JP6265743B2 - Methods for evaluating drug sensitivity by analyzing various analgesic genes - Google Patents

Description

  The present invention relates to a drug by analysis of at least two various analgesic genes selected from the group consisting of a GIRK channel gene, a mu opioid receptor gene, a voltage-dependent calcium channel gene, an adrenergic receptor gene, and a cyclic AMP response element binding protein gene. The present invention relates to a method for evaluating sensitivity.

The present inventors have clarified a part of the genetic mechanism of individual differences in drug sensitivity in humans (Non-patent Documents 1-5, Patent Document 1), and have identified many gene polymorphisms significantly related to analgesia and pain. . As a result, we established a drug susceptibility evaluation method based on gene polymorphism analysis of mu opioid receptor, GIRK channel, POMC, adrenergic receptor, voltage-dependent calcium channel, and cyclic AMP response element binding protein.
However, it is unclear whether combining these gene polymorphisms accurately predicts individual analgesic susceptibility and is useful for treating individualized pain in actual clinical settings.

WO2005 / 095601 Publication

Hayashida M, Nagashima M, Satoh Y, Katoh R, Tagami M, Ide S, Kasai S, Nishizawa D, Ogai Y, Hasegawa J, Komatsu H, Sora I, Fukuda K, Koga H, Hanaoka K, Ikeda K, Analgesic requirements after major abdominal surgery are associated with OPRM1 gene polymorphism genotype and haplotype.Pharmacogenomics (2008) 9: 1605-1616. Nishizawa D, Nagashima M, Katoh R, Satoh Y, Tagami M, Kasai S, Ogai Y, Han W, Hasegawa J, Shimoyama N, Sora I, Hayashida M, Ikeda K, Association between KCNJ6 (GIRK2) gene polymorphisms and postoperative analgesic requirements after major abdominal surgery. PLoS ONE (2009) 4: e7060. Aoki, Rin Hayashida, Akira Tagami, Makoto Nagashima, Kenichi Fukuda, Daisuke Nishizawa, Yasuo Otani, Shinya Kasai, Kazutaka Ikeda, Kazuhiko Iwahashi, Analgesic Necessity and 5-HT2A Receptor in Postoperative Analgesia Association research with gene polymorphism. Clinical psychopharmacology (2009) 12: 1159-1164. Fukuda K, Hayashida M, Ide S, Saita N, Kokita Y, Kasai S, Nishizawa D, Ogai Y, Hasegawa J, Nagashima M, Tagami M, Komatsu H, Sora I, Koga H, Kaneko Y, Ikeda K, Association between OPRM1 gene polymorphisms and fentanyl sensitivity in patients undergoing painful cosmetic surgery. Pain (2009) 147: 194-201. Aoki J, Hayashida M, Tagami M, Nagashima M, Fukuda K, Nishizawa D, Ogai Y, Kasai S, Ikeda K, Iwahashi K Association between 5-hydroxytryptamine 2A receptor gene polymorphism and postoperative analgesic requirements after major abdominal surgery. Neurosci. Lett (2010) 479: 40-43.

  An object of the present invention is to provide a method for predicting an individual's analgesic sensitivity and a necessary amount of a postoperative analgesic by determining a genetic polymorphism before surgery, and practicing personalized pain therapy. .

  As a result of earnest research to solve the above problems, the present inventor predicts individual analgesic sensitivity and the necessary amount of postoperative analgesic by determining genetic polymorphism before surgery, and individualized pain treatment The present inventors have found a method for practicing and has completed the present invention.

That is, the present invention is as follows.
I. The present invention relates to a gene polymorphism of at least two genes selected from the group consisting of a GIRK channel gene, a mu opioid receptor gene, a voltage-dependent calcium channel gene, an adrenergic receptor gene and a cyclic AMP responsive element binding protein gene. A method for evaluating drug sensitivity, characterized by associating a combination of types with drug sensitivity of an individual.
The method of the present invention is characterized by evaluating the tendency of drug sensitivity of an individual based on the analysis result of the gene polymorphism or predicting the required amount of drug.
Moreover, the method of this invention includes the following processes.

