JP6489676B2 - Biological nitrogen fixation regulator and its use - Google Patents

Description

  The present specification relates to a factor that controls nitrogen fixation (biological nitrogen fixation) by an organism and use thereof.

  Crop productivity depends on large amounts of chemical fertilizers. Chemical fertilizers are produced by industrial nitrogen fixation, which requires high energy costs, and a process of converting nitrogen molecules present in the air into stable nitrogen compounds, in which a large amount of fossil fuel is consumed.

  It is known that limited prokaryotes perform nitrogen fixation (biological nitrogen fixation). Biological nitrogen fixation refers to a process in which molecular nitrogen is converted to ammonia by nitrogenase. Biological nitrogen fixation is considered to involve not only the structural gene of nitrogenase but also a large number of genes such as biosynthesis of metal clusters that are the active centers and supply of reducing power (Non-patent Document 1).

  Examples of prokaryotes that perform nitrogen fixation include Leptolyngbya boryana (L. boryana). L. boryana is a so-called cyanobacteria that is a filamentous cyanobacteria that fixes nitrogen without forming heterocysts under anaerobic conditions. Since this cyanobacteria does not form heterocysts, it also has a feature of performing photosynthesis and nitrogen fixation in the same cell (Non-patent Document 2).

Rubio and Ludden Ann. Rev. Microbiol. 62: 93-111 (2008) J.C.Venter et l., Plos Biol., 2007, 5, e266

  If biological nitrogen fixation ability can be imparted to a plant body, it is considered that dependence on chemical fertilizer can be reduced and fossil energy consumption can also be reduced.

  However, the complex metal center of the enzyme nitrogenase responsible for biological nitrogen fixation requires the regulation of the expression of many genes for its biosynthesis. In addition, these three metal centers have a vulnerability that they are destroyed in units of seconds when exposed to oxygen. This vulnerability is problematic due to the coexistence with photosynthesis that generates oxygen. Furthermore, since nitrogenase consumes a large amount of ATP, it is also required to suppress its expression except under nitrogen depletion conditions.

  The present specification identifies a gene for realizing nitrogen fixation by expressing nitrogenase in a photosynthetic organism, and provides the application of the gene to a non-nitrogen fixation organism.

  The present inventors have found that nitrogen-fixing cyanobacteria, particularly L. boryana, is suitable for imparting nitrogen-fixing ability to photosynthetic organisms because photosynthesis and nitrogen fixation coexist in a single cell. I focused on it. The present inventors performed functional analysis of a nitrogen-fixing gene cluster in L. boryana. As a result, we have identified several genes involved in biological nitrogen fixation, and have found that a system capable of expressing or controlling nitrogen fixation in relation to nitrogen depletion and hypoxia can be established. Based on such knowledge, the disclosure of the present specification provides the following means.

(1) The following (a) to (e):
(A) protein having the amino acid sequence represented by SEQ ID NO: 2 (b) amino acid having an amino acid sequence having 50% or more identity with the amino acid sequence represented by SEQ ID NO: 2 and represented by SEQ ID NO: 2 A protein functionally equivalent to a protein comprising the sequence (c) having an amino acid sequence having substitution, deletion, insertion or addition of one or more amino acids in the amino acid sequence represented by SEQ ID NO: 2, A protein functionally equivalent to a protein consisting of the amino acid sequence represented by (d) a protein having an amino acid sequence encoded by the base sequence represented by SEQ ID NO: 1 (e) a base sequence represented by SEQ ID NO: 1 A protein encoded by a nucleotide sequence having 50% or more identity and functionally identical to the protein consisting of the amino acid sequence represented by SEQ ID NO: 2 Comprising the activation of expression of the gene encoding any protein selected from a protein, a transformant.
(2) The transformant according to (1), wherein nitrogen fixation by nitrogenase can be enhanced.
(3) The transformant according to (2), wherein the nitrogen fixation can be inductively enhanced by hypoxia and nitrogen compound depletion.
(4) The transformant according to any one of (1) to (3), further comprising activation of one or more genes selected from a group of nitrogen-fixing genes derived from cyanobacteria.
(5) The transformant according to (4), wherein the nitrogen-fixing gene group is a nitrogen-fixing gene group of L. boryana.
(6) Furthermore, the protein according to any one of the following (f) to (j);
(F) a protein having the amino acid sequence represented by SEQ ID NO: 4 (g) an amino acid having an amino acid sequence having 50% or more identity with the amino acid sequence represented by SEQ ID NO: 4 and represented by SEQ ID NO: 3 A protein functionally equivalent to a protein comprising the sequence (h) having an amino acid sequence having substitution, deletion, insertion or addition of one or more amino acids in the amino acid sequence represented by SEQ ID NO: 4; SEQ ID NO: 4 A protein functionally equivalent to a protein consisting of the amino acid sequence represented by (i) a protein having an amino acid sequence encoded by the base sequence represented by SEQ ID NO: 3 (j) a base sequence represented by SEQ ID NO: 3 A protein encoded by a nucleotide sequence having 50% or more identity and functionally identical to the protein consisting of the amino acid sequence represented by SEQ ID NO: 4 A protein comprising the activation of expression of a gene encoding, (1) The transformant according to any one of - (5).
(7) The transformant according to any one of (1) to (6), wherein the transformant is a photosynthetic organism.
(8) The transformant according to (7), wherein the photosynthetic organism is a cyanobacteria.
(9) The transformant according to (7), wherein the photosynthetic organism is a plant.
(10) The following (a) to (e):
(A) protein having the amino acid sequence represented by SEQ ID NO: 2 (b) amino acid having an amino acid sequence having 50% or more identity with the amino acid sequence represented by SEQ ID NO: 2 and represented by SEQ ID NO: 2 A protein functionally equivalent to a protein comprising the sequence (c) having an amino acid sequence having substitution, deletion, insertion or addition of one or more amino acids in the amino acid sequence represented by SEQ ID NO: 2, A protein functionally equivalent to a protein consisting of the amino acid sequence represented by (d) a protein having an amino acid sequence encoded by the base sequence represented by SEQ ID NO: 1 (e) a base sequence represented by SEQ ID NO: 1 A protein encoded by a nucleotide sequence having 50% or more identity and functionally identical to the protein consisting of the amino acid sequence represented by SEQ ID NO: 2 Comprising a polynucleotide encoding any of the proteins selected from the proteins, transformation vectors.
(11) A method for producing a transformant according to any one of (1) to (9),
In the host organism cell, the following (a) to (e):
(A) protein having the amino acid sequence represented by SEQ ID NO: 2 (b) amino acid having an amino acid sequence having 50% or more identity with the amino acid sequence represented by SEQ ID NO: 2 and represented by SEQ ID NO: 2 A protein functionally equivalent to a protein comprising the sequence (c) having an amino acid sequence having substitution, deletion, insertion or addition of one or more amino acids in the amino acid sequence represented by SEQ ID NO: 2, A protein functionally equivalent to a protein consisting of the amino acid sequence represented by (d) a protein having an amino acid sequence encoded by the base sequence represented by SEQ ID NO: 1 (e) a base sequence represented by SEQ ID NO: 1 A protein encoded by a nucleotide sequence having 50% or more identity and functionally identical to the protein consisting of the amino acid sequence represented by SEQ ID NO: 2 Step of transforming by introducing a polynucleotide encoding any of the proteins selected from the proteins,
A manufacturing method comprising:
(12) A method for producing useful substances using nitrogen fixation,
(1) A process for producing a useful substance by fixing nitrogen to the transformant according to any one of (9) and growing or proliferating the transformant,
A production method comprising:
(13) The production method according to (12), wherein the transformant is a photosynthetic organism.
(14) The production method according to (12), wherein the photosynthetic organism is a cyanobacteria or a plant.
(15) A method for producing organisms using nitrogen fixation,
A step of growing or proliferating the transformant by fixing nitrogen to the transformant according to any one of (1) to (9) as the organism;
A production method comprising:
(16) A screening method for transcriptional regulators operable under hypoxia and nitrogen depletion conditions,
The following (b), (c) and (e):
(B) a protein having an amino acid sequence having 50% or more identity with the amino acid sequence represented by SEQ ID NO: 2 and functionally equivalent to a protein comprising the amino acid sequence represented by SEQ ID NO: 2 (c) The amino acid sequence represented by No. 2 has an amino acid sequence having substitution, deletion, insertion or addition of one or more amino acids, and is functionally equivalent to the protein consisting of the amino acid sequence represented by SEQ ID No. 2. Protein (e) is a protein encoded by a base sequence having 50% or more identity with the base sequence represented by SEQ ID NO: 1, and is functionally equivalent to a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 Hypoxia and nitrogenation in non-nitrogen-fixed organisms transformed with a gene encoding one or more test proteins selected from various proteins Step of evaluating the test one or more enhanced expression of nitrogen fixation genes by proteins in object depleted conditions,
A screening method comprising:

It is a figure which shows the 50-kb nif gene cluster of L. boryana. The 50 genes included in this gene cluster were assigned serial numbers from the left. The region deleted in each gene disruption strain NK1-NK11 is indicated by a black bar. In addition, 25 genes (genes 15 to 39 shown in red) arranged in the center of this cluster are transferred to Synechocystis sp. PCC 6803. In addition, cnfR (41) is expressed as a transcriptional regulatory protein in another neutral site under the control of the constitutive promoter trc. It is a figure which shows the growth of each gene deletion strain, and nitrogenase activity comparison. In the upper bar graph, NK1 to NK11 were incubated for 12 h under nitrogen fixation conditions, and the nitrogenase activity of the cells was evaluated by acetylene reduction activity (ethylene production rate). * Indicates the result of statistically significant difference from the wild type (WT). The lower part was cultured under aerobic / anaerobic conditions using a nitric acid medium and a nitrogen-free medium, and the growth was compared. It is a figure which shows the RT-PCR analysis of the transcript level of a nif gene cluster. For 27 genes in the nif gene cluster, the presence or absence of nitrate and the transcript level under aerobic / anaerobic conditions were evaluated by RT-PCR in wild type and NK4. Gene serial numbers (FIG. 1) are shown on the left and gene names on the right. In NK4, the gene (14-38) in which the transcript amount under nitrogen fixation was reduced or no longer detected was shown in bold. It is a figure which shows the expression control of the nifB promoter by cnfR. The luxAB gene was linked under the nifB promoter as a reporter, and cnfR was linked under the trc promoter control as an effector (T-B1 strain). As a control, strain N-B1 without cnfR was used. These strains were cultured under aerobic / anaerobic conditions in a nitrate medium and a nitrogen-free medium, and luciferase activity was detected as bioluminescence. It is a figure which shows a series of plasmids for the sequential transfer to Synechocystis sp. PCC 6803 of nif gene group. A. Gene arrangement in the central part (modA ~ cnfR) of nif gene cluster. B to F. A series of plasmids incorporating subfragments for sequential insertion into the neutral site 3 of the wild strain. The fragment derived from L. boryana is shown in dark gray, and the fragment derived from Synechocystis sp. PCC 6803 is shown in light gray. It is a figure which shows the procedure of the sequential insertion to Synechocystis sp. PCC 6803 of a nif gene group. Transform to wild type (WT) with plasmid pSeqNif1KF and transform the resulting kanamycin resistant transformant SN1 with the second plasmid pSeqNif2SF to obtain spectinomycin resistant (kanamycin sensitive) transformant SN2 . In this way, transformation is repeated successively, and kanamycin resistant transformant SN5 containing the region from the central part fdxB to nifT of the nif gene cluster of L. boryana is isolated. Thin crossed solid lines indicate homologous recombination. It is a figure which shows the last step of the sequential insertion to Synechocystis sp. PCC 6803 of a nif gene group. Ptrc-cnfR is inserted into the neutral site 1 (psbA2) of SN5 obtained in FIG. 6 to obtain a final transformant CnfR-Nif strain having spectinomycin-kanamycin double resistance. A primer list used for inverse PCR and gene walking by PCR with degenerate primers is shown. A primer list used for inverse PCR and gene walking by PCR with degenerate primers is shown. A primer list used for inverse PCR and gene walking by PCR with degenerate primers is shown. The gene list of the nitrogen fixation gene cluster of L. boryana is shown. The gene list of the nitrogen fixation gene cluster of L. boryana is shown. The primer list used for plasmid construction for isolation of a gene deletion strain is shown. The primer list used for plasmid construction for isolation of a gene deletion strain is shown. The primer list used for RT-PCR is shown. The primer list used for RT-PCR is shown.

