JP6359921B2 - Pulmonary hypertension drug and screening method thereof - Google Patents

Description

  The present invention relates to a therapeutic drug for pulmonary hypertension and a screening method thereof.

  The circulatory system is composed of systemic circulation and pulmonary circulation, and the main significance of pulmonary circulation is to provide a place for lung gas exchange. The blood ejected from the left ventricle perfuses the entire body tissue widely, but the perfused blood flows into the pulmonary vascular system via the right heart system (the right ventricle and the right atrium), and the lungs Gas exchange is performed between capillaries and alveoli. Therefore, the pulmonary circulatory system is basically a high flow-low pressure-low resistance system, and mechanisms such as dilatation of pulmonary blood vessels and recanalization (reopening of closed blood vessels) against increase in pulmonary blood flow. There is a mechanism to suppress the rise in pressure.

  The average pulmonary artery pressure is controlled within the upper limit of 20 mmHg during normal / resting. Even if the pulmonary blood flow increases due to exercise, there is no immediate increase in the pulmonary artery, but it has been reported that when about 50-60% or more of the pulmonary vascular bed is occluded, pressure and vascular resistance increase. ing. At the 4th World Symposium on Pulmonary Hypertension (Dana Point Conference) in 2008, pulmonary hypertension was defined as the mean pulmonary artery mean pressure (mean PAP) measured using right heart catheterization at rest was 25 mmHg or higher. Furthermore, pulmonary arterial hypertension was defined as a pulmonary arterial hypertension when the pulmonary artery wedge pressure (PCWP) was 15 mmHg or less. This definition has not been changed at the 2013 Nice Conference, and a mean pulmonary artery pressure of 25 mmHg or more is maintained as a definition of pulmonary hypertension.

  Pulmonary arterial hypertension (hereinafter sometimes abbreviated as “PAH”) is a disease having a pulmonary arterial media and intimal hyperproliferation as a pathological background. Currently, the treatment of pulmonary hypertension includes endothelin receptor antagonists (bosentan, ambrisentan, etc.), phosphodiesterase (PDE) 5 inhibitors (sildenafil, tadalafil, etc.), prostaglandin I2 and derivatives thereof (epoprostenol, beraprost). Etc.) are used. However, the improvement in prognosis by these treatments is not sufficient, and PAH has been designated as one of intractable diseases. Therefore, there is a demand for the development of new treatments for PAH.

In recent years, inflammation has been reported to be involved in the progression of the pathological condition of PAH, and in particular, involvement of IL-6 (interleukin-6), which is an inflammatory cytokine, has been reported. For example, it has been reported that patients with idiopathic PAH having a high IL-6 blood concentration have a poorer prognosis than patients with idiopathic PAH having a low IL-6 blood concentration (Non-patent Document 1). ). In addition, as a result of examination using experimental pulmonary hypertension model mice with hypoxia (10% O ₂ ) load, it has been reported that IL-6 is important for the pathogenesis (Non-patent Documents 2 and 3). ).

Soon E et al, Circulation 122, 920-927, 2010 Steiner MK et al, Circ. Res. 104, 236-244, 2009 Savale L et al, Respir Res. 10, 6, 2009

  An object of the present invention is to find a molecule involved in the pathogenesis of pulmonary arterial hypertension, and to provide a novel preventive and / or therapeutic drug for pulmonary hypertension targeting the molecule. Another object of the present invention is to provide a screening method for a therapeutic drug for pulmonary hypertension that targets the molecule.

The present invention includes the following inventions in order to solve the above problems.
[1] A pharmaceutical for the prevention and / or treatment of pulmonary hypertension comprising a substance that inhibits signal transduction from IL-21 (interleukin-21) as an active ingredient.
[2] The medicament according to [1], wherein the substance that inhibits signal transduction from IL-21 is a substance that inhibits the interaction between IL-21 and IL-21 receptor.
[3] A substance that inhibits the interaction between IL-21 and IL-21 receptor is an anti-IL-21 antibody, an anti-IL-21 receptor antibody, a peptide that binds to IL-21, and an IL-21 receptor. The medicament according to the above [2], which is a kind selected from the group consisting of peptides that bind.
[4] The medicament according to [3], wherein the substance that inhibits the interaction between IL-21 and IL-21 receptor is an anti-IL-21 antibody.
[5] A screening method for a therapeutic agent for pulmonary hypertension, characterized by using IL-21 and IL-21 receptor.
[6] The method according to [5] above, wherein a substance that inhibits signal transduction from IL-21 is selected.
[7] The method described in [5] above, wherein a substance that inhibits the interaction between IL-21 and IL-21 receptor is selected.
[8] A step of contacting a test substance with a cell expressing IL-21 and IL-21 receptor, a step of measuring a signal amount downstream of the IL-21 receptor, and the cell when the test substance is not contacted The method according to [6] above, comprising a step of selecting a test substance that decreases the signal amount as compared with the signal amount in step (1).
[9] A step of bringing a test substance into contact with IL-21 and IL-21 receptor, a step of measuring a binding level between IL-21 and IL-21 receptor, and a binding level when not bringing the test substance into contact The method according to [7], further comprising a step of selecting a test substance that decreases the binding level.

  ADVANTAGE OF THE INVENTION According to this invention, the novel pharmaceutical useful for the prevention and / or treatment of pulmonary hypertension can be provided. Moreover, according to the screening method of the present invention, a substance useful as a therapeutic agent for pulmonary hypertension can be obtained.