(1) A step of performing genetic polymorphism analysis using a sample derived from a subject and selecting a genetic polymorphism,
(2) a multivariate analysis of the association between the genotype of the gene polymorphism selected in step (1) and drug sensitivity, and (3) a gene polymorphism significantly associated with drug sensitivity in the subject. A process used to evaluate drug sensitivity.
In the method of the present invention, the gene polymorphism can include at least one selected from the group consisting of a single nucleotide polymorphism, an insertion polymorphism, a deletion polymorphism, and a base repeat polymorphism.

II. The present invention also relates to each of at least two genes selected from the group consisting of a GIRK channel gene, a mu opioid receptor gene, a voltage-dependent calcium channel gene, an adrenergic receptor gene, and a cyclic AMP responsive element binding protein gene. It is a disease vulnerability assessment method characterized by associating a combination of genetic polymorphisms with an individual disease vulnerability.
The method of the present invention is characterized by evaluating the tendency of the disease vulnerability of an individual based on the analysis result of the genetic polymorphism.

Moreover, this invention includes the following processes.
(1) A step of performing genetic polymorphism analysis using a sample derived from a subject and selecting a genetic polymorphism,
(2) a multivariate analysis of the association between the genotype of the gene polymorphism selected in step (1) and pain sensitivity, and (3) a gene polymorphism significantly associated with pain sensitivity in the subject. A process used to assess disease vulnerability.
Disease vulnerability includes, for example, drug sensitivity, pain sensitivity, or vulnerability to drug dependence.
In the method of the present invention, the gene polymorphism can include at least one selected from the group consisting of a single nucleotide polymorphism, an insertion polymorphism, a deletion polymorphism, and a base repeat polymorphism.

III. Further, the present invention is a method for determining the kind, amount and / or number of times of administration of an agent to be administered to an individual using the result evaluated by the method described in I or II as an index.

IV. In the method of the present invention, at least one oligonucleotide belonging to each group is selected from at least two groups selected from the following oligonucleotide groups (a) to (e), and the selected oligo Nucleotides can be used.
(a) containing the 51st base in the base sequence shown in any one of SEQ ID NOs: 1 to 10 and 440 to 449, which can specifically hybridize to a DNA fragment containing a gene polymorphism of the GIRK channel Oligonucleotide comprising a base sequence having a length of at least 10 bases or a base sequence complementary to the base sequence
(b) at least 10 containing the 51st base in the base sequence shown in any one of SEQ ID NOs: 11 to 108, which can specifically hybridize to a DNA fragment containing a gene polymorphism of a mu opioid receptor. Oligonucleotide consisting of a base sequence having a base length or a base sequence complementary to the base sequence
(c) including at least the 51st base in the base sequence shown in any one of SEQ ID NOs: 110 to 199, which can specifically hybridize to a DNA fragment containing a gene polymorphism of a voltage-dependent calcium channel Oligonucleotide consisting of a base sequence having a length of 10 bases or a base sequence complementary to the base sequence
(d) at least 10 bases including the 51st base in the base sequence shown in any one of SEQ ID NOs: 200 to 267, which can specifically hybridize to a DNA fragment containing an adrenergic receptor gene polymorphism Oligonucleotide comprising a long base sequence or a base sequence complementary to the base sequence
(e) the 51st base in the base sequence shown in any one of SEQ ID NOs: 268 to 439, which can specifically hybridize to a DNA fragment containing a gene polymorphism of a cyclic AMP responsive element binding protein. An oligonucleotide comprising a base sequence having a length of at least 10 bases or a base sequence complementary to the base sequence

V. Furthermore, the present invention is an oligonucleotide set comprising oligonucleotides each selected from at least two groups selected from the following oligonucleotide groups (a) to (e).
(a) containing the 51st base in the base sequence shown in any one of SEQ ID NOs: 1 to 10 and 440 to 449, which can specifically hybridize to a DNA fragment containing a gene polymorphism of the GIRK channel Oligonucleotide comprising a base sequence having a length of at least 10 bases or a base sequence complementary to the base sequence
(b) at least 10 containing the 51st base in the base sequence shown in any one of SEQ ID NOs: 11 to 108, which can specifically hybridize to a DNA fragment containing a gene polymorphism of a mu opioid receptor. Oligonucleotide consisting of a base sequence having a base length or a base sequence complementary to the base sequence
(c) including at least the 51st base in the base sequence shown in any one of SEQ ID NOs: 110 to 199, which can specifically hybridize to a DNA fragment containing a gene polymorphism of a voltage-dependent calcium channel Oligonucleotide consisting of a base sequence having a length of 10 bases or a base sequence complementary to the base sequence
(d) at least 10 bases including the 51st base in the base sequence shown in any one of SEQ ID NOs: 200 to 267, which can specifically hybridize to a DNA fragment containing an adrenergic receptor gene polymorphism Oligonucleotide comprising a long base sequence or a base sequence complementary to the base sequence
(e) the 51st base in the base sequence shown in any one of SEQ ID NOs: 268 to 439, which can specifically hybridize to a DNA fragment containing a gene polymorphism of a cyclic AMP responsive element binding protein. An oligonucleotide comprising a base sequence having a length of at least 10 bases or a base sequence complementary to the base sequence