  The disclosure herein relates to factors that control biological nitrogen fixation and uses thereof. Factors disclosed in the present specification, that is, expression control of nitrogen-fixing genes related to nitrogen fixation by organisms and specific conditions of the protein having the amino acid sequence represented by SEQ ID NO: 2 and a protein functionally equivalent thereto The present invention relates to the use for controlling the expression of a desired gene.

  The factor that controls nitrogen fixation according to the present disclosure (hereinafter, simply referred to as this regulator) can activate the expression of a group of nitrogen-fixing genes including nitrogenase. The regulatory factor can also activate expression of a desired gene under hypoxic and nitrogen depletion conditions.

  According to the inventors, this regulator is a transcription factor that is inducibly synthesized under nitrogen depletion conditions in L. boryana. Although not limiting the disclosure herein, the regulator is inducibly synthesized under nitrogen depletion conditions, and further converted to an active form under hypoxic conditions to act on specific promoters. It is thought to activate the expression of genes under the control of the promoter. In L. boryana, since the gene group which comprises nitrogenase is connected under the control of this promoter, the expression of nitrogenase and the like is enhanced, and as a result, it is inferred that nitrogen fixation is enhanced.

  ATP is required for nitrogen fixation by nitrogenase. It is inferred that the necessary ATP can supply ATP by activating the photosynthesis and respiration-related enzyme group under hypoxia under the hypoxic condition.

  As described above, according to the present disclosure, nitrogen fixation can be enhanced by using this control factor. That is, a nitrogen-fixed gene group can be expressed by operably linking the nitrogen-fixed gene group to a promoter on which this regulatory factor acts.

  In addition, according to the present disclosure, expression of a desired gene can be enhanced by using this regulatory factor under specific conditions, typically under hypoxia and nitrogen depletion conditions. That is, by linking a desired gene group operably to a promoter on which this regulatory factor acts, the gene can be expressed under hypoxia and nitrogen depletion conditions.

As used herein, hypoxic conditions refer to an oxygen consuming agent (Gas Generation Kit Anaerobic System) in an anaerobic jar (BBL GasPak anaerobic systems, BD Biosciences, Franklin Lakes, NJ, USA, and the equivalent sealable jar). , Oxoid, Basingstroke, Hants, UK, and the equivalent oxygen consuming agent) that completely consumes oxygen in the jar and does not inhibit oxygen generation by photosynthesis in cyanobacterial cells . Here, the condition that does not inhibit oxygen generation by photosynthesis may be, for example, about 40 μmol _photon m ⁻² s ⁻¹ , or may be up to about 100 μmol μmol _photon m ⁻² s ⁻¹ .

Further, in this specification, the nitrogen depletion condition refers to a condition of growing in a medium that does not substantially contain a nitrate such as potassium nitrate (KNO ₃ ) that is usually added to the medium as a nitrogen source. In addition, it does not contain substantially means not adding nitrate with respect to the culture medium to which nitrate is not added. Nitrate as an inevitable impurity is acceptable.

  Hereinafter, representative and non-limiting embodiments of the present disclosure will be described in detail with reference to the drawings as appropriate. This detailed description is intended merely to provide those skilled in the art with details for practicing the preferred embodiments of the present invention and is not intended to limit the scope of the present disclosure. Additionally, the additional features and inventions disclosed below can be used separately from or in conjunction with other features and inventions to provide further improved control factors and uses thereof.

  Further, the combinations of features and steps disclosed in the following detailed description are not essential in carrying out the present disclosure in the broadest sense, and are particularly only for explaining representative specific examples of the present disclosure. It is described. Moreover, various features of the representative embodiments described above and below, as well as those described in the independent and dependent claims, are described herein in providing additional and useful embodiments of the present disclosure. They do not have to be combined in the specific examples given or in the order listed.

  All the features described in this specification and / or the claims, apart from the configuration of the features described in the embodiments and / or the claims, are individually disclosed as limitations on the original disclosure and the specific matters claimed. And are intended to be disclosed independently of each other. Further, all numerical ranges and group or group descriptions are intended to disclose intermediate configurations thereof as a limitation to the original disclosure and claimed subject matter.

(This control factor)
This control factor is a protein having the amino acid sequence represented by SEQ ID NO: 2 or a protein functionally equivalent to the protein.

  This regulatory factor, which is a protein consisting of the amino acid sequence represented by SEQ ID NO: 2, is L. boryana IAM-M101, which is a conserved strain of Nagoya University, and L. boryana IAM-M101 dg5, L. boryana sp. Found in PCC6306. In addition, L. boryana IAM-M101, which is a conserved strain of Nagoya University, and L. boryana IAM-M101 dg5, which is a mutant of the strain, are a part of the Graduate School of Bioagricultural Sciences, Nagoya University It can be sold from No. 1).

  According to the present inventors, as already described, this regulatory factor is a transcription factor responsible for controlling the expression of a gene encoding a protein constituting nitrogenase in a nitrogen-fixing gene group (cluster) of L. boryana. And it can act on a specific promoter under hypoxia and nitrogen depletion conditions to promote the expression of the gene under its control.

  In addition to those already disclosed, this regulator has an amino acid sequence having a certain relationship with the amino acid sequence represented by SEQ ID NO: 2, and is functional with a protein comprising the amino acid sequence represented by SEQ ID NO: 2. It may be a protein equivalent to

  As another aspect of the present control factor, it preferably has an amino acid sequence having 50% or more identity with the amino acid sequence represented by SEQ ID NO: 2, more preferably 55% or more, More preferably 60% or more, more preferably 65% or more identity, 70% or more identity, preferably 75% or more, more preferably 80% or more, still more preferably 85% or more. More preferably 90% or more, still more preferably 95% or more, still more preferably 97% or more, still more preferably 98% or more, and most preferably 99% or more. preferable.

  In another aspect of the present regulatory factor, when aligned with the amino acid sequence represented by SEQ ID NO: 2, the first Cys motif (CxxCxxCxxxCP) and the 39th position at positions 9 to 20 of the amino acid sequence It is preferable that the protein is provided with the respective motifs of the second Cys motifs (CxxCx8CxxxC) at the 45th position at the corresponding sites. These motifs have been found by homolog search using BLAST of the amino acid sequence represented by SEQ ID NO: 2.

  In another aspect of the present regulatory factor, when aligned with the amino acid sequence represented by SEQ ID NO: 2, a DNA binding motif (helix-turn-helix motif) at positions 485 to 534 of the amino acid sequence Is preferably a protein provided at a site corresponding to these. These motifs have been found by homolog search using BLAST of the amino acid sequence represented by SEQ ID NO: 2.

  In the present specification, “identity” in an amino acid sequence or a base sequence is used to mean the degree of coincidence of amino acid residues or bases constituting each sequence between compared sequences. At this time, regarding the amino acid sequence, the existence of a gap and the nature of the amino acid are considered (Wilbur, Proc. Natl. Acad. Sci. U.S.A. 80: 726-730 (1983)). For the calculation of identity, commercially available software such as BLAST (Altschul: J. Mol. Biol. 215: 403-410 (1990)), FASTA (Peasron: Methods in Enzymology 183: 63-69 (1990)) and the like are used. Can be used. Any numerical value of “identity” may be a numerical value calculated using a homology search program known to those skilled in the art. For example, the homology algorithm BLAST (Basic local alignment) of the National Center for Biotechnology Information (NCBI) search tool) http://www.ncbi.nlm.nih.gov/BLAST/, using default (initial setting) parameters.

  Based on the amino acid sequence represented by SEQ ID NO: 2, etc., the following proteins are included in the embodiment of the present regulatory factor.

  Functionally equivalent to the protein consisting of the amino acid sequence represented by SEQ ID NO: 2 is the expression of a gene that is operably linked to the specific promoter described below under hypoxia and nitrogen depletion conditions This means that the function that promotes the maintenance of substantially the same level. Whether it is functionally equivalent or not is determined under conditions of hypoxia and nitrogen depletion in cyanobacteria and the like by allowing a gene encoding the protein to be compared and an appropriate reporter gene to be expressed under the control of a specific promoter. For example, by evaluating the expression level of the reporter gene. That is, when the expression level of the reporter gene is enhanced under hypoxia and nitrogen depletion conditions, the protein encoded by the gene is functionally equivalent to the protein consisting of the amino acid sequence represented by SEQ ID NO: 2. Can be determined.

  Another aspect of the present regulatory factor is that the amino acid sequence represented by SEQ ID NO: 2 has an amino acid sequence in which one or more amino acids are inserted, substituted, deleted and added, and is represented by SEQ ID NO: 2. It may encode a protein functionally equivalent to the protein consisting of the amino acid sequence represented. Such proteins have, for example, 1 to 30, preferably 1 to 20, more preferably 1 to 10, more preferably 1 to 5, more preferably 1 to 2 amino acid insertions, substitutions and deletions. And additions can be provided. This substitution is preferably a conservative substitution.

  As used herein, “conservative substitution” means substitution of one or more amino acid residues with another chemically similar amino acid residue so as not to substantially alter the function of the protein. For example, when a certain hydrophobic residue is substituted by another hydrophobic residue, a certain polar residue is substituted by another polar residue having the same charge, and the like. Functionally similar amino acids that can make such substitutions are known in the art for each amino acid. Specific examples include non-polar (hydrophobic) amino acids such as alanine, valine, isoleucine, leucine, proline, tryptophan, phenylalanine, and methionine. Examples of polar (neutral) amino acids include glycine, serine, threonine, tyrosine, glutamine, asparagine, and cysteine. Examples of positively charged (basic) amino acids include arginine, histidine, and lysine. Examples of negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

  Furthermore, as another embodiment of the present regulatory factor, it hybridizes under stringent conditions with DNA encoding the amino acid sequence represented by SEQ ID NO: 2 or a part thereof, or DNA having a base sequence complementary thereto. And a protein functionally equivalent to the protein consisting of the amino acid sequence represented by SEQ ID NO: 2.

