JP6274570B2 - Novel nucleoside derivative, polynucleotide containing the same, bottom-up three-dimensional cell culture method and nucleic acid aptamer selection method using the polynucleotide - Google Patents

Description

  The present invention relates to a novel nucleoside derivative, a polynucleotide containing the derivative, a bottom-up three-dimensional cell culture method and a nucleic acid aptamer selection method using the polynucleotide.

  In cell culture, a method of three-dimensionally culturing cultured cells is desired so that a living tissue can be mimicked more.

  As seen in Non-Patent Document 1, in the conventional three-dimensional cell culture method, cells are cultured using a special three-dimensional culture platform, or two-dimensionally cultured cells are inserted into a three-dimensional mold and engrafted there. Or a method of making it three-dimensional by repeating application of two-dimensional culture and scaffolding material or the like is known. In addition, a technique for processing a culture substrate by a top-down microfabrication technique (Non-patent Document 2) and culturing cells three-dimensionally there is also known. However, in these methods, production of the culture substrate takes time and cost, and a simpler three-dimensional culture method has been desired.

Advanced Materials, 2011,23,3506-3510 Scientific Reports, 2013, 3: 1316

  An object of the present invention is to find a modified nucleoside structure excellent in cell membrane affinity, to produce a polynucleotide (nucleic acid aptamer) using the structure, and to provide an efficient method for three-dimensional cell culture and a method for selecting a nucleic acid aptamer And

  As a result of intensive studies to solve the above problems, the present inventors have succeeded in synthesizing a novel nucleoside derivative having a lipophilic group and an amphiphilic group in its chemical structure, including this, It has been found that by culturing cells using a polynucleotide incorporating a thrombin binding sequence, fibrin gel is efficiently formed in the vicinity of the cells, and as a result, the cells can be efficiently three-dimensionally cultured. Then, it is known that fibrin gel is formed when human thrombin and fibrinogen are reacted under physiological conditions. At that time, it was found that human thrombin is taken into fibrin gel. Furthermore, it was clarified that the nucleic acid aptamer is also incorporated into the fibrin gel by complexing human thrombin with the nucleic acid aptamer having it as a ligand. In other words, this study showed for the first time that any functional group can be introduced into a fibrin gel using a thrombin-binding aptamer. In addition, the inventors have found that a polynucleotide using a novel nucleoside derivative can be efficiently used for selection of nucleic acid aptamers, and completed the present invention.

That is, the present invention is as follows.
[1] A nucleoside derivative represented by any one of the following formulas (I-1) to (I-4) or a salt thereof.
(In the formulas (I-1) to (I-4), R ¹ is a hydrogen atom (—H), a fluorine atom (—F), a hydroxyl group (—OH), an amino group (—NH ₂ ), or a mercapto group. (—SH), R ² independently represents a hydrogen atom (—H) or a hydroxyl protecting group, R ³ independently represents a hydrogen atom (—H) or a hydrocarbon group having 1 to 6 carbon atoms, A represents —CONH— or —CH ₂ NHCO—, Y represents a divalent hydrocarbon group having 2 to 12 carbon atoms which may contain a branched structure and / or an unsaturated bond, and n represents an integer of 2 to 20 P represents an integer of 1 to 6, q represents an integer of 1 to 20, and r represents an integer of 1 to 6.)
[2] A 5′-phosphate ester, a phosphorothioate derivative or a salt thereof of the nucleoside derivative according to [1].
[3] A substrate solution for polynucleotide synthesis comprising the 5′-phosphate ester, phosphorothioate compound or a salt thereof according to [2], or a labeled nucleotide derivative having a labeling substance introduced thereto.
[4] A polynucleotide synthesis reagent comprising the polynucleotide synthesis substrate solution according to [3].
[5] Production of a polynucleotide, characterized in that the 5′-phosphate ester, phosphorothioate compound or salt thereof according to [2], or a labeled nucleotide derivative having a labeling substance introduced thereto is used as a substrate for synthesis. Method.
[6] A polynucleotide comprising a 5′-phosphate ester of the nucleoside derivative according to [2] and / or a phosphorothioate derivative thereof as a structural unit.
[7] The polynucleotide according to [ 6 ] , comprising a ligand binding sequence.
[8] The polynucleotide according to [7], wherein the ligand binding sequence is thrombin, fibrin, or fibrinogen binding sequence.
[9] A cell culture method, comprising culturing cells using the polynucleotide according to [7] or [8] and thrombin, or the polynucleotide, thrombin and fibrinogen.
[10] A fibrin gel comprising the polynucleotide according to [7] or [8] and thrombin, or the polynucleotide, thrombin and fibrinogen.
[11] The polynucleotide according to [6], which is a nucleic acid aptamer.
[12] A polynucleotide library comprising the polynucleotide according to [6] or [11].
[13] A method for selecting a nucleic acid aptamer, comprising a step of selecting a target substance-binding polynucleotide using the polynucleotide library according to [12].

The polynucleotide comprising the nucleoside derivative of the present invention has a lipophilic group and an amphiphilic group introduced in its chemical structure, and thus is easily anchored to the cell membrane and interacts with macropolymer molecules such as fibrin. It has the feature of showing.
When the polynucleotide containing the nucleoside derivative of the present invention contains a ligand binding sequence, it can be immobilized on the cell surface in a state of being bound to the ligand. This concentrates the ligand component on the cell surface, making it easier for the cell to form a scaffold or an adhesion surface, and the interaction between the lipophilic group and the amphiphilic group and the generated fibrin to adhere cells. Is promoted, and the cells gather and grow three-dimensionally.
The present invention provides a methodology for enabling three-dimensional growth of cells simply by adding a reagent or the like to a medium. As a result, it is possible to omit complicated operations such as repeated application of cells and scaffolding, as in conventional methods, and special three-dimensional culture platforms. In addition, because aggregate formation is left to the spontaneous growth of cells, oxygen, nutrients, excrement, etc. are transported by co-culture with vascular endothelial cells, etc., without the need for conventional top-down microfabrication techniques, etc. Production of artificial tissues / organs having a vascular network can be expected. In addition, since various functional groups can be introduced into fibrin gel, which is a scaffold for cell growth, through thrombin-binding aptamers, it is considered that not only tissue culture but also cell tissue formation can be inhibited. It is expected that new types of anticancer agents such as inhibitors will be developed.
Such a bottom-up three-dimensional cell culture method is expected to be applied to organ formation and tissue regeneration in test tubes and incubators. The present invention is expected to be widely applied to critical fields in life innovation such as regenerative medicine, drug development, development / differentiation, and research on elucidation of disease mechanisms.
By using a plurality of modified nucleoside triphosphates of the present invention at the same time, multiple modified DNA can be synthesized enzymatically, and nucleic acid aptamers can be efficiently selected by the SELEX method or the like.

An electrophoretogram of a polynucleotide containing a modified adenosine derivative A5 synthesized by PCR. An electrophoretogram of a polynucleotide comprising a modified thymidine derivative T5 synthesized by PCR. An electrophoretogram of a polynucleotide containing a modified cytidine derivative C3 synthesized by PCR. An electrophoretogram of a polynucleotide containing a modified guanosine derivative G12-1 synthesized by PCR. Electrophoresis photograph of a polynucleotide synthesized by PCR and containing one modified nucleoside triphosphate. Electrophoretic photograph of a polynucleotide synthesized by PCR and containing two modified nucleoside triphosphates. An electrophoretogram of a polynucleotide synthesized by PCR and containing four types of modified nucleoside triphosphates. Electrophoretic photograph of a polynucleotide (15% modified DNA) containing 4 types of modified nucleoside triphosphates synthesized by PCR (5% MeCN added). The arrow indicates the target PCR product. Electrophoresis photograph of polynucleotide (20% modified DNA) synthesized by PCR (5% MeCN added) and containing 4 types of modified nucleoside triphosphates. The arrow indicates the target PCR product. Photomicrographs before and after dissociation of cells cultured with aptamer or cell adhesion factor added. The description of (A) to (D) is shown in Table 10. Photomicrographs before and after dissociation of cells cultured with aptamer or cell adhesion factor added. The description of (A) to (D) is shown in Table 10. Photomicrographs immediately after the start of culture (0 hour) and after 72 hours of cells cultured with the addition of aptamers or cell adhesion factors at various concentrations. The explanation of (A) to (D) is shown in Table 11. Photomicrographs immediately after the start of culture (0 hour) and after 72 hours of cells cultured with the addition of aptamers or cell adhesion factors at various concentrations. The explanation of (A) to (D) is shown in Table 11. Photomicrographs immediately after the start of culture (0 hour) and after 72 hours of cells cultured with the addition of aptamers or cell adhesion factors at various concentrations. The description of (A) to (D) is shown in Table 12. Photomicrographs immediately after the start of culture (0 hour) and after 72 hours of cells cultured with the addition of aptamers or cell adhesion factors at various concentrations. The description of (A) to (D) is shown in Table 12. The graph which shows the human thrombin activity in presence of TBA or TBA-m4. The graph which shows the aptamer uptake | capture measurement to the fibrin gel by a fluorescence polarization method. The vertical axis represents (amount of change in the degree of fluorescence polarization), and the horizontal axis represents the fibrinogen concentration. The photograph which shows the influence on a cultured cell by fibrinogen, thrombin, and / or TBA-m4 addition. (A) Control (no addition), (B) Fibrinogen addition, (C) Fibrinogen and DNA-thrombin complex added, (D) Fibrinogen and TBA-m4-thrombin complex added.

  In describing the nucleoside derivative and salt thereof, the 5′-phosphate ester of the nucleoside derivative and salt thereof, and the polynucleotide, specific examples will be described, but the following contents are included unless departing from the gist of the present invention. However, the present invention is not limited to this, and can be implemented with appropriate modifications.

<Nucleoside derivative or salt thereof>
The nucleoside derivative which is one embodiment of the present invention is represented by any one of the following formulas (I-1) to (I-4). Note that salts obtained from such nucleoside derivatives are also included in the scope of the present invention, and hereinafter, the nucleoside derivatives and salts thereof may be abbreviated as “nucleoside derivatives of the present invention”.

(In the formulas (I-1) to (I-4), R ¹ is a hydrogen atom (—H), a fluorine atom (—F), a hydroxyl group (—OH), an amino group (—NH ₂ ), or a mercapto group. (—SH), R ² independently represents a hydrogen atom (—H) or a hydroxyl protecting group, R ³ independently represents a hydrogen atom (—H) or a hydrocarbon group having 1 to 6 carbon atoms, A represents —CONH— or —CH ₂ NHCO—, Y represents a divalent hydrocarbon group having 2 to 10 carbon atoms which may contain a branched structure and / or an unsaturated bond, and n represents an integer of 2 to 20 P represents an integer of 1 to 6, q represents an integer of 1 to 20, and r represents an integer of 1 to 6.)

In formulas (I-1) to (I-4), R ¹ represents a hydrogen atom (—H), a fluorine atom (—F), a hydroxyl group (—OH), an amino group (—NH ₃ ), or a mercapto group ( -SH), it is preferably a hydrogen atom, that is, a sugar moiety such as a nucleoside derivative is preferably deoxyribose.