VI. Furthermore, the present invention is a drug sensitivity evaluation kit or a disease vulnerability evaluation kit comprising the oligonucleotide set described above.
VII. Further, the present invention provides each of at least two genes selected from the group consisting of a GIRK channel gene, a mu opioid receptor gene, a voltage-dependent calcium channel gene, an adrenergic receptor gene, and a cyclic AMP responsive element binding protein gene. It is a gene polymorphism marker for evaluating the tendency of individual drug sensitivity including gene polymorphism, or a gene polymorphism marker for evaluating the tendency of individual disease vulnerability.

According to the present invention, a method for evaluating drug sensitivity or disease vulnerability can be provided using a combination of polymorphisms of at least two genes selected from five types of analgesic genes. This evaluation method makes it possible to easily know or predict the proper prescription amount and proper prescription schedule for narcotic drugs such as morphine, and is extremely useful for tailor-made pain treatment and drug dependence treatment.

It is a correlation figure with the predicted value at the time of using 5 polymorphisms regarding a 24 hour fentanyl administration required amount (microgram / kg; logarithm conversion value) after mandibular plastic surgery, and the measured value of the required dose in the operation. It is a correlation diagram with the predicted value at the time of using 4 polymorphisms regarding a 24 hour fentanyl administration required amount (microgram / kg; logarithm conversion value) after mandibular plastic surgery, and the measured value of the required dose in the operation. It is a correlation diagram with the predicted value at the time of using 3 polymorphisms regarding a 24 hour fentanyl administration required amount (microgram / kg; logarithm conversion value) after mandibular plastic surgery, and the measured value of the administration required amount in the same operation. It is a correlation diagram with the predicted value at the time of using 2 polymorphisms regarding a 24 hour fentanyl administration required amount (microgram / kg; logarithm conversion value) after mandibular plastic surgery, and the measured value of the administration required amount in the same operation. Predicted value when using 5 polymorphisms for fentanyl required dosage (μg / kg; logarithm conversion value) for 24 hours after mandibular plastic surgery and actual measured value of analgesic dosage required for 24 hours after abdominal surgery FIG. Predicted value using 5 polymorphisms for fentanyl required dosage (μg / kg; logarithmic conversion value) 24 hours after mandibular plastic surgery and actual measured value of total analgesic dosage required for perioperative period in abdominal surgery FIG.

  Hereinafter, the present invention will be described in detail. This specification includes the contents of the specification of Japanese Patent Application No. 2011-288940 (filing date: December 28, 2011), which is a Japanese patent application on which the priority of the present application is claimed. It should be noted that all publications cited in the present specification, for example, prior art documents, publications, patent gazettes and other patent documents are incorporated herein by reference in their entirety.

1. Overview The inventor has studied the genetic mechanisms of analgesic dose individual differences and dependent vulnerability individual differences for GIRK channels, mu opioid receptors, voltage-gated calcium channels, adrenergic receptors, cyclic AMP response element binding proteins, etc. (Ikeda et al., Trends Pharmacol Sci, 26: 311-317, 2005; Nishizawa et al., Neuropsychobiology, 53: 137-141, 2006; Hayashida et al., Pharmacogenomics, 9: 1605-1616, 2008; Nishizawa et al., PLoS ONE, 4: e7060, 2009; Fukuda et al., Pain, 147: 194-201, 2009). As a result, we identified a number of gene polymorphisms significantly related to analgesia and pain. Therefore, in the present invention, five kinds of genes are used, and the gene polymorphisms are judged before surgery to predict individual analgesic sensitivity and the necessary amount of postoperative analgesics, and practice individualized pain treatment. A methodology was devised. As a result, it was found that all of the polymorphisms used were significantly useful for predicting the analgesic requirement for 24 hours after surgery, and it was shown that it could be realized for clinical application as an individualized pain treatment.

  Therefore, the present invention selects at least two genes from the group consisting of GIRK channel gene, mu opioid receptor gene, voltage-dependent calcium channel gene, adrenergic receptor gene, and cyclic AMP response element binding protein gene as various analgesic genes. The present invention also provides a method for evaluating drug susceptibility and disease vulnerability by detecting gene polymorphism in each gene and associating the combination of detected polymorphisms with individual drug susceptibility.

2. Gene polymorphism The gene polymorphism of the gene used in the present invention mainly includes single nucleotide polymorphism (hereinafter also referred to as SNP), but is not limited, insertion polymorphism, deletion polymorphism Polymorphism and base repeat polymorphism can also be included.

  A single nucleotide polymorphism [SNP (SNPs)] means a gene polymorphism resulting from substitution of one specific base of a gene with another base. The insertion / deletion polymorphism means a gene polymorphism caused by deletion / insertion of one or more bases.

  In addition, the base repeat polymorphism means a gene polymorphism caused by the difference in the number of base sequence repeats. Base repeat polymorphism is classified into microsatellite polymorphism (number of bases: about 2 to 4 bases) and VNTR (variable number of tandem repeat) polymorphism (repetitive bases: several bases to several tens of bases) due to the difference in the number of repeated bases. The number of repetitions varies depending on the individual.

3. Analysis target gene (1) GIRK channel gene
GIRK channels are ion channels that are abundant in the brain and heart and play an important role in the control of neuronal excitability and heart rate. The GIRK channel has a structure that penetrates the cell membrane twice at the M1 and M2 sites, and the H5 site between the M1 and M2 sites bites into the cell membrane. The H5 site forms the central part through which ions pass. The GIRK channel functions in a tetrameric state with four subunits combined. There are four types of subunits, GIRK1, GIRK2, GIRK3, and GIRK4. GIRK1, GIRK2, and GIRK3 are strongly expressed in the brain, and GIRK1 / 2 type GIRK channels are mainly functioning in combination with GIRK1 and GIRK2. To do. In the heart, GIRK1 and GIRK4 are strongly expressed, and GIRK1 / 4 type mainly functions.
In order for analgesics such as morphine to exert a sufficient analgesic effect, the opening of the GIRK channel is considered to be an extremely important step.
Table 1 shows information on GIRK channel gene polymorphisms to be analyzed in the present invention.

  In Table 1, “GIRK2” (italic notation) represents the gene of the GIRK2 subunit of the GIRK channel, and “GIRK3” (italic notation) represents the gene of the GIRK3 subunit of the GIRK channel.

  The present invention provides an oligonucleotide containing the gene polymorphism that can specifically hybridize to a DNA fragment containing the gene polymorphism. “Can hybridize” means that a DNA pair can be formed in a normal PCR or hybridization process. Therefore, the conditions under which hybridization can be performed can be set by using a commercially available PCR reagent or hybridization reagent. The same applies hereinafter.

  In Table 1 (SEQ ID NOs: 1 to 10 and 440 to 449), 101 bases are displayed, and the polymorphic site is displayed at the 51st position. For example, “A / G” means that it is a polymorphism of “A” and “G”, and “C / T” means that it is a polymorphism of “C” and “T”. To do. Other base combinations other than “A / G” and “C / T” are also displayed accordingly. Among these, in the present invention, at least 10 bases including the polymorphic site (the 51st base) of the above base sequences (SEQ ID NOs: 1 to 10 and 440 to 449), preferably 10 to 100 bases, more preferably 10 Oligonucleotides having ˜45 bases, more preferably 14-25 bases are provided.

(2) Mu opioid receptor gene The mu (μ) opioid receptor is an endogenous opioid peptide or narcotic analgesic that develops various side effects such as analgesic action and dependence formation, tolerance formation and withdrawal symptoms. It has been revealed that it plays a very important role. In recent years, dependence on drugs and alcohol other than narcotic analgesics and part of mental illness have been known (Lichtman AH, et al., J Pharmacol Exp Ther, 298, 1007-14, ( 2001); Becker A, et al., Naunyn Schmiedebergs Arch Pharmacol, 365, 296-302, (2002); Berrendero F, et al., J Neurosci, 22, 10935-40, (2002); Contarino A, et al , Eur J Pharmacol, 446, 103-9, (2002)). Since it is considered that the mu opioid receptor gene polymorphism may affect the promotion or suppression of dependency formation by opioid or non-opioid drugs, in the present invention, the mu opioid receptor gene is targeted for analysis. can do.