  “Stringent conditions” means that the reaction is carried out at a temperature of 40 ° C. to 70 ° C., preferably 60 ° C. to 65 ° C. in a hybridization buffer that can be usually used by those skilled in the art. It can be carried out according to a method of washing in a washing solution such as 300 mmol / L, preferably 15 to 60 mmol / L. The temperature and salt concentration can be appropriately adjusted according to the length of the probe used. Furthermore, the conditions for washing the hybridized material can be 0.2 or 2 × SSC, 0.1% SDS, and a temperature of 20 ° C. to 68 ° C. Whether the conditions are stringent (high stringency) or mild (low stringency), there can be a difference depending on the salt concentration or temperature at the time of washing. When providing a difference in hybridization at the salt concentration, 0.2 × SSC, 0.1% SDS as a stringent wash buffer, 2 × SSC as a mild string wash buffer, This can be done with 0.1% SDS. In addition, in the case of providing the difference in hybridization by temperature, in the case of stringent, 68 ° C, in the case of moderate stringency, 42 ° C, in the case of mild, at any room temperature (20 ° C-25 ° C) May be performed with 0.2 × SSC and 0.1% SDS.

  Another embodiment of the present regulatory factor is encoded by DNA consisting of a base sequence having a certain identity with the base sequence encoding the protein consisting of the amino acid sequence represented by SEQ ID NO: 2, and is represented by SEQ ID NO: 2 It may be a protein that is functionally equivalent to a protein comprising an amino acid sequence. The control factor of this embodiment is preferably encoded by, for example, a DNA comprising a base sequence having 50% or more identity with the base sequence represented by SEQ ID NO: 1. More preferably 55% or more identity, still more preferably 60% or more identity, more preferably 65% or more identity, still more preferably 70% or more, more preferably 75% or more, More preferably 80% or more, still more preferably 85% or more, more preferably 90% or more, still more preferably 95% or more, still more preferably 97% or more, still more preferably 98% or more, and most preferably 99% or more. It is preferable that they have the same identity.

  The gene encoding the protein of the above various embodiments is, for example, a nucleic acid derived from DNA extracted from gramineous plants using primers designed based on the sequence of SEQ ID NO: 1 or the like, various cDNA libraries or genomic DNA libraries It can be obtained as a nucleic acid fragment by PCR amplification using as a template. Further, it can be obtained as a nucleic acid fragment by performing hybridization using a nucleic acid derived from the above library or the like as a template and a DNA fragment which is a part of this gene as a probe. Alternatively, this gene may be synthesized as a nucleic acid fragment by various nucleic acid sequence synthesis methods known in the art such as chemical synthesis methods.

  In addition, the present gene encoding the protein of the above-described various embodiments may, for example, convert DNA encoding the amino acid sequence represented by SEQ ID NO: 2 (for example, consisting of the base sequence represented by SEQ ID NO: 1) into a conventional sudden It can be obtained by modification by a mutagenesis method, a site-specific mutagenesis method, a molecular evolution method using error-prone PCR, or the like. As such a technique, a known technique such as the Kunkel method or the Gapped duplex method, or a similar method can be mentioned. For example, a mutation introduction kit using site-directed mutagenesis (for example, Mutant-K (manufactured by TAKARA) ), Mutant-G (manufactured by TAKARA)), or the like, or the LA PCR in vitro Mutagenesis series kit from TAKARA.

In addition, those skilled in the art should refer to Molecular Cloning (Sambrook, J. et al., Molecular Cloning: a Laboratory Manual 2nd ed., Cold Spring Harbor Laboratory Press, 10 Skyline Drive Plainview, NY (1989)). Thus, for example, based on a known sequence such as SEQ ID NO: 1 or 2, the present gene encoding proteins of various aspects can be obtained.

(Transformant)
The transformant disclosed in the present specification (hereinafter also simply referred to as the present transformant) has activation of the expression of a gene encoding the regulatory factor (hereinafter also simply referred to as the present gene). .

  Although the host for the transformant is not particularly limited, the present regulatory factor enhances nitrogen fixation, and at the same time promotes gene expression under hypoxia and nitrogen depletion conditions. A non-nitrogen-fixing organism is preferred. Moreover, since this control factor is related to nitrogen fixation coexisting with photosynthesis, it is preferably a photosynthetic organism. More preferred is an oxygen-generating photosynthesis organism.

  Examples of the host of the transformant include, but are not particularly limited to, various prokaryotes and eukaryotes, and preferably include photosynthetic prokaryotes such as cyanobacteria. The cyanobacteria may be nitrogen-fixed cyanobacteria such as Anabaena sp. PCC 7120, but more preferably non-nitrogen-fixed cyanobacteria such as Synechocystis sp. PCC 6803 and Synechococcus elongatus PCC 7942.

  Further, the eukaryote as the host is preferably a plant body in consideration of photosynthesis and non-nitrogen fixation. Examples of plants include, but are not limited to, various monocotyledonous and dicotyledonous plants. Typically, it is preferably a plant that is a crop such as cereals, vegetables and fruits.

  The plant cell is not particularly limited, and examples thereof include cells of Arabidopsis, rice, corn, potato, tobacco, etc., preferably dicotyledonous plants, and more preferably grasses. Examples of gramineous plants include rice, wheat, barley, corn, sorghum and the like. In addition to cultured cells such as suspension cultured cells, plant cells include protoplasts and callus. Plant cells include shoot primordia, multi-buds, hairy roots and the like, as well as cells in plant bodies such as leaf sections.

  The gene encoding this regulatory factor can encode the regulatory factor of various embodiments. The gene may be any gene as long as it has genetic information encoding the regulatory factor via a polynucleotide such as DNA or RNA. In general, genes are constructed of DNA. This gene only needs to encode this regulatory factor, and may be genomic DNA or the like in addition to cDNA.

  Activation of the expression of this gene means that the synthesis of this regulatory factor as a protein based on the gene information possessed by this gene is promoted. Therefore, when this gene is originally synthesized in the host and this regulator is originally synthesized, it means that the synthesis of this regulator is further increased. If not synthesized, it means that the synthesis of this control factor is newly given.

  The provision of activation of expression of this gene generally means that an expression cassette capable of expressing the gene is held on the host chromosome or outside the host chromosome. Say.

  In the present transformant, the gene may be retained so as to be constitutively expressed, or may be retained so as to be inducibly expressed by some factor. Promoters for constitutively expressing a desired gene in cyanobacteria and plants are known to those skilled in the art, and those skilled in the art can link this gene under the control of such a promoter. Moreover, when this gene is expressed in an inductive manner, those skilled in the art can appropriately select a promoter according to a desired inducing factor.

  For example, in cyanobacteria, the psbA2 promoter, the rbc promoter, the cpc promoter, and the trc promoter derived from an E. coli expression vector can be mentioned.

  Moreover, in a plant body, as a promoter for constitutive expression, for example, cauliflower mosaic virus 35S promoter (Odell et al. 1985 Nature 313: 810), rice actin promoter (Zhang et al. 1991 Plant Cell 3 : 1155), corn ubiquitin promoter (Cornejo et al. 1993 Plant Mol. Biol. 23: 567) and the like. In addition, promoters for inducibly expressing this gene are expressed by external factors such as infection and invasion of filamentous fungi, bacteria and viruses, low temperature, high temperature, drying, ultraviolet irradiation, and spraying of specific compounds. Examples of such promoters are known. Examples of such promoters include rice chitinase gene promoter (Xu et al. 1996 Plant Mol. Biol. 30: 387) and tobacco PR protein gene promoter (Ohshima et al. 1990 Plant Cell 2:95), Rice “lip19” promoter (Aguan et al. 1993 Mol.GenGenet. 240: 1), rice “hsp80” and “hsp72” promoters (Van Breusegem et al. 1994 Planta 193: 57), Arabidopsis Promoter of the “rab16” gene (Nundy et al. 1990 Proc. Natl. Acad. Sci. USA 87: 1406), Parsley chalcone synthase gene promoter (Schulze-Lefert et al. 1989 EMBO J. 8: 651) And the promoter of corn alcohol dehydrogenase gene (Walker et al. 1987 Proc. Natl. Acad. Sci. USA 84: 6624).

  Moreover, when expressing this control factor in a plant body, it is preferable to make it express in a chloroplast. In this case, for example, a plastid expression vector such as pHK20 (Kuroda and Maliga (2001) Nucleic Acids Res 24: 970-975) equipped with the rrn promoter of the ribosomal RNA operon is applied to tissues such as young leaves of plants. A transformant in which an expression vector is inserted into a specific site of chloroplast DNA can be obtained through homologous recombination by introduction into a plant cell by cancer (Lu et al. (2013) PNAS E623-E632).

  A promoter that controls the expression of this regulatory factor in an organism from which this regulatory factor is originally derived can also be used. For example, in L. boryana, this regulatory factor is inducibly expressed under nitrogen depletion conditions, so a region upstream of the coding region of this regulatory factor may be used as the promoter region.

  In the present transformant, one or more of this gene may be retained. These may be operable by the same promoter or may be operable by different promoters.

  The present transformant is suitable as a host (material) for expressing a desired gene using the present regulatory factor, which is a product of the present gene, by retaining the present gene in an expressible manner. In other words, the expression of an exogenous or endogenous gene linked under the control of a promoter that acts on this regulator can be introduced and retained in this transformant to regulate the expression of that gene. It becomes. In particular, the expression of these genes can be induced and promoted under hypoxic and nitrogen depleted conditions.

  The transformant can further retain one or more genes capable of acting on the control factor, which is a product of the gene, so that the gene can be expressed. According to such a transformant, it is possible to regulate the expression of an exogenous or endogenous gene linked under the control of the promoter via the promoter on which this control factor acts. In particular, the expression of these genes can be induced and promoted under hypoxic and nitrogen depleted conditions.

  The promoter (regulatory region) on which this regulatory factor acts is included, for example, in the nifB-nifP intergenic region 1255 bp (SEQ ID NO: 5) of the nitrogen-fixing gene group of L. boryana. Two promoters are included in this region, and the direction of mutual action is the opposite direction. One is, for example, a 1223 bp region (SEQ ID NO: 6) upstream of the nifB gene, and the other is a 315 bp region (SEQ ID NO: 7) upstream of the nifP gene, for example.

  By using the upstream region of these genes as a promoter to which this regulator acts, a desired gene under the control of these promoters can be expressed under hypoxia and nitrogen depletion conditions. The promoter on which this regulatory factor acts is functionally equivalent to the promoter shown above, and may include base substitution, deletion, insertion and / or addition. Such modified promoters can be obtained by screening from nitrogen-fixing genes such as cyanobacteria other than L. boryana.