It is a figure which shows the result of having analyzed the time-dependent expression level of IL-6 gene in the lung of the mouse | mouth raised in the hypoxia chamber by quantitative RT-PCR (** p <0.01). It is the immunohistochemical dyeing | staining image by the anti- IL-6 antibody of the lung of the mouse | mouth raised in the hypoxic chamber. The upper row is an arteriole, the lower row is a small artery, the left is normoxic, and the right is hypoxic. STAT3 phosphorylation status in the hypoxic control antibody administration group, hypoxia anti-IL-6 receptor antibody (MR16-1) administration group and normoxia control antibody administration group It is a figure which shows the result of having performed the western blotting using the anti- P-STAT3-Tyr705 antibody and the anti-STAT3 antibody as a sample. It is an experimental protocol for examining the influence of IL-6 signal inhibition by administration of an anti-IL-6 receptor antibody (MR16-1) on the pathology of hypoxia-induced pulmonary hypertension. The result of having examined the pathological condition of the pulmonary hypertension in the hypoxia control antibody administration group, the hypoxia anti-IL-6 receptor antibody (MR16-1) administration group, and the normoxia control antibody administration group on the 28th day after the hypoxia load is shown. A is the result of right ventricular systolic pressure (RVSP), B is the result of Fulton's coefficient, C is the result of medial thickening coefficient, D is the Elastica-Wangieson staining of lung sections, and pulmonary vascular remodeling is observed FIG. It is a figure which shows the result of having examined the expression of F4 / 80 (the glycoprotein expressed only in a macrophage) in the lung on the 7th day after hypoxia, and A and B are the results of Western blotting with anti-F4 / 80 antibody. A result is shown and C and D are the figures which show the result of having observed the positive cell by the immunohistochemical dyeing | staining by an anti-CD68 antibody. It is a figure which shows the result of having analyzed the time-dependent expression level of Fizz1 gene (M2 macrophage marker) in the macrophage extract | collected from the lung of the mouse | mouth raised in the hypoxic chamber (* p <0.05, **). p <0.01). Macrophage M2 marker collected 4 days after hypoxic load from the lungs of mice in hypoxic control antibody administration group, hypoxia anti-IL-6 receptor antibody (MR16-1) administration group and normoxia control antibody administration group It is a figure which shows the result of having analyzed the expression level of the gene by quantitative RT-PCR, A is a result of a Fizz1 gene, B is an Arg1 gene, C is a Chi313 gene, D is a Mrc1 gene, E is a result of a Cxcl12 gene. M1 marker of macrophages collected 4 days after hypoxic load from lungs of mice of hypoxic control antibody administration group, hypoxia anti-IL-6 receptor antibody (MR16-1) administration group and normoxia control antibody administration group It is a figure which shows the result of having analyzed the expression level of the gene by quantitative RT-PCR, A is a Nos2 gene, B is a result of IL-12 (beta) gene, C is a result of a TNF- (alpha) gene. Macrophages collected from bronchoalveolar lavage from mice were cultured and stimulated with IL-6, soluble IL-16 receptor or both, and then the expression levels of macrophage M2 marker gene and M1 marker gene were determined by quantitative RT-PCR. It is a figure which shows the result of analysis, A is Fizz1 gene, B is Arg1 gene, C is Chi3l3 gene, D is Mrc1 gene, E is Cxcl12 gene, F is Nos2 gene, G is IL-12β gene, H is TNF- It is the result of the α gene. Flow of Th1 cell and Th2 cell dynamics in the lung 3 days after hypoxic load of hypoxia control antibody administration group, hypoxia anti-IL-6 receptor antibody (MR16-1) administration group and normoxia control antibody administration group It is a figure which shows the result analyzed by cytometry, A is a flow cytometry analysis result of each group, B is a figure which shows the frequency of IFN-γ expression CD4 positive cell, C is IL-4 expression CD4 positive It is a figure which shows the frequency of a cell. It is a figure which shows the result of having analyzed with time quantitative expression level of IL-17 gene in the lung of the mouse | mouth raised in the hypoxic chamber by quantitative RT-PCR (* p <0.05). Quantified the expression level of Th17 cell marker gene in the lung 2 days after hypoxic load in the hypoxic control antibody administration group, hypoxia anti-IL-6 receptor antibody (MR16-1) administration group and normoxia control antibody administration group It is a figure which shows the result analyzed by RT-PCR, A is an IL-17A gene, B is a Rorc gene, C is a Cxcl1 gene, D is a result of a TNF- (alpha) gene. The expression level of IL-17 in the lungs 2 days after hypoxic load in the hypoxic control antibody administration group, hypoxia anti-IL-6 receptor antibody (MR16-1) administration group and normoxia control antibody administration group was determined by Western blotting. It is a figure which shows the result analyzed, A is a photograph of a band, B is a figure which digitized the density of the band. Flow cytometry of Th17 cell dynamics in the lungs 2 days after hypoxic load in the hypoxic control antibody administration group, hypoxia anti-IL-6 receptor antibody (MR16-1) administration group and normoxia control antibody administration group It is a figure which shows the result analyzed, A is a flow cytometry analysis result of each group, B is a figure which shows the frequency of IL-17 expression CD4 positive cell. It is an experimental protocol for examining the influence of inhibition of IL-17 signal on the pathology of hypoxia-induced pulmonary hypertension. It is a figure which shows the result of having examined the pathological condition of the pulmonary hypertension in the hypoxia control antibody administration group, the hypoxia anti-IL-17A neutralization antibody administration group, and the normoxia control antibody administration group on the 28th day after the hypoxic load, Is a diagram showing the result of right ventricular systolic pressure (RVSP), and B is a diagram showing the result of Fulton coefficient. It is a figure which shows the result of having analyzed the expression level with time of the IL-21 gene in the lung of the mouse | mouth raised in the hypoxia chamber by quantitative RT-PCR (* p <0.05). Quantification of IL-21 gene expression level in the lung 2 days after hypoxic load in hypoxia control antibody administration group, hypoxia anti-IL-6 receptor antibody (MR16-1) administration group and normoxia control antibody administration group It is a figure which shows the result analyzed by RT-PCR. The expression level of IL-21 in the lungs 2 days after hypoxic load in the hypoxic control antibody administration group, hypoxia anti-IL-6 receptor antibody (MR16-1) administration group and normoxia control antibody administration group was determined by Western blotting. It is a figure which shows the result analyzed, A is a photograph of a band, B is a figure which digitized the density of the band. The dynamics of IL-21-producing Th17 cells in the lungs on the second day after hypoxic load in the hypoxic control antibody administration group, hypoxia anti-IL-6 receptor antibody (MR16-1) administration group and normoxia control antibody administration group It is a figure which shows the result analyzed by flow cytometry, A is a flow cytometry analysis result of each group, B shows the frequency of IL-21 expression CD4 positive cell, C is IL-17A and IL-21 expression It is a figure which shows the frequency of CD4 positive cell. It is a figure which shows the result of having analyzed the macrophage extract | collected by the bronchoalveolar lavage from the mouse | mouth, and having stimulated with IL-21, and analyzed the expression level of the M2 marker gene of a macrophage by quantitative RT-PCR, A is a Fizz1 gene, B is the result of the Arg1 gene, and C is the result of the Cxcl12 gene. It is a figure which shows the result of having analyzed the expression level of the M1 marker gene of a macrophage by quantitative RT-PCR after culturing the macrophage extract | collected from the mouse | mouth by bronchoalveolar lavage, and stimulating with IL-21, A is a Nos2 gene, B is the result of IL-12β gene, and C is the result of TNF-α gene. It is a figure which shows the result of having examined the effect which stimulates a human pulmonary artery smooth muscle cell directly with IL-21, and has on proliferation. The figure which shows the result which examined the effect on proliferation when a human pulmonary artery smooth muscle cell was cultured using the culture supernatant (macrophage conditioned medium) obtained by culturing a mouse alveolar macrophage in presence of IL-21. It is. Culture medium obtained by culturing mouse pulmonary artery smooth muscle cells with mouse alveolar macrophages in the presence of IL-21 (macrophage conditioned medium), a medium in which AMD3100, a selective inhibitor of CXCR4 receptor CXCR4, is added It is a figure which shows the result of having examined the effect which acts on proliferation when it culture | cultivates using. Fizz1-positive cells (M2 macrophages) in the lung 7 days after hypoxic load in the hypoxic control antibody administration group, hypoxia anti-anti-IL-21 neutralization antibody administration group and normoxia control antibody administration group were treated with anti-Fizz1 antibody. It is a figure which shows the result observed by the immunohistochemical dyeing | staining, A is an immunohistochemical dyeing | staining image, B is a figure which shows the number of Fzz1-positive cells of each group. Phosphorylated histone H3 (pHH3) positive cells in the lung 7 days after hypoxic load in the hypoxic control antibody administration group, the hypoxia anti-anti-IL-21 neutralization antibody administration group and the normoxia control antibody administration group were treated with anti-phosphorus. It is a figure which shows the result observed by the immunofluorescence dyeing | staining with an oxidation histone H3 antibody, A is an immunofluorescence dyeing | staining image, B is a figure which shows the phosphorylated histone H3 positive cell number of each group. It is a figure which shows the result of having examined the pathological condition of the pulmonary hypertension in the hypoxic wild type mouse group, the hypoxic IL-21 receptor gene deletion mouse group, and the normoxic wild type mouse group on the 28th day after the hypoxic load, A FIG. 7 is a graph showing the results of right ventricular systolic pressure (RVSP), B is the result of Fulton coefficient, and C is the result of medial thickness coefficient. It is a figure which shows the molecular mechanism of pulmonary hypertension onset by hypoxia.

  The present inventors have found that IL-21 is secreted from Th17 cells, which is a subset of helper T cells, downstream of the IL-6 signal and have an important role in the pathogenesis of pulmonary hypertension. That is, the present inventors secreted IL-21 from Th17 cells in an IL-6 signal-dependent manner under hypoxic conditions, and the action of IL-21 induced differentiation of alveolar macrophages into a state predominantly M2 macrophages. Thus, it was revealed that pulmonary arterial smooth muscle cells are proliferated by humoral factors (such as SDF-1) secreted from M2 macrophages and pulmonary blood vessels are remodeled to develop pulmonary hypertension (see FIG. 30). . The present inventors made a hypoxia-induced pulmonary hypertension model using IL-21 receptor-deficient (IL-21RKO) mice that lack IL-21 signal. -21RKO mice were found to significantly suppress the right ventricular systolic pressure, right ventricular / left ventricular + ventricular septal weight ratio, and pulmonary arterial media thickening rate, which are indicators of pulmonary hypertension, from IL-21 It was found that the pathophysiology of pulmonary hypertension can be suppressed by inhibiting signal transduction. Until now, there has been no report suggesting the possibility of treatment of pulmonary hypertension by inhibiting signal transduction from IL-21, and the findings of the present inventors are considered to be an innovative result in this field.

