JP6403372B2 - Tocotrienol production method and plant therefor - Google Patents

Description

  The present invention relates to the field of substance production using plants. More specifically, the present invention relates to the technical field of production of tocotrienol using plant cells.

  Tocotrienol (hereinafter sometimes abbreviated as “T3”) is a vitamin E analog together with tocopherol (hereinafter sometimes abbreviated as “Toc”). Both are structurally similar and the only structural difference is whether the side chain of the chroman ring is a phytyl side chain or an isoprenoid side chain.

  Both are grouped as vitamin E, but T3 is 50-60 times more antioxidant than Toc and is sometimes called super vitamin E. Recently, it has become clear that there is a big difference in functionality between the two. The inventors' group has already discovered for the first time in the world that T3 has a potent anti-angiogenic action, a unique physiological function not found in Toc. (Patent Documents 1 and 2).

  The only organisms that produce vitamin E are plants, algae, and cyanobacteria. Since Toc and T3 are similar in molecular structure, when trying to purify only T3, Toc with similar physical properties is likely to be mixed as a contaminant, and it is not easy to separate them.

  Currently, T3 with a purity of about 60% (the remaining main contaminant is Toc) is sold as oryzatocotrienol, but high-purity T3 with a purity close to 100% is not commercially available.

  Beninoki is the only plant that produces only T3 without producing Toc. There are four types of isomers, α, β, γ, and δ, in T3, but T3 contained in cypress is γ and δ.

  In cyanobacteria, there is a report that non-patent document 1 detects α-form T3 by sil1091 gene recombination, but in this non-patent document 1, T3 is detected by HPLC. The substance generated by recombination has not been sufficiently verified to be T3. In the first place, since there is no homogentisic acid geranylgeranyltransferase (HGGT gene), which is a gene that originally produces T3, cyanobacteria, even if T3 is produced, it is likely to remain in a very small amount, It is far from industrial use.

Patent No. 4447198 US Patent No. US6, 608, 103, B2

Biochemica et Biophysica Acta, 1076, 195-203

  The present invention includes an efficient production method of tocotrienol (T3), a plant that produces tocotrienol and does not substantially produce tocopherol, and a method for producing the plant.

  Furthermore, the present invention includes a gene expression suppression method (RNAi method) using RNAi technology for producing a plant body such as callus that produces tocotrienol and does not substantially produce tocopherol, an RNA expression construct therefor, and the expression construct The plant modification method used is also included. More specifically, an RNAi method for producing a plant body such as a callus that produces α-form tocotrienol and does not substantially produce tocopherol, an RNA expression construct therefor, and a plant modification method using the expression construct are also included. .

  The present invention also includes a method for producing tocotrienol substantially free of tocopherol.

  Furthermore, the present invention includes a novel geranylgeranyl reductase gene (GGR gene) and a method for suppressing its expression.

  In the test of the anticancer effect and cholesterol lowering effect of T3, it is known that the function decreases when Toc is mixed. Therefore, it is desired to supply high-purity T3 free of Toc, but T3 containing no Toc is currently not commercially available. If a large amount of high-purity T3 can be supplied, it is expected that functional research of T3 will further advance, and the results can be expected to be applied to pharmaceuticals. Moreover, when using as a pharmaceutical, a high purity pharmaceutical active substance is required.

  It is an object of the present invention to provide a method for supplying a large amount of such high-purity T3, a plant or cell or callus used therefor, a method for producing the plant or callus, and the like.

  Inventors of the present application in a plant that naturally produces T3 and Toc, by substantially destroying T3 without destroying the geranylgeranyl reductase gene of the plant or inhibiting or suppressing the expression of the gene, It has been found that plants or cells or callus that produce only can be produced.

  Furthermore, the inventors of the present invention discovered for the first time that there are two types of genes having geranylgeranyl reductase activity in rice, and destroyed both geranylgeranyl reductase 1 and geranylgeranyl reductase 2 genes, or Rice callus that produces T3 substantially free of Toc is obtained by inhibiting or suppressing expression, or disrupting one of the two GGR genes and inhibiting or suppressing expression of the other gene. I found out.