  The gene linked under the control of such a promoter is not particularly limited, but can be a nitrogen-fixing gene as described above. The nitrogen-fixing gene can be appropriately selected by those skilled in the art. For example, a nitrogen-fixing gene in cyanobacteria can be used. Among these, the following genes found by the present inventors for L. boryana are mentioned. These genes encode nitrogenase constituent proteins and proteins involved in nitrogenase activity. When nitrogen fixation is intended, it is preferable to include at least nifD, nifK, and nifH among these. More preferably, it is preferable to include one or more selected from each gene of nifP, nifW and nifZ. More preferably, it is preferable to include one or more selected from nifN, nifE and nifB. In addition, it is preferable to include one or more selected from nifX, nifS, nifU, nifV, nifT, fdxN, fdxH, fdxB, feoA, hesA, and hesB.

  The transformant can further retain a gene encoding a chlR protein so that the gene can be expressed. According to the inventors, such genes are constitutively expressed in L. boryana and induce the expression of genes involved in the biosynthesis of chlorophyll heme bilin pigments under hypoxic conditions. These proteins are thought to be involved in photosynthesis and respiration under hypoxic conditions, and are thought to contribute to ATP supply for nitrogen fixation under hypoxic and nitrogen depleting conditions. The base sequence of the chlR gene in L. Boryana and the amino acid sequence encoded by the gene are represented by SEQ ID NO: 3 and SEQ ID NO: 4, respectively. For the expression of ChlR gene, psbA2 promoter, rbc promoter, cpc promoter, trc promoter derived from E. coli expression vector, and the like can be used.

  As for these various genes, genes that have a certain relationship with the amino acid sequence represented by the specific sequence number and that encode a protein functionally equivalent to the protein comprising the amino acid sequence can be used. .

  As described above, the present transformant can retain these regulatory factors, and in addition to the regulatory factors, a desired gene such as a nitrogen-fixing gene can be expressed. Elements necessary for the expression of these genes, for example, elements such as promoters and terminators are appropriately provided as necessary.

(Production of transformation vector and transformant)
Such a transformant can be prepared by a technique known to those skilled in the art depending on the type of host using the transformation vector disclosed in the present specification. The transformation vector disclosed herein (hereinafter also simply referred to as the present transformation vector) can contain a polynucleotide encoding the present regulatory factor. This transformant vector is suitable not only for conferring nitrogen fixing ability to a host but also for conferring a desired gene under hypoxia and nitrogen depletion conditions. The polynucleotide may be DNA or RNA, but is generally preferably DNA.

  The present transformation vector can comprise an expression cassette for expressing the present regulatory factor. This regulatory factor may be under the control of a promoter for constitutive expression.

  The present transformation vector may be provided with a desired gene such as one or more nitrogen-fixing genes already described. These desired genes may be provided, for example, in the form of a cluster inherent in L. boryana or independently, under the control of a promoter on which this regulatory factor acts.

  A transforming vector that can express a desired gene such as one or two or more nitrogen-fixed genes already described can be combined as a kit with the present transforming vector that can express the control factor in a host. This transformation vector can be provided with one or more desired genes under the control of a promoter on which this regulatory factor acts.

  In addition, as a desired gene other than the nitrogen-fixing gene, for example, one or two or more enzymes for producing various useful substances or the useful substances may be encoded. For example, proteins useful as pharmaceutical ingredients (eg, interferon, insulin, erythropoietin, human growth hormone, various cytokines), proteins useful as reagents (eg, DNA / RNA polymerase, protease, restriction enzyme), fluorescent proteins (eg, GFP, DsRed, Phycocyanin), bioplastic production related proteins (eg polyhydroxyalkanoic acid (PHA), polyhydroxybutyric acid (PHB) or polyhydroxyvaleric acid (PHV) synthase), amino acid synthases, biofuel related synthases (eg triglycerides, fatty acids) (Such as stearic acid or oleic acid) or hydrocarbon (alkane / alkene) synthase, hydrogen producing enzyme), antibacterial active substance synthase, functional substance synthase (for example, γ-linolenic acid, docosahexaene Acid (DHA), eicosapentaenoic acid, β-carotene, and astaxanthin) and the like, and biofuel-related synthase genes are particularly preferable. A gene encoding such a useful substance is a known method such as a PCR method or a hybridization method using a primer or probe designed from information on the base sequence or amino acid sequence registered in an existing database such as GenBank. It can be obtained by.

  Such a desired gene does not necessarily have to be provided under the control of a promoter on which this regulatory factor acts. This is because, if the transformation vector imparts a nitrogen fixing ability to the host and allows efficient growth or proliferation, the production of such useful substances can be efficiently increased along with the growth.

  A transformation vector is generally a cloning site for inserting one or more enhancers or silencers, operators, promoters, terminators, polyadenylation signals, one or more drug resistance genes, foreign genes, depending on the type of host, etc. Etc. can be included.

  Examples of drug resistance genes include, but are not limited to, chloramphenicol resistance gene, neomycin resistance gene, hygromycin resistance gene, kanamycin resistance gene, ampicillin resistance gene, spectinomycin resistance gene and the like.

  The transformation vector can take various forms without particularly specifying the form. Although it may be a DNA fragment, it is typically a plasmid vector, but for example, non-plasmid vectors such as viral vectors can also be used. Also preferably, the transformation vector is a shuttle vector for adapting to a plurality of host cells. For example, vectors that can be introduced into any cell of E. coli and cyanobacteria and can express foreign genes in these host cells can be mentioned. Such shuttle vectors can be replicated in large quantities using E. coli.

  When the transformation vector is applied to cyanobacteria, the origin of the parent vector is not particularly limited as long as the gene can be expressed efficiently in cyanobacteria. For example, vectors used in cyanobacteria, pVZ321 (Zinchenko VV, Piven IV, Melnik VA, Shestakov SV (1999) Genetika 35: 291-296), pMB1 (Kreps S, Ferino F, Mosrin C, Gerits J, Mergeay) Known vectors such as M, Thuriaux P (1990) Mol. Gen. Genet. 221: 129-133) and RSF1010 (Meyer R (2009) Plasmid 62: 57-70) can be used.

  When the transformation vector is applied to a plant body, for example, plasmids pBI121, pBI221, pBI101 (all of which are manufactured by Clontech) can be used.

  This transformant can be obtained by using this transformation vector for a host and using a known transformation method according to the host. As a transformation method of cyanobacteria, for example, natural transformation method and electroporation method can be used. Further, a junction transmission method can be used. The natural transformation method is a method in which gene introduction is possible only by mixing cyanobacteria and a transformant vector. The electroporation method is a method for introducing a gene by applying an electric pulse to a mixed solution of cyanobacteria and a transformant vector. The conjugation transfer method is a method in which a plasmid into which a gene to be introduced is inserted is transformed into E. coli, and then the E. coli and cyanobacteria are mixed to introduce the gene. Those skilled in the art can appropriately implement these methods. Moreover, in order to select a transformant, the drug resistance gene etc. which were hold | maintained at the transformation vector can be used.

  Introduction of a vector into a plant body (plant cell, plant tissue, chloroplast, etc.) is known to those skilled in the art such as polyethylene glycol method, electroporation method (electroporation), Agrobacterium-mediated method, particle gun method, etc. Various methods can be used. For example, gene transfer to protoplasts using polyethylene glycol (Datta, SK (1995) In Gene Transfer To Plants (Potrykus I and Spangenberg Eds.) Pp66-74), gene transfer to protoplasts using electric pulses (Toki et al. (1992) Plant Physiol. 100, 1503-1507), gene transfer directly into cells by particle gun method (Christou et al. (1991) Bio / technology, 9: 957-962.) And gene transfer via Agrobacterium (Hiei et al. (1994) Plant J. 6: 271-282.). In addition, regeneration of plant bodies from converted plant cells can be performed by methods known to those skilled in the art depending on the type of plant cells (see Toki et al. (1995) Plant Physiol. 100: 1503-1507). ). For example, the method of Fujimura et al. (Plant Tissue Culture Lett. 2:74 (1995)) can be cited for rice, and the method of Shillito et al. (Bio / Technology 7: 581 (1989)) or Gorden-Kamm for maize. (Plant Cell 2: 603 (1990)), for potatoes the method of Visser et al. (Theor.Appl.Genet 78: 594 (1989)), for tobacco, Nagata and Takebe (Planta 99 : 12 (1971)), and for Arabidopsis, the method of Akama et al. (Plant Cell Reports 12: 7-11 (1992)) is used.

  Regeneration of the plant body from the transformed plant cell can be performed by a method known to those skilled in the art depending on the type of plant cell (see Toki et al. (1995) Plant Physiol. 100: 1503-1507). . For example, in rice, a method for producing a transformed plant is a method of regenerating a plant (indian rice varieties are suitable) by introducing a gene into protoplasts using polyethylene glycol (Datta, SK (1995) In Gene Transfer To Plants (Potrykus I and Spangenberg Eds.) Pp66-74), Gene transfer to protoplasts by electric pulses to regenerate plants (Japanese rice varieties are suitable) (Toki et al. (1992) Plant Physiol. 100, 1503-1507), a method of directly introducing a gene into a cell by the particle gun method to regenerate a plant body (Christou et al. (1991) Bio / technology, 9: 957-962.) And Agrobacterium Some technologies have already been established, such as a method for introducing a gene via a um and regenerating a plant (Hiei et al. (1994) Plant J. 6: 271-282.). Widely used. In the present invention, these methods can be suitably used.

  If a transformed plant in which the present gene is integrated on the genome is obtained, offspring can be obtained from the plant by sexual reproduction or asexual reproduction. It is also possible to obtain a propagation material (for example, seeds, fruits, cuttings, tubers, tuberous roots, strains, callus, protoplasts, etc.) from the plant body, its descendants or clones, and mass-produce the plant body based on them. Is possible. The disclosure of the present specification includes (1) a plant cell into which the present gene has been introduced, (2) a plant containing the cell, (3) progeny and clones of the plant, and (4) The plant body, its progeny, and clonal propagation material are included.

(Method of producing useful substances using nitrogen fixation)
The method for producing a useful substance using nitrogen fixation disclosed in the present specification includes the step of fixing nitrogen to the transformant and growing or proliferating the transformant to produce a useful substance. Can be provided. According to this production method, the use of biological nitrogen can be used to reduce or avoid the use of nitrogen fertilizer, and to produce useful substances efficiently while suppressing the influence on environmental pollution and global warming.

  It is preferable that the present transformant is provided with a necessary nitrogen-fixing gene so that the nitrogen-fixing gene can be expressed under the control of a promoter on which this regulatory factor acts. The transformant is preferably a photosynthetic organism. This is because solar energy can be used for photosynthetic organisms.