Each R ² independently represents a hydrogen atom (—H) or a protecting group for a hydroxyl group,
The protecting group is not particularly limited as long as it is used as a protecting group for a hydroxyl group. For example, ether type protective groups such as methyl group, benzyl group, p-methoxybenzyl group, tert-butyl group; acyl type protective groups such as acetyl group, pivaloyl group, benzoyl group; trimethylsilyl group, triethylsilyl group, tert-butyldimethyl Examples include silyl ether protecting groups such as silyl group, triisopropylsilyl group, and tert-butyldiphenylsilyl group.

R ³ independently represents a hydrogen atom or a hydrocarbon group having 1 to 6 carbon atoms, and the carbon number of R ³ is preferably 5 or less, more preferably 4 or less.

A is -CONH- or represents the _-CH 2 NHCO-, preferably -CONH-, in which case, a structure of the following (I'-1) ~ (I' -4).

Y represents a divalent hydrocarbon group having 2 to 10 carbon atoms which may contain a branched structure and / or an unsaturated bond, and the carbon number of Z is preferably 8 or less, more preferably 6 or less. It is. As Z, ethylene group (—CH ₂ —CH ₂ —), vinylene group (—CH═CH—), isopropylene group (—CH ₂ —CH (CH ₃ ) —), isopropylenylene group (—CH═ C (CH ₃
)-), N-butylene group (—CH ₂ —CH ₂ —CH ₂ —CH ₂ —), n-butanedienylene group (—CH═CH—CH═CH—) and the like.

  Although n represents the integer of 2-20, it is more preferable that it is an integer of 10-18. p represents an integer of 1 to 6, and is more preferably an integer of 1 to 3. q represents an integer of 1 to 20, and more preferably an integer of 10 to 18. r represents an integer of 1 to 6, and is more preferably an integer of 1 to 3.

More specifically, the following compounds (I ″ -1) to (I ″ -4) are exemplified (
m represents an integer of 2 to 20).

  The method for producing the nucleoside derivative and the like of the present invention is not particularly limited, and can be produced by appropriately combining known synthetic methods. For example, it can be produced according to the methods described in the examples below.

<5'-phosphate ester of nucleoside derivative, phosphorothioate or salt thereof>
The nucleoside derivative and the like of the present invention are useful compounds for producing a nucleic acid aptamer excellent in binding affinity and target diversity. The nucleotide obtained by phosphorylating the nucleoside derivative of the present invention, that is, the nucleoside derivative 5 A '-phosphate ester or a phosphorothioate form is also an embodiment of the present invention. In addition, the salt obtained from the 5′-phosphate ester or phosphorothioate compound of the present invention is also included in the scope of the present invention.

The 5′-phosphate ester and phosphorothioate compound of the present invention can be represented by any one of the following formulas (II-1) to (II-4), for example.

In formulas (II-1) to (II-4), each Z independently represents an oxygen atom or a sulfur atom, and R ¹ , R ² , R ³ , A, Y, n, p, q, and r Are synonymous with the aforementioned nucleoside derivatives of the present invention.

More preferable examples of the 5′-phosphate ester of the present invention include the following.

  The 5'-phosphate ester or phosphorothioate form of the present invention may be in the form of a labeled nucleotide derivative into which a labeling substance such as a fluorescent substance is introduced. A polynucleotide containing a 5'-phosphate ester or a phosphorothioate conjugated with a labeling substance as a constituent unit can be a useful probe or the like. The labeling substance is not particularly limited as long as it is a known substance used as a label for nucleic acids, and examples thereof include fluorescent labeling substances such as fluorescein, Cy5, tetramethylcarboxyrhodamine, and pyrene. The labeling substance can be introduced into, for example, the amino group of 5'-phosphate ester or phosphorothioate. In addition to fluorescent labels, functional modified polynucleotides such as catalysts and nucleic acid aptamers can also be synthesized by introducing various functional substances into the 5'-phosphate ester or phosphorothioate form of the present invention. It is also possible to bind an inhibitor.

<Polynucleotide Synthesis Substrate Solution / Polynucleotide Synthesis Reagent / Polynucleotide Production Method>
The 5′-phosphate ester and salt thereof, phosphorothioate compound and salt thereof, or a labeled nucleotide derivative having a labeling substance introduced into them is a synthetic substrate useful for synthesizing a polynucleotide. A polynucleotide synthesis substrate solution containing at least one of these, a polynucleotide synthesis reagent containing the polynucleotide synthesis substrate solution, and a method for producing a polynucleotide using these as a synthesis substrate are also one aspect of the present invention. .

<Polynucleotide>
The nucleoside derivative or the like of the present invention is a useful compound for producing a nucleic acid aptamer excellent in binding affinity or target diversity. However, a nucleic acid produced using the nucleoside derivative or the like of the present invention, that is, 5 of the present invention. A polynucleotide containing a '-phosphate ester and / or its phosphorothioate as a structural unit is also an embodiment of the present invention (hereinafter, may be abbreviated as “polynucleotide of the present invention”). In addition, the labeled polynucleotide which contains 5'-phosphate ester which introduce | transduced labeling substances, such as a fluorescent substance, as a structural unit shall also be contained in the scope of the present invention.
Examples of the polynucleotide of the present invention include those containing at least a nucleotide structure that can be represented by any one of the following formulas (III-1) to (III-4).

In formulas (III-1) to (III-4), Z independently represents an oxygen atom or a sulfur atom, and R ¹ , R ² , R ³ , A, Y, n, p, q, and r Are synonymous with the aforementioned nucleoside derivatives of the present invention. In addition, the parentheses in the formulas (III-1) to (III-4) represent the binding positions with adjacent nucleotide structures, respectively. Further, “the phosphorothioate form” means that Z is a sulfur atom.

The polynucleotide of the present invention is not particularly limited as long as it contains the 5′-phosphate ester of the present invention and / or its phosphorothioate compound as a structural unit, but may contain a plurality of 5′-phosphate esters of the present invention. A plurality of types (two or more types of adenosine derivatives, cytidine derivatives, thymidine derivatives, and guanosine) may be included. The number of bases of the polynucleotide of the present invention is usually 10 or more, preferably 15 or more, and is usually 200 or less, preferably 100 or less, more preferably 70 or less.

The method for producing the polynucleotide of the present invention is not particularly limited, and can be suitably produced by a known synthesis method using, for example, the 5′-phosphate ester or phosphorothioate compound of the present invention as a raw material (substrate). . For example, in the case of DNA production, a polynucleotide can be synthesized using a DNA synthesizer, or a polynucleotide can be synthesized by PCR. When a polynucleotide is synthesized by PCR using the 5′-phosphate ester of the present invention as a substrate, acetonitrile is preferably added to the reaction system. In particular, when PCR is performed using a plurality of types of 5′-phosphate esters of the present invention, it is preferable because the amplification efficiency of the polynucleotide is improved. After the polynucleotide is synthesized, the polynucleotide of the present invention can be produced by purification using anion exchange column chromatography or the like.
In addition, the phosphorothioate structure in the polynucleotide of the present invention can be formed by appropriately adopting known methods for introducing phosphorothioate groups.

The polynucleotide of the present invention may be a polynucleotide into which a labeling substance such as a fluorescent substance is introduced, but it can also be used as a probe for a microarray in a single strand.
In addition, the use of the polynucleotide of the present invention is not particularly limited and can be appropriately used for known uses such as a catalyst and a nucleic acid aptamer, but is preferably used as a nucleic acid aptamer. For example, it can also be used as a nucleic acid drug for regulating gene expression such as antisense molecules and antigene molecules. The polynucleotide of the present invention can exhibit excellent cell membrane permeability, gene suppression activity, alleviation of side effects, and nuclease resistance, and can be used as an effective nucleic acid drug.

<Method of selecting nucleic acid aptamer>
The polynucleotide of the present invention can be used in a polynucleotide library used in the SELEX method, etc., and a polynucleotide library containing the polynucleotide of the present invention, as well as target substance binding properties using this polynucleotide library. A method for selecting a nucleic acid aptamer including a step of selecting a polynucleotide is also an embodiment of the present invention.
The polynucleotide library is not particularly limited as long as it includes the polynucleotide of the present invention, but preferably includes a plurality of types of polynucleotides including random sequences.
The selection method is not particularly limited as long as it includes a step of selecting a target substance-binding polynucleotide using a polynucleotide library. For example, the selection method can include a step performed in the SELEX method. In the SELEX method, the target substance is usually immobilized on a carrier such as a bead, a polynucleotide library is added thereto, the nucleic acid binding to the target substance is recovered, the recovered polynucleotide is amplified, and the amplified polynucleotide is recovered. A method for obtaining a target substance-binding aptamer by repeating a series of steps of adding nucleotides to a target substance again, concentrating polynucleotides having high specificity and binding power to the target substance, and determining the base sequence thereof It is.
According to the selection method of the present invention, various functional nucleic acids such as nucleic acid aptamers for various biological substances and ribozymes that catalyze a specific reaction can be screened. That is, aptamers and ribozymes having physiological activity can be obtained by synthesizing a plurality of random polynucleotides and selecting a specific polynucleotide from the enzyme activity as an index.

<Cell targeting of a ligand using the polynucleotide of the present invention>
The polynucleotide of the present invention may be a polynucleotide library containing random sequences, but those containing sequences to which thrombin, fibrinogen or fibrin can bind (thrombin or fibrinogen binding aptamer) are preferable. Further, the binding may inhibit thrombin activity to some extent. Furthermore, it may be used with other aptamers that contain a ligand binding sequence to which other ligands can bind.
Since the polynucleotide of the present invention has a lipophilic or amphiphilic group, such a ligand-binding sequence can be targeted to a component of a cell membrane or the like.

  Examples of aptamer ligands used together with thrombin and fibrinogen binding aptamers include low molecular weight compounds, peptides, proteins, nucleic acids, drugs, and the like, but cell growth factors and cell adhesion factors are preferred.

  Cell growth factors include vascular endothelial growth factor, fibroblast growth factor, platelet-derived growth factor, insulin-derived growth factor, transforming growth factor, hepatocyte growth factor, bone morphogenetic protein, nerve growth factor, epidermal growth factor, etc. Illustrated.

Examples of the cell adhesion factor include the following.
Scaffolding component (extracellular matrix)
Collagen
Fibronectin
Laminin
Elastin
Proteoglycan
Entactin
Vitronectin
Fibrinogen
Tenascin
Osteopontin nidogen
Thrombospondin hyaluronic acid
Adhesive component Integrin cadherin selectin claudin occludin immunoglobulin family (ICAM, MCAM, VCAM, CD4, 8 etc.)

  The ligand binding sequence may be a known sequence that is known to bind to a certain ligand, or a sequence selected by the SELEX method or the like.

<Cell culture method>
Since the polynucleotide of the present invention has a binding sequence of thrombin, fibrin, or fibrinogen, a fibrin gel can be formed in the vicinity of the cell when the cell is cultured in addition to the medium. As a result, the cells can easily form a scaffold or an adhesion surface, the adhesion between the cells is promoted, and the cells are assembled and cultured three-dimensionally.