  Table 2 shows information on the mu opioid receptor gene polymorphism to be analyzed in the present invention (WO2005 / 095601).

In Table 2, “Position” means the position of the mu opioid receptor gene on the genome, and represents 5 ′ or 3 ′ untranslated region, exon, intron. “SNP name” is the name of SNP (single nucleotide polymorphism) at a position on the genome, and is assigned by the inventor. Basically, alphabets of A, G, C, or T are given before and after 3 to 4 digits and symbols, respectively, to identify which base SNP. For example, “A-5580G” indicates that the base 5580 bp upstream (5 ′ side) from the start codon of the mu opioid receptor gene is a polymorphism of A and G. "IVS1-A4980G" in the "Intron-1" column is a polymorphism in intron 1, with the base of intron 1 in contact with exon 2 being 1, and the 4980 bp upstream base is changed from A to G Is shown. Similarly, “TAA + G886A” in the “3′UTR” column indicates a polymorphism in which the 886 bp base is changed from G to A on the 3 ′ side from TAA, which is a stop codon.
Table 3 shows examples of the bases of the repetitive polymorphism of the μ opioid receptor gene in healthy individuals.

  In Table 3, “IVS3 + 6113 (GT) n” means a polymorphism that repeats n located 6113 and 6114 bp downstream of intron 3 with the base of intron 3 in contact with exon 3 as n in intron 3. In addition, “IVS3 + 8761 (32bp) n” means a polymorphism that repeats n times in units of 23bp, which is similarly located downstream of 8761bp in intron 3.

  The present invention provides an oligonucleotide containing the gene polymorphism that can specifically hybridize to a DNA fragment containing the gene polymorphism. Table 4 shows oligonucleotides containing the gene polymorphisms of the present invention. For example, the oligonucleotide of the present invention is an oligonucleotide selected from the nucleotide sequences shown in SEQ ID NOs: 11 to 108 containing the polymorphism or nucleotide sequences complementary thereto (Table 4).

  In Table 4 (SEQ ID NOs: 11 to 108), 101 bases are displayed, and the polymorphic site is displayed at the 51st position. The notations such as “A / G” and “C / T” are the same as described above. Also, `` (AC) n '' means a polymorphism in which `` AC '' is repeated n times, `` del (A) '' is a deletion polymorphism of `` A '', and `` ins (TTTC) '' Means an insertion polymorphism of “TTTC”. The other bases are indicated in the same manner.

  Among these, in the present invention, at least 10 bases, preferably 10 to 100 bases, more preferably 10 to 10 bases including the polymorphic site (the 51st base) of the base sequences shown in Table 4 (SEQ ID NOs: 11 to 108). Oligonucleotides having 45 bases, more preferably 14-25 bases are provided. Here, “the 51st base” means the base of the polymorphic site, but the base of this polymorphic site is not necessarily one base. Therefore, in the deletion type polymorphism, there is no base, so the number of bases is not counted, and even if a plurality of bases are repeated, they are counted as the “51st base”.

   In Table 4, the 322 bp sequence (SEQ ID NO: 109) contained in the gene polymorphism (SEQ ID NO: 68) indicated as “TAA + 7075del (322 bp)” is shown outside the table.

(3) Voltage-dependent calcium channel gene The voltage-dependent calcium (Ca ²⁺ ) channel (VDCC) is composed of five subunits, α1, α2, β, γ, and δ. Ca ²⁺ is allowed to flow into the cell. Among these subunits, Ca ²⁺ flows into the cell from the outside mainly through the α1 subunit. Channel conductivity, ion selectivity, activation / inactivation reaction time, and specificity for drugs vary depending on the structure of α1 subunit. So far, genes encoding 10 types of α1 subunits have been identified, of which the Cav2 calcium channel family (so-called Cav2.1, Cav2.2, Cav2.3) exists in the presynaptic membrane of neurons, It is known to be involved in the regulation of neurotransmitter release (Tedford HW., Zamponi GW, Direct G protein modulation of Cav2 calcium channels., Pharmacol. Rev., (2006) 58: 837-862.). Cav2.1, Cav2.2, and Cav2.3 channels are encoded by CACNA1A, CACNA1B, and CACNA1E genes, respectively, and are located on human chromosomes 19, 9, and 1.