  The growth or proliferation conditions of the transformant are not particularly limited, and conditions according to the type of host can be adopted. It may grow under natural 24-hour periodic conditions on the earth, or may be artificial conditions. In order to enhance nitrogen fixation, it is preferable to include a growth step with hypoxia and nitrogen depletion conditions. The growth process under low oxygen and nitrogen depletion conditions is not particularly limited, but can be about 12 to 24 hours per day. The hypoxia and nitrogen depletion conditions can be artificially imparted, and may occur without being artificially imparted depending on the plant part, the growth environment, and the like. Therefore, even if it grows on the natural 24-hour periodic condition on the earth, the growth process is partially established under conditions of low oxygen and nitrogen depletion. For example, a deep tissue cell such as a vascular sheath cell of a plant may be in a condition of hypoxia and nitrogen depletion. This is because the tissue in the deep part of the plant is in a hypoxic condition at night when photosynthesis is not performed, and is grown under conditions where fertilization is not performed, resulting in a constant nitrogen depletion condition.

  By enhancing and growing the nitrogen fixing ability of the transformant, efficient growth becomes possible. When the transformant produces a useful substance, a useful substance can be efficiently produced. Useful substances include those produced by genetic modification in addition to those originally produced in the transformant host.

(Method of producing organisms using nitrogen fixation)
The method for producing an organism using nitrogen fixation disclosed in the present specification comprises a step of growing or growing the transformant by fixing nitrogen to the transformant as the organism. Can do. According to this production method, biological nitrogen fixation can be used to reduce or avoid the use of nitrogen fertilizer, and to efficiently produce a living organism while suppressing the influence on environmental pollution and global warming. When the transformant is cyanobacteria or a plant, it is useful because it can effectively increase the production of nutrient sources and useful crops. Also, these cyanobacteria and plants are useful. Even when producing useful substances, the remaining organisms after extraction are also useful.

  Also in this production method, the growth or proliferation conditions of the transformant are not particularly limited, and conditions according to the type of host can be employed. It may grow under natural 24-hour periodic conditions on the earth, or may be artificial conditions. In order to enhance nitrogen fixation, it is preferable to include a growth step under conditions of low oxygen and nitrogen depletion, as in the production method of useful substances.

According to the disclosure of the present specification, a screening method for transcriptional regulators operable under hypoxia and nitrogen depletion conditions is provided. This screening method
The following (b), (c) and (e):
(B) a protein having an amino acid sequence having 50% or more identity with the amino acid sequence represented by SEQ ID NO: 2 and functionally equivalent to a protein comprising the amino acid sequence represented by SEQ ID NO: 2 (c) The amino acid sequence represented by No. 2 has an amino acid sequence having substitution, deletion, insertion or addition of one or more amino acids, and is functionally equivalent to the protein consisting of the amino acid sequence represented by SEQ ID No. 2. Protein (e) is a protein encoded by a base sequence having 50% or more identity with the base sequence represented by SEQ ID NO: 1, and is functionally equivalent to a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 Hypoxia and nitrogen depletion in non-nitrogen-fixed organisms transformed with a gene encoding one or more test proteins selected from various proteins Wherein the step of assessing the enhanced expression of one or more reporter gene by the test protein under conditions, can be provided with.

  According to this screening method, a protein that is a transcriptional regulatory factor that can operate under hypoxia and nitrogen depletion conditions can be screened. This regulator can regulate (promote) transcription under hypoxia and nitrogen depletion conditions, and is useful for nitrogen fixation.

  As a reporter gene for evaluating expression enhancement, a reporter gene known to those skilled in the art such as luciferase can be appropriately selected and used. Non-nitrogen biofixed organisms can be used without particular limitation, such as cyanobacteria and plants. The promoter found in L. boryana already described can be used as the promoter for operably linking the reporter gene. In accordance with this screening method, transcription regulators that act under hypoxia and nitrogen depletion conditions in advance, various base sequences as promoters as test base sequences, under hypoxia and nitrogen depletion conditions By evaluating the enhanced expression of the reporter gene, it is possible to screen for a promoter that acts on a specific transcriptional regulatory factor.

  Hereinafter, specific examples embodying the present disclosure will be described, but the following specific examples do not limit the present disclosure.

  In this example, the base sequence of the nitrogen-fixing gene group of L. boryana was determined.

(Cyanobacterial strains used and culture conditions)
In the experiment, a filamentous cyanobacterium Leptolyngbya boryana (formerly Plectonema boryanum) that fixes nitrogen under anaerobic conditions and a unicellular cyanobacterium Synechocystis sp. PCC 6803 (Syn. 6803) that does not have nitrogen fixing ability were used. For L. boryana, the dg5 strain having high heterotrophic growth ability in a completely dark place was used as a wild type. BG-11 medium (Rippka et al. 1979, J Gen Microbiol 111: 1-61) was used for culture of both strains. The agar medium was prepared by adding 1.5% (w / v) agar (BactoAgar, Difco). The pH of the BG-11 medium was adjusted with 20 mM HEPES-KOH so that L. boryana was 7.5 and Syn. 6803 was 8.2. For normal subculture, a medium containing 10 mM KNO ₃ (hereinafter referred to as nitric acid medium) was used as a nitrogen source, but a medium not containing nitrogen compounds such as nitric acid (hereinafter referred to as nitrogen-free) was used during the nitrogen fixation induction treatment. Medium). Cultivation under anaerobic conditions is in an anaerobic jar (BBL GasPak anaerobic systems, BD Biosciences, Franklin Lakes, NJ) with an anaerobic pack (oxygen consuming agent) (Gas Generating Kit Anaerobic System, Oxioid, Basingstoke, Hants, UK) (Aoki et al. 2012, J Biol Chem 287: 13500-13507).

(L. boryana genomic DNA extraction and gene walking)
The genomic DNA of L. boryana was performed by the method of Willams (Williams 1988, Methods Enzymol., Eds Packer L & Glazer AN, Academic Press, vol 167: 766-778). The gene walking by the inverse PCR which continued in both directions from the nifUHD gene (Fujita et al. 1991, Plant Cell Physiol 32: 1093-1106) which had already been reported by Fujita et al. 230 ng of genomic DNA of L. boryana was completely digested with BglII, EcoRI, HindIII or XbaI. After inactivating the restriction enzyme by heat treatment, DNA was collected by ethanol precipitation and dissolved in 15 μl of distilled water. These DNA fragments were circularized with a DNA Ligation Kit (Mighty Mix; Takara, Kyoto, Japan) and used as templates for inverse PCR. When the fragment was not amplified by inverse PCR, the unknown region was amplified by genomic PCR using degenerate primers. Amplification was performed by nested PCR, and the enzyme was KOD FX Neo polymerase (TOYOBO, Osaka, Japan). The amplified fragment was purified by Wizard SV Gel and PCR Clean-UP System (Promega, Madison, Wis., USA), and the nucleotide sequence was determined using ABI3100 sequencer (Applied Biosystems, Foster City, CA, USA). The primers used for each PCR and the amplified region are shown in FIGS. The gene arrangement of the 50 kb region for which the base sequence was determined is shown in FIG. 1, and details of each gene are shown in FIGS. 9A to 9B.

Note that the notes in FIGS. 8A to 8C are shown below.
¹ fragment number. Numbers were numbered sequentially with nifUHD fragment set to 0, U in the upstream direction, and D in the downstream direction.
The methods used to obtain ^second-order DNA fragments. Inverse PCR (inverse PCR) or degenerate PCR (PCR with degenerate primers. For inverse PCR). Restriction enzymes used in inverse PCR are shown in parentheses. An asterisk (*) was added when it was assumed that the fragment was obtained by the star activity of the restriction enzyme.
The length of the fragment obtained by the restriction enzyme treatment was shown, not the length of the fragment obtained by ³ inverse PCR.
^{4 The} two genes just outside the nif gene cluster are marked with **.
⁵ Two consecutive nested PCRs were performed to reduce non-specific amplification.
The sequence of ⁶ U6 fragment has already been reported as the base sequence of the 2.4-kb EcoRI fragment (Schrautemeimer et al, 1994, J Bacteriol 176: 1037-1046).
^{The 7} U2 fragment was obtained by PCR using genomic DNA as a template. Primers 7425nifE-r1 and 7425nifE-r2 used at this time were designed based on the known nifE sequence of Cyanothece sp. PCC 7425.

In addition, notes in FIGS. 9A to 9B are shown below.
^One gene name is indicated by the name of the gene showing the highest score. The gene name of the putative gene whose function is unknown is tentatively orfN, and N is the number of amino acid residues.
² + and − indicate gene directions (right direction and left direction, respectively) (see FIG. 1).
³ Protein name showing the highest score.
⁴ Name of the organism that originated the protein with the highest score.
⁵ Based on BLAST search results, genes were grouped as follows; S, stored in all cyanobacteria; A, stored in all nitrogen-fixing cyanobacteria; B, some nitrogen-fixing cyanobacteria C, stored in some cyanobacteria (not limited to nitrogen-fixing cyanobacteria); AC, stored in all nitrogen-fixing cyanobacteria, and stored in some non-nitrogen-fixing cyanobacteria D, L. boryana peculiar gene
⁶ Microcoleus chthonoplastesPCC 7420
⁷ Anabaena variabilis ATCC 29413
⁸ Fischerella sp. UTEX 'LB1931'
⁹ Leptolyngbya boryana IAM M-101
¹⁰ Nodularia spumigena CCY9414

In this example, nif gene disruption strains were prepared and functional defects were evaluated.
(Construction of plasmid used for gene disruption of dg5 strain)
All 11 types of plasmids pNK1 to pNK11 were constructed by the same method. That is, PCR fragments of the upstream and downstream regions of the target gene amplified using the L. boryana genome as a template were inserted into both ends of the kanamycin resistance cassette of plasmid pUCK192. The primers and restriction enzymes used are shown in FIGS. 10A and 10B. PUCK192 is a plasmid in which a kanamycin resistant cartridge (BamHI fragment) of pMC19 (Fujita et al. 1992, Plant Cell Physiology, 33: 81-92) is inserted into the BamH site of pUC19.

Note that notes in FIGS. 10A to 10B are shown below.
¹ Plasmid name was named after the defective strain.
A plasmid for isolating ^two gene-deficient strains consists of a 3′-region of the target gene, a kanamycin resistance cartridge, and a 5′-region of the target gene. Both 3'- and 5'-regions were amplified by PCR.
³ D shows the direction of the PCR primers; F, forward; and R, reverse.
⁴ Shows the restriction enzyme used when subcloning the PCR fragment into pUC192. pUCK192 is a plasmid in which a kanamycin resistance cartridge is inserted into the BamHI site of pUC19.
⁵ Restriction enzyme used to linearize the plasmid when subjected to electroporation.