The cell type is not particularly limited, and examples thereof include fibroblasts, hepatocytes, epithelial cells, pancreatic β cells, adipocytes, nerve cells, osteoblasts, vascular endothelial cells and the like.
The culture conditions such as the medium to be used can be appropriately selected according to the cell type, but as the medium, the minimum essential medium (MEM), Dulbecco's modified Eagle medium (DMEM), Iskov's modified Dulbecco medium (IMDM), Ham's F -12 medium and the like.

The concentration of the polynucleotide of the present invention added to the medium is preferably 120 nM.
It is preferable to add thrombin and fibrinogen simultaneously to the medium.
Thrombin is preferably added at a concentration of 120 nM.
Fibrinogen is preferably added at a concentration of 600 nM.
In this case, the polynucleotide of the present invention and thrombin, or the polynucleotide of the present invention and thrombin and fibrinogen may be added simultaneously, but pretreatment with the polynucleotide of the present invention is preferred.

The fibrin gel formed by using the polynucleotide of the present invention and thrombin, or the polynucleotide of the present invention and thrombin and fibrinogen can also be used for pharmaceutical applications such as tissue adhesion and membrane formation.
In addition, the fibrin gel obtained by using the polynucleotide of the present invention and thrombin, or the polynucleotide of the present invention and thrombin and fibrinogen is also included in the scope of the present invention. Since a functional group can be arbitrarily introduced into the fibrin gel using a thrombin-binding aptamer, a functional group according to the purpose can be introduced for use in medicine. For example, a functional group that inhibits cell tissue formation can be introduced and used as an anticancer agent.

  Further, in the present invention, it has been found for the first time that a complex of thrombin and a thrombin binding substance is incorporated into a fibrin gel. Therefore, a fibrin gel containing a thrombin binding substance and thrombin or a thrombin binding substance and thrombin and fibrinogen is also included in the scope of the present invention. The thrombin binding substance is not limited to the thrombin binding aptamer containing the polynucleotide of the present invention, and may be an antithrombin antibody or a thrombin binding sugar chain. Furthermore, the above functional groups may be introduced into these thrombin binding substances. Such a fibrin gel containing a thrombin-binding substance and thrombin or a thrombin-binding substance and thrombin and fibrinogen can also be used for pharmaceutical applications such as tissue adhesion and membrane formation. In addition, a functional group that inhibits cell tissue formation can be introduced into a thrombin-binding substance and used as an anticancer agent.

  Hereinafter, the present invention will be described more specifically with reference to examples and comparative examples, but can be appropriately changed without departing from the gist of the present invention. Accordingly, the scope of the present invention should not be construed as being limited by the specific examples shown below.

Synthesis of thymidine derivative T2.
Vacuum-dried 1,12-diaminododecane (2.153 g, 10.7 mmol, FW 200.36) was suspended in Dry-DMF (100 mL) and DIPEA (1.8 mL, 10.3 mmol, FW 129.55, d = 0.742 g / mL) Was added. (E) -5- (2-carboxyvinyl) -2'-deoxyuridine (300 mg, 335 μmol, FW 298.25), PyBOP (631 mg, 1.21 mmol, FW 520.39), HOBt ・ H ₂ O (210 mg, 1.37 mmol , FW 153.44)
Is dissolved in Dry-DMF (3 mL) and DIPEA (3.5 mL, 20. 0 mmol) is added dropwise.
Stir for hours. After completion of the reaction, the reaction solution was distilled off under reduced pressure and dried in vacuum. The vacuum-dried residue was dissolved in Dry-MeOH (5 mL), TEA (450 μL, 3.24 mmol, FW 101.19, d = 0.728 g / mL), TFA Ethyl Ester (3.6 mL, 30.2 mmol, FW 142.08, d = 1.190 g / mL) was added, and the mixture was stirred at room temperature for 2 hours. After completion of the reaction, the reaction solution was distilled off under reduced pressure, azeotroped with CHCl ₃ (10 mL) three times, and vacuum-dried. The vacuum-dried residue was dissolved in Dry-DMF (5 mL), and imidazole (699 mg, 10.3 mmol, FW 68.08) and TBDMS-Cl (759 mg, 504 μmol, FW 150.72) were added to Dry-DMF (2 mL). The dissolved one was added and stirred at room temperature for 5 hours. After completion of the reaction, the reaction solution was evaporated under reduced pressure, and the residue was dissolved in a mixture of AcOEt: Et ₂ O = 1: 1, and washed with saturated aqueous sodium hydrogen carbonate and saturated brine. The organic phase was dried over MgSO ₄ and suction filtered, and the filtrate was distilled off under reduced pressure. Silica gel column chromatography (Silica gel 60, 63-210 μm, 100% CH ₂ Cl ₂ → 3% MeOH / CH ₂ Cl ₂ ), (Silica gel 60, 40-50 μm, 30% → 50% AcOEt / Hexane)) gave compound T2.

Yield: 400 mg Yield: 49%

¹ H NMR (400 MHz, CDCl ₃ ) δ 7.85 (1H, s) 7.08-7.19 (2H, m) 6.27 (1H, dd) 4.39 (1H, m) 3.98 (1H, m) 3.89 (2H, m) 3.28 -3.37 (4H, m) 2.32 (1H, m) 1.99 (1H, m) 1.48-1.58 (4H, m) 1.24-1.28 (17H, m) 0.87-0.90 (18H, m) 0.06-0.13 (12H, m ); ESI-MS (positive ion mode) m / z, found ＝ 805.1, calculated for [(M + H) ⁺ ] ＝ 805.5

Synthesis of thymidine derivative T3
Compound T2 (387 mg, 481 μmol, FW 805.13) dried in vacuum was dissolved in NH ₃ / MeOH solution, 28% NH ₃ aqueous solution was added, and the mixture was stirred at room temperature. When the reaction did not proceed, the reaction solution was distilled off under reduced pressure, and NH ₃ / MeOH solution and 28% NH ₃ aqueous solution were added again. After completion of the reaction, the reaction solution was distilled off under reduced pressure and dried in vacuum. The vacuum-dried residue was dissolved in Dry-DMF (2 mL), mPEG acid (329 mg, 559 μmol, FW588.7), HBTU (289 mg, 762 μmol, FW 379.25), HOBt ・ H ₂ O (114 mg , 762 μmol,
A solution obtained by adding DIPEA (200 μL, 1.15 mmol, FW 129.55, d = 0.742 g / mL) to a Dry-DMF solution (3 mL) of FW 153.44) was added dropwise and stirred at room temperature for 1 hour. After completion of the reaction, the reaction mixture was evaporated under reduced pressure, the residue was dissolved in ethyl acetate, and washed with saturated aqueous sodium hydrogen carbonate and saturated brine. The organic phase was dried over MgSO ₄ and suction filtered, and the filtrate was distilled off under reduced pressure. This was purified by silica gel column chromatography (Silica gel 60, 63-210 μm, 2% → 3% MeOH / CHCl ₃ ) to obtain compound T3.

Yield: 473 mg Yield: 74%

¹ H NMR (400 MHz, CDCl ₃ ) δ 7.86 (1H, s) 7.10-7.27 (2H, m) 6.29 (1H, dd) 4.41 (1H, m) 4.00 (1H, m) 3.80 (2H, m) 3.73 (2H, t) 3.64-3.66 (46H, m) 3.38 (3H, s) 3.34 (2H, m) 3.22 (2H, m) 2.47 (2H, t) 2.35 (1H, m) 2.01 (1H, m) 1.45 -1.56 (4H, m) 1.24-1.29 (18H, m) 0.90-0.93 (18H, m) 0.09-0.16 (18H, m); ESI-MS (positive ion mode) m / z, found = 1301.2, calculated for [(M + Na) ⁺ ] = 1301.8

Synthesis of thymidine derivative T4
Compound T3 (436 mg, 341 μmol, FW 1279.79), which had been vacuum-dried, was dissolved in MeOH (3 mL), and TREAT-HF (1.11 mL, 6.80 mmol, FW 161.21, d = 0.989 g / mL) was added at room temperature. Stir for 2 hours. After completion of the reaction, the reaction solution was evaporated under reduced pressure, the residue was dissolved in AcOEt, and washed with saturated aqueous sodium hydrogen carbonate and saturated brine. Since the target product was present in the organic and aqueous phases, the organic phase was dried over MgSO ₄ and filtered with suction, and the filtrate was distilled off under reduced pressure, followed by silica gel column chromatography (Silica gel 60, 63-210mesh, 2% → 3% Purification by MeOH / CHCl ₃ ) gave compound 3 . The aqueous phase was purified by silica gel column chromatography (Wakosil 40C18, 30-50 μm, 10% → 90% MeOH / H ₂ O) to give compound T4.

Yield: 251 mg Yield: 66%

¹ H NMR (400 MHz, CD ₃ OD) δ 8.38 (1H, s) 7.04-7.23 (2H, m) 6.28 (1H, t) 4.43 (1H, m) 3.81 (2H, m) 3.81 (2H, m) 3.72 (2H, t) 3.59-3.63 (45H, m) 3.36 (3H, s) 3.25 (2H, t) 3.17 (2H, t) 2.43 (2H, t) 2.23-2.36 (2H, m) 1.48-1.55 ( 4H, m) 1.31 (17H, m); ESI-MS (positive ion mode) m / z, found = 1073.9, calculated for [(M + Na) ⁺ ] = 1073.6

Synthesis of thymidine derivative T5
Vacuum-dried compound T4 (100 mg, 95.1 μmol, FW 1051.26) was azeotroped twice with Dry-DMF (5 mL), azeotroped three times with Dry-MeCN (10 mL), N, N, N ′, N′-Tetramethyl-1,8-naphthalenediamine (32 mg, 149 μmol, FW 214.31) was added and vacuum-dried overnight. This was dissolved in Dry-Trimethyl phosphate (1 mL) and stirred for 30 minutes under ice cooling. Phosphoryl chloride (13 μL, 143 μmol, FW 153.33, d = 1.645 g / mL) was added under ice cooling, and the mixture was stirred for 45 minutes. Then add Dry-Tributhyl amine (91 μL, 381 μmol, FW 185.35, d = 0.775 g / mL) and 0.5 M Diphosphoric acid in DMF (1.20 mL, 600 μmol, FW 177.98) under ice-cooling. Stir for hours. After stirring for 5 minutes in an ice bath, TEAB buffer was added to quench the reaction. The reaction solution was distilled off under reduced pressure and concentrated, followed by separation with distilled water and Et ₂ O. The aqueous phase was distilled off under reduced pressure and concentrated, and then purified by anion exchange column chromatography and medium pressure column chromatography to obtain compound T5.

Yield: 18 mg Yield: 15%

ESI-MS (negative ion mode) m / z, found = 1288.4, calculated for [(MH) ^- ] = 1289.5

Synthesis of adenosine derivative A2
Vacuum-dried 1,12-diaminododecane (3.556 g, 17.7 mmol, FW 200.36) was suspended in Dry-DMF (80 mL) and DIPEA (2.6 mL, 14.9 mmol, FW 129.55, d = 0.742 g / mL) Was added. Compound A1 (473 mg, 1.48 mmol, FW 320.30), PyBOP (922 mg, 1.77 mmol, FW 520.39), HOBt ・ H ₂ O (297 mg, 1.94 mmol, FW 153.44) were dissolved in Dry-DMF (26 mL). What added DIPEA (5.3 mL, 30.4 mmol) was dripped, and it stirred at room temperature for 1.5 hours. After completion of the reaction, the reaction solution was distilled off under reduced pressure and dried in vacuum. The vacuum-dried residue was dissolved in Dry-MeOH (8 mL), TEA (876 μL, 6.30 mmol, FW 101.19, d = 0.728 g / mL), TFA Ethyl Ester (5.3 mL, 44.3 mmol, FW 142.08, d = 1.190 g / mL) was added, and the mixture was stirred at room temperature for 2 hours. After completion of the reaction, the reaction solution was distilled off under reduced pressure, azeotroped with CHCl ₃ (10 mL) three times, and vacuum-dried. The vacuum-dried residue was dissolved in Dry-DMF (5 mL), and imidazole (1.020 g, 15.0 mmol, FW 68.08) and TBDMS-Cl (1.128 g, 7.48 mmol, FW 150.72) were added to Dry-DMF (5 mL). The dissolved one was added and stirred at room temperature for 3 hours. After completion of the reaction, the reaction solution was evaporated under reduced pressure, and the residue was dissolved in a mixture of AcOEt: Et ₂ O = 1: 1, and washed with saturated aqueous sodium hydrogen carbonate and saturated brine. The organic phase was dried over MgSO ₄ and suction filtered, and the filtrate was distilled off under reduced pressure. This was purified by silica gel column chromatography (Silica gel 60, 63-210 μL, 0.5 → 5% MeOH / CH ₂ Cl ₂ ), (Silica gel 60, 40-50 μL, 30% → 50% AcOEt / hexane). Compound A2 and compound A2-1 were obtained.

Compound A2
Yield: 288 mg Yield: 24%

¹ H NMR (400 MHz, CDCl ₃ ) δ 8.29 (1H, s) 7.76 (1H, d) 7.47 (1H, s) 6.65 (1H, t) 6.14 (1H, d) 4.53 (1H, m) 3.96 (1H , m) 3.77 (2H, m) 3.30-3.36 (4H, m) 2.30-2.43 (2H, m) 1.50-1.55 (4H, m) 1.24-1.28 (19H, m) 0.87-0.91 (18H, m) 0.05 -0.09 (12H, m); ESI-MS (positive ion mode) m / z, found = 827.7, calculated for [(M + H) ⁺ ] = 827.5

Compound A2-1
Yield: 176 mg Yield: 17%

¹ H NMR (400 MHz, CDCl ₃ ) δ 8.32 (1H, s) 7.77 (1H, d) 7.51 (1H, s) 6.71 (1H, t) 6.18 (1H, d) 4.62 (1H, m) 4.04 (1H , m) 3.86 (2H, m) 3.34-3.42 (4H, m) 2.44-2.60 (2H, m) 1.54-1.60 (4H, m) 1.27-1.33 (16H, m) 0.92-0.94 (9H, m) 0.10 -0.12 (12H, m); ESI-MS (positive ion mode) m / z, found = 713.1, calculated for [(M + H) ⁺ ] = 713.4

Synthesis of adenosine derivative A3
Compound A2 (280 mg, 338 μmol, FW 827.18) that had been vacuum-dried was dissolved in NH ₃ / MeOH solution, 28% NH ₃ aqueous solution was added, and the mixture was stirred at room temperature. When the reaction did not proceed, the reaction solution was distilled off under reduced pressure, and NH ₃ / MeOH solution and 28% NH ₃ aqueous solution were added again. After completion of the reaction, the reaction solution was distilled off under reduced pressure and dried in vacuum. The vacuum-dried residue was dissolved in Dry-DMF (1 mL), mPEG acid (269 mg, 457 μmol, FW588.7), HBTU (210 mg, 554 μmol, FW 379.25), HOBt · H ₂ O (87 mg , 567 μmol, FW 153.44) -Dry-DMF solution (1 mL) with DIPEA (128 μL, 733 μmol, FW 129.55, d = 0.742 g / mL) added dropwise, and stirred at room temperature for 1 hour. After completion of the reaction, the reaction mixture was evaporated under reduced pressure, the residue was dissolved in ethyl acetate, and washed with saturated aqueous sodium hydrogen carbonate and saturated brine. The organic phase was dried over MgSO ₄ and suction filtered, and the filtrate was distilled off under reduced pressure. This was purified by silica gel column chromatography (Silica gel 60, 63-210 μm, 2-3% MeOH / CHCl ₃ ) to obtain compound A3.

Yield: 375 mg Yield: 79%

¹ H NMR (400 MHz, CDCl ₃ ) δ 8.31 (1H, s) 7.76 (1H, d) 7.52 (1H, s) 6.68 (1H, t) 6.24 (1H, d) 4.56 (1H, m) 3.99 (1H , m) 3.80 (2H, m) 3.73 (2H, t) 3.64-3.66 (45H, m) 3.38 (3H, s) 3.34-3.41 (2H, m) 3.18-3.25 (2H, m) 2.49 (2H, t 2.33-2.43 (2H, m) 1.47-1.60 (4H, m) 1.27-1.33 (17H, m) 0.91-0.94 (19H, m) 0.09-0.11 (12H, m); ESI-MS (positive ion mode) m / z, found = 1301.3, calculated for [(M + Na) ⁺ ] = 1301.8

Synthesis of adenosine derivative A3-1
Compound A2-1 (161 mg, 226 μmol, FW 712.92) that had been vacuum-dried was dissolved in NH ₃ / MeOH solution, 28% NH ₃ aqueous solution was added, and the mixture was stirred at room temperature. When the reaction did not proceed, the reaction solution was distilled off under reduced pressure, and NH ₃ / MeOH solution and 28% NH ₃ aqueous solution were added again. After completion of the reaction, the reaction solution was distilled off under reduced pressure and dried in vacuum. The vacuum-dried residue was dissolved in Dry-DMF (1 mL), mPEG acid (162 mg, 375 μmol, FW588.7), HBTU (148 mg, 369 μmol, FW 379.25), HOBt ・ H ₂ O (59 mg , 385 μmol, FW 153.44) in Dry-DMF solution (1 mL) and DIPEA (88 μL, 504 μmol, FW 129.55, d =
0.742 g / mL) was added dropwise, and the mixture was stirred at room temperature for 1 hour. After completion of the reaction, the reaction mixture was evaporated under reduced pressure, the residue was dissolved in ethyl acetate, and washed with saturated aqueous sodium hydrogen carbonate and saturated brine. The organic phase was dried over MgSO ₄ and suction filtered, and the filtrate was distilled off under reduced pressure. This was purified by silica gel column chromatography (Silica gel 60, 63-210 μm, 2-4% MeOH / CHCl ₃ ) to obtain compound A3-1.

Yield: 160 mg Yield: 54%

¹ H NMR (400 MHz, CDCl ₃ ) δ 8.30 (1H, s) 7.76 (1H, d) 7.53 (1H, s) 6.70 (1H, t) 6.25 (1H, d) 4.62 (1H, m) 4.02 (1H , m) 3.86 (2H, m) 3.73 (2H, t) 3.60-3.66 (44H, m) 3.38 (3H, s) 3.34-3.45 (2H, m) 3.18-3.25 (2H, m) 2.47 (2H, t ) 2.45-2.56 (2H, m) 1.49-1.61 (4H, m) 1.27-1.32 (16H, m) 0.92-0.93 (9H, m) 0.11 (6H, m); ESI-MS (positive ion mode) m / z, found = 1187.2, calculated for [(M + Na) ⁺ ] = 1187.7

Synthesis of adenosine derivative A4
Compound A3 (375 mg, 288 μmol, FW 1301.84) that has been vacuum-dried is dissolved in Dry-DMF (1 mL), and 1 M Tetra-n-butylammonium fluoride (870 μL, 870 μmol, FW 261.45) is added at room temperature. Stir for 1 hour. After completion of the reaction, the reaction solution was distilled off under reduced pressure. Similarly, Compound A3-1 (135 mg, 134 μmol, FW 1301.84) dried in vacuum was dissolved in Dry-DMF (1 mL) and 1 M Tetra-n-butylammonium fluoride inTHF (410 μL, 410 μmol, FW 261.45). ) Was added and stirred at room temperature for 1 hour. After completion of the reaction, the reaction solution was distilled off under reduced pressure. The residue was purified by silica gel column chromatography (Silica gel 60, 63-210 μm, 3-5% MeOH / CHCl ₃ ), (Wakosil 40C18, 30-50 μm, 100% H ₂ O → 70% MeOH / H ₂ O). Purification gave compound A4.

Yield: 423 mg Yield: 93%

¹ H NMR (400 MHz, CD ₃ OD) δ 8.25 (1H, s) 7.74 (1H, d) 7.42 (1H, s) 6.33 (1H, d) 6.32 (1H, t) 4.76 (1H, m) 4.15 ( 1H, m) 3.81-3.96 (2H, m) 3.72 (2H, t) 3.63-3.66 (43H, m) 3.38 (3H, s) 3.20-3.29 (6H, m) 2.61 (3H, m) 2.46 (2H, t) 2.30-2.35 (1H, m) 1.55-1.67 (4H, m) 1.26-1.29 (15H, m); ESI-MS (positive ion mode) m / z, found =
1073.9, calculated for [(M + Na) ⁺ ] = 1073.6

Synthesis of adenosine derivative A5
Vacuum-dried Compound A4 (106 mg, 98.8 μmol, FW 1073.32) was azeotroped 3 times with Dry-DMF (3 mL), azeotroped 2 times with Dry-MeCN (3 mL), N, N, N ′, N′-Tetramethyl-1,8-naphthalenediamine (32 mg, 149 μmol, FW 214.31) was added and vacuum-dried overnight. This was dissolved in Trimethyl phosphate (1 mL) and stirred for 30 minutes under ice cooling. Phosphoryl chloride (14 μL, 150 μmol, FW 153.33, d = 1.645 g / mL) was added under ice cooling, and the mixture was stirred for 45 minutes. Then add Dry-Tributhyl amine (95 μL, 402 μmol, FW 185.35, d = 0.775 g / mL) and 0.5 M Diphosphoric acid in DMF (1.24 mL, 620 μmol, FW 177.98) under ice-cooling. Stir for hours. After stirring for 5 minutes in an ice bath, TEAB buffer was added to quench the reaction. The reaction solution was distilled off under reduced pressure and concentrated, followed by separation with distilled water and Et ₂ O. The aqueous phase was distilled off under reduced pressure and concentrated, and then purified by anion exchange column chromatography and medium pressure column chromatography to obtain compound A5.

Yield: 19 mg Yield: 14%

ESI-MS (negative ion mode) m / z, found = 1311.4, calculated for [(MH) ^- ] = 1311.6

Synthesis of cytidine derivative C1
The vacuum-dried thymidine derivative T3 (360 mg, 281 μmol, FW 1279.79) was azeotroped three times with Dry-pyridine (3 mL) and vacuum-dried. It was dissolved in Dry-CH ₂ Cl ₂ (2 mL) and stirred for 10 minutes in an ice bath. Add TEA (250 μL, 1.80 mmol, FW 101.19, d = 0.728 g / mL), stir in an ice bath for 5 minutes, then add 2,4,6-Triisopropylbenzenesulfonyl chloride (256 mg, 845 μmol, FW 302.86) and N N-dimethyl-4-aminopyridine (16 mg, 131 μmol, FW 122.17) dissolved in Dry-CH ₂ Cl ₂ (1 mL) was added and stirred at 10 ° C. for 20 hours. NH ₃ / MeOH solution (5 mL) was added thereto, and the mixture was stirred at 10 ° C. for 1 hr. The reaction solution was distilled off under reduced pressure, dissolved in CH ₂ Cl ₂ and washed with water. The organic phase was dried over MgSO ₄ and suction filtered, and the filtrate was distilled off under reduced pressure, and purified by silica gel column chromatography (Silica gel 60, 63-210 μm, 3% → 10% MeOH / CHCl ₃ ) to obtain compound C1. Obtained.

Yield: 282 mg Yield: 78%

¹ H NMR (400 MHz, CDCl ₃ ) δ 8.00 (1H, s) 7.32 (1H, d) 6.29 (1H, dd) 6.25 (1H, t) 4.37 (1H, m) 4.01 (1H, m) 3.81 (2H , m) 3.72 (2H, t) 3.63-3.66 (50H, m) 3.38 (3H, s) 3.19-3.30 (4H, m) 2.50 (1H, m) 2.46 (2H, t) 2.00 (1H, m) 1.45 -1.50 (4H, m) 1.25-1.28 (19H, m) 0.89-0.90 (19H, m) 0.08-0.11 (13H, m); ESI-MS (positive ion mode) m / z, found = 1301.0, calculated for [(M + Na) ⁺ ] = 1300.8

Synthesis of cytidine derivative C2
Compound C1 (215 mg, 168 μmol, FW 1278.80) dried in vacuo was dissolved in MeOH (1 mL), and TREAT-HF (822 μL, 4.89 mmol, FW 161.21, d = 0.989 g / mL) was added at room temperature. Stir for 2 hours. After completion of the reaction, the reaction solution was distilled off under reduced pressure and purified by silica gel column chromatography (Wakosil 40C18, 30-50 μm, 10% → 90% MeOH / H ₂ O) to obtain Compound C2.

Yield: 172 mg Yield: 98%

¹ H NMR (400 MHz, CD ₃ OD) δ 8.77 (1H, s) 7.37 (1H, d) 7.09 (1H, s) 6.41 (1H, d) 4.42 (1H, m) 4.00 (1H, m) 3.86 ( 2H, m) 3.72 (2H, t) 3.60-3.63 (45H, m) 3.36 (3H, s) 3.15-3.31 (4H, m) 2.46 (1H, m) 2.43 (2H, t) 2.27 (1H, m) 1.48-1.57 (4H, m) 1.31-1.34 (17H, m); ESI-MS (positive ion mode) m / z, found = 1050.9, calculated for [(M + H) ⁺ ] = 1050.5

Synthesis of cytidine derivative C3
Vacuum-dried Compound C2 (69 mg, 65.7 μmol, FW 1050.28) was added 4 times with Dry-DMF (3 mL).
Azeotropically, azeotrope three times with Dry-MeCN (5 mL), add N, N, N´, N´-Tetramethyl-1,8-naphthalenediamine (21 mg, 98.0 μmol, FW 214.31), add 1 Vacuum dried overnight. This was dissolved in Trimethylphosphate (1 mL) and stirred for 30 minutes under ice cooling. Phosphoryl chloride (12.2 μL, 131 μmol, FW 153.33, d = 1.645 g / mL) was added under ice cooling, and the mixture was stirred for 45 minutes. Then add Dry-Tributhyl amine (65 μL, 272 μmol, FW 185.35, d = 0.775 g / mL) and 0.5 M Diphosphoric acid in DMF (840 μL, 420 μmol, FW 177.98) under ice-cooling for 1 hour at room temperature. Stir. After stirring for 5 minutes in an ice bath, TEAB buffer was added to quench the reaction. The reaction solution was distilled off under reduced pressure and concentrated, followed by separation with distilled water and Et ₂ O. The aqueous phase was evaporated under reduced pressure and concentrated, and then purified by anion exchange column chromatography, medium pressure column chromatography, and HPLC to obtain compound C3.

Yield: 1.1 mg Yield: 1.4%

ESI-MS (negative ion mode) m / z, found = 1287.3, calculated for [(MH) ^- ] = 1288.5

Synthesis of guanosine derivative G2
Vacuum-dried 6-chloro-7-deazaguanine (2.436 g, 14.5 mmol, FW 168.58) was dissolved in Dry-pyridine (40 mL) and stirred for 10 minutes in an ice bath. isobutyryl chloride (1.85 mL, 17.7 mmol, d = 1.107 g / mL) was added, and the mixture was stirred for 20 minutes in an ice bath. After completion of the reaction, the reaction solution was distilled off under reduced pressure, the residue was suspended in Et ₂ O, suction filtered, and the filtrate was washed with cold 80% MeOH / Et ₂ O, cold MeOH, cold Et ₂ O and compound G2 Got. A similar reaction was performed again.

Yield: 1.958 g Yield: 56%
Total yield: 2.648 Total yield: 53%

¹ H NMR (400 MHz, CDCl ₃ ) δ 7.38 (1H, m) 6.56 (1H, m) 1.31 (1H, d); ESI-MS (positive ion mode) m / z, found = 239.2, calculated for [( M + Na) ⁺ ] = 239.1

Synthesis of guanosine derivative G3
Compound G2 (1.088 g, 3.52 mmol, FW 238.67) after vacuum drying was dissolved in Dry-DMF (20 mL), and N-iodosuccinimide (1.131 g, 5.03 mmol, FW 224.98) was dissolved in Dry-DMF (4 mL). And stirred at room temperature for 1 hour. After completion of the reaction, the reaction solution was evaporated under reduced pressure, the residue was suspended by adding water and a small amount of MeOH, filtered by suction, and the residue was washed with cold MeOH to obtain Compound G3. A similar reaction was performed again.

Yield: 1.367 g Yield: 82%
Total yield: 3.345 g Total yield: 87%

¹ H NMR (400 MHz, CDCl ₃ ) δ 7.52 (1H, s) 2.78 (1H, m) 1.20 (1H, d); ESI-MS (positive ion mode) m / z, found = 364.9, calculated for [( M + H) ⁺ ] = 364.9

Synthesis of guanosine derivative G4
Vacuum-dried compound G3 (1.333 g, 3.66 mmol, FW 364.57) and NaH (222 mg, 5.55 mmol, FW 24.00) were vacuum-dried, suspended in Dry-MeCN (80 mL), and 1-alpha-chloro -3,5-ditoluoyl-2-deoxy-D-ribose (1.992 g, 5.12 mmol, FW 388.84) was suspended in Dry-DMF (10 mL) and stirred at room temperature for 1 hour. After completion of the reaction, the reaction mixture was filtered with suction, and the residue was washed with cold water to obtain compound G4. A similar reaction was performed again.

Yield: 2.127 g Yield: 81%
Total yield: 5.504 g Total yield: 82%

¹ H NMR (400 MHz, CDCl ₃ ) δ 7.95 (5H, m) 7.42 (1H, s) 7.27 (4H, m) 6.69 (1H, t) 5.76 (1H, m) 4.72 (2H, m) 4.60 (1H , m) 2.92 (1H, m) 2.73-2.90 (2H, m) 2.45 (3H, s)
2.43 (3H, s) 1.29 (6H, d); ESI-MS (positive ion mode) m / z, found = 717.0, calculated for [(M + H) ⁺ ] = 717.1

Synthesis of guanosine derivative G5
Vacuum-dried compound G4 (2.215 g, 3.69 mmol, FW 716.95) and CuI (238 mg, 1.25 mmol, FW 190.45), Methyl acrylate (117 ml, 1.30 mol, FW 86.09) and degassed Dry-DMF (44 The mixture was suspended, and Pd (PPh ₃ ) ₄ (1.431 g, 1.24 mmol, FW 1155.56), TEA (1.75 mL, 12.6 mmol, FW 101.19, d = 0.728 g / mL) was added, and 70 Reflux at 5 ° C. for 5 hours. After completion of the reaction, the residue was dissolved in CH ₂ Cl ₂ and washed with saturated aqueous sodium hydrogen carbonate and saturated brine. The organic phase is dried over MgSO ₄ and suction filtered, the filtrate is distilled off under reduced pressure, and the residue is subjected to silica gel column chromatography (Silica gel 60, 63-210 μm, 100% CH ₂ Cl ₂ → 20% AcOEt / CH ₂ Cl ₂ ), the residue was suspended in MeOH and suction filtered to give compound G5 as a filtrate. A similar reaction was performed again.

Yield: 1.503 g Yield: 72%
Total yield: 3.536 g Total yield: 68%

¹ H NMR (400 MHz, CDCl ₃ ) δ 8.08 (1H, d) 7.92-8.00 (5H, m) 7.62 (1H, s) 6.73 (1H, t) 5.97 (1H, d) 5.80 (1H, m) 4.85 (1H, m) 4.61-4.68 (2H, m) 3.81 (3H, s) 2.97 (1H, m) 2.80-2.91 (2H, m) 2.46 (3H, s) 2.43 (3H, s) 1.30 (3H, s ) 1.28 (3H, s); ESI
-MS (positive ion mode) m / z, found = 675.2, calculated for [(M + H) ⁺ ] = 675.2

Synthesis of guanosine derivative G6
Compound G5 (1.503 g, 2.22 mmol, FW 675.13) dried in vacuo was suspended in 1N NaOH (30 mL) and 1,4-dioxane and stirred overnight. After completion of the reaction, the reaction solution was neutralized with HCl and evaporated under reduced pressure. The residue was suspended in 1N NaOH (30 mL), MeOH (10 mL) and allowed to stir for 7 hours. After completion of the reaction, the reaction solution was neutralized with HCl, evaporated under reduced pressure, suspended in MeOH and suction filtered, and the filtrate was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (Wakosil 40C18, 30-50 μm, 100% water → 70% MeOH / water) to give compound G6. A similar reaction was performed again.

Total yield: 1.371 g Total yield: 81%

¹ H NMR (400 MHz, CDCl ₃ ) δ 7.55 (1H, d) 7.39 (1H, s) 6.63 (1H, d) 6.39 (1H, t) 4.50 (1H, m) 4.06 (3H, s) 3.97 (1H , m) 3.75 (2H, m) 2.63 (1H, m) 2.26 (1H, m); ESI-MS (positive ion mode) m / z, found = 351.3, calculated for [(M + H) ⁺ ] = 351.1

Synthesis of guanosine derivative G7
Compound G6 (856 mg, 2.44 mmol, FW 350.33) dried in vacuo was suspended in Dry-MeCN (50 mL), and NaI (808 mg, 5.39 mmol, FW 149.89) was dissolved in Dry-MeCN (10 mL). After that, Trimethylsilyl chloride (680 μL, 5.38 mmol, FW 108.64) was added, and the mixture was stirred at room temperature for 1 hour. The mixture was refluxed in an oil bath at 90 ° C. overnight. After completion of the reaction, the reaction solution was distilled off under reduced pressure, the residue was suspended in water, suction filtered, and the residue was washed with MeOH. The filtrate was purified by silica gel column chromatography (Wakosil 40C18, 30-50 μm, 100% water → 70% MeOH / water) to obtain compound G7. A similar reaction was performed again.

Total yield: 800 mg Total yield: 69%

¹ H NMR (400 MHz, CDCl ₃ ) δ 7.67 (1H, d) 7.42 (1H, s) 7.11 (1H, d) 6.40 (1H, t) 4
.48 (1H, m) 3.94 (1H, m) 3.74 (1H, m) 2.49 (1H, m) 2.28 (1H, m); ESI-MS (positive ion mode) m / z, found = 337.3, calculated for [(M + H) ⁺ ] = 337.1

Synthesis of guanosine derivative G8
Vacuum-dried 1,12-diaminododecane (953 mg, 4.76 mmol, FW 200.36) was suspended in Dry-DMF (20 mL) and DIPEA (0.8 mL, 4.58 mmol, FW 129.55, d = 0.742 g / mL) Was added. Compound G7 (160 mg, 476 μmol, FW 336.30), PyBOP (631 mg, 1.21 mmol, FW 520.39), HOBt ・ H ₂ O (210 mg, 1.37 mmol, FW 153.44) dissolved in Dry-DMF (10 mL) What added DIPEA (1.7 mL, 9.74 mmol) was dripped, and it stirred at room temperature for 1 hour. After completion of the reaction, the reaction solution was distilled off under reduced pressure and dried in vacuum. The vacuum-dried residue was dissolved in Dry-MeOH (2.5 mL), TEA (200 μL, 1.44 mmol, FW 101.19, d = 0.728 g / mL), TFA Ethyl Ester (1.70 mL, 14.2 mmol, FW 142.08, d = 1.190 g / mL) was added, and the mixture was stirred at room temperature for 2 hours. After completion of the reaction, the reaction solution was distilled off under reduced pressure, azeotroped with CHCl ₃ (10 mL) three times, and vacuum-dried. The vacuum-dried residue was dissolved in Dry-DMF (2 mL), and imidazole (330 mg, 4.85 mmol, FW 68.08) and TBDMS-Cl (360 mg, 2.89 μmol, FW 150.72) were added to Dry-DMF (2 mL). The dissolved one was added and stirred at room temperature for 2 hours. Since the progress of the reaction stopped, imidazole (664 mg, 9.75 mmol) and TBDMS-Cl (717 mg, 4.76 μmol) dissolved in Dry-DMF (2 mL) were added, and the mixture was stirred at room temperature for 4 hours. After completion of the reaction, the reaction solution was evaporated under reduced pressure, and the residue was dissolved in a mixture of AcOEt: Et ₂ O = 1: 1, and washed with saturated aqueous sodium hydrogen carbonate and saturated brine. The organic phase was dried over MgSO ₄ and suction filtered, and the filtrate was distilled off under reduced pressure. This was purified by silica gel column chromatography (Silica gel 60, 40-50 μm, 50% → 60% AcOEt / hexane) to obtain compound G8.

Yield: 213 mg Yield: 53%

¹ H NMR (400 MHz, CDCl ₃ ) δ 7.52 (1H, d) 7.18 (1H, d) 7.10 (1H, s) 6.42 (1H, t) 4.51 (1H, m) 3.94 (1H, m) 3.75 (2H , m) 3.24-3.37 (4H, m) 2.28-2.33 (2H, m) 1.47-1.58 (4H, m) 1.22-1.27 (18H, m) 0.92-0.90 (18H, m) 0.09-0.11 (12H, m ); ESI-MS (positive ion mode) m / z, found = 843.5, calculated for [(M + H) ⁺ ] = 843.5

Synthesis of guanosine derivative G9
Compound G8 (213 mg, 481 μmol, FW 805.13), which had been vacuum-dried, was dissolved in NH ₃ / MeOH solution, 28% NH ₃ aqueous solution was added, and the mixture was stirred at room temperature. When the reaction did not proceed, the reaction solution was distilled off under reduced pressure, and NH ₃ / MeOH solution and 28% NH ₃ aqueous solution were added again. After completion of the reaction, the reaction solution was distilled off under reduced pressure and dried in vacuum. The vacuum-dried residue was dissolved in Dry-DMF (1 mL), mPEG acid (176 mg, 299 μmol, FW 588.7), HBTU (146 mg, 385 μmol, FW 379.25), HOBt ・ H ₂ O (58 mg, 378 μmol,
FW 153.44) was dissolved in Dry-DMF and DIPEA (88 μL, 504 μmol, FW 129.55, d = 0.742 g / mL) was added dropwise, and the mixture was stirred at room temperature for 1 hour. After completion of the reaction, the reaction solution was distilled off under reduced pressure,
The residue was dissolved in AcOEt and washed with saturated aqueous sodium hydrogen carbonate and saturated brine. The organic phase was dried over MgSO ₄ and suction filtered, and the filtrate was distilled off under reduced pressure. This was purified by silica gel column chromatography (Silica gel 60, 63-210 μm, 3% → 6% MeOH / CHCl ₃ ) to obtain compound G9.

Yield: 171 mg Yield: 51%

¹ H NMR (400 MHz, CDCl ₃ ) δ 7.48 (2H, d) 7.04 (1H, s) 6.44 (1H, t) 4.52 (1H, m) 3.91 (1H, m) 3.69-3.76 (4H, m) 3.64 -3.66 (49H, m) 3.39 (3H, s) 3.36 (2H, m) 3.23 (2H, m) 2.48 (2H, t) 2.20-2.34 (2H, m) 1.44-1.56 (6H, m) 1.26 (19H , m) 0.90-0.95 (20H, m) 0.09-0.11 (12H, m); ESI-MS (positive ion mode) m / z, found = 1317.9, calculated for [(M + H) ⁺ ] = 1317.8

Synthesis of guanosine derivative G10
Compound G9 (124 mg, 94.1 μmol, FW 1317.84), which had been vacuum-dried, was dissolved in Dry-pyridine and stirred for 10 minutes in an ice bath. Add Trimethylsilyl chloride (94 μL, 744 μmol, FW 108.64, d = 0.856 g / mL) and stir in an ice bath for 30 minutes, then add isobutyryl chloride (60 μL, 573 μmol, FW 106.55, d = 1.107 g / mL). The mixture was further stirred at room temperature for 1 hour. After completion of the reaction, the reaction solution was evaporated under reduced pressure, the residue was dissolved in AcOEt, and washed with saturated aqueous sodium hydrogen carbonate and saturated brine. The organic phase was dried over MgSO ₄ and suction filtered, and the filtrate was distilled off under reduced pressure. This was purified by silica gel column chromatography (Silica gel 60, 63-210 μm, 1% → 5% MeOH / CHCl ₃ ) to obtain compound G10.

Yield: 58 mg Yield: 44%

¹ H NMR (400 MHz, CDCl ₃ ) δ 7.63 (1H, d) 7.49 (1H, s) 7.24 (1H, d) 6.42 (1H, m) 4.55 (1H, m) 4.19 (1H, m) 3.95 (1H , m) 3.78-3.83 (2H, m) 3.73 (4H, t) 3.39 (3H, s) 3.64-3.66 (62H, m) 3.35 (3H, m) 3.21 (3H, m) 2.59-2.75 (2H, m ) 2.47 (3H, m) 2.23-2.36 (3H, m) 1.45-1.56 (4H, m) 1.26-1.31 (18H, m) 0.93 (21H, m) 0.09-0.12 (14H, m); ESI-MS ( positive ion mode) m / z, found = 1409.5, calculated for [(M + Na) ⁺ ] = 1409.9

Synthesis of guanosine derivative G12-1
Compound G11-1 (106 mg, 98.8 μmol, FW 1073.32) dried in vacuo was azeotroped 3 times with Dry-DMF (3 mL), azeotroped 2 times with Dry-MeCN (3 mL), N, N, N ′, N′-Tetramethyl-1,8-naphthalenediamine (32 mg, 149 μmol, FW 214.31) was added and vacuum dried overnight. This was dissolved in Trimethyl phosphate (1 mL) and stirred for 30 minutes under ice cooling. Phosphoryl chloride (14 μL, 150 μmol, FW 153.33, d = 1.645 g / mL) was added under ice cooling, and the mixture was stirred for 45 minutes. Then add Dry-Tributhyl amine (95 μL, 402 μmol, FW 185.35, d = 0.775 g / mL) and 0.5 M Diphosphoric acid in DMF (1.24 mL, 620 μmol, FW 177.98) under ice-cooling. Stir for hours. After stirring for 5 minutes in an ice bath, TEAB buffer was added to quench the reaction. The reaction solution was distilled off under reduced pressure and concentrated, followed by separation with distilled water and Et ₂ O. The aqueous phase was distilled off under reduced pressure and concentrated, and then purified by anion exchange column chromatography and medium pressure column chromatography to obtain compound G12-1.

Yield: 8 mg Yield: 18%

ESI-MS (negative ion mode) m / z, found = 1327.6, calculated for [(M + H) ⁺ ] = 1327.6

<Synthesis of polynucleotides using modified nucleotide derivatives>
1. Introduction of modified adenosine derivative A5 Primer Extension
The reaction solution was prepared as follows. This was heat-denatured at 94 ° C. for 0.5 minutes, and annealed at a temperature decrease rate of 1.2 ° C./min. Thereafter, an enzyme was added and a primer extension reaction was performed at 74 ° C. (0.5 minutes, 5 minutes). The elongation reaction was confirmed by 20% denaturing polyacrylamide gel electrophoresis (TBE Buffer, 200 V, 45 ° C., 140 minutes). The results are shown in FIG.

Primer 5'-GGATTAGCGAACAGGCCATACCTTT-3 'SEQ ID NO: 1
Template 3'-CCTAATCGCTTGTCCGGTATGGAAATAAGCC-5 'SEQ ID NO: 2

2. Introduction of modified thymidine derivative T5 Primer Extension
The reaction solution was prepared as follows. This was heat-denatured at 94 ° C. for 0.5 minutes, and annealed at a temperature decrease rate of 1.2 ° C./min. Thereafter, an enzyme was added and a primer extension reaction was performed at 74 ° C. (0.5 minutes, 5 minutes). The extension reaction was confirmed by 20% denaturing polyacrylamide gel electrophoresis (TB
E Buffer, 200 V, 45 ° C., 140 minutes). The results are shown in FIG.

Primer 5'-GGATTAGCGAACAGGCCATACCTTT-3 'SEQ ID NO: 1
Template 3'-CCTAATCGCTTGTCCGGTATGGAAAATAGCC-5 'SEQ ID NO: 3

3. Introduction of modified cytidine derivative C3 Primer Extension
The reaction solution was prepared as follows. This was heat-denatured at 94 ° C. for 0.5 minutes, and annealed at a temperature decrease rate of 1.2 ° C./min. Thereafter, an enzyme was added and a primer extension reaction was performed at 74 ° C. (0.5 minutes, 5 minutes). The elongation reaction was confirmed by 20% denaturing polyacrylamide gel electrophoresis (TBE Buffer, 200 V, 45 ° C., 140 minutes). The results are shown in FIG.

Primer 5'-GGATTAGCGAACAGGCCATACCTTT-3 'SEQ ID NO: 1
Template 3'-CCTAATCGCTTGTCCGGTATGGAAAGAAGCC-5 'SEQ ID NO: 4

4. Introduction of modified guanosine derivative G12-1 Primer Extension
The reaction solution was prepared as follows. This was heat-denatured at 94 ° C. for 0.5 minutes, and annealed at a temperature decrease rate of 1.2 ° C./min. Thereafter, an enzyme was added and a primer extension reaction was performed at 74 ° C. (0.5 minutes, 5 minutes). The elongation reaction was confirmed by 20% denaturing polyacrylamide gel electrophoresis (TBE Buffer, 200 V, 45 ° C., 140 minutes). The results are shown in FIG.

Primer 5'-GGATTAGCGAACAGGCCATACCTTT-3 'SEQ ID NO: 1
Template 3'-CCTAATCGCTTGTCCGGTATGGAAACAAGCC-5 'SEQ ID NO: 5

5. Introduction of Modified Nucleoside Triphosphate One Primer PCR One kind of modified substrate One primer PCR was performed under the following conditions using a modified substrate instead of a natural substrate.
The reaction was confirmed by 10% denaturing polyacrylamide gel electrophoresis (TBE Buffer, 200 V, 45 ° C., 45 minutes). The results are shown in FIG.

6. Introduction of modified nucleoside triphosphates One Primer PCR Two types of modified substrates One primer PCR was performed under the following conditions using modified substrates instead of natural substrates.
The reaction was confirmed by 10% denaturing polyacrylamide gel electrophoresis (TBE Buffer, 200 V, 45 ° C., 45 minutes). The results are shown in FIG.

7. Synthesis of modified DNA by PCR
PCR was performed under the following conditions. A mixture of A5, T5, C3, and G12-1 and natural dNTPs were mixed at different ratios and used as a substrate. MeCN was added so that the final concentration would be 5% in the reaction solutions containing 15% and 20% of the modified substrate.
The reaction was confirmed by 1% agarose gel electrophoresis (TBE Buffer, 100 V, room temperature, 45 minutes) and confirmed by EtBr staining. The results are shown in FIG.

Template NK104 # T1N
5'-GAGCGGCAGTTTGATGGAAGTTATCCGTCAAACGTTACGGGTCCTCAAATCGGTCCCATAACGTTACGGGATCCAGTTTCGAATACCC CACACCCGCTCTTTGGTTCT -3 'SEQ ID NO: 6
primer region
Primer FE # P2F
5'-AGAACCAAAGAGCGGGTGTG-3 'SEQ ID NO: 7

Consecutive sequence in the introduction of three modified species
ATC introduction
5'- GAG C GG C AGTTTGATGGAAGTTAT CC GT C AAA C GTTA C GGGT CC T C AAAT C GGT CCC ATAA C GTTA C GGGAT CC AGTTT C GAATA CCC CACACCCGCTCTTTGGTTCT -3 'SEQ ID NO: 6

ATG introduced
5'-G A G C GG CA G TTT G AT GG AA G TTATCC G TCAAAC G TTAC GGG TCCTCAAATC GG TCCCATAAC G TTAC GGG ATCCA G TTTC G AATACCCCACACCCGCTCTTTGGTTCT -3 'SEQ ID NO: 6

ACG introduction
5'- G A GCGGC A GTTTG A TGG AA GTT A TCCGTC AAA CGTT A CGGGTCCTC AAA TCGGTCCC A T AA CGTT A CGGG A TCC A GTTTCG AA T A CCCCACACCCGCTCTTTGGTTCT -3 'SEQ ID NO: 6

TCG introduction
5'- GAGCGGCAG TTT GA T GGAAG TT A T CCG T CAAACG TT ACGGG T CC T CAAA T CGG T CCCA T AACG TT ACGGGA T CCAG TTT CGAA T ACCCCACACCCGCTCTTTGGTTCT -3 'SEQ ID NO: 6

8． Synthesis of modified DNA by PCR Addition of 15% modified DNA and 5% MeCN
PCR was performed under the following conditions. A mixture of A5, T5, C3, and G12-1 and natural dNTPs were mixed at a ratio of 15:85 and used as a substrate. MeCN was added to a final concentration of 5%.
The reaction was confirmed by 1% agarose gel electrophoresis (TBE Buffer, 100 V, room temperature, 45 minutes), and confirmed by 488 nn laser irradiation (FAM detection mode) and 512 nn laser irradiation (EtBr detection mode). The results are shown in FIG.

9． Synthesis of modified DNA by PCR Addition of 20% modified DNA and 5% MeCN
PCR was performed under the following conditions. A mixture of A5, T5, C3, and G12-1 and natural dNTPs were mixed at a ratio of 20:80 and used as a substrate. MeCN was added to a final concentration of 5%.
The reaction was confirmed by 1% agarose gel electrophoresis (TBE Buffer, 100 V, room temperature, 45 minutes) and confirmed by external laser (FAM) and EtBr staining. The results are shown in FIG.

<Cell culture experiment>
Aptamers examined for introduction: TBA: AGT CCG TGG TAG GGC AGG TTG GGG TGA CT: SEQ ID NO: 8
・ TBA # Tm4 (4 TBA modified T (T5))
AGT CCG TGG TAG GGC AGG TTG GGG TGA CT tttt: SEQ ID NO: 9
t represents modification T (DP3).
TBA: Thrombin-binding aptamer

Cells and HEPG2 used for introduction study (7.5 x 10 ⁴ cells per well)

<protocol>
150 μL each of Nitta Gelatin cellmatrix 0.3 mg / ml hydrochloric acid solution was placed in a chamber cell (1 cm × 1 cm). The solution was taken out at room temperature for 1 hour. Air dried overnight. In order to take out the cells cultured in the dish, the medium was taken out, washed with a PBS 1 mM EDTA solution, and then taken out with a trypsin solution. Thereto was added 4 mL of medium to make a total volume of 5 mL, and the whole volume was transferred to a centrifuge tube and centrifuged at 1 krpm. 1 min. The supernatant was discarded, and a further 5 mL of medium was added for suspension, followed by centrifugation at 1 krpm. 1 min. This was repeated once more. Thereafter, 7.5 × 10 ⁴ cells / 450 μl of a cell solution was prepared. 450 μL of the cell solution was poured into the collagen-treated chamber without depending on the center. Cultured for 24 hours. 37 ° C, 95% Air, 5% CO ₂ After removing 400 μL of the medium, add 360 μL of the medium to 40 μL (DNA / Thr20 μL (DNA2.7 μM, Th2.7 μM), FIB20 μL (13.5 μM)) reagent (PBS
Solution) was added. The culture was continued for 48 hours. After 48 hours, the cells were dissociated, detached from the chamber, and observed with a microscope.

The culture conditions such as the medium are as follows.
Medium: Wako D-MEM low glucose (containing L-glutamine and phenol red)
Culture conditions with antibiotics and bovine serum 37 ° C, 95% Air, 5% CO ₂
PBS: 11.8 mM phosphoric acid, 157 mM NaCl, 4.5 mM KCl
The DNA / Th solution was annealed at 37 ° C. after annealing the DNA at 5.4 μM and then adding a 5.4 μM Th solution 1: 1 (both in PBS).

The results are shown in FIG. 10 and FIG.
As an aptamer, TBA # Tm4 into which the modified nucleotide of the present invention was introduced was more effective than TBA. When TBA # Tm4 was used as an aptamer and thrombin and fibrinogen were added, a lump in which cells were particularly firmly adhered to each other was observed even after the dissociation treatment (FIG. 11 (D)).

<Cell culture experiment: Examination of reagent concentration>
Aptamer TBA # Tm4 (4 T-modified T (T5))
Cells and HeLa used for introduction study (10 x 10 ⁴ cells per well)

<protocol>
150 μL each of Nitta Gelatin cellmatrix 0.3 mg / ml hydrochloric acid solution was placed in a chamber cell (1 cm × 1 cm). The solution was taken out at room temperature for 1 hour. Air dried overnight.
In order to take out the cells cultured in the dish, the medium was taken out, washed and removed with a PBS 1 mM · EDTA solution, and then the cells were peeled off with 1 mL of a trypsin solution. 4 mL of the medium was added thereto to make a total volume of 5 mL, which was transferred to a centrifuge tube, and centrifuged at 1 krpm. 1 min. Discard the supernatant and add another 5mL
The medium was added and suspended, and centrifuged at 1 krpm. 1 min. This was repeated once more. Thereafter, a cell solution of 2.2 × 10 ⁵ cells / ml (10 × 10 ⁴ cells / 450 μl) was prepared. 450 μL of the cell suspension was poured into the collagen-treated chamber without depending on the center. The cells were cultured for 24 hours (37 ° C., 95% Air, 5% CO ₂ ). After removing 300 μL of the medium, add 225 μL of the medium to 75 μL (DNA
-Reagents (PBS solution) of Thr 30 μL, Fibronectin (FN) 25 μL, FIB 20 μL) were added. The culture was continued for 72 hours. The state of each culture solution after 72 hours was photographed.

The culture conditions such as the medium are as follows.
Medium: Wako D-MEM low glucose (containing L-glutamine and phenol red)
Culture conditions with antibiotics and bovine serum 37 ° C, 95% Air, 5% CO ₂
PBS: 11.8 mM phosphoric acid, 157 mM NaCl, 4.5 mM KCl
The DNA / Th solution was annealed at 18 μM, mixed with 18 μM or 3.6 μM Th solution at a concentration of 18 μM or 3.6 μM 1: 1 (volume ratio), and incubated at 37 ° C. for 30 min.

The results are shown in FIGS.
m4 (120nM) + Th (120nM) + FIB (600nM) (FN120nM) gave the best results (FIG. 12D)
). In addition, the effect by addition of FN was small.

<Measurement of inhibitory activity of substrate degradation reaction (inhibitor: TBA, TBA-m4)>
1. Preparation of human thrombin solution Human thrombin (Thrombin, Human Plasma, High Activity: Calbiochem) was dissolved in distilled water and allowed to stand for 3 hours. After that, prepare a solution containing human thrombin (40 nM) in Buffer A (PO ₄ ^3- (11.8 mM), Na ⁺ (157 mM), K ⁺ (4.5 mM), Cl ⁻ (about 140 mM); pH 7.4) The mixture was allowed to stand at room temperature for 3 hours. Then, it used for preparation of the liquid mixture with an aptamer.

2. Preparation of Aptamer Solution An aptamer solution (200 nM) was prepared by adding 3.5 μL of 10 × Buffer A and 28 μL of distilled water to 3.5 μL of an aptamer (TBA or TBA-m4) solution (2 μM) serving as an inhibitor. Subsequently, 35 μL of aptamer solution (200 nM) was annealed (annealing was performed by heat denaturation at 94 ° C. for 0.5 minutes, and then cooled to 25 ° C. at a rate of 0.5 ° C./min).

3. Preparation of aptamer / human thrombin mixed solution 31 μL of aptamer solution (200 nM) and 31 μL of human thrombin solution (40 nM) were mixed and incubated at 37 ° C. for 30 min.