  Therefore, in the present invention, in a plant that naturally produces T3 and Toc, by making the geranylgeranyl reductase gene of the plant not substantially function, a plant that does not substantially contain Toc and produces only T3 A method of producing a cell or plant is included. Specifically, in the present invention, in a plant that naturally produces T3 and Toc, (a) by destroying the geranylgeranyl reductase gene of the plant, (a) inhibiting or suppressing the expression of the gene Or (c) a method of producing a plant cell or callus or plant that produces only T3, substantially free of Toc, by combining disruption of the same gene and suppression or inhibition of expression of the same gene Is included.

  More specifically, when there are a plurality of endogenous geranylgeranyl reductases in the plant, for all the geranylgeranyl reductase genes, Toc is suppressed in the plant by destroying the gene or inhibiting or suppressing the expression of the gene. A plant cell or callus or a method for producing a plant that is substantially free of T3 and produces only T3 is included.

  More specifically, in the present invention, in rice, the geranylgeranyl reductase 1 and geranylgeranyl reductase 2 genes are disrupted, or the expression of the geranylgeranyl reductase 1 and geranylgeranyl reductase 2 genes is inhibited or suppressed. Includes a method of producing plant cells or callus or plants that produce only T3, substantially free of Toc, by combining the disruption of one of the two genes and the suppression or inhibition of the expression of the other gene. To do.

  Further, the present invention includes inhibiting or suppressing the expression of the geranylgeranyl reductase gene, RNA silencing method, gene expression suppression method using RNAi technology, antisense RNA method, ribozyme method, method using artificial nucleic acid, A plant cell or callus that produces only T3, substantially free of Toc, which is formed by one method selected from the transposon method, the mutation method using ethylmethanesulfonic acid, the ZFN method, and the TALEN method, or a combination thereof. Includes a method of producing a plant.

  The method of the present application makes it possible to efficiently produce vitamin E containing T3 substantially free of Toc, which has been difficult in the past.

  In addition, the present invention efficiently provides an α-form T3 that is substantially different from Toc and has a property different from that of the T3 product derived from cypress.

  According to the present invention, substantially free of Toc, specifically, with respect to T3, Toc is 10% or less, preferably 5% or less, more preferably 1% or less, and even more preferably. Can provide T3 containing, for example, 0.64% or less, 0.1% or less, or 0.01% or less.

Biosynthetic pathway of vitamin E The synthetic pathway of tocotrienol and tocopherol in plants is shown. Regarding the GGR-deficient mutant strain (Nipponbare Tos 17 mutant strain) due to transposon, when the expression of GGR2 was confirmed, it was confirmed that the GGR2 gene was expressed. The photograph of the leaves of the seedlings of GGR-deficient rice (Nipponbare Tos 17 mutant strain) and V.E quantification results by transposon are shown together with the results of the seedlings in which the GGR gene functions (left figure). A photograph of GGR-deficient callus (derived from Nipponbare Tos 17 mutant strain) and V.E quantification results with transposon are shown together with the results of WT-derived callus (right figure). Shown is a photograph of callus grown by transformation of callus from Nipponbare Tos 17 mutant line NE1041 strain. The Toc and T3 content in callus when GGR2 expression is suppressed by the RNAi method for WT-derived callus are shown. The Toc and T3 content in callus when callus derived from Nipponbare Tos 17 mutant line NE1041 strain, which is a GGR1-deficient strain, is suppressed by the RNAi method using GGR2 expression. About the callus derived from WT, Toc and T3 content in callus are shown. Furthermore, when both the WT-derived callus and the callus derived from the Nipponbare Tos 17 mutant line NE1041 strain, which is a GGR1-deficient strain, suppress the expression of GGR2 by the RNAi method, HPLC-MS / MS was used to measure the Toc content in the callus. Data is shown.

1. Introduction Angiogenesis is a phenomenon in which blood vessels are newly formed at sites where blood vessels did not exist so far, and occurs in many diseases. Typical examples include cancer and diabetes, which have a very large number of affected individuals. In cancer, angiogenesis is an essential phenomenon for the growth of cancer cells because when the tumor grows, if the blood vessels that draw nutrients into the tumor mass do not become new, the cells inside it become necrotic. It is. If angiogenesis can be suppressed, tumor growth can be suppressed. In animal studies, many groups have confirmed that T3 exerts a strong anti-angiogenic effect and suppresses cancer growth.

  Diabetes is the second most common cause of blindness in Japan, with a high probability of diabetic retinopathy, which causes symptoms of blood vessels in the retina of the eye. There are two types of diabetes: pancreatic β-cell inactive type and type II (insulin resistant or insulin secreting type). 20 years after onset, 100% of type 1 and 60 of type 2 Retinopathy develops in% of patients. Therefore, development of a drug having an effect of suppressing angiogenesis in the retina is also expected.

  In addition to cancer and diabetic retinopathy, diseases with a very large number of diseases (aged macular disease, rheumatoid arthritis, chronic bronchitis, psoriasis, etc., 50 types of diseases) are angiogenesis-dependent diseases As confirmed. In these diseases, T3 is expected to exert an antiangiogenic effect in the future.

2. About the general synthetic pathway of vitamin E:
2-1. Overview of vitamin E biosynthesis (Figure 1)
Farnesyl diphosphate (FPP) is synthesized by the mevalonate pathway or the non-mevalonate pathway.

  Farnesyl diphosphate (FPP) is in equilibrium with farnesol, and geranylgeranyl diphosphate (GGPP) is synthesized from farnesyl diphosphate (FPP).

  (I) Geranylgeranyl diphosphate (GGPP) is combined with homogentisic acid (HGA) by the action of homogentisic acid geranylgeranyltransferase (HGGT) to produce T3. In addition, (b) phytylyl diphosphate (PPP) is synthesized from geranylgeranyl diphosphate (GGPP) by geranylgeranyl reductase (GGR) or without chlorophyll, and from phytyl diphosphate by VTE2. Troferol (Toc) is produced.

2-2. Production of farnesyl diphosphate (FPP) by mevalonate pathway or non-mevalonate pathway Fungi (such as yeast), plants and animals have a mevalonate pathway. In this pathway, acetyl CoA is the first precursor. Acetoacetyl-CoA is produced from acetyl-CoA, further hydroxymethylglutaryl-CoA is produced by HMGCoA synthase, and mevalonic acid is produced by HMG CoA reductase. From mevalonate, 5-phosphomevanronate and ADP are produced by mevalonate kinase, and further, 5-diphosphomevanronate is produced by phosphomevanronate kinase. Phosphomevanronate decarboxylase produces isopentenyl diphosphate, and isomerase produces dimethylallyl diphosphate. Geranyl diphosphate is produced from dimethylallyl diphosphate and IPP, and FPP is produced by FPP synthase.

  On the other hand, there are non-mevalonic acid pathways in bacteria and higher plants. Starting from pyruvic acid and glyceraldehyde 3-phosphate [Lois et al., Proc. Natl. Acad. Sci. USA, 95, 2105-2110 (1998); Rohmer et al., J. Am. Chem. Soc. 118, 2564-256 (12) Special Table 2002-5193976 (1996); Arigoni, et al., Proc. Natl. Acad. Sci. USA, 94, 10600-10605 (1997); Lange et al., Proc Natl. Acad. Sci. USA, 95, 2100-2104 (1998)].

  Plants have both mevalonate and non-mevalonate pathways, the former being shown to be in the cytoplasm and the latter in the plastids [Arigoni, et al., Proc. Natl. Acad. Sci. USA , 94, 10600-10605 (1997); Lange et al., Proc. Natl. Acad. Sci. USA, 95, 2100-2104 (1998)]. Multiple stages of the non-mevalonate pathway have been identified. The first step is catalyzed by D-1-deoxyxylulose 5-phosphate synthase to produce D-1 deoxyxylulose 5-phosphate from pyruvate and glyceraldehyde 3-phosphate. The second and third stages are catalyzed by D-1-deoxyxylulose 5-phosphate reductoisomerase and the 2-C-methyl D erythritol-4-P of D-1 deoxyxylulose 5-phosphate ( Conversion to MEP) is catalyzed. Then, dimethylaryl diphosphate is produced from MEP by isomerase. Subsequently, geranyl diphosphate is produced from dimethylallyl diphosphate and IPP, and FPP is produced by FPP synthase, as in the mevalonate pathway [Lois et al., Proc. Natl. Acad. Sci. USA, 95, 2105 -2110 (1998); Takahashi et al., Proc. Natl. Acad. Sci. USA, 95, 2100-2104 (1998); Duvold etal. Tetrahedron Letters, 38, 4769-4772 (1997)].

  Farnesyl diphosphate (FPP) is in equilibrium with farnesol, and geranylgeranyl diphosphate (GGPP) is synthesized from farnesyl diphosphate (FPP).

2-3. Tocotrienol
Tocotrienol is generated from geranylgeranyl diphosphate (GGPP) and homogentisic acid (HGA) by homogentisic acid geranylgeranyltransferase (HGGT). HGGT is present in palm, barley, wheat, rice, corn, sorghum and the like, but not in soybean, rapeseed, sunflower, sesame and the like. Therefore, at present, the plant species in which tocotrienol is present is limited.

2-4. Tocopherol
As described above, there are two routes for Toc synthesis, one that passes through chlorophyll and the other that does not pass through chlorophyll, but in any case, via phytinyl diphosphate (FPP) and VTE2 (vitamin E synthase 2). Troferol (Toc) is produced.

3. Production of plant containing mainly tocotrienol and substantially free of tocopherol The inventors of the present invention examined T3 synthesis pathway in detail and inhibited Toc synthesis system to contain T3. First of all, it was examined whether it was possible to produce plants that did not contain them.

  In order to prevent the production of Toc, it is conceivable to inhibit the pathway upstream of Toc and not upstream of T3. As seen from FIG. 1, it is conceivable to inhibit GGR.

3-1. GGR gene expression inhibition or GGR gene disruption
Tocopherol production requires that geranylgeranyl reductase (GGR) is involved from geranylgeranyl diphosphate (GGPP) to produce phytinyl diphosphate. The inventors of the present application first aimed to increase the production amount and content of T3 by suppressing the GGR gene encoding geranylgeranyl reductase (GGR) in the plant body. Conventionally, Os02g0744900 is known as a sequence related to the GGR gene in rice.

  Therefore, there is the NIPPONHARA Tos 17 mutant strain NE1041 strain as a rice GGR-deficient mutant that has a transposon insertion mutation in the (GGR region) in Os02g0744900 and does not produce GGR. Seeds can be received from (Cryogenic Science Vol. 67, pp. 43-52). When confirmed with Nipponbare Tos 17 mutant strain NE1041 strain, chlorophyll production was suppressed and albino mutation was found, and although the amount of vitamin E decreased, the ratio of T3 to Toc increased, when confirmed with callus The production of Toc was not much suppressed, but the production of T3 tended to increase (see the right column in Fig. 3).

  Conventionally, in Arabidopsis thaliana, which is the standard for experimental plants, only one type (AT1G74470) is known as a gene that may encode GGR. GGR is also known to catalyze various reactions (for example, Eur. J. Biochem. 251, 413-417 (1998)). Therefore, in rice, it is widely believed that GGR encoded by a kind of gene (SEQ ID NO: 1) highly homologous to Arabidopsis thaliana is involved in the production of phytinyl diphosphate through both chlorophyll and non-pass pathways. It was done.

  On the other hand, Toc production could not be suppressed even if the expression of the GGR gene represented by SEQ ID NO: 1 was suppressed as described above. Therefore, Fig. 1 assumes the existence of a new pathway that is not described, or it is believed that there is only one kind of gene that encodes GGR in rice conventionally, but there may be a homolog in the gene that encodes GGR. We decided to consider the possibility of not being able to do it.

  As a result, it was found from rice that the sequence described in SEQ ID NO: 2 also encodes GGR. The inventors of the present application named the newly discovered GGR-encoding gene as GGR2 gene, and the conventionally known rice GGR highly homologous to Arabidopsis thaliana GGR was named GGR1 gene to distinguish them. Further, for the GGR1 gene, the sequence including the 3 'untranslated region and the 5' untranslated region is shown in SEQ ID NO: 3. Further, for the GGR2 gene, the sequence including the 5 'untranslated region is shown in SEQ ID NO: 4.

  When the newly discovered GGR2 expression was confirmed for the GGR-deficient mutants caused by the transposon examined above, it was confirmed that the GGR2 gene was expressed (FIG. 2). In addition, since the GGR-deficient mutant is albino (FIG. 3), the production of phytinyl diphosphate by geranylgeranyl reductase (GGR) from geranylgeranyl diphosphate (GGPP), which is the previous stage of Toc production, Seems to be involved. Therefore, it is considered that if not only the GGR1 gene but also the GGR2 gene expression is suppressed, the production of Toc can be suppressed and a high-quality T3 substantially free of Toc can be produced.

3-2. Development of a plant that suppresses production of Toc by not allowing the GGR gene to substantially function in the plant body, and produces T3 at a high quality In the plant body, by making the GGR gene substantially non-functional, Plants that suppress Toc production and produce high-quality T3 can be developed. More specifically, it is possible to develop a plant body that suppresses the production of Toc and produces T3 in high quality by deleting the GGR gene in the plant body or suppressing or blocking the expression of the GGR gene. it can.

  Preferably, for a plant that naturally produces tocotrienol, the production of Toc is suppressed by suppressing the production of Toc by deleting the GGR gene in the plant body or suppressing or inhibiting the expression of the GGR gene. Plants can be developed.

  As a method of deleting the GGR gene in the plant body or suppressing or inhibiting the expression of the GGR gene, the expression of the GGR gene is inhibited or suppressed, or the function of the GGR gene is suppressed or the function of the GGR gene is impaired, Alternatively, a method for disrupting the GGR gene can be used. More specifically, although not limited to the following examples, for example, RNA silencing method, RNAi method, method using antisense RNA, method using ribozyme, method using artificial nucleic acid, or gene knockout Examples thereof include a transposon method, a mutation method using ethyl methanesulfonic acid, a ZFN method, and a TALEN method.

  When there are multiple GGR genes in a plant, for all of the GGR genes, the expression of the GGR gene is inhibited or suppressed, the function of the GGR gene is inhibited or the function of the GGR gene is impaired, or the GGR gene is destroyed. . For example, if rice is taken as an example, both the GGR1 gene and the GGR2 gene may be prevented from substantially functioning. Specifically, for both the GGR1 gene and the GGR2 gene, the genes may be deleted or destroyed, the expression of both genes may be inhibited or suppressed, or one of the genes may be destroyed or missing. It is possible to prevent both of the GGR1 gene and the GGR2 gene from substantially functioning by deleting and inhibiting or suppressing the expression of the other gene. The same is true for plants with multiple GGR genes.

  Hereinafter, rice will be taken as an example, and the case of using the RNAi method will be mainly described, but any plant may be used as long as it produces T3 and GGR contributes to production of Toc, for example, wheat, barley, Examples include oats, palm, corn, sorghum and coconut. Needless to say, plants that produce T3 other than rice and GGR contributes to Toc production are not limited to RNAi methods, but can be produced using methods such as inhibiting or suppressing or knocking out gene expression as described above. It is possible to develop a plant body that suppresses T3 and produces T3 with high quality. The sequence of each GGR gene is described in SEQ ID NO: 12 and SEQ ID NO: 13 for wheat and barley. Furthermore, a partial sequence of the palm GGR gene sequence is shown in SEQ ID NO: 14. In addition, the sequences of the respective GGR genes are described in SEQ ID NO: 15 and SEQ ID NO: 16 for corn and sorghum.

3-2-1. RNAi
(1) RNAi target sequence
Examples of target genes that suppress expression in rice by RNAi include GGR1 shown in SEQ ID NO: 1, GGR2 shown in SEQ ID NO: 2, and natural variants thereof.

  For specific rice varieties or individuals, first, genomic DNA is extracted, using the region selected from SEQ ID NO: 1 or 2 as a probe, GGR1 or GGR2 gene of the rice is extracted and sequenced Thus, the nucleic acid sequence of GGR1 or GGR2 serving as the target sequence in the rice cultivar or individual can be examined.

(2) Designing a sequence for inhibiting the expression of a target sequence In order to inhibit the expression of a target gene with RNAi, a nucleic acid sequence encoding GGR1 or GGR2, such as SEQ ID NO: 1 or 3, or SEQ ID NO: 2 or 4 The appropriate area can be selected. Moreover, it is thought that the effect of suppressing the function of the gene is higher when targeting the 3 ′ untranslated region or the 3 ′ side of the translated region. In addition, software can be used for selection of such regions [Ui-Tei K et al., J Biomed. Biotechnol., Article ID 65052 (2006)].

  It is more desirable to conduct a database search of rice genome sequences and select a region where the selected sequence does not show high homology with rice genes other than GGR1 and GGR2.

  In some cases, a sequence having 95%, 96%, 97%, 98% or 99% identity to the target sequence is replaced with the target sequence, and a sequence for inhibiting the expression of the target sequence is added. It can also be designed.

  More specifically, for example, the region of SEQ ID NO: 5 can be selected as the RNAi sequence for inhibiting GGR gene expression.

(3) Construction of vector for RNAi
Examples of the vector for RNAi include a vector containing a sequence obtained by binding the sequence (sense strand) selected in (2) above to a complementary region (antisense strand) of the region with a spacer region in between. . As the spacer, an intron or other spacer sequence can be used, and the promoter incorporated in the vector may be any promoter as long as it can be transcribed in the target plant to be transformed. For example, a cauliflower mosaic A viral 35S promoter, a maize ubiquitin gene promoter, or the like can be used.

  Various vectors having such a structure have already been supplied, and well-known vectors can be used. For example, vectors incorporating Gateway® technology (Plant J. 27, 581 (2001), and binary vectors for inducing efficient RNAi in rice include pANDA (Plant Cell Physiol., 45,490 (2004)). ).

(4) Preparation of Callus as Target for Introducing the Expression Vector for RNAi Callus can be prepared by culturing seeds in a callus induction medium. Alternatively, embryos can be collected from rice seeds and cultured in a callus induction medium to induce callus. The callus induction medium contains a callus inducer such as a plant hormone such as auxin.

  Alternatively, free small callus can be induced by osmotic culture of a mature seed embryo of rice.

(5) Transformation method for preparation of plant body in which expression of GGR1 gene and GGR2 gene is inhibited The prepared vector is Agrobacterium method, particle gun method using callus, electroporation using protoplast. And the polyethylene glycol method.

More specifically, for example, the Agrobacterium method can be used for the above-described pANDA binary vector and Gateway (R) binary vector. As Agrobacterium, for example, EHA101 strain or EHA105 strain can be used.
In addition, the plant body of this invention is not limited to the reproduced | regenerated plant body, Callus and also a plant culture are also included.

4). Production of T3 from callus Transformed callus already accumulates T3 in the callus without having the plant redifferentiated.
Therefore, T3 can be produced from callus using a known method.

  For example, callus can be squeezed and / or crushed, and an extract can be prepared with an appropriate solvent. If necessary, the extract can be further separated by adding water, and the oil layer can be separated and purified by column chromatography to prepare tocotrienol containing no or only traces of tocopherols. The ratio and content of each tocotrienol homologue can be measured by a conventional method, for example, by HPLC-MS / MS or the like in which a liquid chromatography and a mass spectrometer are connected.

  Alternatively, the extracted and concentrated tocotrienol can be further subjected to column chromatography, and can be isolated and purified to each component of α-tocotrienol, β-tocotrienol, γ-tocotrienol and δ-tocotrienol.

  If necessary, T3 can also be produced from a plant individual in the same manner as from callus by regenerating from a callus using a suitable regeneration medium.

[Example 1]
Production of Tocopherol-Free Tocotrienol-Producing Rice Cells by Suppressing Expression of New Genes Using RNAi Gene Suppression Technology (1) Preparation of Kasuru Nipponbare Tos 17 mutant line NE1041 strain obtained from National Institute of Agrobiological Resources The seeds from which the cocoons had been removed were sterilized with an antiformin aqueous solution, and then immersed in 70% ethanol for further sterilization.

  Callus induction solid medium (per liter: CHU [N6] Basal salt buffer 4 g, glycine 2 mg, thiamine hydrochloride 1 mg, nicotinic acid 0.5 mg, pyridoxine hydrochloride 0.5 mg, myo-inositol 100 mg, 2,4-dichlorophenoxyacetic acid 2 mg, The above sterilized NE1041 seeds were placed on Gellite 4g). Since callus formed in about 3 weeks of germination, only the callus part was separated from the seed and planted in a new callus induction medium.

  There are three types of Tos 17 mutant lines, the GGR1 gene part that contains the Tos 17 transposon homozygously, the heterozygous one, and the Tos 17 transposon that does not contain the Tos 17 transposon. In order to select homozygous Tos 17 transposon, genomic PCR was performed and genotyping was performed. PCR was performed using two primer pairs, primer pair 1 (forward primer GGCGTGTGAACAACTAGTGC and reverse primer GTTTTCAGACACGATCTGGC) and primer pair 2 (forward primer GGCGTGTGAACAACTAGTGC and reverse primer TCCACCTTGAGTTTGAAGGG). PCR conditions are 94 ° C 3 minutes → (98 ° C 10 seconds → 58 ° C 30 seconds → 72 ° C 1 minute 20 seconds) x 35 cycles. The target callus containing the Tos 17 transposon is homologous with primer pair 1 but not with primer pair 2. Callus meeting this condition was used in the following experiment.

  Similarly, callus was prepared for wild-type (WT) rice using a callus induction medium.

(2) Preparation of gene expression suppression vector Total RNA was extracted from the bran portion of rice seeds using Qiagen RNeasy Plant Mini Kit. Using the RNA as a template, cDNA was synthesized using Qiagen's QuantiTect Reverse Transcription Kit.

  Further, using the cDNA as a template, the 5 'untranslated region and a part of the translated region of the GGR2 gene were amplified by PCR. The forward primer and reverse primer sequences are CACCAATTTGAGCTGTGGCGCCATCTC and GGGTTGCGCTCGAGGAGGAAC, respectively. PCR conditions are 94 ° C for 2 minutes → (98 ° C for 10 seconds → 68 ° C for 30 seconds) x 35 cycles.

  The obtained PCR amplification product was introduced into the pENTR vector, which is a cloning vector, using Invitorogen's Directional TOPO cloning system.

  A part of the gene cloned in the above pENTR vector was recombined from the pENTR vector into the pANDA vector, which is a gene expression suppression vector, using the LR reaction used in the Gateway system of invitorogen.

(3) Callus Transformation The pANDA vector into which the above gene was introduced was transformed into Agrobacterium EHA101 strain using electroporation. The successfully transformed EHA101 strain grows on a selective medium containing kanamycin and hygromycin, so LB medium (per liter: Bacto peptone 10 g, Bacto yeast extract 5 g, sodium chloride 10 g, agar 15 g, kanamycin 20 mg, hygromycin 50 mg) was applied to EHA101 strain after transformation, and selection was performed using drug resistance as an index. The selected colonies were confirmed by PCR that the target gene had been introduced, and cultured in an LB liquid medium containing kanamycin and hygromycin.

  When the callus prepared according to (1) “Preparation of callus” has grown sufficiently, the transformed EHA101 strain is placed on an LB solid medium containing 20 mg / L of kanamycin and 50 mg / L of hygromycin. Coated and grown at 28 ° C.

  After the cells grew, the transformed EHA101 strain was scraped from the plate, and the coexisting liquid medium (per liter: CHU [N6] Basal salt buffer 4 g, glycine 2 mg, thiamine hydrochloride 1 mg, nicotinic acid 0.5 mg, Pyridoxine hydrochloride 0.5 mg, myo-inositol 100 mg, sucrose 30 g, glucose 10 g, 2,4-dichlorophenoxyacetic acid 2 mg, acetosyringone 40 mg).

  Smaller calli were collected from the grown calli and immersed in the above-mentioned solution in which Agrobacterium was suspended for 30 minutes. Thereafter, the callus was placed on a filter paper to sufficiently remove moisture.

  Coexisting solid medium (per liter: CHU [N6] Basal salt buffer 4 g, glycine 2 mg, thiamine hydrochloride 1 mg, nicotinic acid 0.5 mg, pyridoxine hydrochloride 0.5 mg, myo-inositol 100 mg, sucrose 30 g, glucose 10 g, 2 , 4-dichlorophenoxyacetic acid 2 mg, acetosyringone 40 mg, gellite 4 g) was placed on tweezers and cultured for 3 days under light-shielded conditions at 20 ° C.

  The callus was washed three times with the coexisting liquid medium, and water was removed on the filter paper.

  Selection medium (per liter: CHU [N6] Basal salt buffer 4 g, glycine 2 mg, thiamine hydrochloride 1 mg, nicotinic acid 0.5 mg, pyridoxine hydrochloride 0.5 mg, myo-inositol 100 mg, sucrose 30 g, casamino acid 1 g, 2 , 4-dichlorophenoxyacetic acid 2 mg, kanamycin 20 mg, hygromycin 50 mg, gellite 4 g). Callus grows from cells transformed by Agrobacterium if callus is inoculated to the selective medium every 2 weeks. Callus in which gene transfer occurred was grown on a selective medium.

  The state of callus obtained by transformation growth of callus derived from Nipponbare Tos 17 mutant line NE1041 strain is shown in FIG.

(4) Vitamin E content analysis
Tocopherol and tocotrienol in callus were quantified by HPLC-MS / MS analysis as follows.

  Tocopherol and tocotrienol were extracted by adding 3 mL of 2-propanol containing 0.025% (w / v) BHT to 50 mg of powdered callus, freeze-dried, pulverized, and sonicated for 10 minutes. The extract was centrifuged at 3200 rpm for 10 minutes, and the supernatant was collected and filtered through a 0.45 μm PTFE filter. 800 μL of hexane was added to 200 μL of the obtained filtrate and mixed, and 20 μL was subjected to HPLC analysis. For HPLC analysis, column: silica gel column (Inertsil SIL 100A-3, 4.6 x 250 mm, GL Science), column temperature: 40 ° C, mobile phase: hexane / 1,4-dioxane / 2-propanol (1000/40/5 , v / v / v), flow rate: 1.0 mL / min, MS-MS analysis was performed using AB SCIEX 4000QTRAP (APCI, Positive), MRM values α-Toc 430.7, 165.1, β-Toc 416.7 , 151.2, γ-Toc 416.7, 151.0, δ-Toc 402.7, 137.2, α-T3 424.7, 165.3, β-T3 410.7, 151.1, γ-T3 410.7, 151.0, δ-T3 396.7, 137.1. The amount of tocopherol and tocotrienol in the sample was quantified by a quantitative curve using each standard.

  Fig. 5 shows the results of transformation of WT, Fig. 6 shows the results of transformation of callus derived from the Nipponbare Tos 17 mutant line NE1041 strain, which is a GGR1-deficient strain, and Fig. 6 shows the results of WT without transformation. As shown in FIG. FIG. 8 shows WT (average value of individuals measured in FIG. 7), callus results obtained by transformation of a GGR1-deficient strain, and HPLC-MS / MS data of both. In the upper part of FIGS. 5-7 and FIG. 8, the vertical axis indicates the amount of vitamin E per 100 g of freeze-dried callus, which is divided into Toc and T3.

  Separately, the results of WT and Tos17 performed by the same method as described above are shown in the upper part of FIG. Moreover, the result of having similarly analyzed the content of vitamin E about the leaf of the seedling obtained by cultivating the seed of the Nipponbare Tos 17 mutant line NE1041 line is shown in FIG.

  The present invention can be used for growing new useful plants. Furthermore, the present invention can be used for vitamin E production technology.

Claims (5)

In rice producing tocotrienol,
(1) deleting or destroying both the geranylgeranyl reductase 1 gene and the geranylgeranyl reductase 2 gene;
(2) inhibit or suppress the expression of both geranylgeranyl reductase 1 gene and geranylgeranyl reductase 2 gene, or
(3) By destroying or deleting one of the genes of geranylgeranyl reductase 1 gene and geranylgeranyl reductase 2 gene and inhibiting or suppressing the expression of the other gene,
A method for producing rice or rice callus that produces tocotrienol substantially free of tocopherol by substantially losing the functions of both geranylgeranyl reductase 1 gene and geranylgeranyl reductase 2 gene. The geranylgeranyl reductase 1 gene is deleted by transposon method, the method of expression of geranylgeranyl reductase 2 gene suppressing claim 1, wherein the RNAi method.   The method according to claim 2, wherein the geranylgeranyl reductase 1 gene is a sequence represented by SEQ ID NO: 1, and the geranylgeranyl reductase 2 gene is represented by SEQ ID NO: 2.   Rice or rice callus produced by the method according to any one of claims 1 to 3 and producing tocotrienol substantially free of tocopherol. Against rice callus
(1) deleting or destroying both the geranylgeranyl reductase 1 gene and the geranylgeranyl reductase 2 gene;
(2) inhibit or suppress the expression of both geranylgeranyl reductase 1 gene and geranylgeranyl reductase 2 gene, or
(3) Obtained by destroying or deleting one of the genes of geranylgeranyl reductase 1 gene and geranylgeranyl reductase 2 gene and inhibiting or suppressing expression of the other gene,
Not substantially function in rice callus in both geranylgeranyl reductase 1 gene and geranylgeranyl reductase 2 gene both rice calli producing tocotrienol not containing tocopherol substantially.

Images