(Isolation of nif gene disruption strain)
In order to isolate a gene-deficient strain via double homologous recombination of dg5 strain, a plasmid for gene disruption was introduced into cells by electroporation (Fujita et al. 1992, Plant Cell Physiol , 33: 81-92). For transformation, the constructed plasmid for gene disruption was cleaved outside the homologous region with the genome with the restriction enzymes shown in FIGS. 10A and 10B and linearized. The dg5 cells grown photosynthesis on a nitrate agar medium (30 ° C.) were collected in a bottle top filter (0.22 μm) with sterilized water, and then water was removed by suction filtration. The salt contained in the cell suspension was removed by performing this operation three times in total. The cells were resuspended in 0.5-2.0 ml of chilled sterilized water, which was used as a competent cell for electroporation.
Competent cells (50 μl) and linearized DNA fragments (10 μl) were mixed and subjected to attenuation pulse treatment with a voltage of 1410 V, resistance of 250 Ω, capacitance of 25 μF, and electrode distance of 1 mm (Gene Pulser Xcell ^™ , Bio-Rad). Collect the pulsed cells by adding 350 μl of BG-11 (20 mM HEPES-KOH; containing pH 7.5) and spread it on a BG-11 agar medium with nylon membrane (Amersham Hybond ^TM -N +, GE Healthcare). It was. After growing for 2 days at 30 ° C, light intensity 2 μmol _photon m ^-2 s ^-1 , transferred to BG-11 agar medium supplemented with kanamycin (final concentration 15 mg / L) with nylon membrane, light intensity 50 μmol _photon Drug-resistant strains were selected under irradiation with m ⁻² s ⁻¹ .
Two weeks later, the nif gene-disrupted strains selected as kanamycin resistant strains were NK1 (nifD, nifK deficient), NK2 (nifZ, nifT deficient), NK3 (orf206a deficient), NK4 (cnfR deficient), NK5 (coxB2, coxA2). Deficiency), NK6 (orf159-orf108 deficiency), NK7 (nifP-orf99 deficiency), NK8 (nifX deficiency), NK9 (hesA-mop deficiency), NK10 (orf118, orf332 deficiency), NK11 (chlR deficiency). Gene disruption in these mutants was confirmed by colony PCR that amplifies DNA fragments directly from the cells.

(Preparation of cnfR complementary strain NK4CS)
Plasmid pPBHcnfRS for cnfR complementation was constructed from plasmid pPBHLI18. pPBHLI18 is a plasmid containing a T5 promoter followed by a ChlL-6xHis protein coding region and a terminator derived from pPBH202 (Yamamoto et al. 2009, Plant Cell Physiol, 50: 1663-1673). The coding region of cnfR was amplified by PCR using L. boryana genomic DNA as a template. Is CCTATC GGATCC AGATAATCAGTCCATC; PbpatB-r9BamHI containing GCATT GCATGC CG GCTAGCTGGAGCCACCCGCAGTTCGAAAAAGGCGC CTACAAAATTTCTGGTGAC and BamHI sites (singlet); PbpatB-f12SphI comprising using primers SphI site (singlet) and Strep-tag sequence (singlet after) . The obtained fragment was treated with SphI and BamHI and then treated with the same enzyme to insert the ChlL-6xHis region into the excised plasmid. The thus obtained pPBHcnfRS expresses CnfR with the Strep-tag added to the N-terminal side by the trc promoter derived from pQE-60 (QIAGEN). This plasmid was introduced into the NK4 strain by the electroporation method described above. However, since pPBHcnfRS is retained as a plasmid in L. boryana cells, it was not linearized by restriction enzyme treatment. Chloramphenicol (final concentration 15 mg / L) was used for selection of transformed cells.

(Growth comparison of gene-deficient strains)
Wild strains and mutant strains cultured for 2 days in nitric acid agar medium and aerobic conditions were collected in distilled water using a platinum loop to prepare a cell suspension with an OD ₇₃₀ of 1.0. 6 μl of this was spotted on nitric acid or nitrogen-free agar medium. The culture was performed under aerobic or anaerobic conditions, continuous light of 40 μmol _photon m ⁻² s ⁻¹ at 30 ° C. for 4 days. Comparison of growth of NK1 to NK11 is shown in FIG.

  As shown in FIG. 2, no nitrogenase activity was observed in the NK4 strain under anaerobic and nitrogen-free conditions.

(L. boryana gene expression analysis)
L. boryana cells grown on an agar medium were collected, and RNA was extracted by the method of Minamizaki et al. (Miamizaki et al. 2008, J Biol Chem 283: 2684-2692). Using this as a template, reverse transcription reaction was performed using random hexamers and ReverTra Ace (TOYOBO) to synthesize single-stranded cDNA. PCR (total amount 15 μl) was performed with 1.5 U KOD Plus polymerase (TOYOBO) using cDNA corresponding to 13 ng of total RNA per template as a template. Primers specific to each gene are shown in FIGS. The internal standard was rpoA, which is a gene encoding the α subunit of RNA polymerase. The amplified DNA fragment (6 μl of the reaction solution) was electrophoresed on a 2% (w / v) agarose gel and stained with GelRed (Biotium, Hayward, CA, USA) for visualization. The results are shown in FIG.

The notes in FIGS. 11A-11B are shown below.
^The number 1 corresponds to the gene numbers shown in FIGS. 9A to 9B and FIG.
² Indicates the length of the fragment obtained by RT-PCR.
³ Indicates the number of RT-PCR cycles.

  As shown in FIG. 3, in the wild type, it was found that the expression of the cnfR gene was strongly induced under anaerobic and nitrogen-free conditions. In the wild type, under anaerobic / nitrogen-free conditions, major members of the nitrogen-fixing gene (mop, fdxB, hesA, nifW, nifN, nifE, nifP, nifB, nifS, nifH, nifD, nifK, nifV, nifZ, It was found that the expression of ocxB2, orf206b) was induced. On the other hand, when the cnfR gene was deleted, transcripts of major members of the nitrogen fixation gene were not detected. This suggests that these members are regulated by the cnfR protein.

(In vivo nitrogenase activity measurement)
The activity of nitrogenase was measured by a reduction reaction from acetylene to ethylene. A wild strain or mutant strain of L. boryana grown in a medium containing nitric acid for 2 days was recovered in distilled water using a platinum loop to obtain a cell suspension having an OD ₇₃₀ = 6.0. 400 μl of this was plated on nitric acid or nitrogen-free agar medium and cultured for 12 h at 30 ° C. with anaerobic, continuous light of 50 μmol _photon m ⁻² s ⁻¹ . Drop 1.5 ml of liquid BG-11 medium on the agar medium, suspend the cells using a large rod, and place in an 8-ml vial that can be sealed with 1 ml of suspension (OD ₇₃₀ is about 3). Enclosed. The nitrogen condition of the liquid medium was the same as that of the agar medium used for the culture. This collection operation was performed in an anaerobic chamber (model A, COY Laboratory Products, Grass Lake, MI, USA). The gas phase inside the vial was replaced with a mixed gas (10% acetylene in argon; as standard gas; Japan Fine Products, Oyama, Japan), and at 30 ° C under 50 μmol _photon m ^-2 s ^-1 light irradiation. Incubated for 10 min. The gas phase was sampled and ethylene produced by gas chromatography was detected and quantified by FID (GC-2014AF, Shimadzu, Kyoto). The column was a Porapak N column (0.3 m × 3 mm), and the column temperature was 40 ° C. (Gavini and Burgess, 1992, J Biol Chem 267: 21179-21186). Under these conditions, ethylene is eluted at 0.8 min. After quantification of ethylene, the cell suspension was collected and the exact value of OD ₇₃₀ was measured to obtain a constant OD ₇₃₀ activity correction value. The results of nitrogenase activity are shown in FIG.

  As shown in FIG. 2, the growth under nitrogen fixation conditions (anaerobic and nitrogen-free conditions) and the ethylene production rate correlated well. These results indicate that the cnfR gene product strongly promotes the expression of multiple nitrogen fixation gene members under nitrogen fixation conditions.

(Isolation of mutant for Syn.6803 reporter assay)
Syn. 6803 used in the reporter assay expressed CnfR, an effector, from neutral site 1 (in the psbA2 (slr1311) coding region) on the genome and inserted into neutral site 2 (in the ssr1880 coding region) nifB of L. boryana The luxAB gene, which is a reporter, is expressed by acting on a promoter.

(Preparation of effector introduction plasmid)
PCR was carried out with primers 6803psbA2-f1 and slr1312-r1EcoRI using Syn. 6803 genomic DNA as a template to amplify a region (1697 bp) containing slr1312 downstream of the psbA2 gene. This fragment and plasmid pUC19 were treated with EcoRI and KpnI and ligated to obtain p6803EF1. Similarly, psbA2 upstream region (1389 bp) amplified with primers sll1212-r1SphI and 6803psbA2-r1SalI was inserted into p6803EF1 with SalI and SphI to obtain p6803EF2. Furthermore, a kanamycin resistance cassette excised from pUCK192 with BamHI and SalI was inserted in the reverse direction between the psbA2 upstream region and the downstream region of p6803EF2 to obtain p6803EF3. The plasmid pP _trc -cnfR in which the cnfR gene of L. boryana is controlled by the E. coli artificial promoter trc was constructed by inserting a P _trc -cnfR fragment upstream of the kanamycin resistance gene coding region of p6803EF3. Two steps of PCR were performed to generate the P _trc -cnfR fragment. First, a fragment A (1,755 bp) obtained by amplification using L. boryana genomic DNA as a template and primers Pbtrc-patB-f1 and Pbhypo1-f2 is used. On the other hand, E. coli expression vector pNF4-Pbpor with P _trc (Enomoto, Fujita, unpublished, E. coli expression vector pQE-60 (QIAGEN) promoter sequence as trc promoter (base number 7-112; 106 bp )) Is used as a template, and the product amplified using primer p7 and Ptrc-patB-r1 is designated as fragment B (1,393 bp). Next, using the same mol number of fragment A and fragment B as templates, amplification was performed using primers 6803por-f3SacI and PbpatB-r9BamHI. The amplified fragment (1,807 bp) was treated with SacI and BamHI and then ligated to the SacI and BamHI sites of p6803EF3 to construct plasmid pP _trc -cnfR. The absence of PCR errors in the trc promoter and cnfR gene of this plasmid was confirmed by sequencing.

  The base sequences of the primers used for the preparation of the effector introduction plasmid are as follows.

