JP6460486B2 - ATP or AMP analysis device and analysis method - Google Patents

Description

  The present invention relates to a nucleic acid sensor for analysis of ATP or AMP, an analysis device, and an analysis method.

  In recent years, an increase in food poisoning due to microbial infection such as Escherichia coli and Salmonella has been a problem. A major cause of this problem is poor cleaning. For this reason, it is indispensable to perform a cleaning degree inspection in a food processing plant or the like.

  In such examinations, in recent years, a method for analyzing the degree of cleaning by measuring ATP (adenosine triphosphate) or AMP (adenosine monophosphate) has been put into practical use. ATP and AMP are known as essential components for energy metabolism in all living organisms. For this reason, the amount of ATP or AMP is considered to correlate with the amount of microorganisms and foods present therein. Therefore, by measuring ATP or AMP in the target area, the degree of microorganisms and food residues remaining in the area can be analyzed, and thus the degree of cleaning can be evaluated.

  As a tool for detecting AMP, for example, a nucleic acid element in which a DNA aptamer that specifically binds to AMP and a DNA that causes peroxidase activity (hereinafter, DNAzyme) are linked has been reported (Non-patent Document 1). In this nucleic acid element, in the absence of AMP, the aptamer and DNAzyme self-associate to inhibit the catalytic ability of DNAzyme, and in the presence of AMP, the self-association is released by binding of AMP and the aptamer. The structure is controlled so that the catalytic ability of DNAzyme occurs. For this reason, if AMP is present, for example, a peroxidase reaction occurs due to the DNAzyme in which catalytic ability has been generated. Therefore, the amount of AMP can be indirectly measured by measuring the reaction. In addition, in the absence of AMP, the catalytic ability of DNAzyme is not generated, and thus the peroxidase reaction does not occur. However, for such a nucleic acid element, further improvement in sensitivity, ease of operation, etc. is required for practical use.

Carsten Teller et al., Anal. Chem. 2009, 81, 9114-9119

  Therefore, an object of the present invention is to provide a new nucleic acid sensor for detecting ATP or AMP.

The nucleic acid sensor for analysis of the present invention is a nucleic acid sensor for analysis of ATP or AMP, and has a catalytic nucleic acid molecule (D) that generates a catalytic function and a binding nucleic acid molecule (A) that binds to ATP or AMP ( It comprises a nucleic acid element of I), (II), (II ′) or (III).
(I) a double-stranded nucleic acid element composed of a first strand and a second strand,
In the first strand (ss1), the binding nucleic acid molecule (A), the loop forming sequence (L1) and the catalytic nucleic acid molecule (D) are linked in this order,
In the second strand (ss2), a stem forming sequence (S _A ), a loop forming sequence (L2) and a stem forming sequence (S _D ) are linked in this order,
The terminal region on the loop forming sequence (L1) side of the binding nucleic acid molecule (A) in the first strand (ss1) and the stem forming sequence (S _A ) in the second strand (ss2) are complementary. Yes,
The terminal region on the loop-forming sequence (L1) side of the catalytic nucleic acid molecule (D) in the first strand (ss1) and the stem-forming sequence (S _D ) in the second strand (ss2) are complementary. Yes,
The loop forming sequence (L1) in the first strand (ss1) and the loop forming sequence (L2) in the second strand (ss2) are non-complementary,
In the absence of ATP or AMP, the respective stem formation in the stem-forming sequence (S _A ) and the stem-forming sequence (S _D ) inhibits the catalytic function of the catalytic nucleic acid molecule (D),
In the presence of ATP or AMP, binding of the ATP or AMP and the binding nucleic acid molecule (A) releases the respective stem formation in the stem-forming sequence (S _A ) and the stem-forming sequence (S _D ). , A nucleic acid element (II) in which the catalytic function of the catalytic nucleic acid molecule (D) occurs, a single-stranded nucleic acid element,
The binding nucleic acid molecule (A), the loop forming sequence (L1), the stem forming sequence (S _D ), the catalytic nucleic acid molecule (D), the loop forming sequence (L2), and the stem forming sequence (S _A ) in this order. Consolidated
The terminal region on the loop forming sequence (L1) side of the binding nucleic acid molecule (A) and the stem forming sequence (S _A ) are complementary,
The terminal region on the loop forming sequence (L2) side of the catalytic nucleic acid molecule (D) and the stem forming sequence (S _D ) are complementary,
The loop forming sequence (L1) and the loop forming sequence (L2) are non-complementary,
In the absence of ATP or AMP, the respective stem formation in the stem-forming sequence (S _A ) and the stem-forming sequence (S _D ) inhibits the catalytic function of the catalytic nucleic acid molecule (D),
In the presence of ATP or AMP, binding of the ATP or AMP and the binding nucleic acid molecule (A) releases the respective stem formation in the stem-forming sequence (S _A ) and the stem-forming sequence (S _D ). , A nucleic acid element (II ′) in which the catalytic function of the catalytic nucleic acid molecule (D) occurs, a single-stranded nucleic acid element,
The catalytic nucleic acid molecule (D), the loop forming sequence (L2), the stem forming sequence (S _A ), the binding nucleic acid molecule (A), the loop forming sequence (L1) and the stem forming sequence (S _D ) are in this order. Consolidated
The terminal region on the loop forming sequence (L2) side of the catalytic nucleic acid molecule (D) and the stem forming sequence (S _D ) are complementary,
The terminal region on the loop forming sequence (L1) side of the binding nucleic acid molecule (A) and the stem forming sequence (S _A ) are complementary,
The loop forming sequence (L1) and the loop forming sequence (L2) are non-complementary,
In the absence of ATP or AMP, the respective stem formation in the stem-forming sequence (S _A ) and the stem-forming sequence (S _D ) inhibits the catalytic function of the catalytic nucleic acid molecule (D),
In the presence of ATP or AMP, binding of the ATP or AMP and the binding nucleic acid molecule (A) releases the respective stem formation in the stem-forming sequence (S _A ) and the stem-forming sequence (S _D ). , A nucleic acid element (III) in which the catalytic function of the catalytic nucleic acid molecule (D) occurs, a single-stranded nucleic acid element,
The catalytic nucleic acid molecule (D), the intervening sequence (I) and the binding nucleic acid molecule (A) are linked in this order;
The intervening sequence (I) is non-complementary to the catalytic nucleic acid molecule (D) and the binding nucleic acid molecule (A);
In the absence of ATP or AMP, the catalytic function of the catalytic nucleic acid molecule (D) is inhibited,
A nucleic acid element in which the catalytic function of the catalytic nucleic acid molecule (D) occurs in the presence of ATP or AMP

  The analysis device of the present invention is an ATP or AMP analysis device, and includes a base material, a nucleic acid sensor, and a detection unit. The nucleic acid sensor and the detection unit are arranged on the base material, and the nucleic acid sensor is In the nucleic acid sensor of the present invention, the detection unit is a detection unit that detects a catalytic function of the catalytic nucleic acid molecule (D) in the nucleic acid sensor.

  The analysis method of the present invention is an analysis method of ATP or AMP, the step of bringing the sample containing ATP or AMP into contact with the nucleic acid sensor for analysis of ATP or AMP of the present invention, and the catalytic nucleic acid in the nucleic acid sensor The method includes detecting ATP or AMP in the sample by detecting the catalytic function of the molecule (D).

  The analysis method of the present invention is an ATP or AMP analysis method, the step of bringing a sample containing ATP or AMP into contact with the analysis device of the present invention, and the nucleic acid in the detection unit of the analysis device The method includes detecting ATP or AMP in the sample by detecting a catalytic function of the catalytic nucleic acid molecule (D) in a sensor.

  According to the nucleic acid sensor of the present invention, ON / OFF of the catalytic function of the catalytic nucleic acid molecule (D) can be switched depending on whether the binding nucleic acid molecule (A) is bound to ATP or AMP, and Excellent sensitivity. For this reason, the presence or amount of ATP or AMP can be easily detected by detecting the catalytic function of the catalytic nucleic acid molecule. Moreover, since the analysis device of the present invention uses the nucleic acid sensor as described above, for example, the device can be reduced in size and chipped, and a simple analysis can be performed even for a large number of samples. . For this reason, the present invention can be said to be an extremely useful technique for research and examination in various fields such as clinical medicine, food, and environment. In the present invention, “analysis” is a concept including, for example, quantitative analysis, semi-quantitative analysis, and qualitative analysis.

FIG. 1 is a schematic diagram showing an example of a nucleic acid element in the nucleic acid sensor of the present invention. FIG. 2 is a schematic diagram showing another example of the nucleic acid element in the nucleic acid sensor of the present invention. FIG. 3 is a schematic diagram showing another example of the nucleic acid element in the nucleic acid sensor of the present invention. FIG. 4 is a schematic diagram showing another example of the nucleic acid element in the nucleic acid sensor of the present invention. FIG. 5 is a graph showing the results of absorbance measurement in Example 1. FIG. 6 is a graph showing the results of absorbance measurement in Example 2. FIG. 7 is a graph showing the results of absorbance measurement in Example 3. FIG. 8 is a graph showing the results of absorbance measurement in Example 4.

(Nucleic acid sensor and analysis method using the same)
As described above, the nucleic acid sensor for analysis of ATP or AMP of the present invention has the catalytic nucleic acid molecule (D) that generates a catalytic function and the binding nucleic acid molecule (A) that binds to ATP or AMP (I) (II), (II ′) or (III) nucleic acid element.

  The binding nucleic acid molecule (A) is not particularly limited as long as it is a nucleic acid molecule that binds to ATP or AMP. For example, the binding nucleic acid molecule (A) may bind to one or both of ATP and AMP. In the present invention, “binding to ATP or AMP” may be capable of binding to any of ATP or ATP, ATP derivative, and AMP derivative, in addition to ATP or AMP.

  The binding nucleic acid molecule (A) is, for example, a single strand. The length of the binding nucleic acid molecule (A) is not particularly limited, and the lower limit is, for example, 18 base length, preferably 20 base length, more preferably 24 base length, and the upper limit is, for example, It is 120 bases long, preferably 60 bases long, more preferably 26 bases long.

Examples of the binding nucleic acid molecule (A) include those containing the following polynucleotide (a1), (a2), (a3) or (a4). The binding nucleic acid molecule (A) may be, for example, a molecule composed of the polynucleotide or a molecule containing the polynucleotide. The binding nucleic acid molecule (A) containing the polynucleotide (a1), (a2), (a3) or (a3) can also be referred to as a binding DNA molecule, for example.
(A1) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 SEQ ID NO: 1 CCTGGGGGAGTATTGCGGAGGAAGG
(A2) a polynucleotide (a3) wherein the base sequence of (a1) comprises a base sequence in which one or more bases are substituted, deleted, added and / or inserted, and which binds to ATP or AMP A polynucleotide comprising a base sequence having 50% or more identity with the base sequence of (a1) and capable of binding to ATP or AMP (a4) under stringent conditions with the base sequence of (a1) A polynucleotide comprising a base sequence complementary to a base sequence hybridizing with ATP and capable of binding to ATP or AMP

  In the (a2), “one or more” is not particularly limited, and the polynucleotide (a2) may be bound to ATP or AMP. In the base sequence (a1), the number of the substituted bases is, for example, 1 to 5, preferably 1 to 4, more preferably 1 to 3, still more preferably 1 or 2. Particularly preferred is one. The number of added or inserted bases is, for example, 1 to 5, preferably 1 to 4, more preferably 1 to 3, further preferably 1 or 2 in the base sequence (a1). One, particularly preferably one. In the base sequence (a1), the number of deleted bases is, for example, 1 to 5, preferably 1 to 4, more preferably 1 to 3, further preferably 2 or 1. Particularly preferred is one.