4). Preparation of Substrate Solution A substrate solution (1 mM) was prepared by adding 20 μL of 10 × Buffer A and 140 μL of distilled water to 40 μL of a substrate (SPECTROZYME TH: Sekisui Diagnostics, LLC) aqueous solution (5 mM). The prepared substrate solution was warmed to 37 ° C.

The cell was pre-warmed to 37 ° C. 60 μL of substrate solution and aptamer / human thrombin mixture 60
μL was mixed in the cell. The final concentrations of aptamer, human thrombin, and substrate are 50 nM, 10 nM, and 0.5 mM, respectively.

Using a UV-Vis spectrophotometer, the time course of absorption at a reaction temperature of 37 ° C. at a monitor wavelength of 405 nm was recorded every 2 seconds and followed for 2000 seconds. The results are shown in FIG.
In FIG. 16, the control solution is a reaction solution containing no inhibitor.
The initial reaction rate was calculated using ε ₄₀₅ = 9650M ⁻¹ of p-nitroanilide.
Initial reaction speed: v ₀
Control: 52.8nM ・ s ^-1
TBA-m4: 12.8nM ・ s ^-1
TBA: 7.86nM ・ s ^-1
From the above, it was shown that the protease activity remained even in the presence of 5 equivalents of inhibitor for human thrombin.

<Measurement of aptamer incorporation into fibrin gel by fluorescence polarization method>
a) Preparation of sample solution Preparation of human thrombin solution Human thrombin was dissolved in distilled water and allowed to stand for 3 hours. Thereafter, a solution containing human thrombin (480 nM) in Buffer A was prepared and allowed to stand at room temperature for 3 hours. Then, it used for preparation of the liquid mixture with an aptamer.

2. Preparation of DNA (TBA, TBA-m4, WS, WS-m4) solution
A DNA solution (480 nM) dissolved in Buffer A was prepared. The DNA solution (480 nM) was annealed (the annealing was performed by heat denaturation at 94 ° C. for 0.5 minutes, and then the temperature was lowered at a rate of 0.5 ° C./min to 25 ° C.).
TBA: 5′-FAM-AGT CCG TGG TAG GGC AGG TTG GGG TGA CT-3 ′ (SEQ ID NO: 8)
TBA-m4: 5'-FAM-AGT CCG TGG TAG GGC AGG TTG GGG TGA CTt ttt-3 '(SEQ ID NO: 9)
WS: 5'-FAM-TTT TTT TTT TAG GGC AGG TTG GGG TGA CT-3 '(SEQ ID NO: 10)
WS-m4: 5′-FAM-TTT TTT TTT TAG GGC AGG TTG GGG TGA CTt ttt-3 ′ (SEQ ID NO: 11) t = modified T

3. Preparation of DNA / human thrombin mixture
20 μL of DNA solution (480 nM) and 20 μL of human thrombin solution (480 nM) were mixed and incubated at 37 ° C. for 30 minutes.

4). Preparation of Fluorescein solution
Fluorescein (480 nM) dissolved in Buffer A was prepared.

5. Preparation of Fluorescein / human thrombin mixture
20 μL of Fluorescein solution (480 nM) and 20 μL of human thrombin solution (480 nM) were mixed and incubated at 37 ° C. for 30 minutes.

6). Preparation of fluorescently labeled human thrombin (FL-Thrombin) solution
FL-Thrombin was prepared by fluorescently labeling human thrombin with a kit (Fluorescein Labeling Kit-NH2; Dojindo). 40 μL of a solution containing FL-Thrombin (240 nM) in Buffer A was prepared and incubated at 37 ° C. for 30 minutes.

7). Preparation of fibrinogen solution Fibrinogen (Human Plasma: Calbiochem) was dissolved in Buffer A and mixed by inverting for 3 hours. Then, it left still at room temperature for 6 hours. Subsequently, dilute with Buffer A and add 12 μM, 6
μM, 3 μM, 2.0 μM, 1.2 μM and 0.6 μM fibrinogen solutions were prepared, respectively.

b) Measurement of fibrin gel formation reaction and fluorescence polarization
35 μL of DNA / human thrombin mixed solution (240 nM each) and 35 μL of fibrinogen solution (12 μM, 6 μM, 3 μM, 2.0 μM, 1.2 μM, 0.6 μM, 0 μM) with different concentrations were mixed and reacted at 25 ° C. for 30 minutes .
Similarly, Fluorescein / human thrombin mixed solution and FL-Thrombin solution were also mixed with fibrinogen solution and reacted at 25 ° C. for 30 minutes.
Final concentrations are DNA (120nM), human thrombin (120nM), Fluorescein (120nM), FL-Thrombin (120nM), fibrinogen (6μM, 3μM, 2.0μM, 1.2μM, 0.6μM, 0.3μM, 0μM)
It is.

After the reaction was completed, the fluorescence polarization of the reaction solution was measured for 5 minutes at an excitation wavelength of 490 nm and a monitor wavelength of 520 nm, and the average value was plotted. However, in the measurement using FL-Thrombin, the excitation wavelength was 497 nm and the monitor wavelength was 522 nm. The results are shown in FIG.
When there is no human thrombin in the reaction solution, there is no significant change in fluorescence polarization. However, under conditions where human thrombin is present and a fibrin gel is formed, the presence of TBA or TBA-m4 greatly increases the fluorescence polarization (FIG. 17). A, B). However, DNA that does not bind to human thrombin (WS, WS-m4)
In Fluorescein, human thrombin may exist, but there is no significant change in fluorescence polarization (C, D, E in FIG. 17). In addition, although FL-Thrombin seems to have TBA, the fluorescence polarization changes greatly (F in FIG. 17).
From the above, it was shown that human thrombin is incorporated into fibrin gel and that TBA and TBA-m4 complexed with human thrombin are also incorporated into fibrin gel.

<Cell culture experiment>
[1] Preparation of reagents a. Preparation of sample solution DNA annealing 30 μL of 2 × Buffer A was added to 30 μL of 9.6 μM DNA dissolved in distilled water to prepare 60 μL of a 4.8 μM DNA Buffer A solution.
The 4.8 μM DNA Buffer A solution was denatured at 94 ° C. for 30 seconds, and then annealed from 94 ° C. to 25 ° C. at a rate of 0.5 ° C./min.

2. Preparation of thrombin solution
30 μL of 2 × Buffer A solution was added to 30 μL of 9.6 μM thrombin solution to prepare 60 μL of 4.8 μM thrombin Buffer A solution.

3. DNA-thrombin complex solution
60 μL of 4.8 μM DNA Buffer A solution and 60 μL of 4.8 μM thrombin Buffer A solution were mixed and incubated at 37 ° C. for 30 minutes.

4). Preparation of fibrinogen solution Fibrinogen was dissolved in Buffer A and mixed by inversion for 3 hours. Thereafter, it was diluted with Buffer A to prepare a 6 μM Buffer A solution.

b. Culture using Transwell 1. Transwell substituted with media (Transwell Clear (polyester membrane) Membrane diameter 6.5 mm, culture area 0.33 cm ^2, the membrane pore size 0.4μm, Corning Life science) 3.3 × 10 4 / 100μL per sheet, 1.5 × 10 ^4/100 [mu] L, were seeded 0.6 × 10 ⁴ / ^100μL of the He-La cells. The cells were cultured in a CO ₂ incubator for 24 hours so as to settle on the membrane.

2. After confirming fixation, reagents were added to the insert and plate as shown in the table below.

For the insert, 15 μL of the medium was extracted and 5 μL of 2.4 μM DNA + Th complex ([20-fold solution], Final 120 nM), 10 μL of 6 μM fibrinogen ([10-fold solution], 600 nM) was added. The final concentration is 100 μL, the DNA + Th complex is 120 nM, and the fibrinogen is 600 nM.
To the plate, 90 μL of the medium was extracted, and 2.4 μM of DNA + Th complex ([20 times solution], Final 120 nM) 30 μL, 6 μM fibrinogen ([10 times solution], 600 nM) 60 μL. The final concentration is 600 μL, DNA + Th complex is 120 nM, and fibrinogen is 600 nM.

3. Forty-eight hours after sample addition, the cells were placed in a CO ₂ incubator and cultured.

4). Observation was performed using a phase-contrast optical microscope. The result is shown in FIG.
FIGS. 18A and 18B show the results of control and fibrinogen addition, respectively. Since these cells have peeled off, the number of cells in the photograph is small and they are quiet.
(C) shows the addition of fibrinogen and DNA-thrombin complex. The cells are gathered to a certain extent, but the effect as shown in (D) below was not seen.
(D) shows the addition of fibrinogen and TBA-m4-thrombin complex. The cells are closely adhered to each other, which is more effective than the other three.

  The nucleoside derivative of the present invention can be used as a raw material for producing a polynucleotide (nucleic acid aptamer) excellent in cell affinity, and can be applied as a cell culture reagent, nucleic acid drug, biomarker test drug, research reagent, etc. can do.

Claims (13)

A nucleoside derivative represented by any one of the following formulas (I-1) to (I-4) or a salt thereof.
(In the formulas (I-1) to (I-4), R ¹ is a hydrogen atom (—H), a fluorine atom (—F), a hydroxyl group (—OH), an amino group (—NH ₂ ), or a mercapto group. (—SH), R ² independently represents a hydrogen atom (—H) or a hydroxyl protecting group, R ³ independently represents a hydrogen atom (—H) or a hydrocarbon group having 1 to 6 carbon atoms, A represents —CONH— or —CH ₂ NHC.
O-, Y is a divalent hydrocarbon group having 2 to 12 carbon atoms which may contain a branched structure and / or an unsaturated bond, n is an integer of 2 to 20, and p is an integer of 1 to 6 , Q represents an integer of 1 to 20, and r represents an integer of 1 to 6. )   The 5'-phosphate ester, phosphorothioate form of the nucleoside derivative according to claim 1, or a salt thereof.   A substrate solution for polynucleotide synthesis comprising the 5'-phosphate ester according to claim 2, a phosphorothioate compound or a salt thereof, or a labeled nucleotide derivative into which a labeling substance is introduced.   A reagent for polynucleotide synthesis comprising the substrate solution for polynucleotide synthesis according to claim 3.   A method for producing a polynucleotide, wherein the 5'-phosphate ester, phosphorothioate compound or a salt thereof according to claim 2 or a labeled nucleotide derivative into which a labeling substance is introduced is used as a substrate for synthesis.   A polynucleotide comprising, as a structural unit, a 5'-phosphate ester of the nucleoside derivative according to claim 2 and / or a phosphorothioate derivative thereof.   The polynucleotide of claim 6 comprising a ligand binding sequence.   The polynucleotide according to claim 7, wherein the ligand binding sequence is thrombin, fibrin or fibrinogen binding sequence.   A cell culture method comprising culturing cells using the polynucleotide according to claim 7 or 8 and thrombin, or the polynucleotide, thrombin and fibrinogen.   A fibrin gel comprising the polynucleotide according to claim 7 or 8 and thrombin, or the polynucleotide and thrombin and fibrinogen.   The polynucleotide according to claim 6, which is a nucleic acid aptamer.   A polynucleotide library comprising the polynucleotide according to claim 6 or 11.   A method for selecting a nucleic acid aptamer, comprising a step of selecting a target substance-binding polynucleotide using the polynucleotide library according to claim 12.