6803psbA2-f1; GATCTACCCCATTGGTCAAGGCTC
slr1312-r1EcoRI; GCTTGACCGAATTCCACATAGAGTTGG
sll1212-r1SphI; GTCCTTGGCATGCCCCAATCCCGCT
6803psbA2-r1SalI; GTTGGTAGAGGTCGACCCACTGAC
Pbtrc-patB-f1; GAGGAGAAATTAAGCATGGCGTACAAAATTTCTGG
Pbhypo1-f2; GACTGCTTAGGCAAATGCTCAATGG
p7; CGCCAGGGTTTTCCCAGTCACGAC
Ptrc-patB-r1; CCAGAAATTTTGTACGCCATGCTTAATTTCTCCTC
6803por-f3SacI; TGTGCGAGCTCCTAAAGAATGGCAAAG
PbpatB-r9BamHI; CCTATCGGATCCAGATAATCAGTCCATC

(Preparation of reporter introduction plasmid)
Using the genomic DNA of Syn. 6803 as a template, the upstream region of ssl0410 was amplified by primers 6803ndhB-f1PstI and ssl0410-r1XhoI. This was treated with PstI and XhoI, and then ligated to pPbBU3 (pUC19 multicloning site, upstream sequence of neutral site 3 (slr2030), spectinomycin resistance cartridge, and psbA2 promoter, a plasmid with a spectinomycin resistance cassette. A plasmid having a partial fragment upstream from PstI of a nifH and kanamycin resistant cartridge; Enomoto and Fujita, unpublished) was ligated with a fragment treated with PstI and XhoI. The plasmid thus obtained was designated as p6803RP1. Next, the downstream fragment of ssl0410 amplified with primers 6803ndhB-f2KpnI and slr0251-f1SacI was treated with KpnI and SacI, and ligated with similarly treated p6803RP1 to obtain p6803RP2. Furthermore, L. boryana shuttle vector pKTL21 (Terauchi et al. 2005, Photosynthesis: Fundamental Aspects to Global Perspectives, Edited by van der Est, A. and Diner, B., Allen Press, vol. 2, pp. 729-730) as a template, and the luxAB fragment was amplified using primers luxA-f1BglII and luxAB-r1BamHI. This was treated with BamHI and BglII, and inserted in the reverse direction into the BglII site existing upstream of the spectinomycin resistance cassette of p6803RP2. The plasmid thus obtained was designated as pEmpty-luxAB. Upstream of L. boryana nifB, nifP is encoded in the reverse direction, and its intergenic region is 1,255 bp. A region corresponding to 1,223 bp upstream of the translation start point as a promoter region of nifB was amplified with primers PbnifB-f5KpnI and PbnifB-r8BglII. This fragment was treated with KpnI and BglII and inserted into the KpnI and BglII sites upstream of the luxA coding region of pEmpty-luxAB. The obtained plasmid was _designated as pP _nifB -luxAB1. The absence of PCR errors in the nifB promoter and luxAB gene of this plasmid was confirmed by sequencing.

The base sequences of the primers used were as follows.
6803ndhB-f1PstI; GTAACGTCTGCAGCGCAACTCAATGC
ssl0410-r1XhoI; CCCAAGATCTCGAGCTTTAAATCGG
6803ndhB-f2KpnI; TTGGTTGGTACCTCGCTGGCAGG
slr0251-f1SacI; AGGGGTTTCGAGCTCCCCTACGGAAAC
luxA-f1BglII; GATCCAGATCTATGAAATTTGGAAACTTCC
luxAB-r1BamHI; GCTGAGGATCCCATGAAAATCAAGTC
PbnifB-f5KpnI; GCTATGGTACCTGGTCTGCTTTGC
PbnifB-r8BglII; GAGGGTGGTAGATCTCATTGAATTTCGG

(Introduction of effector and reporter to Syn.6803)
Syn. 6803 wild strain cultured for 2 days in nitrate agar medium was collected with a platinum loop, suspended in distilled water and adjusted to OD ₇₃₀ = 1.0. 1 μg of p6803EF3 or pP _trc -cnfR was added to 300 μl of the suspension and spread on an agar medium on which a nylon membrane was placed. After growing at 30 ° C and light intensity of 2 μmol _photon m ^-2 s ^-1 for 1 day, transfer to an agar medium supplemented with kanamycin (final concentration 15 mg / L) together with nylon membrane, and light intensity of 50 μmol _photon m ^-2 Drug-resistant strains were selected under s ^-1 irradiation. Two weeks later, the strains selected as kanamycin resistant strains were designated as NEF strain and TcnfR strain, respectively. These strains were obtained by repeating subculture in the presence of kanamycin and replacing all genome copies with mutants. Furthermore, pP _nifB -luxAB1 was introduced into the NEF and TcnfR strains in the same manner, and those selected with spectinomycin (final concentration 15 mg / L) _were designated as N-B1 and T-B1 strains, respectively. Isolated. The N-B1 strain is a negative control strain having no effector.

(Luciferase activity measurement)
The activity of the expressed LuxAB (luciferase) was quantified by detecting bioluminescence generated by the reaction with n-decanal which is a fluorescent substrate.
Under aerobic / continuous light (50 μmol _photon m ⁻² s ⁻¹ ), Syn. 6803 N-B1 and T-B1 were precultured in nitrate agar for 3 days. The cells were inoculated into nitric acid or nitrogen-free agar medium with platinum loops and cultured under aerobic or anaerobic / continuous light (50 μmol _photon m ⁻² s ⁻¹ ) irradiation for 14 hours. After culturing, the cells were collected with a micro spatula to prepare 1 ml of a suspension with an OD ₇₃₀ = 0.1. The experimental operation was performed aerobically at 30 ° C. In addition, 1 ml of 0.1% n-decanal was prepared and emulsified by sonication at 30 ° C. for 10 minutes with an ultrasonic cleaner (Model 3210J, Branson, Danbury, CT, USA). 20 μl of this solution was added to the cell suspension and allowed to emit light. The amount of luminescence by luciferase was detected by AQUACOSMOS / VIM (Hamamatsu Photonics, Hamamatsu, Japan). The results of luciferase activity are shown in FIG.

  As shown in FIG. 4, although the cnfR gene was constitutively expressed, luciferase luminescence was observed only under anaerobic and nitrogen-free conditions. This indicates that the cnfR gene acts on the nif promoter only under anaerobic and nitrogen-free conditions to express the gene under the promoter control.

  In this example, a mutant strain in which a cnfR gene derived from L. boryana was constitutively expressed in Syn. 6803 and a nitrogen-fixing gene cluster derived from L. boryana was introduced under the control of the nifB promoter was prepared.

(Isolation of Syn.6803 nif gene expression strain)
Syn. 6803 CnfR-Nif strain expresses CnfR from the neutral site 1 on the genome by the trc promoter, thereby inserting nifT from fdxB of the L. boryana nif cluster inserted into neutral site 3 (intergenic region of slr2030 and slr2031). It is a strain constructed to express a gene group in the 20,763 bp region containing it under nitrogen fixation conditions. Since the introduced nif cluster is a large fragment of 20 kb or more, it was divided into five subfragments and introduced sequentially from the fdxB side (FIGS. 5 to 7).

(Preparation of plasmid for nif cluster introduction)
The upstream region of Syn. 6803 genomic neutral site 3 was amplified with primers sll1910-f2XbaI and slr2030-r1XhoI, and inserted into pUCK19sacB2 using XbaI and XhoI. pUCK19sacB2 is a plasmid having a kanamycin resistance cassette derived from pUCK192 and the sacB gene. The resulting plasmid was named pNSsacB1. Note that sacB encodes levansucrase that degrades sucrose to produce levan toxic to cells, and is used as a negative marker for genetic manipulation. Next, the downstream region of neutral site 3 was amplified with primers slr2031-f3SacI and slr1133-r2SacI, and the one inserted into the SacI site of pNSsacB1 was designated as pNSsacB2. Furthermore, pNSkmR was obtained by removing the sacB gene from pNSsacB2 by KpnI treatment. In this plasmid, the kanamycin resistance cassette is inserted in the neutral site 3 in the reverse direction to the transcription direction of slr2030 and slr2031. In addition, for pNSsacB2 from which kanamycin resistance cassette and sacB gene were removed by treatment with KpnI and XhoI, the kanamycin resistance cassette amplified with primers KmR-f2XhoI and KmR-r2KpnI from pNSsacB2 or the primer SpeR-f2XhoI from p6803RP1 PNSkmF and pNSspeF were obtained by inserting the spectinomycin resistance cassette amplified with SpeR-r3KpnI, respectively. The former has a kanamycin resistance cassette and the latter has a spectinomycin resistance cassette inserted in the forward direction with respect to the transcription directions of slr2030 and slr2031, respectively.

  4,171 bp (mop'-fdxB-feoA-fdxH-hesB-hesA-nifW-orf70-orf155-nifX ') from the middle of the Mop coding region to the middle of the nifX coding region with primers Pbmop-r5SalI and PbnifX-f1SacXho The DNA fragment amplified and treated with SalI and XhoI was inserted into the XhoI site located between the neutral region 3 upstream region of pNSkmF and the kanamycin resistance cassette. The obtained plasmid was designated as pSeqNif1KF. Further, 5,525 bp from the downstream of the nifW coding region to the middle of the nifP coding region was amplified with the primers PbnifW-r3SalI and PbnifP-f2XhoI. pNSspeR was treated with SalI and XhoI to remove the neutral region 3 upstream region, and a similarly treated PCR fragment was inserted instead. The obtained plasmid was designated as pSeqNif2SF. Furthermore, 5,405 bp from the middle of the nifE coding region to the middle of the fdxN coding region was amplified with primers PbnifE-r5SalI and PbfdxN-r2XhoI, and treated with SalI and XhoI. The plasmid pSeqNif3KR was obtained by ligating this with pNSkmR excluding the neutral region 3 upstream region by SalI treatment. 6,066 bp from the middle of the nifB coding region to the middle of the nifD coding region was amplified with primers PbnifB-f9XhoI and PbnifD-r7SalI. By treating pNSspeR with SalI and XhoI, the neutral region 3 upstream region was removed, and a similarly treated PCR fragment was inserted instead. The obtained plasmid was designated as pSeqNif4SF. 5,797 bp from the middle of the nifH coding region to the downstream of the nifT coding region was amplified with primers PbnifH-f3SalI and PbnifT-r6SalI. Plasmid pSeqNif5KR was obtained by treating pNSkmR with SalI, excluding the neutral region 3 upstream region, and replacing it with a SalI-treated PCR fragment (FIG. 5). The absence of PCR error in the nif cluster region of these plasmids was confirmed by sequencing.

The base sequences of the primers used were as follows.
sll1910-f2XbaI; GAAGGGAAGCGTCTAGAATTGTCGAGG
slr2030-r1XhoI; CTACAACTCGAGCCTATTGAACCAGC
slr2031-f3SacI; TTGTTGAGCTCCCACTTCTCCGGTG
slr1133-r2SacI; GAAATTACCGAGCTCGGTATTCCTGG
KmR-f2XhoI; CCACCGATCTCGAGAACGACAGC
KmR-r2KpnI; GGTTCAATAGGTACCGAGTGGGTG
SpeR-f2XhoI; GTACCAAGCTCTCGAGTAACATCAAG
SpeR-r3KpnI; GATTTAAAGCTCGGTACCAACTATTGC
Pbmop-r5SalI; AGCTAAGCCGTCGACTGAGGATTTCG
PbnifX-f1SacXho; CTCATTTTGAGCTCGAGCCAGTAAGATTG
PbnifW-r3SalI; GACAGAGAGTCGACACTCAGCGAAG
PbnifP-f2XhoI; CGAACAGCTCGAGGAGCAACTGC
PbnifE-r5SalI; GATCAGTGCAGTCGACAAGTCGAATAG
PbfdxN-r2XhoI; GAATGGCTCCTCTCGAGCAAACTGG
PbnifB-f9XhoI; TCACTATGCTCGAGATGCACGTTGC
PbnifD-r7SalI; GCAATCTGAGTCGACCCGAAGAAG
PbnifH-f3SalI; GACGTACTAGGTCGACGTTGTATGC
PbnifT-r6SalI; TGAACGAAGTCGACGTGAACGGGAC

(Preparation of cnfR expression plasmid)
A plasmid for expressing CnfR from the trc promoter at the genome neutral site 1 of Syn. 6803 was constructed as follows. The kanamycin resistance cassette was removed by treating the above pP _trc -cnfR with SacI and SalI. In addition, the pectinomycin resistance cassette amplified with primers slr2030-f2SacI and PAII-nifH-r1 using pPbBU3 as a template was treated with SacI and SalI, and ligated to obtain plasmid pP _trc -cnfR2 with converted drug resistance. It was.