[Pharmaceutical for the prevention and / or treatment of pulmonary hypertension]
The present invention provides a medicament for preventing and / or treating pulmonary hypertension, which comprises a substance that inhibits signal transduction from IL-21 as an active ingredient. The active ingredient of the medicament of the present invention may be any substance that inhibits signal transduction from IL-21, and is not particularly limited, but inhibits the interaction between IL-21 and IL-21 receptor. It is preferable that it is a substance. Examples of the substance that inhibits the interaction between IL-21 and IL-21 receptor include, for example, an anti-IL-21 antibody, an anti-IL-21 receptor antibody, a peptide that binds to IL-21, and an IL-21 receptor. Examples include, but are not limited to, a peptide that binds. These antibodies or peptides are antibodies (neutralizing antibodies) or peptides that can inhibit the interaction between IL-21 and IL-21 receptor by binding to IL-21 or IL-21 receptor. Preferably there is. An antibody or peptide capable of inhibiting the interaction between IL-21 and IL-21 receptor can inhibit signal transduction from IL-21 and can suppress pathogenesis of pulmonary hypertension. .

  Antibodies known as antibodies capable of inhibiting the interaction between IL-21 and IL-21 receptor can be suitably used as the active ingredient of the medicament of the present invention. Examples of such known anti-IL-21 antibody and anti-IL-21 receptor antibody include, for example, “Rosanne Spolski and Warren J. Leonard, Interleukin-21: a double-edged sword with therapeutic potential, Nature Reviews Drug Discovery 13, 379-95 (2014) ", anti-IL-21 antibody and anti-IL-21 receptor antibody described in Table 1, anti-zalpha11 ligand antibody described in WO2000 / 053761, anti-IL-21 antibody described in WO2010 / 055366, And anti-IL-21 receptor antibodies described in WO2004 / 083249.

  Peptides known as peptides capable of inhibiting the interaction between IL-21 and IL-21 receptor can be suitably used as the active ingredient of the medicament of the present invention. Examples of such known peptides that bind to IL-21 and IL-21 receptor include those described in WO2003 / 040313, WO2006 / 113331, WO2008 / 049920, JBC285, 12223-12231, 2010 and the like. Peptides that bind to IL-21, peptides that bind to IL-21 receptor, and the like can be mentioned.

  An anti-IL-21 antibody can be produced using IL-21 or a fragment thereof as an antigen. IL-21 used for the antigen may be IL-21 derived from any animal, but is preferably mammalian IL-21, and more preferably human IL-21. IL-21 or a fragment thereof used as an antigen is assembled by a known method (for example, affinity column) from a culture supernatant or cell extract of IL-21-expressing cells, or a known gene recombination technique. It can be obtained by a method of producing as a replacement protein. The nucleotide sequence information and amino acid sequence information of the gene encoding IL-21 of major mammals can be obtained from a known database (DDBJ / GenBank / EMBL, etc.). For example, the accession number of the base sequence of the gene encoding human IL-21 is AF254069, and the accession number of the amino acid sequence of human IL-21 is AAG29348.

  An anti-IL-21 receptor antibody can be produced using an IL-21 receptor or a fragment thereof as an antigen. The IL-21 receptor used for the antigen may be any animal-derived IL-21 receptor, but is preferably a mammalian IL-21 receptor, and preferably a human IL-21 receptor. More preferred. The IL-21 receptor or fragment thereof used for the antigen can be purified from the culture supernatant or cell extract of IL-21 receptor-expressing cells by a known method (for example, an affinity column), or a known gene recombination technique. Can be obtained by a method of preparing a recombinant protein using Base sequence information and amino acid sequence information of genes encoding major mammalian IL-21 receptors can be obtained from publicly known databases (DDBJ / GenBank / EMBL, etc.). For example, the accession number of the base sequence of the gene encoding the human IL-21 receptor is AF254067, and the accession number of the amino acid sequence of the human IL-21 receptor is AAG29346.

  The antibody used as the active ingredient of the medicament of the present invention may be a polyclonal antibody or a monoclonal antibody. Further, it may be a complete antibody molecule or an antibody fragment (for example, Fab, F (ab ') 2, Fab', Fv, scFv, etc.) that can specifically bind to an antigen. The antibody is preferably a human chimeric antibody or a humanized antibody.

  Polyclonal antibodies and monoclonal antibodies can be prepared by known methods. The polyclonal antibody is prepared by, for example, dissolving an antigen (IL-21 or a fragment thereof, or IL-21 receptor or a fragment thereof) in PBS, and mixing an appropriate amount of a normal adjuvant (for example, Freund's complete adjuvant) if necessary. Can be prepared by immunizing a mammal (mouse, rat, rabbit, goat, horse, etc.), collecting blood from the immunized animal according to a conventional method, separating the serum, and purifying the polyclonal antibody fraction. . Although the immunization method is not particularly limited, for example, a method of subcutaneous injection or intraperitoneal injection once or a plurality of times at an appropriate interval is preferable. A monoclonal antibody can be prepared, for example, by fusing an immune cell (eg, spleen cell) obtained from the immunized mammal and a myeloma cell to obtain a hybridoma, and collecting the antibody from the hybridoma culture. it can. Alternatively, an antibody gene can be cloned from a hybridoma, incorporated into an appropriate vector, introduced into a host cell, and a recombinant monoclonal antibody can be produced using gene recombination techniques. Furthermore, monoclonal antibodies can also be produced using the phage display method. The resulting antibody inhibits the interaction between IL-21 and IL-21 receptor. For example, cells in which cell division is induced when IL-21 binds to IL-21 receptor (mouse-derived B9 cell line) , N1186 human T cell line) and the like, and the inhibitory effect on IL-21-dependent cell proliferation can be measured.

  A human chimeric antibody refers to an antibody comprising a heavy chain variable region and a light chain variable region of an antibody derived from a non-human animal, and a heavy chain constant region and a light chain constant region of a human antibody. A humanized antibody is obtained by grafting a CDR (complementarity determining region) of an antibody derived from a non-human animal into a CDR of a human antibody, and is also referred to as a CDR-grafted antibody or a reconstituted antibody. The FR (framework region) of the humanized antibody is selected so that CDR forms a favorable antigen-binding site. If necessary, the amino acid sequence of FW in the variable region of the antibody may be substituted so that the CDR of the humanized antibody forms an appropriate antigen-binding site. The amino acid sequence of the constant region of a human antibody can be obtained from a known database (Protein Data Bank etc.).

The peptide used as the active ingredient of the medicament of the present invention can be prepared by a solid phase synthesis method (Fmoc method, Boc method) or a liquid phase synthesis method according to a known general peptide synthesis protocol. Moreover, it can produce using the transformant which introduce | transduced the expression vector containing DNA which codes a peptide. Alternatively, it can be produced by a method using an in vitro transcription / translation system. The peptide may be any of carboxyl group, carboxylate, amide or ester at the C-terminus. The peptide may be such that the N-terminal amino group is protected with a protecting group (for example, a C _1-6 acyl group such as a C _2-6 alkanoyl group such as formyl group or acetyl). The peptide may form a salt, and a physiologically acceptable salt is preferable as the salt. The resulting peptide inhibits the interaction between IL-21 and IL-21 receptor. For example, cells that induce cell division when IL-21 binds to IL-21 receptor (mouse-derived B9 cell line) , N1186 human T cell line) and the like, and the inhibitory effect on IL-21-dependent cell proliferation can be measured.

  The medicament of the present invention can be formulated according to conventional means using a substance that inhibits signal transduction from IL-21 as an active ingredient. For example, preparations for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (including soft capsules), Examples include syrups, emulsions, and suspensions. These preparations are produced by a known method and contain carriers, diluents or excipients usually used in the pharmaceutical field. For example, lactose, starch, sucrose, magnesium stearate and the like are used as carriers and excipients for tablets. As preparations for parenteral administration, for example, injections, suppositories and the like are used, and injections are intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, infusions, intraarticular injections. And other dosage forms. Such an injection is prepared according to a known method, for example, by dissolving, suspending or emulsifying the active ingredient of the medicament of the present invention in a sterile aqueous or oily liquid usually used for injection. As an aqueous solution for injection, for example, isotonic solution containing physiological saline, glucose and other adjuvants, and the like are used, and suitable solubilizers such as alcohol (for example, ethanol), polyalcohol (for example, , Propylene glycol, polyethylene glycol, etc.), nonionic surfactants (eg, polysorbate 80, HCO-50, etc.) and the like. As the oily liquid, for example, sesame oil, soybean oil and the like are used, and benzyl benzoate, benzyl alcohol and the like may be used in combination as a solubilizing agent. The suppository used for rectal administration is prepared by mixing the active ingredient of the medicament of the present invention with an ordinary suppository base. When the active ingredient of the medicament of the present invention is a peptide or an antibody, it can be used as an injection or infusion formulated with a pharmaceutically acceptable carrier as a parenteral route of administration, for example, intravenous, intramuscular, intradermal, intraperitoneal It is preferred to administer internally, subcutaneously or locally. Since the preparation thus obtained is safe and has low toxicity, for example, it is orally administered to humans and mammals (eg, rats, mice, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc.). Or it can be administered parenterally.

The medicament of the present invention can contain 0.001 to 50 mass%, preferably 0.01 to 10 mass%, more preferably 0.1 to 1 mass%, of the active ingredient.
The dosage of the medicament of the present invention is appropriately set in consideration of the purpose, the severity of the disease, the patient's age, weight, sex, medical history, type of active ingredient, and the like. When an average human having a body weight of about 65 to 70 kg is used as a target, about 0.02 mg to 4000 mg per day is preferable, and about 0.1 mg to 200 mg is more preferable. The total daily dose may be a single dose or divided doses.

[Screening method]
The present invention provides a screening method for a therapeutic agent for pulmonary hypertension. The screening method of the present invention is characterized by using IL-21 and IL-21 receptor. IL-21 and IL-21 receptor used in the screening method of the present invention may be full-length proteins or functional fragments. The IL-21 and IL-21 receptor used in the screening method of the present invention may be IL-21 derived from any animal, but is preferably mammalian IL-21, and is human IL-21. It is more preferable. IL-21 and IL-21 receptor or fragments thereof can be made by the methods described above.

  The test substance used in the screening method of the present invention is not particularly limited. For example, nucleic acid, peptide, protein, non-peptide compound, synthetic compound, fermentation product, cell extract, cell culture supernatant, plant extract, mammal Animal tissue extracts, plasma and the like can be preferably used. The test substance may be a novel substance or a known substance. These test substances may form a salt. As a salt of a test substance, a salt with a physiologically acceptable acid or base is used.

  It is preferable to select a substance that inhibits signal transduction from IL-21 by the screening method of the present invention. If signal transduction from IL-21 is inhibited, the pathogenesis of pulmonary hypertension can be suppressed, and pulmonary hypertension can be prevented and / or treated. When selecting a substance that inhibits signal transduction from IL-21 by the screening method of the present invention, for example, a step of contacting a test substance with cells expressing IL-21 and IL-21 receptor, and IL-21 Preferably, the method includes a step of measuring a signal amount downstream of a receptor and a step of selecting a test substance that decreases the signal amount as compared with the signal amount in the cell when the test substance is not contacted. Can do.

  The cell expressing the IL-21 receptor may be any cell as long as it is an IL-21 receptor-expressing cell capable of measuring the downstream signal amount of the IL-21 receptor by interacting with IL-21. Such cells are preferably cultured cells, and may be primary cultured cells or cell lines. Examples of primary cultured cells include mouse alveolar macrophages and human B lymphocyte cells. Examples of cell lines include human N1186T cell line, mouse B9 cell line, and HEK293 cells in which IL-21 receptor is forcibly expressed. Can be mentioned. Any of these can be suitably used in the screening method of the present invention. The method for bringing the test substance into contact with IL-21 and IL-21 receptor-expressing cells is not particularly limited. For example, in the case of using cultured cells, a method of adding the test substance and IL-21 to the medium can be mentioned. It is done. The contact time is not particularly limited and may be appropriately selected. In addition, a control group that does not contact the test substance is provided.

  The amount of signal downstream of the IL-21 receptor can be determined by, for example, inducing cells that induce cell division when IL-21 binds to the IL-21 receptor (such as mouse-derived B9 cell line, N1186 human T cell line). When used as a receptor-expressing cell, cell proliferation of the used IL-21 receptor-expressing cell can be measured as an index. For measuring cell proliferation, a known cell proliferation method can be appropriately selected and used. In addition, the level of STAT3 tyrosine phosphorylation activated in an IL-21-dependent manner can be used as an index. The level of tyrosine phosphorylation of STAT3 can be detected and quantified using a known method such as Western blot.

  The test substance can be selected as a candidate drug for the treatment of pulmonary hypertension if the signal level is reduced when the test substance is brought into contact with the control group not brought into contact with the test substance. . It is preferable to select a test substance that significantly reduces the signal level statistically significantly compared to the signal level of the control group, more preferably to select a test substance that reduces the signal level to 50% or less. More preferably, a test substance that reduces the amount to 25% or less is selected.

  It is preferable to select a substance that inhibits the interaction between IL-21 and IL-21 receptor by the screening method of the present invention. If the interaction between IL-21 and IL-21 receptor is inhibited, signal transduction from IL-21 can be inhibited, pathogenesis of pulmonary hypertension can be suppressed, and / or pulmonary hypertension can be prevented and / or Can be treated. When a substance that inhibits the interaction between IL-21 and IL-21 receptor is selected by the screening method of the present invention, for example, a step of contacting a test substance with IL-21 and IL-21 receptor, Preferably, the method comprises a step of measuring the binding level between -21 and IL-21 receptor, and a step of selecting a test substance that decreases the binding level compared to the binding level when the test substance is not contacted. Can be used.

  The method for bringing the test substance into contact with IL-21 and the IL-21 receptor is not particularly limited. For example, a method of preparing a reaction system containing IL-21 and IL-21 receptor and adding a test substance thereto can be mentioned. The contact time and the contact temperature are not particularly limited and may be appropriately selected. IL-21 receptor-expressing cells may be used as the IL-21 receptor. When IL-21 receptor-expressing cells are used, a method of adding a test substance and IL-21 to the medium in which the cells are cultured can be mentioned. Regardless of which system is used, a control group is provided that does not come into contact with the test substance.

  The method for confirming the binding level between IL-21 and IL-21 receptor is not particularly limited, and a known method can be appropriately selected and used. For example, an ELISA method, a fluorescence polarization method, a method for measuring cell proliferation, and the like can be suitably used. When using the ELISA method, either IL-21 or IL-21 receptor is immobilized, and the other and a test substance are added thereto and reacted to determine the binding level of IL-21 and IL-21 receptor. Detection can be performed using appropriate primary and secondary antibodies.

  Compared with the binding level of IL-21 and IL-21 receptor in the control group not contacted with the test substance, the binding level of IL-21 and IL-21 receptor decreased when the test substance was contacted. If so, the test substance can be selected as the target substance. It is preferable to select a test substance that reduces the binding level statistically significantly compared to the binding level of the control group, more preferably to select a test substance that reduces the binding level to 50% or less. More preferably, a test substance that reduces the level to 25% or less is selected.

  The present invention includes a method for preventing and / or treating pulmonary hypertension, comprising the step of administering an effective amount of a substance that inhibits signal transduction from IL-21. The present invention also includes the use of a substance that inhibits signal transduction from IL-21 for producing a pharmaceutical composition for preventing and / or treating pulmonary hypertension. The present invention also includes substances that inhibit signal transduction from IL-21 for use in the prevention and / or treatment of pulmonary hypertension.

  EXAMPLES Hereinafter, although an Example demonstrates this invention in detail, this invention is not limited to these.

[Experimental materials and methods]
(1) Experimental animals All experiments were performed using 8-week-old male mice. C57BL / 6 mice (purchased from Japan SLC) were used for experiments other than those using IL-21 receptor-deficient (IL-21RKO) mice. IL-21RKO) mice were donated by Dr. Warren J. Leonard, NIH, USA. The genetic background of IL-21RKO mice is C57BL / 6.
All mice were housed in a breeding room adjusted to 24 ± 1 ° C. in a light / dark 12-hour / 12-hour cycle, and received standard mouse food and water ad libitum. When hypoxic, mice were housed in a 10% oxygen hypoxia chamber for 4 weeks. However, mice were placed outside the chamber (normoxic environment) twice a week for 5 minutes each for cleaning in the hypoxic chamber. Low oxygen gas was continuously supplied to the low oxygen chamber at a flow rate of 1 L / min. In the experiment, a hypoxia control antibody administration group, a hypoxia neutralization antibody administration group, and a normoxia control antibody administration group were provided. The number of animals in one group was 8-12. After exposure to hypoxia, the mice were euthanized after measuring the hemodynamics, and the heart and lungs were removed and organ weights were measured for pathological analysis.