  In the above (a3), the identity is, for example, 70% or more, preferably 80% or more, more preferably 90% or more, further preferably 95% or more, 96% or more with respect to the base sequence (a1). 97% or more, 98% or more, particularly preferably 99% or more. The identity can be calculated, for example, by calculating under default conditions using BLAST or the like.

  In the above (a4), “hybridizes under stringent conditions” is, for example, well-known experimental conditions for hybridization in those skilled in the art. Specifically, the “stringent condition” is, for example, that hybridization is performed at 60 to 68 ° C. in the presence of 0.7 to 1 mol / L NaCl, and then 0.1 to 2 times the SSC solution is used. , The conditions under which the base sequence can be identified by washing at 65-68 ° C. 1 × SSC consists of 150 mmol / L NaCl, 15 mmol / L sodium citrate.

  The binding nucleic acid molecule (A) is not limited to these examples, and may be any nucleic acid molecule that binds to ATP or AMP as described above.

  The binding nucleic acid molecule (A) is, for example, a molecule containing a nucleotide residue, and may be a molecule consisting only of a nucleotide residue or a molecule containing a nucleotide residue. The nucleotide is, for example, ribonucleotide, deoxyribonucleotide and derivatives thereof. The binding nucleic acid molecule (A) may contain, for example, only one kind of ribonucleotide, deoxyribonucleotide and derivatives thereof, two kinds or more, or all of them. Specifically, the nucleic acid molecule may be, for example, DNA containing deoxyribonucleotide and / or a derivative thereof, RNA containing ribonucleotide and / or a derivative thereof, or a chimera (DNA / RNA containing the former and the latter )

  The nucleotide may contain, for example, either a natural base (non-artificial base) or a non-natural base (artificial base) as a base. Examples of the natural base include A, C, G, T, U, and modified bases thereof. Examples of the modification include methylation, fluorination, amination, and thiolation. Examples of the non-natural base include 2′-fluoropyrimidine, 2′-O-methylpyrimidine, etc. Specific examples include 2′-fluorouracil, 2′-aminouracil, 2′-O-methyluracil, Examples include 2-thiouracil. The nucleotide may be, for example, a modified nucleotide, and the modified nucleotide may be, for example, a 2′-methylated-uracil nucleotide residue, 2′-methylated-cytosine nucleotide residue, 2′-fluorinated-uracil nucleotide. Residue, 2′-fluorinated-cytosine nucleotide residue, 2′-aminated-uracil nucleotide residue, 2′-aminated-cytosine nucleotide residue, 2′-thiolated-uracil nucleotide residue, 2′- Examples include thiolated-cytosine nucleotide residues. The binding nucleic acid molecule (A) may include non-nucleotides such as PNA (peptide nucleic acid) and LNA (Locked Nucleic Acid).

  The catalytic nucleic acid molecule (D) may be a nucleic acid molecule that causes a catalytic function. The catalytic function is, for example, a catalytic function of a redox reaction. The oxidation-reduction reaction may be a reaction that causes transfer of electrons between two substrates in the process of generating a product from the substrates, for example. The kind of the redox reaction is not particularly limited. The catalytic function of the oxidation-reduction reaction includes, for example, the same activity as an enzyme, and specifically includes, for example, the same activity as peroxidase (hereinafter referred to as “peroxidase-like activity”). Examples of the peroxidase activity include horseradish peroxidase (HRP) activity. The catalytic nucleic acid molecule (D) can be referred to as a DNA enzyme or DNAzyme in the case of DNA as described later, and can be referred to as an RNA enzyme or RNAzyme in the case of RNA as described later.

  The catalytic nucleic acid molecule (D) is preferably a nucleic acid forming a G-quartet (or G-tetrad) structure, more preferably a guanine quadruplex (or G-quadruplex) structure. . The G-tetrad is, for example, a surface structure in which guanine is a tetramer, and the G-quadruplex is, for example, a structure in which a plurality of the G-tetradra are overlapped. The G-tetrad and the G-quadruplex are formed in a nucleic acid having a G-rich structural motif repeatedly, for example. Examples of the G-tetrad include a parallel type and an anti-parallel type, and a parallel type is preferable. In the nucleic acid element, the catalytic nucleic acid molecule (D) forms the G-tetrad by forming the stem in a state in which, for example, ATP or AMP is not bound to the binding nucleic acid element (A). Is inhibited, and binding of ATP or AMP to the binding nucleic acid molecule (A) results in release of the stem formation and formation of the G-tetrad.

  The catalytic nucleic acid molecule (D) is preferably a nucleic acid that can bind to porphyrin, and specifically, a nucleic acid that forms the G-tetrad and can bind to the porphyrin. It is known that the nucleic acid having G-tetrad causes a catalytic function of the oxidation-reduction reaction as described above, for example, by binding to the porphyrin to form a complex. In the nucleic acid element, the catalytic nucleic acid molecule (D) is bound to the porphyrin by forming the stem in a state where ATP or AMP is not bound to the binding nucleic acid molecule (A), for example. It is preferable that the stem formation is canceled by binding of ATP or AMP to the binding nucleic acid molecule (A) and binding to the porphyrin. Specifically, in the nucleic acid element, the catalytic nucleic acid molecule (D) is inhibited from forming the G-tetrad in a state where, for example, ATP or AMP is not bound to the binding nucleic acid molecule (A) and Thereby, the binding to the porphyrin is inhibited, and it is preferable that ATP or AMP binds to the binding nucleic acid molecule (A) to form the G-tetrad and bind to the porphyrin.

  The porphyrin is not particularly limited, and examples thereof include unsubstituted porphyrin and derivatives thereof. Examples of the derivatives include substituted porphyrins and metal porphyrins complexed with metal elements. Examples of the substituted porphyrin include N-methylmesoporphyrin. Examples of the metal porphyrin include hemin, which is a trivalent iron complex. The porphyrin is, for example, preferably the metal porphyrin, more preferably hemin.

  The catalyst nucleic acid molecule (D) is, for example, a single strand. The length of the catalyst nucleic acid molecule (D) is not particularly limited, and the lower limit is, for example, 11 bases, preferably 13 bases, more preferably 15 bases, and the upper limit is, for example, It is 60 bases long, preferably 36 bases long, more preferably 18 bases long.

Examples of the catalytic nucleic acid molecule (D) include DNAzymes disclosed in the following papers (1) to (4) as DNA having peroxidase activity.
(1) Travascio et al., Chem. Biol., 1998, vol.5, p.505-517
(2) Cheng et al., Biochimistry, 2009, vol.48, p.7817-7823
(3) Teller et al., Anal. Chem., 2009, vol.81, p.9114-9119
(4) Tao et al., Anal. Chem., 2009, vol.81, p.2144-2149

  Specific examples of the catalytic nucleic acid molecule (D) include those containing the following polynucleotide (d1), (d2), (d3) or (d4). The catalytic nucleic acid molecule (D) may be, for example, a molecule composed of the polynucleotide or a molecule containing the polynucleotide. The catalytic nucleic acid molecule (D) containing the polynucleotide (d1), (d2), (d3) or (d4) can also be referred to as, for example, a catalytic DNA molecule or DNAzyme.

(D1) A polynucleotide comprising any one of the nucleotide sequences of SEQ ID NOS: 11 to 31 and 66 to 85 (d2) In the nucleotide sequence of (d1), one or more bases are substituted, deleted, added and / or Or consisting of an inserted base sequence, and a polynucleotide (d3) that causes a catalytic function of the oxidation-reduction reaction (d3) consisting of a base sequence having 50% or more identity with the base sequence, and The polynucleotide (d4) that causes the catalytic function of the redox reaction, the base sequence complementary to the base sequence that hybridizes with the base sequence of the (d1) under stringent conditions, and the redox reaction Polynucleotides that cause the catalytic function of

EAD2 (SEQ ID NO: 11)
CTGGGAGGGAGGGAGGGA
c-Myc (SEQ ID NO: 12)
TGAGGGTGGGGAGGGTGGGGAA
m_c-Myc-0527 (SEQ ID NO: 13)
TGAGGGGAGGGAGGGCGGGGAA
m_c-Myc-0579 (SEQ ID NO: 14)
TGAGGGGTGGGAGGGAGGGGAA
m_c-Myc-0580 (SEQ ID NO: 15)
TGAGGGGTGGGAGGGACGGGAA
m_c-Myc-0583 (SEQ ID NO: 16)
TGAGGGGTGGGAGGGTGGGGAA
m_c-Myc-058 (SEQ ID NO: 17)
TGAG GGGTGGGAGGGTCGGG AA
neco0584 (SEQ ID NO: 18)
GGGTGGGAGGGTCGGG
m_c-Myc-0586 (SEQ ID NO: 19)
TGAGGGGTGGGAGGGGTGGGAA
m_c-Myc-0588 (SEQ ID NO: 20)
TGAGGGGTGGGAGGGGCGGGAA
m_c-Myc-0605 (SEQ ID NO: 21)
TGAGGGGTGGGTGGGCAGGGAA
m_c-Myc-0608 (SEQ ID NO: 22)
TGAGGGGTGGGTGGGCCGGGAA
m_c-Myc-0627 (SEQ ID NO: 23)
TGAGGGGTGGGCGGGAGGGGAA
m_c-Myc-0632 (SEQ ID NO: 24)
TGAGGGGTGGGCGGGTCGGGAA
m_c-Myc-0706 (SEQ ID NO: 25)
TGAGGGGCGGGAGGGATGGGAA
m_c-Myc-0711 (SEQ ID NO: 26)
TGAGGGGCGGGAGGGTGGGGAA
m_c-Myc-0712 (SEQ ID NO: 27)
TGAGGGGCGGGAGGGTCGGGAA
m_EAD2-0032 (SEQ ID NO: 28)
CTGGGTGGGCGGGCGGGA
m_c-Myc-0520 (SEQ ID NO: 29)
TGAGGGGAGGGAGGGTCGGGAA
m_c-Myc-0714 (SEQ ID NO: 30)
TGAGGGGCGGGAGGGGTGGGAA
m_TA-0420 (SEQ ID NO: 31)
GGGCGGGAGGGAGGG

SEQ ID NO: 66 GTGGGTCATTGTGGGTGGGTGTGG
SEQ ID NO: 67 GTGGGTAGGGCGGGTTGG
SEQ ID NO: 68 GGTTGGTGTGGTTGG
SEQ ID NO: 69 GGGGTTGGGGTGTGGGGTTGGGG
SEQ ID NO: 70 AGGGTTAGGGTTAGGGTTAGGG
SEQ ID NO: 71 GGGGTTTTGGGGTTTTGGGGTTTTGGGG
SEQ ID NO: 72 GGGCGCGGGAGGAAGGGGGCGGG
SEQ ID NO: 73 GTGGGTAGGGCGGTTGG
SEQ ID NO: 74 CGAGGTGGGTGGGTGGGA
SEQ ID NO: 75 CTGGGTGGGTGGGTGGGA
SEQ ID NO: 76 CTGGGAGGGAGGGAGGGA
SEQ ID NO: 77 CTGGGCGGGCGGGCGGGA
SEQ ID NO: 78 CTGGGTTGGGTTGGGTTGGGA
SEQ ID NO: 79 CTGGGGTGGGGTGGGGTGGGGA
SEQ ID NO: 80 GGGCGGGCCGGGGGCGGG
SEQ ID NO: 81 TGAGGGTGGGGAGGGTGGGGAA
SEQ ID NO: 82 CGGGCGGGCGCGAGGGAGGGG
SEQ ID NO: 83 GGGAGGGAGAGGGGGCGGG
SEQ ID NO: 84 GGGCGGGCGCGGGCGGG
SEQ ID NO: 85 GGGTAGGGCGGGTTGGG

  In (d2), “one or more” is not particularly limited as long as the polynucleotide of (d2) causes a catalytic function of the redox reaction. The number of the substituted bases is, for example, 1 to 5, preferably 1 to 4, more preferably 1 to 3, further preferably 1 or 2, in the base sequence (d1). Particularly preferred is one. The number of added or inserted bases is, for example, 1 to 5, preferably 1 to 4, more preferably 1 to 3, further preferably 1 or 2 in the base sequence (d1). One, particularly preferably one. The number of the deleted bases is, for example, 1 to 5, preferably 1 to 4, more preferably 1 to 3, further preferably 2 or 1 in the base sequence (d1). Particularly preferred is one.

  In (d3), the identity is, for example, 70% or more, preferably 80% or more, more preferably 90% or more, further preferably 95% or more, 96% or more with respect to the base sequence (d1). 97% or more, 98% or more, particularly preferably 99% or more. The identity can be calculated, for example, by calculating under default conditions using BLAST or the like.

  In the above (d4), “hybridizes under stringent conditions” is the same as described above.

  The catalyst nucleic acid molecule (D) is not limited to the examples of (d1) to (d4), for example, and may be a nucleic acid molecule that causes the catalyst function as described above.

  The catalytic nucleic acid molecule (D) is, for example, a molecule containing a nucleotide residue, and may be a molecule consisting only of a nucleotide residue or a molecule containing a nucleotide residue. The nucleotide is the same as described above. The catalytic nucleic acid molecule (D) may contain, for example, only one kind of ribonucleotide, deoxyribonucleotide and derivatives thereof, two kinds or more, or all of them. Specifically, the nucleic acid molecule may be, for example, DNA containing deoxyribonucleotide and / or a derivative thereof, RNA containing ribonucleotide and / or a derivative thereof, or a chimera (DNA / RNA containing the former and the latter )

  For the nucleotide, the examples in the binding nucleic acid molecule (A) can be used. The catalytic nucleic acid molecule (D) may contain non-nucleotides such as PNA (peptide nucleic acid) and LNA (Locked Nucleic Acid).

  In the present invention, examples of the nucleic acid element include (I), (II), (II ′) and (III) as described above. These three forms will be described below, but each form can incorporate the description unless otherwise indicated.

As described above, the nucleic acid element (I) is a double-stranded nucleic acid element composed of a first strand and a second strand. The second chain is also called a block chain. In the first strand (ss1), the binding nucleic acid molecule (A), the loop-forming sequence (L1) and the catalytic nucleic acid molecule (D) are linked in this order, and the second strand (ss2) is The stem forming sequence (S _A ), the loop forming sequence (L2) and the stem forming sequence (S _D ) are linked in this order. The terminal region on the loop forming sequence (L1) side of the binding nucleic acid molecule (A) in the first strand (ss1) and the stem forming sequence (S _A ) in the second strand (ss2) are complementary. Yes, the terminal region on the loop forming sequence (L1) side of the catalytic nucleic acid molecule (D) in the first strand (ss1) and the stem forming sequence (S _D ) in the second strand (ss2) are complementary. The loop forming sequence (L1) in the first strand (ss1) and the loop forming sequence (L2) in the second strand (ss2) are non-complementary. Then, in the absence of ATP or AMP, the catalytic function of the catalytic nucleic acid molecule (D) is inhibited by the respective stem formation in the stem forming sequence (S _A ) and the stem forming sequence (S _D ). The inhibition of the catalytic function occurs, for example, when the catalytic nucleic acid molecule is caged by this stem formation. That is, due to the formation of the stem, the catalytic nucleic acid molecule (D) cannot take the original structure that causes the catalytic function, thereby inhibiting the catalytic function. On the other hand, in the presence of ATP or AMP, due to the binding of the ATP or AMP and the binding nucleic acid molecule (A), the respective stem formation in the stem forming sequence (S _A ) and the stem forming sequence (S _D ) The catalytic function of the catalytic nucleic acid molecule (D) is generated. The occurrence of the catalytic function occurs, for example, when stem formation is released and cage formation of the catalytic nucleic acid molecule is released. In other words, the catalytic function is generated by releasing the formation of the stem so that the catalytic nucleic acid molecule (D) has an original structure that generates the catalytic function. Note that the present invention is not limited to these mechanisms.

Thus, in the nucleic acid element (I), in the absence of ATP or AMP, the catalytic function of the catalytic nucleic acid molecule (D) is inhibited by the stem formation (switch OFF), and ATP or AMP is present. In this case, the formation of the stem is released, and the catalytic function of the catalytic nucleic acid molecule (D) is generated (switch ON). Specifically, the nucleic acid element (I) includes, for example, a terminal region on the loop-forming sequence (L1) side of the binding nucleic acid molecule (A) in the first strand (ss1) in the absence of ATP or AMP. , The stem-forming sequence (S _A ) in the second strand (ss2) forms a stem, and the end of the catalytic nucleic acid molecule (D) on the loop-forming sequence (L1) side in the first strand (ss1) The region and the stem-forming sequence (S _D ) in the second strand (ss2) form a stem, and the loop-forming sequence (L1) and the loop-forming sequence (L2) are the two stems An internal loop is formed between them. In the present invention, “complementary” means, for example, that two regions to be aligned may be completely complementary, or may be complementary to the extent that a stem can be formed (hereinafter the same). In the present invention, “non-complementary” means, for example, that the two regions to be aligned may be completely non-complementary or non-complementary to the extent that an internal loop can be formed. (The same applies hereinafter).

  The state of the nucleic acid element (I) in the absence of the ATP or AMP is shown in the schematic diagram of FIG. 1A and 1B show a form in which the directions of the first chain (ss1) and the second chain (ss2) are opposite to each other. In FIG. 1, an arrow indicates a direction from the 5 'side to the 3' side (hereinafter the same).

In FIG. 1, the upper strand is the first strand (ss1), A is the binding nucleic acid molecule (A), L1 is the loop-forming sequence (L1), and D is the catalytic nucleic acid molecule (D ), The lower strand is the second strand (ss2), S _A is the stem-forming sequence (S _A ), L2 is the loop-forming sequence (L2), and S _D is the stem The forming sequence (S _D ) is indicated. As shown in FIG. 1, in the absence of ATP or AMP, a stem is formed at two locations between the first strand (ss1) and the second strand (ss2), and an internal space is formed between the stems. A loop is formed. Specifically, a stem is formed between the terminal region of the binding nucleic acid molecule (A) on the loop-forming sequence (L1) side and the stem-forming sequence (S _A ), and the catalytic nucleic acid molecule (D) A stem is formed between the terminal region on the loop-forming sequence (L1) side and the stem-forming sequence (S _D ), and between the loop-forming sequence (L1) and the loop-forming sequence (L2). An internal loop is formed. When ATP or AMP is present, the two stem formations are released by binding of ATP or AMP to the binding nucleic acid molecule (A), thereby causing catalytic activity of the catalytic nucleic acid molecule (D). Is done.

In the nucleic acid element (I), the direction of each component is not particularly limited. As shown in FIG. 1 (A), the first strand (ss1) includes, for example, the binding nucleic acid molecule (A), the loop-forming sequence (L1), and the catalytic nucleic acid molecule (D) from the 5 ′ side. The second strand (ss2) is linked in this order, and the stem-forming sequence (S _A ), the loop-forming sequence (L2) and the stem-forming sequence (S _D ) are arranged in this order from the 3 ′ side. It is preferable to connect with. In this case, the 3 ′ terminal region of the binding nucleic acid molecule (A) in the first strand (ss1) and the stem-forming sequence (S _A ) in the second strand (ss2) are complementary, The 5 ′ terminal region of the catalytic nucleic acid molecule (D) in the first strand (ss1) and the stem-forming sequence (S _D ) in the second strand (ss2) are preferably complementary. As shown in FIG. 1B, the first strand (ss1) is, for example, from the 3 ′ side, the binding nucleic acid molecule (A), the loop-forming sequence (L1) and the catalytic nucleic acid molecule (D ) Are linked in this order, and the second strand (ss2), from the 5 ′ side, the stem-forming sequence (S _A ), the loop-forming sequence (L2) and the stem-forming sequence (S _D ) You may connect in this order. In this case, the 5 ′ end region of the binding nucleic acid molecule (A) in the first strand (ss1) and the stem-forming sequence (S _A ) in the second strand (ss2) are complementary, It is preferable that the 3 ′ terminal region of the catalytic nucleic acid molecule (D) in the first strand (ss1) and the stem-forming sequence (S _D ) in the second strand (ss2) are complementary. The nucleic acid element (I) is presumed to be able to detect excellent sensitivity by forming an internal loop in this way, but the present invention is not limited to this assumption.

  In the nucleic acid element (I), the length of the inner loop is not particularly limited. The loop forming sequence (L1) in the first strand (ss1) and the loop forming sequence (L2) in the second strand (ss2) are each, for example, 0 to 30 bases long, preferably 1 to It is 30 bases long, More preferably, it is 1-15 bases long, More preferably, it is 1-6 bases long. In addition, the lengths of the loop forming sequence (L1) and the loop forming sequence (L2) may be the same or different, for example. In the latter case, the difference in length is not particularly limited, and is, for example, 1 to 10 bases, preferably 1 or 2 bases, more preferably 1 base. The nucleic acid element (I) may have only one of the loop forming sequence (L1) and the loop forming sequence (L2). The nucleic acid element (I) is presumed to be able to detect excellent sensitivity by forming an internal loop in this way, but the present invention is not limited to this assumption.