The base sequences of the primers used were as follows.
slr2030-f2SacI; GCAATGAGCTCAATGGAAGCAAATCCGAC
PAII-nifH-r1; CTAATATTTTCGTCAGACATTTGGTTATAATTCC

(Introduction of nif cluster and cnfR to Syn.6803)
Transformation of Syn. 6803 was performed by the method shown in Example 3. As for the plasmid, the following plasmid was introduced to pSeqNif5KR with respect to the transformant sequentially obtained from pSeqNif1KF, and finally pP _trc -cnfR2 was introduced (FIGS. 6 and 7). First, transformant SN1 in which one end of the nif cluster (region from the middle of mop to the middle of nifX) and the kanamycin resistance cassette were inserted into neutral site 3 was isolated by pSeqNif1KF. Next, SN2 was isolated by introducing the second plasmid pSeqNif2SF into SeqNif1KF in the form of replacing the kanamycin resistance cassette. In the same manner, kanamycin and spectinomycin were alternately used in turn to obtain a kanamycin resistant strain SN5 into which the entire nif cluster (20,763 bp from fdxB to nifT) was introduced (FIG. 6). Finally, in order to control the expression of the nif gene group by CnfR, pP _trc -cnfR was introduced into the neutral site 1 to obtain a CnfR-Nif strain resistant to kanamycin and spectinomycin (FIG. 7).

Claims (16)

The following (a) to (e):
(A) a protein having the amino acid sequence represented by SEQ ID NO: 2 (b) having an amino acid sequence having 90% or more identity with the amino acid sequence represented by SEQ ID NO: 2 under hypoxia and nitrogen depletion conditions L. Enhanced expression of genes operatively linked to the specific promoter by acting on one of the two promoters contained in the nifB-nifP intergenic region 1255 bp (SEQ ID NO: 5) of the nitrogen-fixing gene group of Boryana Protein having activity (c) having an amino acid sequence having 1 to 30 amino acid substitutions, deletions, insertions or additions in the amino acid sequence represented by SEQ ID NO: 2, and under hypoxia and nitrogen depletion conditions . Enhanced expression of genes operatively linked to the specific promoter by acting on one of the two promoters contained in the nifB-nifP intergenic region 1255 bp (SEQ ID NO: 5) of the nitrogen-fixing gene group of Boryana A protein functionally equivalent to a protein having activity (d) A protein having an amino acid sequence encoded by the nucleotide sequence represented by SEQ ID NO: 1 (e) 90% or more identical to the nucleotide sequence represented by SEQ ID NO: 1 A protein encoded by a nucleotide sequence having sex, and under conditions of hypoxia and nitrogen depletion. Enhanced expression of genes operatively linked to the specific promoter by acting on one of the two promoters contained in the nifB-nifP intergenic region 1255 bp (SEQ ID NO: 5) of the nitrogen-fixing gene group of Boryana A transformant comprising a gene encoding any protein selected from proteins having activity so that the gene can be expressed. L. The gene encoding nitrogenase can be expressed under the control of any one of two promoters contained in nifB-nifP intergenic region 1255bp (SEQ ID NO: 5) of the nitrogen-fixing gene group of Boryana. The transformant described.   The transformant according to claim 2, wherein the nitrogen fixation can be inductively enhanced under conditions of hypoxia and nitrogen depletion.   Furthermore, the transformant in any one of Claims 1-3 equipped with the expression of the 1 type, or 2 or more types of gene selected from the nitrogen fixation gene group derived from cyanobacteria.   The transformant according to claim 4, wherein the nitrogen-fixing gene group is a nitrogen-fixing gene group of L. boriana. Furthermore, the protein according to any one of the following (f) to (j);
(F) a protein having the amino acid sequence represented by SEQ ID NO: 4 (g) having an amino acid sequence having 90% or more identity with the amino acid sequence represented by SEQ ID NO: 4 and constitutively expressed in L. boriana A protein having an inducing activity of expression of a gene involved in biosynthesis of chlorophyll, heme, and bilin pigments under hypoxic conditions (h) substitution of 1 to 30 amino acids in the amino acid sequence represented by SEQ ID NO: 4 Has an amino acid sequence having a deletion, insertion or addition, is constitutively expressed in L. boriana, and has an inducing activity of expression of a gene involved in biosynthesis of chlorophyll heme bilin dye under hypoxic conditions Protein (i) Protein (j) having the amino acid sequence encoded by the base sequence represented by SEQ ID NO: 3 Base represented by SEQ ID NO: 3 A protein encoded by a nucleotide sequence having 90% or more identity with the sequence, which is constitutively expressed in L. boriana and is involved in the biosynthesis of chlorophyll, heme, and villin pigments under hypoxic conditions The transformant according to any one of claims 1 to 5, which is capable of expressing a gene encoding a protein having expression-inducing activity.   The transformant according to any one of claims 1 to 6, wherein the transformant is a photosynthetic organism.   The transformant according to claim 7, wherein the photosynthetic organism is a cyanobacteria.   The transformant according to claim 7, wherein the photosynthetic organism is a plant. The following (a) to (e):
(A) a protein having the amino acid sequence represented by SEQ ID NO: 2 (b) having an amino acid sequence having 90% or more identity with the amino acid sequence represented by SEQ ID NO: 2 under hypoxia and nitrogen depletion conditions L. Enhanced expression of genes operatively linked to the specific promoter by acting on one of the two promoters contained in the nifB-nifP intergenic region 1255 bp (SEQ ID NO: 5) of the nitrogen-fixing gene group of Boryana Protein having activity (c) having an amino acid sequence having 1 to 30 amino acid substitutions, deletions, insertions or additions in the amino acid sequence represented by SEQ ID NO: 2, and under hypoxia and nitrogen depletion conditions . Enhanced expression of genes operatively linked to the specific promoter by acting on one of the two promoters contained in the nifB-nifP intergenic region 1255 bp (SEQ ID NO: 5) of the nitrogen-fixing gene group of Boryana Protein having activity (d) Protein having an amino acid sequence encoded by the nucleotide sequence represented by SEQ ID NO: 1 (e) Coded by a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 1 Of the L. protein under hypoxic and nitrogen depletion conditions. Enhanced expression of genes operatively linked to the specific promoter by acting on one of the two promoters contained in the nifB-nifP intergenic region 1255 bp (SEQ ID NO: 5) of the nitrogen-fixing gene group of Boryana A transformation vector comprising a polynucleotide encoding any protein selected from proteins having activity. A method for producing the transformant according to any one of claims 1 to 9,
In the host organism cell, the following (a) to (e):
(A) a protein having the amino acid sequence represented by SEQ ID NO: 2 (b) having an amino acid sequence having 90% or more identity with the amino acid sequence represented by SEQ ID NO: 2 under hypoxia and nitrogen depletion conditions L. Enhanced expression of genes operatively linked to the specific promoter by acting on one of the two promoters contained in the nifB-nifP intergenic region 1255 bp (SEQ ID NO: 5) of the nitrogen-fixing gene group of Boryana Protein having activity (c) having an amino acid sequence having 1 to 30 amino acid substitutions, deletions, insertions or additions in the amino acid sequence represented by SEQ ID NO: 2, and under hypoxia and nitrogen depletion conditions . Enhanced expression of genes operatively linked to the specific promoter by acting on one of the two promoters contained in the nifB-nifP intergenic region 1255 bp (SEQ ID NO: 5) of the nitrogen-fixing gene group of Boryana Protein having activity (d) Protein having an amino acid sequence encoded by the nucleotide sequence represented by SEQ ID NO: 1 (e) Coded by a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 1 Of the L. protein under hypoxic and nitrogen depletion conditions. Enhanced expression of genes operatively linked to the specific promoter by acting on one of the two promoters contained in the nifB-nifP intergenic region 1255 bp (SEQ ID NO: 5) of the nitrogen-fixing gene group of Boryana Introducing a polynucleotide encoding any protein selected from proteins having activity, and transforming,
A manufacturing method comprising: A method for producing useful substances using nitrogen fixation,
Fixing nitrogen to the transformant according to any one of claims 1 to 9 and growing or growing the transformant to produce a useful substance;
A production method comprising:   The production method according to claim 12, wherein the transformant is a photosynthetic organism.   The production method according to claim 12, wherein the photosynthetic organism is a cyanobacteria or a plant. A method of producing organisms using nitrogen fixation,
Fixing the nitrogen to the transformant according to any one of claims 1 to 9 as the organism, and growing or proliferating the transformant;
A production method comprising: A screening method for transcriptional regulators operable under hypoxia and nitrogen depletion conditions comprising:
The following (b), (c) and (e):
(B) having an amino acid sequence having 90% or more identity with the amino acid sequence represented by SEQ ID NO: 2, and under conditions of hypoxia and nitrogen depletion; Enhanced expression of genes operatively linked to the specific promoter by acting on one of the two promoters contained in the nifB-nifP intergenic region 1255 bp (SEQ ID NO: 5) of the nitrogen-fixing gene group of Boryana Protein having activity (c) having an amino acid sequence having 1 to 30 amino acid substitutions, deletions, insertions or additions in the amino acid sequence represented by SEQ ID NO: 2, and under hypoxia and nitrogen depletion conditions . Enhanced expression of genes operatively linked to the specific promoter by acting on one of the two promoters contained in the nifB-nifP intergenic region 1255 bp (SEQ ID NO: 5) of the nitrogen-fixing gene group of Boryana Protein having activity (e) A protein encoded by a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 1, wherein L. Enhanced expression of genes operatively linked to the specific promoter by acting on one of the two promoters contained in the nifB-nifP intergenic region 1255 bp (SEQ ID NO: 5) of the nitrogen-fixing gene group of Boryana One or more of the test protein under hypoxia and nitrogen compound depletion conditions in a non-nitrogen-fixed organism transformed with a gene encoding one or more test proteins selected from proteins having activity Evaluating the enhanced expression of nitrogen fixation genes in
A screening method comprising: