyhydric alcohol in the magnetic substance. (See, for example, ADV. Polym. Sci., Vol. 4, p 111, 1965 or J. Polymer Sci., Part-A, 3, p 1031). , 1965).

  When the mixture of the aggregating substance, the aptamer, and the sample as described above is placed under conditions where the stimulus-responsive polymer relating to the aggregating substance is agglutinated, the agglutination inhibition of the stimulus-responsive polymer occurs when there is no detection target. Does not occur. On the other hand, when a detection target is present, the inhibition of aggregation of the stimulus-responsive polymer is alleviated by the charge portion or hydrophobic portion to be detected, resulting in aggregation.

  Among these, the phenomenon in which the aggregation inhibition is alleviated will be described with reference to FIGS. 1 and 2.

  As shown in FIG. 1, the stimulus-responsive magnetic fine particle 1 contains a particulate magnetic material 2, and the stimulus-responsive polymer 3 is bonded to the surface of the magnetic material 2. Streptavidin 4 is bound to the stimulus-responsive polymer 3, and the aptamer 6 to the detection target 7 is bound via the biotin 5. As a result, the detection target 7 approaches the stimulus-responsive polymer 3 via the aptamer 6, and the aggregation inhibition of the stimulus-responsive polymer 3 is alleviated by the influence of the positive charge portion or the hydrophobic portion of the detection target 7.

  In order to aggregate the stimulus-responsive polymer, for example, when using a temperature-responsive polymer, the container containing the mixture may be transferred to a thermostatic bath at a temperature at which the temperature-responsive polymer aggregates. There are two types of temperature responsive polymers, a polymer having an upper critical solution temperature (hereinafter sometimes abbreviated as "UCST") and a polymer having a lower critical solution temperature (hereinafter sometimes abbreviated as "LCST"). There is. For example, in the case of using a polymer having a lower critical solution temperature where the LCST is 37 ° C., the temperature-responsive polymer can be aggregated by transferring the container containing the mixture to a thermostat at 37 ° C. or higher. In addition, in the case of using a polymer having an upper critical solution temperature at which UCST is 5 ° C., the temperature-responsive polymer can be aggregated by transferring the container containing the mixture to a thermostatic chamber at a temperature lower than 5 ° C.

  When a pH-responsive polymer is used, an acid solution or an alkaline solution may be added to a container containing the mixture. Specifically, an acid solution or an alkaline solution is added to a container containing a dispersed mixture in which the pH-responsive polymer is outside the pH range causing structural change, and the pH-responsive polymer in the container undergoes structural change. It may be changed to the pH range to occur. For example, in the case of using a pH-responsive polymer coagulated at pH 5 or less and dispersed at pH 5 or more, the acid solution may be added to a container containing the mixture dispersed at pH 5 or more so that the pH is 5 or less. When a pH-responsive polymer that aggregates at pH 10 or higher and disperses at pH lower than 10 is used, an alkaline solution may be added to a container containing a mixture dispersed at pH lower than 10 so that the pH is 10 or higher. The pH at which the pH-responsive polymer causes a structural change is not particularly limited, but is preferably pH 4 to 10, and more preferably pH 5 to 9.

In addition, when a photoresponsive polymer is used, the container containing the mixture may be irradiated with light of a wavelength capable of aggregating the polymer. The preferred light for aggregation varies depending on the type and structure of the photoresponsive functional group contained in the photoresponsive polymer, but in general, ultraviolet light or visible light having a wavelength of 190 to 800 nm can be suitably used. At this time, the intensity is preferably 0.1 to 1000 mW / cm ² . The photoresponsive polymer is preferably one that is less likely to cause dispersion, in other words, one that aggregates when irradiated with light used for measurement of turbidity, from the viewpoint of being able to improve the measurement accuracy. When using a photoresponsive polymer that produces dispersion when irradiated with light used for measurement of turbidity, measurement accuracy can be improved by shortening the irradiation time.