In the nucleic acid element (I), the length of each stem is not particularly limited. The length of the stem can be adjusted by, for example, the length of the stem-forming sequence (S _A ) and the stem-forming sequence (S _D ) in the second strand (ss2). The stem-forming sequence (S _A ) has a length of, for example, 0 to 60 bases, preferably 0 to 10 bases, and more preferably 1 to 6 bases. The length of the stem-forming sequence (S _D ) is, for example, 0 to 30 bases and 1 to 30 bases, preferably 0 to 10 bases and 1 to 10 bases, and more Preferably, it is 1 to 6 bases in length.

  In the nucleic acid element (I), the lengths of the first strand (ss1) and the second strand (ss2) are not particularly limited. The length of the first strand (ss1) is, for example, 40 to 200 bases, preferably 42 to 100 bases, and more preferably 45 to 60 bases. The length of the second strand (ss2) is, for example, 4 to 120 bases, preferably 5 to 25 bases, and more preferably 10 to 15 bases.

Specific examples of the nucleic acid element (I) are shown below, but the present invention is not limited thereto. First, the first strand (ss1) is exemplified below. In the following sequences, the underlined portion on the 5 ′ side is the AMP aptamer of SEQ ID NO: 1 (A in FIG. 1), poly dT is the loop-forming sequence (L1 in FIG. 1), and the underlined portion on the 3 ′ side is SEQ ID NO: 18 (neco0584) DNAzyme (D in FIG. 1).
AMP.neco.D0.A0 (SEQ ID NO: 2)
5'- CCTGGGGGAGTATTGCGGAGGAAGG TTTTTTTT GGGTGGGAGGGTCGGG -3 '

Next, the second chain (ss2) with respect to the first chain (ss1) is exemplified below. In the following sequence, the underlined portion on the 5 ′ side is the stem forming sequence ( _{SD in} FIG. 1) complementary to the 5 ′ side region of the DNAzyme of the first strand (ss1), and poly dT is the loop formation This is a sequence (L2 in FIG. 1), and the underlined portion on the 3 ′ side is the stem-forming sequence (S _{A in} FIG. 1) complementary to the 3 ′ side region of the AMP aptamer of the first strand (ss1).
AMP.neco.D5.A5 (SEQ ID NO: 3)
5'- CACCC TTTTTTTT CCTTC -3 '
AMP.neco.D5.A6 (SEQ ID NO: 4)
5'- CACCC TTTTTTTT CCTTCC -3 '
AMP.neco.D5.A7 (SEQ ID NO: 5)
5'- CACCC TTTTTTTT CCTTCCT -3 '
AMP.neco.D5.A8 (SEQ ID NO: 6)
5'- CACCC TTTTTTTT CCTTCCTC -3 '
AMP.neco.D6.A5 (SEQ ID NO: 7)
5'- CCACCC TTTTTTTT CCTTC -3 '
AMP.neco.D6.A6 (SEQ ID NO: 8)
5'- CCACCC TTTTTTTT CCTTCC -3 '
AMP.neco.D6.A7 (SEQ ID NO: 9)
5'- CCACCC TTTTTTTT CCTTCCT -3 '
AMP.neco.D6.A8 (SEQ ID NO: 10)
5'- CCACCC TTTTTTTT CCTTCCTC -3 '
AMP.neco.D7.A5 (SEQ ID NO: 32)
5'- CCCACCC TTTTTTTT CCTTC -3 '
AMP.neco.D7.A6 (SEQ ID NO: 33)
5'- CCCACCC TTTTTTTT CCTTCC -3 '
AMP.neco.D7.A7 (SEQ ID NO: 34)
5'- CCCACCC TTTTTTTT CCTTCCT -3 '
AMP.neco.D7.A8 (SEQ ID NO: 35)
5'- CCCACCC TTTTTTTT CCTTCCTC -3 '
AMP.neco.D8.A5 (SEQ ID NO: 36)
5'- TCCCACCC TTTTTTTT CCTTC -3 '
AMP.neco.D8.A6 (SEQ ID NO: 37)
5'- TCCCACCC TTTTTTTT CCTTCC -3 '
AMP.neco.D8.A7 (SEQ ID NO: 38)
5'- TCCCACCC TTTTTTTT CCTTCCT -3 '
AMP.neco.D8.A8 (SEQ ID NO: 39)
5'- TCCCACCC TTTTTTTT CCTTCCTC -3 '

Next, as described above, the nucleic acid element (II) is a single-stranded nucleic acid element, and the binding nucleic acid molecule (A), the loop forming sequence (L1), the stem forming sequence (S _D ), the catalyst The nucleic acid molecule (D), the loop forming sequence (L2) and the stem forming sequence (S _A ) are linked in this order. The terminal region on the loop forming sequence (L1) side of the binding nucleic acid molecule (A) and the stem forming sequence (S _A ) are complementary, and the loop forming sequence (L2) of the catalytic nucleic acid molecule (D) The terminal region on the side and the stem forming sequence (S _D ) are complementary, and the loop forming sequence (L1) and the loop forming sequence (L2) are non-complementary.

Then, the nucleic acid element (II) can form the catalytic nucleic acid molecule (D) by forming each stem in the stem-forming sequence (S _A ) and the stem-forming sequence (S _D ) in the absence of ATP or AMP. The catalytic function of is inhibited. The inhibition of the catalytic function occurs, for example, when the catalytic nucleic acid molecule is caged by such self-association stem formation. That is, due to the formation of the stem, the catalytic nucleic acid molecule (D) cannot take a structure that causes a catalytic function, thereby inhibiting the catalytic function. On the other hand, in the presence of ATP or AMP, due to the binding of the ATP or AMP and the binding nucleic acid molecule (A), the respective stem formation in the stem forming sequence (S _A ) and the stem forming sequence (S _D ) The catalytic function of the catalytic nucleic acid molecule (D) is generated. The occurrence of the catalytic function occurs, for example, when the stem formation due to self-association is released and the catalytic nucleic acid molecule is released from the cage. In other words, the catalytic function is generated by releasing the formation of the stem so that the catalytic nucleic acid molecule (D) has an original structure that generates the catalytic function. Note that the present invention is not limited to these mechanisms.

In the nucleic acid element (II), similarly to the nucleic acid element (I), when ATP or AMP is absent, the catalytic function of the catalytic nucleic acid molecule (D) is inhibited by the stem formation (switch OFF), When ATP or AMP is present, the stem formation is released and the catalytic function of the catalytic nucleic acid molecule (D) is generated (switch ON). Said nucleic acid element (II), specifically, for example, the absence of ATP or AMP, a distal region of the loop-forming sequence (L1) side of the combined nucleic acid molecule (A), the stem forming sequence (S _A ) Form a stem, the terminal region on the loop forming sequence (L2) side of the catalytic nucleic acid molecule (D) and the stem forming sequence (S _D ) form a stem, and the loop forming sequence (S L1) and the loop forming sequence (L2) form an internal loop between the two stems.

  The state of the nucleic acid element (II) in the absence of the ATP or AMP is shown in the schematic diagram of FIG. 2A and 2B show a form in which the directions are opposite to each other.

In FIG. 2, A is the binding nucleic acid molecule (A), L1 is the loop-forming sequence (L1), _SD is the stem-forming sequence (S _D ), D is the catalytic nucleic acid molecule (D), L2 represents the loop forming sequence (L2), and S _A represents the stem forming sequence (S _A ). As shown in FIG. 2, in the absence of ATP or AMP, a self-annealing of the nucleic acid element (II) forms stems at two locations, and an internal loop is formed between the stems. Specifically, a stem is formed between the terminal region of the binding nucleic acid molecule (A) on the loop-forming sequence (L1) side and the stem-forming sequence (S _A ), and the catalytic nucleic acid molecule (D) A stem is formed between the terminal region on the loop-forming sequence (L1) side and the stem-forming sequence (S _D ), and between the loop-forming sequence (L1) and the loop-forming sequence (L2). An internal loop is formed. When ATP or AMP is present, the two stem formations are released by binding of ATP or AMP to the binding nucleic acid molecule (A), thereby causing catalytic activity of the catalytic nucleic acid molecule (D). Is done.

In the nucleic acid element (II), the direction of each component is not particularly limited. As shown in FIG. 2 (B), the nucleic acid element (II) is, for example, from the 3 ′ side, the binding nucleic acid molecule (A), the loop-forming sequence (L1), the stem-forming sequence (S _D ), The catalytic nucleic acid molecule (D), the loop forming sequence (L2) and the stem forming sequence (S _A ) are preferably linked in this order. In this case, the 5 ′ end region of the binding nucleic acid molecule (A) and the stem-forming sequence (S _A ) are complementary, and the 5 ′ end region of the catalytic nucleic acid molecule (D) and the stem formation The sequence (S _D ) is preferably complementary. As shown in FIG. 2A, the nucleic acid element (II) has, for example, the binding nucleic acid molecule (A), the loop-forming sequence (L1), and the stem-forming sequence ( _SD ) from the 5 ′ side. ), The catalytic nucleic acid molecule (D), the loop forming sequence (L2) and the stem forming sequence (S _A ) may be linked in this order. In this case, the 3 ′ end region of the binding nucleic acid molecule (A) and the stem-forming sequence (S _A ) are complementary, and the 3 ′ end region of the catalytic nucleic acid molecule (D) and the stem formation The sequence (S _D ) is preferably complementary.

  In the nucleic acid element (II), the length of the inner loop is not particularly limited. The loop forming sequence (L1) and the loop forming sequence (L2) are each, for example, 0 to 30 bases long, preferably 1 to 30 bases long, more preferably 1 to 15 bases long. Yes, more preferably 1 to 6 bases in length. In addition, the lengths of the loop forming sequence (L1) and the loop forming sequence (L2) may be the same or different, for example. In the latter case, the difference in length is not particularly limited, and is, for example, 1 to 10 bases, preferably 1 or 2 bases, more preferably 1 base. The nucleic acid element (II) may have only one of the loop forming sequence (L1) and the loop forming sequence (L2). The nucleic acid element (II) is presumed to be able to detect excellent sensitivity by forming an internal loop in this way, but the present invention is not limited to this assumption.

In the nucleic acid element (II), the length of each stem is not particularly limited. The length of the stem can be adjusted by, for example, the length of the stem forming sequence (S _A ) and the stem forming sequence (S _D ). The stem-forming sequence (S _A ) has a length of, for example, 0 to 60 bases and 1 to 60 bases, preferably 1 to 10 bases, and more preferably 1 to 7 bases. The length of the stem-forming sequence (S _D ) is, for example, 0 to 30 bases or 1 to 30 bases, preferably 0 to 10 bases or 1 to 10 bases, more preferably 0 It is -7 base length and 1-7 base length.

  The length of the nucleic acid element (II) is not particularly limited. The length of the nucleic acid element (II) is, for example, 40 to 120 bases, preferably 45 to 100 bases, and more preferably 50 to 80 bases.

Specific examples of the nucleic acid element (II) are shown below, but the present invention is not limited thereto. In the following sequence, from 5 ′ side to 3 ′ side, the lower case sequence is the stem formation sequence (S _A ), the upper case poly dT is the loop formation sequence (L2), and the underlined portion on the 5 ′ side is The DNAzyme (D) of SEQ ID NO: 11 (EAD2), the lower case sequence is the stem forming sequence (S _D ), the upper case poly dT is the loop forming sequence (L1), and the underlined portion on the 3 ′ side is SEQ ID NO: 1. AMP aptamer (A).

AMP.D3.A2 (SEQ ID NO: 40)
5'-ggTTT CTGGGAGGGAGGGAGGGA cagTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.D3.A3 (SEQ ID NO: 41)
5'-aggTTT CTGGGAGGGAGGGAGGGA cagTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.D3.A4 (SEQ ID NO: 42)
5'-caggTTT CTGGGAGGGAGGGAGGGA cagTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.D3.A5 (SEQ ID NO: 43)
5'-ccaggTTT CTGGGAGGGAGGGAGGGA cagTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.D4.A2 (SEQ ID NO: 44)
5'-ggTTT CTGGGAGGGAGGGAGGGA ccagTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.D4.A3 (SEQ ID NO: 45)
5'-aggTTT CTGGGAGGGAGGGAGGGA ccagTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.D4.A4 (SEQ ID NO: 46)
5'-caggTTT CTGGGAGGGAGGGAGGGA ccagTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.D4.A5 (SEQ ID NO: 47)
5'-ccaggTTT CTGGGAGGGAGGGAGGGA ccagTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.D5.A2 (SEQ ID NO: 48)
5'-ggTTT CTGGGAGGGAGGGAGGGA cccagTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.D5.A3 (SEQ ID NO: 49)
5'-aggTTT CTGGGAGGGAGGGAGGGA cccagTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.D5.A4 (SEQ ID NO: 50)
5'-caggTTT CTGGGAGGGAGGGAGGGA cccagTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.D5.A5 (SEQ ID NO: 51)
5'-ccaggTTT CTGGGAGGGAGGGAGGGA cccagTTT CTGGGGGGAGTATTGCGGAGGAAGG -3 '

In the following sequence, from 5 ′ side to 3 ′ side, the lower case sequence is the stem formation sequence (S _A ), the upper case poly dT is the loop formation sequence (L2), and the 5 ′ side underline is the sequence DNAzyme (D) of No. 18 (neco0584), the lower case sequence is the stem forming sequence (S _D ), the upper case poly dT is the loop forming sequence (L1), and the underlined portion on the 3 ′ side is the SEQ ID No. 1. AMP aptamer (A).

AMP.neco.D3.A2 (SEQ ID NO: 52)
5'-ggTTT GGGTGGGAGGGTCGGG cccTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.neco.D3.A3 (SEQ ID NO: 53)
5'-aggTTT GGGTGGGAGGGTCGGG cccTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.neco.D3.A4 (SEQ ID NO: 54)
5'-caggTTT GGGTGGGAGGGTCGGG cccTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.neco.D3.A5 (SEQ ID NO: 55)
5'-ccaggTTT GGGTGGGAGGGTCGGG cccTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.neco.D4.A2 (SEQ ID NO: 56)
5'-ggTTT GGGTGGGAGGGTCGGG acccTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.neco.D4.A3 (SEQ ID NO: 57)
5'-aggTTT GGGTGGGAGGGTCGGG acccTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.neco.D4.A4 (SEQ ID NO: 58)
5'-caggTTT GGGTGGGAGGGTCGGG acccTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.neco.D4.A5 (SEQ ID NO: 59)
5'-ccaggTTT GGGTGGGAGGGTCGGG acccTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.neco.D5.A2 (SEQ ID NO: 60)
5'-ggTTT GGGTGGGAGGGTCGGG cacccTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.neco.D5.A3 (SEQ ID NO: 61)
5'-aggTTT GGGTGGGAGGGTCGGG cacccTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.neco.D5.A4 (SEQ ID NO: 62)
5'-caggTTT GGGTGGGAGGGTCGGG cacccTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.neco.D5.A5 (SEQ ID NO: 63)
5'-ccaggTTT GGGTGGGAGGGTCGGG cacccTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.neco.D6.A2 (SEQ ID NO: 64)
5'-ggTTT GGGTGGGAGGGTCGGG ccacccTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '

Next, the nucleic acid element (II ′) is different from the nucleic acid element (II) in the binding nucleic acid molecule (A), the catalytic nucleic acid molecule (D), the stem-forming sequence (S _A ), and the stem formation. The sequence (S _D ), the loop-forming sequence (L1), and the loop-forming sequence (L2) are single-stranded nucleic acid elements in a positional relationship in which they are interchanged. The nucleic acid element (II ′) can be referred to the description of the nucleic acid element (II) unless otherwise specified.

As described above, the nucleic acid element (II ′) includes the catalytic nucleic acid molecule (D), the loop forming sequence (L2), the stem forming sequence (S _A ), the binding nucleic acid molecule (A), and the loop forming sequence (L1). ) And stem-forming sequence (S _D ) are linked in this order. The terminal region on the loop forming sequence (L2) side of the catalytic nucleic acid molecule (D) and the stem forming sequence (S _D ) are complementary, and the loop forming sequence (L1) of the binding nucleic acid molecule (A) The terminal region on the side and the stem-forming sequence (S _A ) are complementary.

The nucleic acid element (II ′) can form the catalytic nucleic acid molecule (D) by forming each stem in the stem-forming sequence (S _A ) and the stem-forming sequence (S _D ) in the absence of ATP or AMP. ) Is inhibited. The inhibition of the catalytic function occurs, for example, when the catalytic nucleic acid molecule is caged by such self-association stem formation. That is, due to the formation of the stem, the catalytic nucleic acid molecule (D) cannot take the original structure that causes the catalytic function, thereby inhibiting the catalytic function. On the other hand, in the presence of ATP or AMP, due to the binding of the ATP or AMP and the binding nucleic acid molecule (A), the respective stem formation in the stem forming sequence (S _A ) and the stem forming sequence (S _D ) The catalytic function of the catalytic nucleic acid molecule (D) is generated. The occurrence of the catalytic function occurs, for example, when the stem formation due to self-association is released and the catalytic nucleic acid molecule is released from the cage. In other words, the catalytic function is generated by releasing the formation of the stem so that the catalytic nucleic acid molecule (D) has an original structure that generates the catalytic function. Note that the present invention is not limited to these mechanisms.

In the nucleic acid element (II ′), as in the case of the nucleic acid element (II), when ATP or AMP is absent, the catalytic function of the catalytic nucleic acid molecule (D) is inhibited by the stem formation (switch OFF). In the presence of ATP or AMP, the stem formation is canceled and the catalytic function of the catalytic nucleic acid molecule (D) is caused (switch ON). Specifically, the nucleic acid element (II ′) specifically includes, for example, a terminal region on the loop-forming sequence (L1) side of the binding nucleic acid molecule (A) in the absence of ATP or AMP, and the stem-forming sequence (S _A ) forms a stem, the terminal region on the loop forming sequence (L2) side of the catalytic nucleic acid molecule (D) and the stem forming sequence (S _D ) form a stem, and the loop forming sequence (L1) and the loop forming sequence (L2) form an internal loop between the two stems.

  The state of the nucleic acid element (II ') in the absence of the ATP or AMP is shown in the schematic diagram of FIG. 3A and 3B show a form in which the directions are opposite to each other.

In FIG. 3, A is the binding nucleic acid molecule (A), L1 is the loop forming sequence (L1), D is the catalytic nucleic acid molecule (D), L2 is the loop forming sequence (L2), S _A Indicates the stem-forming sequence (S _A ), and _SD indicates the stem-forming sequence (S _D ). As shown in FIG. 3, in the absence of ATP or AMP, a self-annealing of the nucleic acid element (II ′) forms stems at two locations, and an internal loop is formed between the stems. Specifically, a stem is formed between the terminal region of the binding nucleic acid molecule (A) on the loop-forming sequence (L1) side and the stem-forming sequence (S _A ), and the catalytic nucleic acid molecule (D) A stem is formed between the terminal region on the loop-forming sequence (L2) side and the stem-forming sequence (S _D ), and between the loop-forming sequence (L1) and the loop-forming sequence (L2). An internal loop is formed. When ATP or AMP is present, the two stem formations are released by binding of ATP or AMP to the binding nucleic acid molecule (A), thereby causing catalytic activity of the catalytic nucleic acid molecule (D). Is done.

In the nucleic acid element (II ′), the direction of each component is not particularly limited. As shown in FIG. 3 (B), the nucleic acid element (II ′) is, for example, from the 3 ′ side, the catalytic nucleic acid molecule (D), the loop forming sequence (L2), and the stem forming sequence (S _A ). The binding nucleic acid molecule (A), the loop forming sequence (L1), and the stem forming sequence (S _D ) are preferably linked in this order. In this case, the 5 ′ end region of the binding nucleic acid molecule (A) and the stem-forming sequence (S _A ) are complementary, and the 5 ′ end region of the catalytic nucleic acid molecule (D) and the stem formation The sequence (S _D ) is preferably complementary. Further, as shown in FIG. 3A, the nucleic acid element (II ′) has, for example, the catalytic nucleic acid molecule (D), the loop forming sequence (L2), and the stem forming sequence (S _A ), the binding nucleic acid molecule (A), the loop forming sequence (L1), and the stem forming sequence (S _D ) may be linked in this order. In this case, the 3 ′ end region of the binding nucleic acid molecule (A) and the stem-forming sequence (S _A ) are complementary, and the 3 ′ end region of the catalytic nucleic acid molecule (D) and the stem formation The sequence (S _D ) is preferably complementary.

  Next, as described above, the nucleic acid element (III) is a single-stranded nucleic acid element, and the catalytic nucleic acid molecule (D), the intervening sequence (I), and the binding nucleic acid molecule (A) Linked in order, the intervening sequence (I) is non-complementary to the catalytic nucleic acid molecule (D) and the binding nucleic acid molecule (A). In the absence of ATP or AMP, the catalytic function of the catalytic nucleic acid molecule (D) is inhibited. On the other hand, in the presence of ATP or AMP, the catalytic function of the catalytic nucleic acid molecule (D) occurs.

  The nucleic acid element (III), like the nucleic acid elements (I), (II) and (II ′), inhibits the catalytic function of the catalytic nucleic acid molecule (D) when ATP or AMP is absent ( In the presence of ATP or AMP, the catalytic function of the catalytic nucleic acid molecule (D) is generated (switch ON).

  The state of the nucleic acid element (III) in the absence of the ATP or AMP is shown in the schematic diagram of FIG. In FIG. 4, A indicates the binding nucleic acid molecule (A), I indicates the intervening sequence (I), and D indicates the catalytic nucleic acid molecule (D). 4A and 4B show a form in which the directions are opposite to each other.

  Regarding the nucleic acid element (III), the catalytic function of the catalytic nucleic acid molecule (D) is inhibited in the absence of ATP or AMP, and the catalytic function of the catalytic nucleic acid molecule (D) is inhibited in the presence of ATP or AMP. For example, the following reasons are presumed. The present invention is not limited to these assumptions. In the nucleic acid element (III), in the absence of ATP or AMP, a part of the catalytic nucleic acid molecule (D) and a part of the binding nucleic acid molecule (A) interact, and the catalytic nucleic acid molecule (D) Is presumed to form a non-G quartet structure. When ATP or AMP is present, the main form of the nucleic acid element (III) is tilted to the original structure of the binding nucleic acid element (A), that is, a three-dimensional structure that binds to ATP or AMP, and the overall structural change occurs. As a result, it is considered that the catalytic nucleic acid molecule (D) forms a G quartet structure, and its catalytic function occurs.

  In the nucleic acid element (III), the direction of each component is not particularly limited. As shown in FIG. 4 (A), the nucleic acid element (III) includes, for example, the catalytic nucleic acid molecule (D), the intervening sequence (I) and the binding nucleic acid molecule (A) from the 5 ′ side. It is preferable to connect in order. As shown in FIG. 4B, the nucleic acid element (III) includes, for example, the catalytic nucleic acid molecule (D), the intervening sequence (I), and the binding nucleic acid molecule (A) from the 3 ′ side. These may be connected in this order.

  In the nucleic acid element (III), the length of the intervening sequence (I) is not particularly limited. The length of the intervening sequence (I) is, for example, 0 to 30 bases or 1 to 30 bases, preferably 0 to 25 bases or 1 to 25 bases, more preferably It is 0-20 base length and 1-20 base length, More preferably, it is 0-10 base length, 1-10 base length, Most preferably, it is 0-8 base length, 1-8 base length.

  The length of the nucleic acid element (III) is not particularly limited. The length of the nucleic acid element (III) is, for example, 30 to 120 bases, preferably 35 to 80 bases, and more preferably 40 to 60 bases.

Specific examples of the nucleic acid element (III) are shown below, but the present invention is not limited thereto. In the following AMP.neco.D0.A0, the underlined portion on the 5 ′ side is the DNAzyme of SEQ ID NO: 18 (neco0584) (D in FIG. 4), and the underlined portion on the 3 ′ side is the ATP or AMP of SEQ ID NO: 1. It is an aptamer (A in FIG. 4), and poly dT between them is an intervening sequence (I in FIG. 4).
AMP.neco.D0.A0 (SEQ ID NO: 65)
5'- GGGTGGGAGGGTCGGG TTTTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '

  In the nucleic acid elements (I), (II), (II ') and (III), each region may be, for example, either directly linked or indirectly linked. In the case of the direct connection, for example, each region is connected by a phosphodiester bond. Moreover, in the case of the said indirect connection, each area | region connects through an intervening linker, for example. Examples of the intervening linker include nucleic acid molecules composed of nucleotides and / or non-nucleotides as described above. The intervening linker is preferably, for example, a single chain.

  The nucleic acid sensor of the present invention may be, for example, a sensor composed only of the nucleic acid element, or may be a sensor including other components. The nucleic acid sensor of the present invention can also be referred to as a device for detecting SA, for example. Examples of the other component include a base material on which the nucleic acid element is disposed. Examples of the base material include substrates such as substrates, beads, and tubes. Other examples of the other component include a linker. The linker can be used, for example, for linking the nucleic acid element and the base material when the nucleic acid element is immobilized on the base material. For the arrangement of the nucleic acid sensor on the substrate, for example, the analytical device of the present invention described later can be referred to.

  In the nucleic acid element, the connection site with the linker is not particularly limited, and for example, any end of the nucleic acid element is preferable. The double-stranded nucleic acid element (I) includes, for example, either end of the first strand (ss1) having the binding nucleic acid molecule (A) and the catalytic nucleic acid molecule (D), and / or the first strand. Either end of the two strands (ss2) is preferred. The single-stranded nucleic acid elements (II), (II ′) and (III) are preferably at either end, for example. In this case, the linker is also referred to as a terminal linker. Examples of the linker include nucleic acid molecules composed of nucleotides and / or non-nucleotides as described above. The terminal linker is preferably a single chain, for example.

  In the nucleic acid sensor of the present invention, for example, the nucleic acid element may be used in a free state, or may be used in a state where the nucleic acid element is immobilized. In the latter case, for example, it can be immobilized on the substrate and used as a device.

  The method for using the nucleic acid sensor of the present invention is not particularly limited, and can be used for the ATP or AMP analysis method of the present invention as follows.

  As described above, the analysis method of the present invention is an ATP or AMP analysis method, wherein the nucleic acid sensor of the present invention is contacted with a sample containing ATP or AMP, and the catalytic nucleic acid in the nucleic acid sensor. The method includes a detection step of detecting ATP or AMP in the sample by detecting the catalytic function of the molecule (D).

  The sample is not particularly limited. The sample may be, for example, a sample containing ATP or AMP, or a sample in which it is unknown whether or not it contains ATP or AMP. The sample is preferably a liquid sample, for example.

  When the nucleic acid element is used in a free state as the nucleic acid sensor of the present invention, it is preferable that the nucleic acid element and the sample are brought into contact with each other in a container such as a tube. When the nucleic acid element of the present invention is used in a state where the nucleic acid element is disposed on the base material, for example, the sample can be brought into contact with the nucleic acid element on the base material.

  In the detection step, for example, it is preferable to detect a signal generated by the catalytic function of the catalytic nucleic acid molecule (D). Examples of the signal include an optical signal and an electrochemical signal. Examples of the optical signal include a color development signal, a luminescence signal, and a fluorescence signal.

  The signal is preferably generated from a substrate by, for example, the catalytic function of the catalytic nucleic acid molecule (D). Therefore, the detection step is preferably performed, for example, in the presence of a substrate corresponding to the catalytic function of the catalytic nucleic acid molecule (D).

  The substrate is, for example, a substrate that generates a colored, luminescent, or fluorescent product by the catalytic function, a colored, luminescent, or fluorescent substrate, and a generation in which the colored, luminescent, or fluorescent light is lost by the catalytic function. Examples of the substrate that generates a product, and a substrate that generates a product of different color, luminescence, or fluorescence depending on the catalytic function. According to such a substrate, the catalytic function can be detected by visually confirming, for example, the presence or absence of color development, luminescence or fluorescence, or the change or intensity of color development, luminescence or fluorescence as a signal. In addition, for example, the catalytic function can be detected by measuring the absorbance, reflectance, fluorescence intensity, and the like as signals using an optical technique. Examples of the catalytic function include the catalytic function of the oxidation-reduction reaction as described above.

  In addition, when the catalytic nucleic acid molecule (D) has a catalytic function for the oxidation-reduction reaction, for example, a substrate capable of transferring electrons can be mentioned. In this case, for example, a product is generated from the substrate by the catalytic nucleic acid molecule (D), and electrons are transferred in the process. This electron transfer can be detected electrochemically as an electrical signal by application to an electrode, for example. The electric signal can be detected by measuring the intensity of the electric signal such as an electric current.

  The substrate is not particularly limited, and for example, hydrogen peroxide, 3,3 ′, 5,5′-tetramethylbenzidine (TMB), 1,2-phenylenediamine (OPD), 2,2′-Azinobis (3-ethylbenzothiazole- 6-sulfonic Acid Ammonium Salt (ABTS), 3,3′-Diaminobenzodinine (DAB), 3,3′-Diaminobenzoidine Tetrahhydrochloridate Hydrate (DAB4HCl), 3-Amino-9-EC, Amino-9-EC (4C1N), 2,4,6-Tribromo-3-hydroxybenzoic Ac d, 2,4-Dichlorophenol, 4-Aminoantipyrine, 4-Aminoantipyrine Hydrochloride, luminol and the like.

  In the detection step, the substrate may be supplied to the nucleic acid sensor in advance, for example, before contacting the sample with the nucleic acid sensor, or at the same time as contacting the sample or after contacting the sample. The nucleic acid sensor may be supplied. The substrate is preferably supplied to the nucleic acid sensor, for example, as a substrate solution mixed with a liquid. The liquid for mixing the substrate is preferably a buffer such as Tris-HCl. The concentration of the substrate in the substrate solution is not particularly limited, and is, for example, 0.1 to 5 mmol / L, preferably 0.5 to 2 mmol / L. Moreover, pH of the said substrate liquid is 6-9, for example, Preferably it is 6.8-9.

  In the detection step, the reaction conditions for the catalyst nucleic acid molecule (D) are not particularly limited. The temperature is, for example, 15 to 37 ° C., and the time is, for example, 10 to 900 seconds.

  Further, in the detection step, for example, porphyrin may coexist in addition to the substrate. Some known DNAzymes exhibit higher redox activity by forming a complex with porphyrin, for example. Therefore, in the present invention, for example, redox activity may be detected as a complex of the catalytic nucleic acid molecule (D) and porphyrin in the presence of porphyrin. The supply of porferin is not particularly limited and can be performed in the same manner as the substrate.

  The porphyrin is not particularly limited, and examples thereof include unsubstituted porphyrin and derivatives thereof. Examples of the derivatives include substituted porphyrins and metal porphyrins complexed with metal elements. Examples of the substituted porphyrin include N-methylmesoporphyrin. Examples of the metal porphyrin include hemin, which is a trivalent iron complex. The porphyrin is, for example, preferably the metal porphyrin, more preferably hemin.

  According to the nucleic acid sensor of the present invention, ATP or AMP can be detected as described above. In addition, according to the nucleic acid sensor of the present invention, for example, as described above, the microorganisms remaining on the target can detect dirt such as food residues indirectly from the detection of ATP or AMP.

(Analytical device and analytical method using the same)
The analysis device of the present invention is an ATP or AMP analysis device, and includes a base material, a nucleic acid sensor, and a detection unit, and the nucleic acid sensor and the detection unit are disposed on the base material, In the nucleic acid sensor of the present invention, the detection unit is a detection unit that detects a catalytic function of the catalytic nucleic acid molecule (D) in the nucleic acid sensor.

  The analytical device of the present invention is characterized by using the nucleic acid sensor of the present invention, and the other configurations are not limited at all. Unless specifically described, the analysis device of the present invention can use, for example, the description of the nucleic acid sensor of the present invention.

  In the analytical device of the present invention, the arrangement method of the nucleic acid sensor is not particularly limited. For example, the nucleic acid element in the nucleic acid sensor may or may not be immobilized on the base material. Also good. In the former case, the nucleic acid element may be directly fixed or indirectly fixed to the base material, for example. Examples of the immobilization include linking by chemical bonding. Examples of the indirect immobilization include a form in which the nucleic acid element is immobilized on the base material via a linker. Examples of the linker include the terminal linkers described above. Regarding the arrangement of the nucleic acid element, for example, the description of the nucleic acid sensor of the present invention can be cited.

  For the immobilization of the nucleic acid element, for example, a known nucleic acid immobilization method can be adopted. Examples of the method include a method using photolithography, and specific examples thereof can be referred to US Pat. No. 5,424,186. Examples of the immobilization method include a method of synthesizing the nucleic acid element on the base material. As this method, for example, a so-called spot method can be mentioned, and as specific examples, US Pat. No. 5,807,522, JP-T-10-503841 and the like can be referred to.

  The arrangement site | part of the said nucleic acid element in the said base material is not restrict | limited in particular, For example, the form arrange | positioned at the said detection part is mention | raise | lifted.

  The analysis device of the present invention may further have a reagent part, for example. For example, the reagent unit may be disposed in the detection unit. For example, a reagent may be arranged in advance in the reagent unit, or the reagent may be supplied at the time of use. Examples of the reagent include the aforementioned substrate and the porphyrin.

  In the analytical device of the present invention, as described above, the detection unit is a detection unit that detects the catalytic function of the catalytic nucleic acid molecule (D). The detection unit is preferably a detection unit that detects a signal generated by the catalytic function of the catalytic nucleic acid molecule (D) as the catalytic function of the catalytic nucleic acid molecule (D). Examples of the signal include a signal from a substrate due to the catalytic function of the catalytic nucleic acid molecule (D), as described above. Examples of the signal include an optical signal and an electrochemical signal as described above.

  When the signal is an optical signal, the detection unit is, for example, an optical signal detection unit, and examples include a detection unit such as absorbance, reflectance, and fluorescence intensity.

  When the signal is the electrochemical signal, the detection unit includes, for example, an electrode system. In this case, the said detection part can be formed by arrange | positioning the said electrode system on the surface of the said base material, for example. The arrangement method of the electrodes is not particularly limited, and for example, a known method can be adopted. Specific examples include thin film forming methods such as vapor deposition, sputtering, screen printing, and plating. For example, the electrode may be disposed directly or indirectly on the substrate. An indirect arrangement includes, for example, an arrangement through another member.

  The electrode system may include, for example, a working electrode and a counter electrode, or may include a working electrode, a counter electrode, and a reference electrode. The material of the electrode is not particularly limited, and examples thereof include platinum, silver, gold, and carbon. Examples of the working electrode and the counter electrode include a platinum electrode, a silver electrode, a gold electrode, and a carbon electrode, and examples of the reference electrode include a silver / silver chloride electrode. The silver / silver chloride electrode can be formed, for example, by laminating a silver chloride electrode on a silver electrode.

  When the analytical device of the present invention has the electrode system, the nucleic acid element is preferably disposed in the electrode system, for example, and is preferably disposed in the working electrode among the electrodes. When the analytical device of the present invention includes the electrode system and the reagent part, for example, the reagent part is preferably disposed on the electrode system.

  The analysis device of the present invention may include, for example, a plurality of detection units. In this case, for example, it is preferable that the analytical device fractionates the surface of the base material into a matrix, and includes a detection unit as described above in each fractionation region. In the analysis device of the present invention, the number of nucleic acid sensors arranged in one detection unit is not particularly limited.

  The base material is not particularly limited. The substrate is preferably a substrate having an insulating surface, for example. The substrate may be, for example, a substrate made of an insulating material, or a substrate having an insulating layer made of an insulating material on the surface. The insulating material is not particularly limited, and examples thereof include known materials such as glass, ceramic, insulating plastic, and paper. The insulating plastic is not particularly limited, and examples thereof include silicone resin, polyimide resin, epoxy resin, and fluorine resin.

  As described above, the analysis method of the present invention is an ATP or AMP analysis method, in which the sample is brought into contact with the analysis device of the present invention, and in the detection unit of the analysis device, the catalyst It includes a detection step of detecting ATP or AMP in the sample by detecting the catalytic function of the nucleic acid molecule (D).

  The analysis method of the present invention is characterized in that the analysis device including the nucleic acid sensor of the present invention is used, and other conditions are not limited at all. For the analysis method of the present invention, for example, the description of the analysis method in the nucleic acid sensor of the present invention can be cited.

(Analytical reagent)
The analytical reagent of the present invention includes the analytical nucleic acid sensor of the present invention. The analytical reagent of the present invention is characterized by including the nucleic acid sensor, and other configurations are not limited at all.

  The analytical reagent of the present invention may include, for example, components such as the substrate, the porferrin, the buffer solution, and / or the substrate in addition to the nucleic acid sensor.

  The analytical reagent of the present invention may be, for example, an analytical kit. In this case, for example, the nucleic acid sensor and the other components described above may be included and separately accommodated. The analysis kit may further include instructions for use, for example.

Example 1 A single-stranded nucleic acid element (II) provided with an AMP aptamer as a binding nucleic acid molecule (A) and EAD2 as a catalytic nucleic acid molecule (D) was prepared, and the performance as a nucleic acid sensor was confirmed.

As the nucleic acid element, DNA having the following sequence was synthesized (see FIG. 2). From the 5 ′ side to the 3 ′ side in the sequence, the lower case sequence is the stem formation sequence (S _A ), the upper case poly dT is the loop formation sequence (L2), and the 5 ′ side The underlined portion is EAD2 (D) of SEQ ID NO: 11, the lower case sequence is the stem forming sequence (S _D ), the upper case poly dT is the loop forming sequence (L1), and the 3 ′ side The underlined part is the AMP aptamer (A) of SEQ ID NO: 1.

AMP.D4.A4 (SEQ ID NO: 46)
5'-caggTTT CTGGGAGGGAGGGAGGGA ccagTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.D4.A5 (SEQ ID NO: 47)
5'-ccaggTTT CTGGGAGGGAGGGAGGGA ccagTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.D5.A4 (SEQ ID NO: 50)
5'-caggTTT CTGGGAGGGAGGGAGGGA cccagTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '

  In an Eppendorf tube, 100 μL of a reaction solution having the following composition was prepared and reacted at 25 ° C. for 60 seconds, and then the absorbance of the reaction solution was measured (wavelength 415 nm). The measurement used the light absorbency measuring apparatus (Brand name TECAN infinite, TECAN company). In the reaction solution, the composition of the DNAzyme buffer was 50 mmol / L Tris-HCl (pH 7.4), 20 mmol / L KCl, 0.05% Triton X-100. ABTS (2,2′-Azinobis (3-ethylbenzothiazoline-6-sulfonic acid ammonium salt) was used as a substrate.

At the same time, as a negative control, the reaction was similarly performed for the reaction solution (NC) excluding the nucleic acid sensor. In addition, as a positive control, the reaction was similarly performed for a reaction solution (PC) using EAD2 of SEQ ID NO: 11 instead of the nucleic acid sensor.
EAD2 (SEQ ID NO: 11) CTGGGAGGGAGGGAGGGA

  These results are shown in FIG. FIG. 5 is a graph showing the absorbance of the reaction solution. As shown in FIG. 5, as a result of using the nucleic acid sensor of Example, the absorbance of the reaction solution containing 1 mmol / L of AMP showed a significant difference from the absorbance of the reaction solution without addition of AMP. From this result, according to the nucleic acid sensor of the example, it can be said that the presence and concentration of AMP can be measured by measuring absorbance, and specifically, it can be detected even with 1 mmol / L AMP.

(Example 2)
The nucleic acid element AMP. D4. A5 (SEQ ID NO: 47) was used as a nucleic acid sensor, and measurement was performed while changing the AMP concentration.

  The above procedure was carried out except that the AMP concentration in the reaction solution was a predetermined concentration (0 μmol / L, 50 μmol / L, 500 μmol / L, 1 mmol / L, 2.5 mmol / L, 5 mmol / L) and the reaction time was 170 seconds. The reaction was carried out in the same manner as in Example 1, and the absorbance was measured. Negative control (NC) and positive control (PC) were the same as in Example 1 except for the AMP concentration.

  These results are shown in FIG. FIG. 6 is a graph showing the absorbance of the reaction solution. NC, AMP. D4. In A5 and PC, each of the five bars shows, from the left, the results of AMP concentrations of 0 μmol / L, 50 μmol / L, 500 μmol / L, 1 mmol / L, 2.5 mmol / L, and 5 mmol / L. As shown in FIG. 6, in the negative control (NC) using only EAD2, which is DNAzyme, no increase in absorbance depending on the concentration of AMP was confirmed. On the other hand, when the nucleic acid sensor of the example was used, an increase in absorbance was confirmed depending on the AMP concentration. From this result, it can be said that according to the nucleic acid sensor of the example, the concentration of AMP can be measured by absorbance measurement.

Example 3 A single-stranded nucleic acid element (II) having an AMP aptamer as a binding nucleic acid molecule (A) and neco0584 as a catalytic nucleic acid molecule (D) was prepared, and the performance as a nucleic acid sensor was confirmed.

As the nucleic acid element, DNA having the following sequence was synthesized (see FIG. 2). From the 5 ′ side to the 3 ′ side in the sequence, the lower case sequence is the stem formation sequence (S _A ), the upper case poly dT is the loop formation sequence (L2), and the 5 ′ side The underlined portion is neco0584 (D) of SEQ ID NO: 18, the lowercase sequence is the stem forming sequence (S _D ), the uppercase poly dT is the loop forming sequence (L1), and the 3 ′ side The underlined portion is ATP or AMP aptamer (A) of SEQ ID NO: 1.

AMP.neco.D3.A3 (SEQ ID NO: 53)
5'-aggTTT GGGTGGGAGGGTCGGG cccTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.neco.D3.A4 (SEQ ID NO: 54)
5'-caggTTT GGGTGGGAGGGTCGGG cccTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.neco.D3.A5 (SEQ ID NO: 55)
5'-ccaggTTT GGGTGGGAGGGTCGGG cccTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '
AMP.neco.D5.A5 (SEQ ID NO: 63)
5'-ccaggTTT GGGTGGGAGGGTCGGG cacccTTT CCTGGGGGAGTATTGCGGAGGAAGG -3 '

Except that the nucleic acid sensor was used, the reaction was carried out in the same manner as in the above Example, and the absorbance was measured. At the same time, as a negative control, the reaction was similarly performed for the reaction solution (NC) excluding the nucleic acid sensor. Further, as a positive control, a reaction was similarly performed with respect to a reaction solution (PC) using neco0548 of SEQ ID NO: 18 instead of the nucleic acid sensor.
neco0584 (SEQ ID NO: 18) GGGTGGGAGGGTCGGG

  These results are shown in FIG. FIG. 7 is a graph showing the absorbance of the reaction solution. As shown in FIG. 7, as a result of using the nucleic acid sensor of the example, the absorbance of the reaction solution containing 1 mmol / L of AMP showed a significant difference from the absorbance of the reaction solution to which AMP was not added. From this result, according to the nucleic acid sensor of the example, it can be said that the presence and concentration of AMP can be measured by measuring absorbance, and specifically, it can be detected even with 1 mmol / L AMP.

(Example 4) A double-stranded nucleic acid element (I) comprising ATP or AMP aptamer as a binding nucleic acid molecule (A) and DNAzyme as a catalytic nucleic acid molecule (D) was prepared, and its performance as a nucleic acid sensor was confirmed. .

As the first strand nucleic acid (ss1), DNA having the following sequence was synthesized (see FIG. 1). In the following sequence, the underlined portion on the 5 ′ side is the AMP aptamer (A) of SEQ ID NO: 1, poly dT is the loop-forming sequence (L1), and the underlined portion on the 3 ′ side is the DNAzyme of SEQ ID NO: 18 (neco0584). (D).
AMP.neco.D0.A0 (SEQ ID NO: 2)
5'- CCTGGGGGAGTATTGCGGAGGAAGG TTTTTTTT GGGTGGGAGGGTCGGG -3 '

Next, DNA having the following sequence was synthesized as the second strand (ss2) with respect to the first strand (ss1) (see FIG. 1). In the following sequence, the underlined portion on the 5 ′ side is the stem forming sequence ( _{SD in} FIG. 1) complementary to the 5 ′ side region of the DNAzyme of the first strand (ss1), and poly dT is the loop formation The stem formation sequence (S _{A in} FIG. 1) is the sequence (L2 in FIG. 1), and the underlined portion on the 3 ′ side is complementary to the 3 ′ side region of the AMP aptamer of the first strand (ss1).
AMP.neco.D7.A8 (SEQ ID NO: 35)
5'- CTCCTTCC TTTTTTTT CCCACCC -3 '

  In an Eppendorf tube, 100 μL of a reaction solution having the following composition was prepared and reacted at 25 ° C. for 60 seconds, and then the absorbance of the reaction solution was measured (wavelength 415 nm). The measurement used the light absorbency measuring apparatus (Brand name TECAN infinite, TECAN company). In the reaction solution, the composition of the DNAzyme buffer was 50 mmol / L Tris-HCl (pH 7.4), 20 mmol / L KCl, 150 mmol / L NaCl, 0.05% Triton X-100. ABTS was used as the substrate.

At the same time, as a positive control, a reaction was similarly performed for a reaction solution (PC) using DNAzyme of SEQ ID NO: 18 (neco0584) instead of the nucleic acid sensor. In addition, as a negative control, the reaction was similarly performed for the reaction solution (NC) excluding the nucleic acid sensor.
neco0584 (SEQ ID NO: 18) GGGTGGGAGGGTCGGG

  These results are shown in FIG. FIG. 8 is a graph showing the absorbance of the reaction solution. As shown in FIG. 8, as a result of using the nucleic acid sensor of the example, the absorbance of the reaction solution containing 1 mmol / L of AMP showed a significant difference from the absorbance of the reaction solution to which AMP was not added. From this result, it can be said that according to the nucleic acid sensor of the example, the presence and concentration of AMP can be measured by measuring absorbance, and specifically, it can be detected even with 1 μmol / L AMP.

  While the present invention has been described with reference to the embodiments, the present invention is not limited to the above embodiments. Various changes that can be understood by those skilled in the art can be made to the configuration and details of the present invention within the scope of the present invention.

  While the present invention has been described with reference to the embodiments, the present invention is not limited to the above embodiments. Various changes that can be understood by those skilled in the art can be made to the configuration and details of the present invention within the scope of the present invention.

  According to the present invention, ON / OFF of the catalytic function of the catalytic nucleic acid molecule (D) can be switched depending on whether the binding nucleic acid molecule (A) is bound to ATP or AMP, and the sensitivity is excellent. . For this reason, the presence or amount of ATP or AMP can be easily detected by detecting the catalytic function of the catalytic nucleic acid molecule. Moreover, since the analysis device of the present invention uses the nucleic acid sensor as described above, for example, the device can be reduced in size and chipped, and a simple analysis can be performed even for a large number of samples. . For this reason, the present invention can be said to be an extremely useful technique for research and examination in various fields such as clinical medicine, food, and environment.

Claims (18)

Comprising the nucleic acid element of the following (II) or (II ′) having a catalytic nucleic acid molecule (D) that causes a catalytic function and a binding nucleic acid molecule (A) that binds to ATP or AMP,
The nucleic acid sensor for analysis of ATP or AMP, wherein the catalytic nucleic acid molecule (D) comprises the following polynucleotide (d1), (d2) or (d3).
(II) a single-stranded nucleic acid element,
The binding nucleic acid molecule (A), the loop forming sequence (L1), the stem forming sequence (S _D ), the catalytic nucleic acid molecule (D), the loop forming sequence (L2), and the stem forming sequence (S _A ) in this order. Consolidated
The terminal region on the loop forming sequence (L1) side of the binding nucleic acid molecule (A) and the stem forming sequence (S _A ) are complementary,
The terminal region on the loop forming sequence (L2) side of the catalytic nucleic acid molecule (D) and the stem forming sequence (S _D ) are complementary,
The loop forming sequence (L1) and the loop forming sequence (L2) are non-complementary,
In the absence of ATP or AMP, the respective stem formation in the stem-forming sequence (S _A ) and the stem-forming sequence (S _D ) inhibits the catalytic function of the catalytic nucleic acid molecule (D),
In the presence of ATP or AMP, binding of the ATP or AMP and the binding nucleic acid molecule (A) releases the respective stem formation in the stem-forming sequence (S _A ) and the stem-forming sequence (S _D ). , The catalytic function of the catalytic nucleic acid molecule (D) occurs,
In the absence of ATP or AMP,
A terminal region on the loop-forming sequence (L1) side of the binding nucleic acid molecule (A) and the stem-forming sequence (S _A ) form a stem,
The terminal region on the loop-forming sequence (L2) side of the catalytic nucleic acid molecule (D) and the stem-forming sequence (S _D ) form a stem,
The loop forming sequence (L1) and the loop forming sequence (L2) are nucleic acid elements (II ′) that form an internal loop between the two stems, and are single-stranded nucleic acid elements,
The catalytic nucleic acid molecule (D), the loop forming sequence (L2), the stem forming sequence (S _A ), the binding nucleic acid molecule (A), the loop forming sequence (L1) and the stem forming sequence (S _D ) are in this order. Consolidated
The terminal region on the loop forming sequence (L2) side of the catalytic nucleic acid molecule (D) and the stem forming sequence (S _D ) are complementary,
The terminal region on the loop forming sequence (L1) side of the binding nucleic acid molecule (A) and the stem forming sequence (S _A ) are complementary,
The loop forming sequence (L1) and the loop forming sequence (L2) are non-complementary,
In the absence of ATP or AMP, the respective stem formation in the stem-forming sequence (S _A ) and the stem-forming sequence (S _D ) inhibits the catalytic function of the catalytic nucleic acid molecule (D),
In the presence of ATP or AMP, binding of the ATP or AMP and the binding nucleic acid molecule (A) releases the respective stem formation in the stem-forming sequence (S _A ) and the stem-forming sequence (S _D ). , The catalytic function of the catalytic nucleic acid molecule (D) occurs,
In the absence of ATP or AMP,
A terminal region on the loop-forming sequence (L1) side of the binding nucleic acid molecule (A) and the stem-forming sequence (S _A ) form a stem,
The terminal region on the loop-forming sequence (L2) side of the catalytic nucleic acid molecule (D) and the stem-forming sequence (S _D ) form a stem,
Nucleic acid element in which the loop forming sequence (L1) and the loop forming sequence (L2) form an internal loop between the two stems

(D1) a polynucleotide comprising any one of the nucleotide sequences of SEQ ID NOs: 13 to 31, 66, and 68 to 84 (d2) in any one of the nucleotide sequences of SEQ ID NOs: 13 to 31, 66, 68 to 72, and 74 to 84 A polynucleotide (d3) SEQ ID NO: 13-31, 66 consisting of a base sequence in which one or two bases are substituted, deleted, added and / or inserted, and which causes a catalytic function of a redox reaction, A polynucleotide comprising a nucleotide sequence having 90% or more identity with any of the nucleotide sequences 68 to 72 and 74 to 84, and causing a catalytic function of redox reaction In the nucleic acid element (II),
From 3 ′ side, the binding nucleic acid molecule (A), the loop forming sequence (L1), the stem forming sequence (S _D ), the catalytic nucleic acid molecule (D), the loop forming sequence (L2), and the stem forming sequence. (S _A ) are linked in this order,
The 5 ′ end region of the binding nucleic acid molecule (A) and the stem-forming sequence (S _A ) are complementary;
The nucleic acid sensor according to claim 1, wherein the 5 'terminal region of the catalytic nucleic acid molecule (D) and the stem-forming sequence (S _D ) are complementary. The nucleic acid sensor according to claim 1 or 2, wherein each of the loop forming sequence (L1) and the loop forming sequence (L2) has a length of 3 to 30 bases. The nucleic acid according to any one of claims 1 to 3, wherein the stem-forming sequence (S _A ) has a length of 2 to 60 bases, and the stem-forming sequence (S _D ) has a length of 3 to 30 bases. Sensor. The nucleic acid sensor according to any one of claims 1 to 4, wherein the binding nucleic acid molecule (A) has a length of 18 to 60 bases. The nucleic acid sensor according to any one of claims 1 to 5, wherein the binding nucleic acid molecule (A) comprises the following polynucleotide (a1), (a2) or (a3 ) .
(A1) a polynucleotide comprising the base sequence of SEQ ID NO: 1 (a2) consisting of a base sequence in which one or more bases are substituted, deleted, added and / or inserted in the base sequence of (a1), and identity with the nucleotide sequence of the polynucleotide (a3) said that bind to ATP or AMP (a1) is 90% or more of the nucleotide sequences, and, capable of binding to the ATP or AMP polynucleotide The nucleic acid sensor according to any one of claims 1 to 6, wherein the catalytic function of the catalytic nucleic acid molecule (D) is a catalytic function of a redox reaction. The nucleic acid sensor according to any one of claims 1 to 7, wherein the catalytic nucleic acid molecule (D) has a length of 15 to 30 bases. Including a base material, a nucleic acid sensor and a detection unit,
The nucleic acid sensor and the detection unit are disposed on the base material,
The nucleic acid sensor is the nucleic acid sensor according to any one of claims 1 to 8,
The ATP or AMP analysis device, wherein the detection unit is a detection unit that detects a catalytic function of the catalytic nucleic acid molecule (D) in the nucleic acid sensor. The analytical device according to claim 9, wherein the nucleic acid sensor is connected to the substrate via a linker. The analysis device according to claim 9 or 10, wherein the nucleic acid sensor is disposed in the detection unit. The analytical device according to any one of claims 9 to 11, wherein the detection unit is a detection unit that detects a signal generated by a catalytic function of the catalytic nucleic acid molecule (D). 13. The analytical device according to claim 12, wherein the signal is an optical signal or an electrochemical signal. Furthermore, it has a reagent part,
The analytical device according to any one of claims 9 to 13, wherein the reagent part includes a substrate for the catalytic function of the catalytic nucleic acid molecule (D). A contact step of bringing a sample into contact with the nucleic acid sensor for analysis of ATP or AMP according to any one of claims 1 to 8, and
A method for analyzing ATP or AMP, comprising the step of detecting ATP or AMP in the sample by detecting the catalytic function of the catalytic nucleic acid molecule (D) in the nucleic acid sensor. The analysis method according to claim 15, wherein the detection step is performed in the presence of a substrate for the catalytic function of the catalytic nucleic acid molecule (D). A contact step of bringing a sample into contact with the analytical device according to any one of claims 9 to 14, and
An analysis of ATP or AMP comprising a detection step of detecting ATP or AMP in the sample by detecting the catalytic function of the catalytic nucleic acid molecule (D) in the detection unit of the analytical device. Method. The analysis method according to claim 17, wherein the detection step is performed in the presence of a substrate for the catalytic function of the catalytic nucleic acid molecule (D).

Images