(2) Treatment experiment of pulmonary hypertension model mouse using neutralizing antibody (2-1) Anti-IL-6 receptor neutralizing antibody Anti-IL-6 receptor neutralizing antibody (MR16-1) is Chugai Pharmaceutical Co., Ltd. Provided by the company. MR16-1 is a rat monoclonal IgG1 antibody against the mouse IL-6 receptor. In order to examine the IL-6 signal inhibitory effect of MR16-1, first, MR16-1 or 2 mg of a control antibody (purified rat non-immune isotype IgG; MP Biomedicals) was intravenously administered immediately before hypoxia or normoxia. Thereafter, 0.5 mg of MR16-1 or a control antibody was intraperitoneally administered once a week (see FIG. 4).

(2-2) IL-17 neutralizing antibody As an IL-17 neutralizing antibody, a rat anti-mouse IL-17 monoclonal antibody (MAB421; R & D systems) was purchased and used. Anti-IL-17 neutralizing antibody or 0.2 mg of control IgG was administered daily from 1 day before hypoxia or normoxia until 4 days after the load, and then 7, 10, 13, 16, 19, 22, 25 after the load. , Day 28 (see FIG. 16).

(2-3) IL-21 neutralizing antibody IL-21 neutralizing antibody was purchased from a commercially available rat anti-mouse IL-21 monoclonal antibody (FFA21, eBioscience). 100 μg of anti-IL-21 neutralizing antibody or isotype control antibody was intraperitoneally administered 1 day before, 1st, 2nd, 3rd, and 4th day after loading with hypoxia or normoxia, respectively.

(3) Hemodynamic measurement using right heart catheter Mice were anesthetized with sodium pentobarbital (60 mg / kg ip) and the analgesic butorphanol tartrate (0.1-0.4 mg / kg ip). In addition, sodium pentobarbital (15-20 mg / kg / h ip) and butorphanol tartrate (0.03-0.05 mg / kg ip ip) are regularly added to maintain a surgical level of anesthesia. did. Using a thermostat-controlled heat pad in conjunction with a rectal temperature monitor, the body temperature of the mouse during hemodynamic measurement was maintained at 37-38 ° C. A cannulation was inserted into the trachea, and the lungs were ventilated using a mouse ventilator (Minivent type 845; Harvard apparatus). The inspiratory gas was adjusted to high concentration oxygen, and the ventilator was set to a tidal volume of 6 μL / g and a frequency of 170 to 190 / min.

  A polyethylene tube was inserted into the right external jugular vein and advanced to the right ventricle to measure right ventricular pressure (RVP). The RVP signal is detected by a pressure transducer (MLT0670; AD Instruments), relayed by a pressure amplifier (ML117; AD Instruments), continuously sampled by a Power Lab system (AD Instruments), and Chart software ( Recorded on a computer using AD Instruments). Heart rate was obtained from the right ventricular systolic peak. Measurement was performed when the heart rate satisfied the conditions of 300 to 500 times / minute. When the heart rate decreased to 300 times / minute or less, it was excluded from the measurement. Systemic blood pressure was measured non-invasively from conscious mice using a computerized tail cuff system (BP-98A-L; Softron).

(4) Western blot Buffer for lysis of frozen mouse lung (50 mM HEPES, 100 mM sodium fluoride, 2 mM sodium orthovanadate, 4 mM EDTA, 1% Tween-20, 0.1% SDS, protease inhibitor cocktail Complete (Roche Applied Science)) and homogenized using a Polytron homogenizer. Solid matter was removed by centrifugation, and the lung lysate was subjected to SDS-PAGE according to a conventional method. Blots were developed using the ECL system (GE Healthcare). The following antibodies were used in Western blot analysis. Anti-P-STAT3-Tyr705 antibody (CloneD3A7, Cell Signaling Technology), anti-STAT3 antibody (Clone 79D7, Cell Signaling Technology), anti-F4 / 80 antibody (MCA497GA, AbD Serotec), anti-RELM alpha (Fizz1) antibody (ab39626, Abcam ), Anti-IL-17 antibody (sc-52567, Santa Cruz) and anti-IL-21 antibody (MAB594, R & D Systems). In addition, a Western blot using an anti-β-tubulin antibody (T5201, Sigma-Aldrich) was used as an internal control.

(5) Isolation of macrophages from mouse lungs Bronchoalveolar lavage fluid (BALF) was obtained by dripping 0.9 mL of PBS into the bronchi three times and a 40 μm cell strainer to remove massive epithelial cells. And filtered. Primary mouse alveolar macrophages were obtained from BALF for cell culture experiments. The recovered cells containing macrophages were cultured using DMEM containing 2% fetal bovine serum (FBS). The cells were seeded in a 24-well cell culture plate at 1.5 × 10 ⁵ cells / well and cultured in DMEM containing 10% FBS, 2 mM L-glutamine, 100 U / mL penicillin, 100 μg / mL streptomycin. After culturing at 37 ° C. for 4 hours, the medium was replaced with serum-free DMEM and subjected to stimulation tests with various cytokines. After overnight culture in serum-free medium, recombinant mouse IL-21 (20 ng / mL), IL-6 (20 ng / mL), soluble IL-16 receptor (sIL6R, 20 ng / mL) (R & D systems) Stimulated for 18 hours.

(6) Morphological analysis After measuring the hemodynamics, the mice were euthanized by over anesthesia, and the heart was removed. The atrium was removed and the right ventricular (RV) wall was separated from the left ventricle (LV) and septum. The tissue weight was measured after absorbing water, and standardized in terms of 100 g body weight. The weight ratio (Fulton coefficient) between RV and (LV + septum) was used as an index of right ventricular hypertrophy.
Lungs were collected for histological and immunohistochemical analysis. The pulmonary artery and trachea were each perfused with 4% paraformaldehyde (PFA) at a constant pressure (pulmonary artery 100 cmH ₂ O, trachea 25 cmH ₂ O), and the pulmonary artery and airway were fully dilated and fixed. The excised lung was fixed overnight at 4 ° C. with 4% PFA, embedded in paraffin and sectioned at 4 μm. For pulmonary blood vessel morphology analysis, the sections were stained with Elastica-Wangeson. Arterial images were taken with a BZ-9000 microscope (Keyence). Morphological analysis was performed using lung sections of 5-6 animals randomly selected in each treatment group. Pulmonary vascular remodeling is studied by measuring the medial wall thickness (% wall thickness) of the pulmonary artery in the lung parenchyma, the small artery at the end bronchiole level, and the arteriole at the pulmonary lobule level. did. The medial thickness coefficient is defined as the distance between the inner elastic plate and the outer elastic plate doubled and divided by the distance between the outer elastic plates (blood vessel diameter) multiplied by 100. For blood vessels with only one elastic plate, the distance between the elastic plate and the subendothelial basement membrane was measured. Media thickening was analyzed only for blood vessels with a roughly circular incision. Pulmonary artery diameter was measured using NIH Image J software. The media thickness was calculated for at least 10 pulmonary arterioles and pulmonary arterioles per mouse.

(7) Histological and immunohistochemical analysis of pulmonary blood vessels Samples used for immunohistochemical analysis were fixed with 4% PFA / PBS for 1 hour and then replaced with PBS containing 5 to 20% sucrose, and then OCT. They were embedded in a compound (Sakura), frozen, and sectioned at a thickness of 10 μm. The frozen section is treated with PBS, then treated with 1% aqueous hydrogen peroxide / methanol for 30 minutes, and blocking containing 1% bovine serum albumin (BSA) or 5% skim milk in PBST (PBS / 0.1% Triton-X100). The solution was incubated for 1 hour and incubated with primary antibody in PBST overnight at 4 ° C. Primary antibodies include anti-CD68 antibody (1: 200 dilution; MCA1957GA, AbD Serotec), anti-RELM alpha (Fizz1) antibody (1: 100 dilution; ab39626, Abcam), anti-IL-6 antibody (1: 200 dilution; ab6672, Abcam), anti-phospho-Histone-H3 antibody (Ser10) (1: 100 dilution; 06-570, Upstate), anti-Actin, alpha-Smooth Muscle-Cy3 antibody (1: 200 dilution; C6198, Sigma-Aldrich) Was used. Next, the sections were washed with PBST, and fluorescently labeled secondary antibody (1: 200 dilution; Alexa Fluor 488- or 546-binding; Invitrogen) or HRP-labeled secondary antibody (1: 200 dilution; 7074, Cell Signaling Technology) And incubated at room temperature for 1 hour. After washing with PBST as necessary, color was developed using DAB (Sigma). Stained images were taken with a BZ-9000 fluorescence microscope (Keyence).

(8) Flow cytometry (FACS) analysis Mouse lung tissue was directly immersed in DMEM containing collagenase and DNase I (1 U / mL; Takara) and incubated at 37 ° C for 40 minutes to 1 hour. The tissue suspension was passed through a 40 μm mesh and the pellet was resuspended with PBS-F (PBS with 2% FBS) and washed twice with PBS-F. To block the Fcγ receptor, cells were preincubated with CD16 / 32, washed and incubated with anti-CD4 antibody fluorescently labeled with a total volume of 100 μL of PBS-F for 30 minutes.

  To stain intracellular cytokines, stimulation was carried out for 5 hours in medium containing 25 ng / mL PMA, 1 μg / mL ionomycin and 10 μg brefeldin A (Sigma-Aldrich). After surface staining of CD4, the cells were fixed and membrane permeabilized with mouse Foxp3 Buffer Set (BD Pharmingen). After washing twice, the cells were stained with fluorescently labeled antibodies (anti-IFN-γ antibody, anti-IL-4 antibody, anti-IL-17A antibody, anti-IL-21 antibody) on ice for 30 minutes. Cells were analyzed with FACSCanto (BD Biosciences) followed by FlowJo software (Tristar). The antibodies used are as follows, and all are products of eBiosciences. FITC-labeled anti-CD4 antibody (RM4-5), PE-labeled anti-IFN-γ antibody (XMG1.2), APC-labeled anti-IL-4 antibody (11B11), APC-labeled anti-IL-17A (eBio17B7), PE-labeled anti-IL- 21 antibody (mhalx21).

(9) Analysis by quantitative RT-PCR Total RNA was extracted from lung tissue or alveolar macrophages using TRIzol (Invitrogen). Quantitative real-time RT-PCR was performed using the QuantFast SYBRGreen RT-PCR kit (Qiagen). In the RT-PCR reaction, 80 ng of total RNA was reverse-transcribed for 10 minutes at 50 ° C., denatured at 95 ° C. for 5 minutes, and then subjected to 40 cycles of 95 ° C. for 10 seconds and 60 ° C. for 30 seconds. Fluorescence data was collected and analyzed using ABI PRISM 7900HT. The genes used and their primers are as follows.
Gapdh: 5'-TCTCCACACCTATGGTGCAA-3 '(SEQ ID NO: 1)
5'-CAAGAAACAGGGGAGCTGAG-3 '(SEQ ID NO: 2)
Fizz1: 5'- CCCTTCTCATCTGCATCTCC -3 '(SEQ ID NO: 3)
5'- AGGAGGCCCATCTGTTCATA -3 '(SEQ ID NO: 4)
Arg1: 5'- GTGAAGAACCCACGGTCTGT -3 '(SEQ ID NO: 5)
5'- CTGGTTGTCAGGGGAGTGTT -3 '(SEQ ID NO: 6)
Chi3I3: 5'- CCCACCAGGAAAGTACACAG -3 '(SEQ ID NO: 7)
5'-GAGGGAAATGTCTCTGGTGA-3 '(SEQ ID NO: 8)
Mrc1: 5'- CGCGAGGCAATTTTTAATCT -3 '(SEQ ID NO: 9)
5'-ATTTGCATTGCCCAGTAAGG-3 '(SEQ ID NO: 10)
Cxcl12: 5'-GGTTCTTCGAGAGCCACATC-3 '(SEQ ID NO: 11)
5'-TAATTTCGGGTCAATGCACA-3 '(SEQ ID NO: 12)
Il17a: 5'-TCCAGAAGGCCCTCAGACTA -3 '(SEQ ID NO: 13)
5'-CTCGACCCTGAAAGTGAAGG-3 '(SEQ ID NO: 14)
Rorc: 5'- AACCAGGCATCCTGAACTTG -3 '(SEQ ID NO: 15)
5'-CGTAGAAGGTCCTCCAGTCG-3 '(SEQ ID NO: 16)
Il17ra: 5'-TGTACCTCGAGGGTGCAGA-3 '(SEQ ID NO: 17)
5'- GGCCAGGATCTACCACAAAG -3 '(SEQ ID NO: 18)
Cxcl1: 5'- GCCTATCGCCAATGAGCTG -3 '(SEQ ID NO: 19)
5'-TCTGAACCAAGGGAGCTTCA-3 '(SEQ ID NO: 20)
Cxcl5: 5'- CTGCCCCTTCCTCAGTCATA -3 '(SEQ ID NO: 21)
5'- TGGATCCAGACAGACCTCCT -3 '(SEQ ID NO: 22)
Il21: 5'- GGACAGTGGCCCATAAATCA -3 '(SEQ ID NO: 23)
5'-CAGGGTTTGATGGCTTGAGT -3 '(SEQ ID NO: 24)
Il21r: 5'- ATGCGCTTGTCTCAATTCCT -3 '(SEQ ID NO: 25)
5'-CACGTAGTTGGAGGGTTCGT -3 '(SEQ ID NO: 26)
Il6: 5'-TGTGCAATGGCAATTCTGAT -3 '(SEQ ID NO: 27)
5'-GGTACTCCAGAAGACCAGAGGA-3 '(SEQ ID NO: 28)
Nos2: 5'- GCTCATGACATCGACCAGAA-3 '(SEQ ID NO: 29)
5'- TGTTGCATTGGAAGTGAAGC-3 '(SEQ ID NO: 30)
Il12b: 5'- AGGTCACACTGGACCAAAGG -3 '(SEQ ID NO: 31)
5'- AGGGTACTCCCAGCTGACCT -3 '(SEQ ID NO: 32)
Tnf-α: 5'- TGCCTATGTCTCAGCCTCTTC -3 ', (SEQ ID NO: 33)
5'-GGTCTGGGCCATAGAACTGA -3 '(SEQ ID NO: 34)

(10) Proliferation assay of human pulmonary artery smooth muscle cells Human pulmonary artery smooth muscle cells were purchased from Lonza. Human pulmonary artery smooth muscle cells from the first generation to the 6th generation were used. Human pulmonary artery smooth muscle cells were seeded in 96-well cell culture plates at 2 × 10 ³ cells / 100 μL / well. As the medium, SmBM (Lonza) containing 5% FBS and SingleQuot supplement (Lonza) was used. Two days before the assay, the medium was changed to SmBM containing 0.1% FBS, 10 mM L-glutamine, 100 U / mL penicillin, 100 μg / mL streptomycin.

To obtain macrophage conditioned medium, primary mouse alveolar macrophages were collected by bronchoalveolar lavage from mice bred under normoxic conditions, pooled, washed by centrifugation, cell number counted, and 96-well cell culture. Plates were seeded at 2 × 10 ⁵ cells / 100 μL / well. As the medium, DMEM containing 10% FBS, 2 mM L-glutamine, 100 U / mL penicillin, 100 μg / mL streptomycin was used. After culturing at 37 ° C. for 4 hours, the medium was replaced with serum-free DMEM. After overnight culture in serum-free medium, the cells were stimulated with recombinant mouse IL-21 (20 ng / mL) for 18 hours, washed with PBS, and cultured with DMEM alone for 24 hours. The medium was collected and diluted 2-fold with fresh DMEM containing 0.2% FBS and used as conditioned medium.

  Using this conditioned medium, human pulmonary artery smooth muscle cells were cultured for 3 days. If necessary, AMD3100 (1 μg / μL, Sigma) or a solvent (PBS), which is a chemical inhibitor of CXCR4, was added to the conditioned medium. Human pulmonary artery smooth muscle cells were stimulated with recombinant human IL-21 for 24 hours. Cell proliferation was assessed using the MTS assay (Cell Titer 96 kit, Promega). That is, 20 μL of MTS reagent was added to each well (100 μL), and OD490 was measured after incubation at 37 ° C. for 2 hours.

(11) Statistical analysis All data were expressed as mean ± standard error. Differences between multiple groups were compared by a one-way analysis of variance followed by a post hoc comparison using the Sheffe method. Student's t test was used to test the difference between the two groups. A statistically significant difference was determined when P <0.05.

〔Experimental result〕
Experiment 1: Examination of IL-6 expression kinetics in lungs of C57BL6 mice under hypoxic load C57BL / 6 mice were bred in a hypoxic chamber (10% oxygen) and 2, 4, 7, 14, and 28 after hypoxic load RNA was collected from the day mouse lung, and the expression level of IL-6 mRNA was analyzed by quantitative RT-PCR. The expression level of IL-6 mRNA increased about 8 times before loading on day 2 after hypoxia, but decreased to about 5 times on day 4 after loading, and baseline level on day 7 after loading. (Fig. 1).
When the expression site of IL-6 was examined by immunohistochemical staining with an anti-IL-6 antibody, the arterial and small artery endothelial cells (intima) of the mouse lung 2 days after hypoxia ) And smooth muscle cells (media) were strongly expressed (FIG. 2).

Experiment 2: Examination of the effect of IL-6 signal inhibition on pulmonary hypertension by anti-IL-6 receptor antibody (MR16-1) in hypoxia-induced pulmonary hypertension model IL-6 signal is mainly a transcription factor STAT3 Since it is mediated by (signal transducer and activator of transcription 3), activation of STAT3 in the lung 2 days after hypoxia, ie, phosphorylation state of 705 tyrosine residue of STAT3 was examined by Western blot. In the hypoxia control antibody administration group, STAT3 tyrosine phosphorylation was enhanced compared to the normoxia control antibody administration group, but in the hypoxia MR16-1 administration group, the phosphorylation was suppressed to the same level as the normoxia control antibody administration group. (Figure 3). From these results, it was shown that administration of anti-IL-6 receptor antibody efficiently suppresses STAT3 activation by IL-6 in mouse lung.

  In order to examine the influence of IL-6 signal inhibition by administration of anti-IL-6 receptor antibody on the pathology of hypoxia-induced pulmonary hypertension, control antibody (rat IgG) or MR16- 1 was administered. On the 28th day after hypoxia, the right ventricular systolic pressure (RVSP) of the mouse was measured with a right heart catheter, and then the heart of the mouse was removed and Fulton coefficient as an index of the degree of right ventricular hypertrophy The medial thickness coefficient, which is an index of pulmonary artery remodeling, was measured. The results are shown in FIGS. The mice in the hypoxic control antibody administration group showed a significant increase in the right ventricular systolic pressure, Fulton's coefficient and medial thickness coefficient compared to the normoxic control antibody administration group, but the hypoxic MR16-1 The increase was significantly suppressed in the administration group. These results indicate that administration of anti-IL-6 receptor antibody effectively suppresses hypoxia-induced PAH and pulmonary vascular remodeling in IL-6 signal inhibition.

Experiment 3: Investigation of macrophage dynamics in the lung by hypoxic load and the effect of IL-6 signal inhibition by anti-IL-6 receptor antibody In order to examine the infiltration of inflammatory cells in the lung after hypoxic load, The focus was on its dynamics. The results of examining the expression of F4 / 80 (a glycoprotein expressed exclusively in macrophages) in the lung 7 days after hypoxic load by Western blot are shown in FIGS. 6A and 6B. The hypoxia control antibody administration group showed a significant increase compared to the normoxia control antibody administration group, but the hypoxia MR16-1 administration group significantly suppressed the increase. The results similar to the Western blot were obtained by immunohistochemical staining for F4 / 80 (FIGS. 6C and D). From the above results, it was shown that IL-6 signal inhibition by anti-IL-6 receptor antibody administration suppresses macrophage infiltration into the lung induced by hypoxia.

  It has been reported that pulmonary macrophages acquire M2 macrophage-type characteristics due to hypoxia (Vegardi E et al. Circulation 123, 1986-1995, 2011). Thus, the effect of anti-IL-6 receptor antibody administration on macrophage polarity formation was examined. Bronchoalveolar lavage fluid was collected from C57BL / 6 mice exposed to hypoxia (10% oxygen) for 2, 4, 7 and 14 days, and the polarity of macrophages therein was identified by quantitative RT-PCR. The expression level of Fizz1 gene, one of the markers, peaked on the fourth day after hypoxia (FIG. 7). Therefore, when the expression states of M2 marker genes Fizz1, Arg1, Chi313, Mrc1 and Cxcl12 of macrophages collected on the fourth day after hypoxic load were compared between the control antibody administration group and the MR16-1 administration group, the hypoxia control administration In the group, the expression of these genes was significantly increased as compared to the normoxic control administration group, but the increase in the expression of these genes was significantly suppressed in the hypoxic MR16-1 administration group (FIGS. 8A to E). On the other hand, the expression levels of Nos2, IL-12β, and TNF-α, which are representative genes of M1 macrophages, were not significantly different between the two groups (FIGS. 9A to 9C).

  Even if macrophages collected by bronchoalveolar lavage were cultured in vitro and IL-6 and soluble IL-16 receptors were stimulated individually or costimulated, respectively, no change in the expression levels of M1 and M2 macrophage markers was observed. Therefore (FIGS. 10A to H), it was suggested that the above-mentioned hypoxia-induced macrophage M2 polarization phenomenon was not induced by direct stimulation with IL-6 and IL-6 receptor.

Experiment 4: Examination of effect of IL-6 signal inhibition by anti-IL-6 receptor antibody on Th17 cell and Th17 cytokine in hypoxia-induced pulmonary hypertension model Helper T cell plays a crucial role in macrophage polarity formation It has been reported in recent years. Therefore, it was examined whether anti-IL-6 receptor antibody administration affects the dynamics of Th1 cells and Th2 cells in the lung tissue 3 days after hypoxia. The lungs were excised from the mice of the normoxic control administration group, the hypoxia control administration group and the hypoxia MR16-1 administration group on the 3rd day of the test, and the experiment was conducted by the method described in the above experimental materials and method (8) .
FACS development of CD4 positive helper T cells with Th1 marker interferon-γ and Th2 marker IL-4 was compared between the control antibody administration group and the MR16-1 administration group, but no significant difference was observed (Fig. 11A-C).

  Next, the dynamics of Th17 cells, which are the third helper T cell fraction, were examined. C57BL / 6 mice were bred in a hypoxic chamber, and quantitative RT-PCR was performed using total RNA collected from the lungs 2, 4, 7, 14, and 28 days after hypoxia, and representative of Th17 cells. When the expression level of IL-17 mRNA, which is a major marker, was examined, a peak was observed on the second day after hypoxia, which increased approximately 6-fold before the load, but the expression continued after the seventh day after the load. It was rising (Fig. 12).

  Next, the influence of anti-IL-6 receptor antibody administration on the dynamics of Th17 cells in lung tissue on the second day after hypoxia was examined. That is, quantitative RT-PCR was performed using total RNA collected from the lungs on the second day after hypoxia, and IL-17A and other Th17 cell marker genes IL-17A, Rorc (Ror-γt), Cxcl1 The expression level of Cxcl5 mRNA was analyzed. As a result, a significant increase in the expression level was observed in the hypoxic control administration group as compared to the normoxic control administration group, but the increase in the expression level was significantly suppressed in the hypoxic MR16-1 administration group. (FIGS. 13A-D). Moreover, when the expression of IL-17 protein was examined by Western blotting, similar results were obtained (FIGS. 14A and B). Furthermore, when the kinetics of Th17 cells was confirmed by FACS, a significant increase was observed in the hypoxia control administration group compared to the normoxia control administration group, but in the hypoxia MR16-1 administration group, the hypoxia load was observed. The increase by was suppressed significantly (FIG. 15A, B).

Experiment 5: Examination of the effect of IL-17 signal inhibition on pulmonary hypertension pathology by anti-IL-17A neutralizing antibody in hypoxia-induced pulmonary hypertension model . For the purpose of examining the influence on pathogenesis, C57BL / 6 mice were bred in a hypoxic chamber, and a control antibody or an anti-IL-17A neutralizing antibody was administered according to the experimental protocol shown in FIG. On the 28th day after hypoxia, the right ventricular systolic pressure (RVSP) of the mouse was measured with a right heart catheter, and the heart of the mouse was removed to measure the Fulton coefficient. Neither RVSP nor Fulton coefficient was significantly different between the control antibody-administered group and the anti-IL-17A neutralizing antibody-administered group (FIGS. 17A and B). Although not shown, a significant increase was observed in both the control antibody administration group and the anti-IL-17A neutralization antibody administration group as compared to the normoxia control antibody administration group, and the pathology of hypoxia-induced PAH was formed. It was. From this result, it was revealed that IL-17 signal inhibition cannot suppress the pathogenesis of hypoxia-induced PAH.