  When the aptamer binds to the stimulus-responsive polymer and the conjugate is placed under conditions where the stimulus-responsive polymer aggregates, the negative charge of the aptamer causes aggregation inhibition. That is, when there is no detection target, the variance is maintained [(A) of FIG. 2]. On the other hand, when the detection target is present, the inhibition of aggregation of the stimulus-responsive polymer is alleviated and the aggregation is promoted by the influence of the positively charged portion or the hydrophobic portion to be detected [FIG. 2 (B)]. This is apparent from the fact that the absorbance at (A) is higher than that at (B) at the end of the measurement, as shown in FIG. 2, and the turbidity is increased.

  Here, the lower critical solution temperature and the upper critical solution temperature are determined, for example, as follows. First, place the sample in the cell of the absorptiometer, and heat the sample at a rate of 1 ° C./min. During this time, the transmissivity change at 550 nm is recorded. Here, when the transmittance when the polymer is dissolved transparently is 100% and the transmittance when completely aggregated is 0%, the temperature at which the transmittance becomes 50% is determined as LCST. In the case of UCST, the sample is cooled at a rate of 1 ° C./min, which is determined by the same method as LCST.

(Judgement)
The determination of the degree of aggregation, in the above example, the determination of the presence or absence of dispersion can be performed, for example, by visual observation or turbidity measurement. The turbidity can be calculated from the light transmittance of the light scattering device. If the turbidity is low, the aggregation of the stimulus-responsive polymer is inhibited, suggesting the presence of a detection substance. Here, the wavelength of light to be used may be appropriately set so as to obtain a desired detection sensitivity according to the particle size of the magnetic substance and the like. The wavelength of the light is preferably in the range of visible light in that conventional general-purpose devices can be used.

  Visual observation or turbidity measurement may be performed intermittently at a fixed time, or may be performed continuously over time. Alternatively, the determination may be made based on the difference between the turbidity measurement value at a certain point in time and the turbidity measurement value at another point in time.

(Separate)
In the case where the aggregating substance contains a particulate magnetic substance, the detection method of the present invention preferably further includes separating the aggregated magnetic substance by applying a magnetic force. This separates the agglomerated magnetic material from contaminants that contain the non-aggregated magnetic material. For this reason, the measured values such as the amount of the separated magnetic substance and the light transmittance when dispersed in the solvent exclude the influence of contaminants and reflect the presence of the detection substance more faithfully.

  The addition of the magnetic force can be performed by bringing the magnet close to the magnetic substance. The magnetic force of this magnet differs depending on the magnitude of the magnetic force of the magnetic substance used. As a magnet, a neodymium magnet (made by Neomag Co., Ltd.) is mentioned, for example.

  Moreover, although addition of a magnetic force may be performed before determination of a judgment, or parallel to determination, simultaneous parallel is preferable at the point which can shorten the time spent to a process. It should be noted that when magnetic force is applied, the aggregated magnetic substance is separated by entraining contaminants, so the turbidity of the mixture after separation is presumed to be smaller in the presence of contaminants. .

(Target of detection)
The target that can be detected by the above detection method includes substances used for clinical diagnosis, and specifically, for example, vascular endothelial cell growth factor (VEGF) contained in body fluid, urine, sputum, feces, saliva, etc. , Thrombin, human immunoglobulin G, human immunoglobulin M, human immunoglobulin A, human immunoglobulin E, human albumin, human fibrinogen (fibrin and their degradation products), α-fetoprotein (AFP), C-reactive protein (CRP) Myoglobin, carcinoembryonic antigen, hepatitis virus antigen, human chorionic gonadotropin (hCG), human placental lactogen (HPL), HIV virus antigen, allergens, bacterial toxins, bacterial antigens, enzymes, hormones (eg, human thyroid stimulation) Hormones (TSH), insulin etc), drugs etc It is. In addition, it also includes secretions collected from all parts of the body, including causative agents related to all diseases.

  Samples suspected of including these detection targets often contain many types and large amounts of contaminants, but the magnetic field to be measured is not greatly affected by the contaminants in the detection targets. For this reason, it is not necessary to necessarily carry out the preparatory procedure of removing the contaminants before the measurement.

(Action effect)
According to the first embodiment of the present invention, the following effects can be obtained.
When the detection target is present in the sample, the aptamer binds to the detection target. When the complex of the detection target and the aptamer binds to the aggregating substance having the stimulus responsive polymer, the charge portion or hydrophobic portion to be detected is disposed in the vicinity of the stimulus responsive polymer, and the aggregation inhibition of the stimulus responsive polymer is alleviated Be done. Therefore, the presence or absence of a detection target can be determined by observing this change in aggregation inhibition.

  The above procedure is achieved by using only the aggregating substance having the aptamer and the stimulus-responsive polymer, and is performed without using a special reagent or device, so it is inexpensive and easy. In addition, it is possible to carry out rapidly because it only measures changes in the degree of aggregation and does not utilize reactions catalyzed by enzymes.

Second Embodiment
(Method of determination)
In the quantification method of the present invention, first, an aptamer and a sample are mixed. Next, the mixture and the aggregating substance having the stimulus-responsive polymer are mixed, and the mixture is placed under predetermined conditions for the stimulus-responsive polymer to aggregate. Subsequently, the turbidity of the mixture is measured, and the amount of the detection target in the sample is calculated based on the correlation between the amount of the detection target and the turbidity under predetermined conditions. The procedure of the first half is similar to the detection method described above, so the description is omitted.

(Correlation equation)
A correlation equation between the amount to be detected and the turbidity under the same conditions as the predetermined conditions is created. The measurement of the amount of the detection target and the turbidity that make up this correlation equation yields a more reliable correlation equation as the amount of data increases. Therefore, the data may be related to the amount of two or more detection targets, and is preferably related to the amount of three or more detection targets.
Here, the correlation equation between the amount to be detected and the turbidity is not only an expression showing a direct correlation between the amount to be detected and the turbidity, but also the correlation between the amount to be detected and a parameter reflecting the turbidity It may be a formula.

(Calculation)
By substituting the turbidity measurement value of the mixture into the created correlation equation, the amount of the detection target in the sample can be calculated.
Incidentally, “turbidimetric measurement” in the detection method or quantitative method includes not only measuring turbidity directly, but also measuring parameters reflecting turbidity. Such parameters include the difference in turbidity measurement values at multiple time points, the amount of separated aggregates, the turbidity of non-aggregated materials after separation, and the like. Here, it is preferable that, for example, when a magnetic force is applied to a negative control whose detection target is absent, one point in the plurality of time points is a point at which the turbidity reaches a maximum value. As a result, the difference from the turbidity measurement value at another time point is increased, and the amount to be detected can be quantified more accurately.

(Action effect)
According to the second embodiment of the present invention, the following effects can be obtained. As in the first embodiment, since the degree of turbidity depends on the amount of the detection target, the detection target can be quantified by substituting the turbidity measurement value into the correlation equation between the amount to be detected and the turbidity. . In addition, this procedure is achieved by using only the aggregating substance having the aptamer and the stimulus-responsive polymer, and is performed without using special reagents and devices, so it is inexpensive and easy. In addition, since the system only measures the degree of aggregation inhibition and is not a system utilizing a reaction catalyzed by an enzyme, it can be carried out rapidly.

Example 1
(Preparation of thrombin sample)
Bovine α-thrombin (Thrombin; manufactured by Thermo scientific) in 0.1% (w / v) BSA (manufactured by Wako Pure Chemical Industries, Ltd.), 10 mM Tris-HCl (pH 7.5, manufactured by Wako Pure Chemical Industries), 100 mM NaCl, A solution containing 5 mM KCl diluted to 100 nM, 80 nM, 60 nM, 40 nM, 20 nM and 10 nM was prepared as a thrombin sample, respectively.

(Preparation of a thrombin-binding DNA aptamer)
An oligonucleotide (SEQ ID NO: 1) having biotin at the 5 'end is diluted to 1 μM with a solution containing 10 mM Tris-HCl (pH 7.5, Wako Pure Chemical Industries, 100 mM NaCl, 5 mM KCl, After incubating at 95 ° C. for 10 minutes using a thermal cycler (DNA Engine, manufactured by Bio-Rad), one kept at 25 ° C. for 30 minutes was prepared as a thrombin-binding DNA aptamer.

(SEQ ID NO: 1)
5'-agtccgtggtagggcaggttggggtgacttttttggttggtgtggttgg-3 '

(Mixing of samples)
100 μL of a thrombin sample and 10 μL of a thrombin-binding DNA aptamer were placed in a 1.5 mL microtube and mixed by pipetting, and incubated at 37 ° C. for 5 minutes.

(Mixture of sample and magnetic particles)
To the above mixed sample, 100 μL of Therma-Max (trade name) LSA Streptavidin (0.02 mass%) manufactured by JNC Petrochemicals, which is a magnetic fine particle to which streptavidin and a temperature responsive polymer are bound, is added by pipetting And kept at 21 ° C. for 5 minutes.

(Measurement of sample)
As shown in FIG. 3, a 10 mm × 5 mm × 3 mm neodymium permanent magnet B (manufactured by Neomag Co., Ltd.) was attached to a cell adapter A attached to a commercially available microcell for microspectrometer (UVette, manufactured by eppendorf). . Microcell C was placed in this cell adapter, and the cell adapter was placed in an ultraviolet-visible spectrophotometer V-660DS (manufactured by JASCO Corporation) provided with a cell temperature controller, and held at 37 ° C. for 10 minutes or more.

  200 μL of the mixed solution of the above sample and magnetic fine particles was dispensed into the microcell, and the absorbance was measured continuously at a wavelength of 420 nm and a bandwidth of 2.0 nm for 600 seconds. The measurement results of the magnetic microparticles, the magnetic microparticles-aptamer complex, and the magnetic microparticles-aptamer-thrombin (20 nM, 60 nM, 100 nM) complex are shown in FIG.

  As shown in FIG. 4, the absorbance increased until about 200 seconds after the start of the measurement, and then the absorbance decreased. It is presumed that this is because turbidity is increased by aggregation of the stimulus-responsive polymer of the magnetic fine particles, and then the magnetic fine particles are adsorbed and separated by the magnet.

  In addition, it was found that the absorbance after 600 seconds from the start of the measurement was higher in the magnetic fine particle-aptamer complex than in the magnetic fine particles alone. It is presumed that this is because the stimulus-responsive polymer has been inhibited by aggregation inhibition by the aptamer and dispersed, making it difficult to adsorb to the magnet.

  Furthermore, it was found that the absorbance after 600 seconds after the start of measurement became lower as the thrombin concentration was higher. It is speculated that this is because binding of thrombin to the complex of the magnetic microparticles and the aptamer alleviated the aggregation inhibition by the aptamer.

  Next, for each sample, the difference between the measured values at two points immediately after the start and after 600 seconds was calculated. The results are shown in Table 1.

  As shown in Table 1, the difference between the measurements at the two points immediately after initiation and after 600 seconds was dependent on the amount of thrombin. That is, the higher the thrombin concentration, the greater the difference between the measured values at two points immediately after the initiation and after 600 seconds. From this, it was found that thrombin can be detected or quantified with high sensitivity by measuring the difference between the measurement values at two points immediately after the start and after 600 seconds.

  In addition, the detection time within 600 seconds after the start is completed within 15 minutes including the incubation time, which is much shorter than the prior art such as ELISA which required several hours. In addition, the procedure is simple because the detection target can be detected or quantified simply by mixing the reaction between the aptamer and the sample and the temperature-responsive magnetic fine particles and measuring the turbidity.

Example 2
(Preparation of VEGF sample)
VEGF (manufactured by R & D) was diluted with 50 mM acetic acid, 100 mM NaCl, 5 mM KCl (pH 4.5) to be 0, 10, 100, 495 fM. At that time, human serum was added to a final concentration of 10% to prepare a VEGF sample.

(Preparation of VEGF-binding DNA aptamer)
Dilute an oligonucleotide (SEQ ID NO: 2) having biotin at the 5 'end to 1 μM with 50 mM acetic acid, 100 mM NaCl, 5 mM KCl (pH 4.5), heat at 95 ° C. for 10 minutes, and take 30 minutes Cool slowly to 25 ° C. This was diluted with 50 mM acetic acid, 100 mM NaCl, 5 mM KCl (pH 4.5) to 75 nM to obtain a VEGF-binding DNA aptamer.

(SEQ ID NO: 2)
5'-tgtgggggtggacggggccgggtaga-3 '

(Mixing of samples)
50 μL of the sample and 50 μL of the VEGF-binding DNA aptamer were placed in a 1.5 mL microtube, and shaken at 1,200 rpm for 10 minutes at 20 ° C. using a thermomixer.

(Mixture of sample and magnetic particles)
Therma-Max (trade name) LSA manufactured by JNC Petrochemicals, which is a magnetic fine particle in which streptavidin and a temperature responsive polymer diluted with 50 mM acetic acid, 100 mM NaCl, 5 mM KCl (pH 4.5) are bound to the above mixed sample. 50 μL of Streptavidn (0.02% by mass) was added, and shaken at 1,200 rpm for 10 seconds at 20 ° C. using a thermomixer.

(Measurement of sample)
As shown in FIG. 3, a 10 mm × 5 mm × 3 mm neodymium permanent magnet B (manufactured by Neomag Co., Ltd.) was attached to a cell adapter A attached to a commercially available microcell for microspectrometer (UVette, manufactured by eppendorf). . Microcell C was placed in this cell adapter, and the cell adapter was placed in an ultraviolet-visible spectrophotometer V-660DS (manufactured by JASCO Corporation) provided with a cell temperature controller, and held at 37 ° C. for 10 minutes or more.

  150 μL of the mixed solution of the above sample and magnetic fine particles was dispensed into the microcell, and the absorbance was measured continuously continuously for 600 seconds at a wavelength of 420 nm and a band width of 2.0 nm. The measurement results of the magnetic microparticle-aptamer complex and the magnetic microparticle-aptamer-VEGF complex are shown in FIG. The numbers beside the graph in FIG. 5 indicate the concentration of VEGF.

  As shown in FIG. 5, it was found that the absorbance after 300 seconds after the start of measurement was lower as the VEGF concentration was higher. It is presumed that this is because binding of VEGF to the complex of the magnetic microparticles and the aptamer alleviated the aggregation inhibition by the aptamer.

  Next, for each sample, the difference between the measured values at two points immediately after the start and after 600 seconds was calculated. The results are shown in Table 2.

  As shown in Table 2, the difference between the measurements at the two points immediately after initiation and after 600 seconds was dependent on the amount of VEGF. That is, the higher the concentration of VEGF, the larger the difference between the measurement values at two points immediately after the initiation and after 600 seconds. From this, it was found that VEGF can be detected or quantified with high sensitivity by measuring the difference between the measurement values at two points immediately after the start and after 600 seconds.

Example 3
Detection of SARS Coronavirus Nucleocapsid Protein (manufactured by RayBiotech) was performed in the same manner as in Example 1.

  An oligonucleotide having biotin at the 5 'end (SEQ ID NO: 3) was used as the SARS Coronavirus Nucleocapsid Protein binding aptamer.

(SEQ ID NO: 3)
5'- gcaatggtacggtacttccggatgcggaa actggctaatggtgaggctgggggggtcgtgcagcaaaagtgcacgctactttgctaa-3 '

  SARS Coronavirus Nucleocapsid Protein The sample concentration in 0nM, 10nM, 20nM, 40nM, 60nM, 80nM, 100nM, the difference between the measurement values at the start and after 600 seconds is shown in Table 3.

  As shown in Table 3, the difference between the measurements at two points immediately after the start and after 600 seconds was dependent on the amount of SARS Coronavirus Nucleocapsid Protein. That is, the higher the concentration of SARS Coronavirus Nucleocapsid Protein, the smaller the difference between the measured values at the two points immediately after the start and after 600 seconds. From this, it was found that the SARS Coronavirus Nucleocapsid Protein can be detected or quantified with high sensitivity by measuring the difference between the measurement values at two points immediately after the start and after 600 seconds.

Example 4
Detection of Influenza virus hemagglutinin (H5N1-HA, A / Anhui / 1/2005, manufactured by Abnova) was performed in the same manner as in Example 1.

  An oligonucleotide having biotin at the 5 'end (SEQ ID NO: 4) was used as an influenza virus hemagglutinin binding aptamer.

(SEQ ID NO: 4)
5'-gaattcagtcggacagcggggttcccatgcggatgttataaagcagtcgcttata agggatggacgaattcgtctccc-4 '

  Table 4 shows the difference between the measurement values of Influenza virus hemagglutinin sample concentrations of 0 nM and 100 nM immediately after the initiation and at 600 seconds.

  As shown in Table 4, the measured values 600 seconds after the start of the measurement showed a clear difference between the sample concentrations of 0 nM and 100 nM, and accelerated aggregation of the magnetic microparticles was observed in the presence of Influenza virus hemagglutinin. This shows that Influenza virus hemagglutinin can be detected.

Comparative Example 1
In the same manner as in Example 1, detection of VEGF (Human Recombinant VEGF A165: manufactured by Human Zyme) was carried out using an antibody instead of an aptamer.

  Anti-VEGF antibody (Biotin) (manufactured by abcam) was used as a VEGF-binding antibody. Anti-VEGF antibody (Biotin) was used by diluting it to 1 μM with a solution containing 10 mM Tris-HCl (pH 7.5, Wako Pure Chemical Industries), 100 mM NaCl, 5 mM KCl.

  Table 5 shows the difference between the measurement values at two points immediately after the initiation and after 600 seconds at the VEGF sample concentrations of 0 nM, 0.1 nM, 1 nM, 10 nM and 100 nM.

  As shown in Table 5, the difference between the measurements at the two points immediately after initiation and after 600 seconds was dependent on the amount of VEGF. That is, the higher the concentration of VEGF, the larger the difference between the measurement values at two points immediately after the initiation and after 600 seconds. From this, it was found that VEGF can be detected or quantified by measuring the difference between the measurement values at two points immediately after the start and after 600 seconds.

  On the other hand, the difference between the measured values of VEGF 0.1 nM was smaller than the difference between the measured values of VEGF 0 nM. From this, the measurement sensitivity in this detection system is considered to be 0.1 nM or more.

  Thereby, it was confirmed that Example 2 which was able to detect even 10 fM using a VEGF binding DNA aptamer has much higher detection sensitivity than Comparative Example 1 using an antibody.

  From the above results, it was shown that the turbidity changes according to the concentration of the detection target, and the concentration of the detection target can be quantified by measuring the turbidity. That is, the method according to the present invention is a novel method capable of detecting and quantifying a detection target quickly, inexpensively and simply without requiring a secondary antibody, a light emitting reagent, a special reagent such as a light emission detecting device, and a device. Was confirmed.

  The present invention is not limited to the above-described embodiment, and modifications, improvements, and the like as long as the object of the present invention can be achieved are included in the present invention.

1 Stimuli-Responsive Magnetic Fine Particle 2 Magnetic Substance 3 Stimuli-Responsive Polymer 4 Streptavidin 5 Biotin 6 Aptamer 7 Detection Target A Cell Adapter B Neodymium Permanent Magnet C Microcell

Claims (5)

A method for detecting a detection target in a sample, comprising
Mixing the sample, an aptamer capable of binding to the detection target, and an aggregating substance containing a stimulus-responsive polymer,
Under the condition that the stimulus-responsive polymer aggregates the obtained mixture, the degree of aggregation of the aggregating substance containing the stimulus-responsive polymer is determined, and the degree of aggregation is the ratio in the absence of the sample. Including a procedure for determining that there is a detection target in the sample when it changes.
The aggregating substance further includes a particulate magnetic substance, and further including separating the aggregated magnetic substance by applying a magnetic force,
The change in the degree of aggregation is a change in which the inhibition of aggregation of the stimulus-responsive polymer is alleviated,
Detection method of detection target. The method according to claim 1, wherein the aptamer capable of binding to the detection target is DNA or RNA.   The method according to claim 1, wherein the detection target is VEGF.   The method according to claim 1 or 2, wherein the detection target is thrombin. A method of quantifying a detection target in a sample, comprising:
Mixing the sample, an aptamer capable of binding to the detection target, and an aggregating substance containing a stimulus-responsive polymer,
Under the condition that the stimulus-responsive polymer aggregates the obtained mixture, the degree of aggregation of the aggregating substance containing the stimulus-responsive polymer is measured, and the condition of the degree of aggregation and the amount of the detection target Including the step of calculating the amount of the detection target in the sample based on the correlation equation below
The aggregating substance further includes a particulate magnetic substance, and further including separating the aggregated magnetic substance by applying a magnetic force,
The change in the degree of aggregation is a change in which the aggregation inhibition of the stimulus-responsive polymer is alleviated,
The change in which the aggregation inhibition of the stimulus-responsive polymer is alleviated is represented by turbidity,
Method for quantifying sample objects.