Experiment 6: Examination of the effect of IL-6 signal inhibition by IL-6 receptor antibody on IL-21-producing Th17 cells in a hypoxia-induced pulmonary hypertension model Next, one of Th17 cytokines produced by Th17 cells The study was focused on IL-21. Quantitative RT-PCR was performed using total RNA collected from the lungs 2, 4, 7, 14, and 28 days after hypoxia, and the expression level of IL-21 mRNA was examined. The peak increased to about twice that before the load and was observed until the seventh day after the load, but the increase was observed after the 14th day, but returned to the baseline (FIG. 18).

  Next, quantitative RT-PCR was performed on the normoxia control administration group, the hypoxia control administration group, and the hypoxia MR16-1 administration group using total RNA collected from the lungs on the second day of the experiment, and IL-21 mRNA In the hypoxic control administration group, a significant increase in the expression amount was observed compared to the normoxic control administration group. However, in the hypoxia MR16-1 administration group, the expression amount increased. It was significantly suppressed (FIG. 19). Moreover, when the expression of IL-17 protein was examined by Western blotting, similar results were obtained (FIGS. 20A and 20B). Furthermore, when the kinetics of IL-21-producing Th17 cells (triple positive cells of CD4, IL-17a and IL-21) was confirmed by FACS, the hypoxia control administration group was significantly more than the normoxia control administration group. Although an increase was observed, in the hypoxic MR16-1 administration group, the increase due to the hypoxic load was significantly suppressed (FIGS. 21A to 21C).

Experiment 7: Polarization of alveolar macrophages by IL-21 and examination of proliferation of pulmonary artery smooth muscle cells Macrophages collected from bronchoalveolar lavage from C57BL / 6 mice were cultured in vitro, and serum was removed overnight. Cultured for 18 hours in the presence of -21 to examine the gene expression of macrophage markers. IL-21 stimulation increased the mRNA expression levels of the M2 macrophage marker genes Fizz1, Arg1, and Cxcl12 approximately 2-fold (FIGS. 22A-C), whereas the M1 macrophage marker genes Nos2, IL-12β, and No significant change was observed in the expression level of TNF-α (FIGS. 23A to 23C).

  Next, the relationship between IL-21 and pulmonary artery smooth muscle cell proliferation was examined. No proliferative response was seen when directly stimulated with IL-21 against human pulmonary artery smooth muscle cells (FIG. 24). On the other hand, when mouse alveolar macrophages collected by bronchoalveolar lavage were cultured in the presence of IL-21 and human pulmonary artery smooth muscle cells were cultured using the obtained culture supernatant (macrophage conditioned medium), proliferation was promoted. An effect was observed (FIG. 25). From this result, it was suggested that some humoral factors secreted by the action of IL-21 on macrophages act on human pulmonary artery smooth muscle cells to promote proliferation.

  Cxcl12, one of the humoral factors secreted by M2 macrophages, has been reported to be associated with pulmonary artery smooth muscle proliferation (Takeda Y et al. Nature 479, 122-126, 2011). Thus, when the human pulmonary artery smooth muscle cells were cultured by adding the selective inhibitor AMD3100 of CXCR4, which is a receptor for Cxcl12, to the macrophage conditioned medium, the growth promoting action by the macrophage conditioned medium was suppressed (FIG. 26). From the above results, it was suggested that M2 polarization of macrophages by IL-21 is necessary for proliferation of pulmonary artery smooth muscle cells.

Experiment 8: Examination of the effect of anti-IL-21 antibody on pulmonary hypertension pathology in hypoxia-induced pulmonary hypertension model In hypoxia-induced pulmonary hypertension model, hypoxia induced endothelial cells and smooth muscle cells in mouse pulmonary arteries. It was suggested that the expression of IL-6 was induced, and that IL-21 was secreted from Th17 cells downstream thereof plays a critical role in the pathogenesis of pulmonary hypertension. Therefore, we administered a control antibody or an anti-IL-21 neutralizing antibody to a hypoxia-induced pulmonary hypertension model to examine the effects on macrophage M2 polarity formation and pulmonary artery smooth muscle cell proliferation.

  On the 7th day after hypoxic load, in the hypoxic control antibody administration group, Fzz1-positive cells, which are M2 macrophage markers, were significantly increased compared to the normoxia control antibody administration group, but hypoxic IL-21 In the neutralizing antibody administration group, the increase was significantly suppressed (FIGS. 27A and B). In addition, on day 7 after hypoxic load, in the hypoxic control antibody administration group, phosphorylated histone H3 (pHH3) positive cells (arrows in the figure), which serve as an index of cell division of pulmonary artery smooth muscle cells, are normoxic control antibody. Although it increased significantly compared with the administration group, the increase was significantly suppressed in the hypoxic IL-21 neutralizing antibody administration group (FIGS. 28A and 28B). From these results, it was suggested that Th-21 cell-derived IL-21 positively regulates the proliferation of pulmonary artery smooth muscle cells through M2 polarization of macrophages.

Experiment 9: Examination of the effect of IL-21 receptor (IL-21R) gene deficiency (KO) on pulmonary hypertension pathology in a hypoxia-induced pulmonary hypertension model IL-21 receptor gene deficiency (IL-21RKO) mouse (Ozaki et al., Science 298, 1630-1634, 2002) and wild-type mice, respectively, to create hypoxia-induced pulmonary hypertension models, and to investigate the effects of IL-21R gene deficiency on the pathogenesis of pulmonary hypertension investigated. On the 28th day after hypoxia, the RVSP of the mouse was measured with a right heart catheter, and then the heart of the mouse was removed to measure the Fulton coefficient, and the lung tissue was EVG stained to measure the medial thickness coefficient of the pulmonary artery. . Hypoxia-loaded wild type mice showed significant increases in RVSP, Fulton's coefficient, and medial thickness coefficient compared to normoxic wild-type mice, but hypoxia-loaded IL-21RKO mice. These increases were significantly suppressed (FIGS. 29A-C). From this result, it became clear that IL-21 signal inhibition can suppress the pathogenesis process of hypoxia-induced hypertension.

  The present invention is not limited to the above-described embodiments and examples, and various modifications are possible within the scope shown in the claims, and technical means disclosed in different embodiments are appropriately combined. The obtained embodiment is also included in the technical scope of the present invention. Moreover, all the academic literatures and patent literatures described in this specification are incorporated herein by reference.

Claims (9)

  A pharmaceutical for the prevention and / or treatment of pulmonary hypertension comprising a substance that inhibits signal transduction from IL-21 as an active ingredient.   The medicament according to claim 1, wherein the substance that inhibits signal transduction from IL-21 is a substance that inhibits the interaction between IL-21 and IL-21 receptor.   Substances that inhibit the interaction between IL-21 and IL-21 receptor are anti-IL-21 antibody, anti-IL-21 receptor antibody, peptide that binds to IL-21 and peptide that binds to IL-21 receptor The medicament according to claim 2, which is a kind selected from the group consisting of:   The medicament according to claim 3, wherein the substance that inhibits the interaction between IL-21 and IL-21 receptor is an anti-IL-21 antibody.   A screening method for a therapeutic agent for pulmonary hypertension, characterized by using IL-21 and IL-21 receptor.   6. The method according to claim 5, wherein a substance that inhibits signal transduction from IL-21 is selected.   6. The method according to claim 5, wherein a substance that inhibits the interaction between IL-21 and IL-21 receptor is selected.   A step of contacting a test substance with cells expressing IL-21 and IL-21 receptor; a step of measuring a signal amount downstream of the IL-21 receptor; and a signal amount in the cell when the test substance is not contacted The method of Claim 6 including the process of selecting the test substance which reduces a signal amount compared with.   Comparing the test substance with IL-21 and IL-21 receptor, the step of measuring the binding level of IL-21 and IL-21 receptor, and the binding level when the test substance is not contacted And a step of selecting a test substance that decreases the binding level.