Furthermore, the Cav2 calcium channel family is inhibited by opioid receptor activation via the G protein (Soldo BL, Moises HC, μ-opioid receptor activation inhibits N- and P-type Ca ²⁺ channel currents in magnocellular neurons of the rat supraotic nucleus., J. Physiol., (1998) 513: 787-804.).

  Studies with gene-deficient mice revealed that these channels have an important role in pain transmission and opioid analgesia. For example, in Cav2.3-deficient mice, administration of the same amount of morphine resulted in a stronger analgesic effect than wild-type mice (Takumi Tabuchi, Ca channel and pain transmission, Japanese Pharmacology, (2006) 127: 156 -160.) In addition, at the end of 2004, the US Food and Drug Administration (FDA) announced that a Cav2.2 channel inhibitor was used to treat cancer pain that was intolerant or resistant to other treatments such as morphine. (Ziconotide) Intrathecal administration was approved.

The β subunit is a highly hydrophilic protein, does not have a transmembrane site, interacts with the α1 subunit from the cytoplasm side, and affects the amount of Ca ²⁺ current and channel switching dynamics.

  The α2-δ subunit is present in a form in which δ having one transmembrane site and α2, which is entirely extracellular and negatively charged by a sugar chain, are linked by an S—S bond. To date, α2δ-1, α2δ-2, α2δ-3, and α2δ-4 encoded by at least four types of genes have been confirmed.

  Pregabalin and gabapentin, which are used to treat diabetic neuropathic pain and neuropathic pain with shingles, regulate neurotransmitter release at the synapse by binding to the α2δ-1 subunit. (Field MJ. Et al., Identification of the α2δ-1 subunit of voltage-dependent calcium channels as a molecular target for pain mediating the analgesic actions of pregabalin., Proc. Natl. Acad. Sci. USA, (2006) 103: 17537-17542.).

  Information on voltage-dependent calcium channel gene polymorphisms that can be used in the present invention (SNPs in CACNA1A subtype gene, CACNA1B subtype gene and CACNA1E subtype gene found on the genome of Japanese healthy individuals) is shown in Table 5 below. Shown in ~ 7.

  In Tables 5 to 7, “CACNA1A” (italic notation), “CACNA1B” (italic notation) and “CACNA1E” (italic notation) are the CACNA1A subunit gene and CACNA1B subunit gene of the voltage-dependent calcium channel, respectively. Gene, and gene of CACNA1E subunit. The “LD number” represents the disequilibrium (LD) block of each gene polymorphism linkage.

  The “gene polymorphism name” is the name of the SNP at the position on the genome and is registered in the dbSNP database (accessible from http://www.ncbi.nlm.nih.gov/projects/SNP/). Yes (same in this specification). Basically, the ID of “rs” is given before 4 or more digits to identify which SNP.

  The “major allele” and “minor allele” represent the major and minor alleles on the genome of Japanese healthy individuals, respectively.

  The present invention provides an oligonucleotide containing the following gene polymorphism that can specifically hybridize to a DNA fragment containing the gene polymorphism. The oligonucleotide of the present invention is selected from, for example, the nucleotide sequence shown in any one of SEQ ID NOS: 110 to 199 containing the above-mentioned calcium channel gene polymorphism or a nucleotide sequence complementary to the nucleotide sequence. Oligonucleotide.

The gene polymorphic site is the 51st base of the base sequence shown in any one of SEQ ID NOs: 110 to 199 (see Tables 8 to 10).

In Tables 8 to 10, “CACNA1A” (italic notation), “CACNA1B” (italic notation) and “CACNA1E” (italic notation) are the same as described above.
In Tables 8 to 10 (SEQ ID NOs: 110 to 199), 101 bases are displayed, and the polymorphic site is displayed at the 51st position. The notations such as “A / G” and “C / T” are the same as described above. In the present invention, at least 10 bases, preferably 10 to 100 bases, more preferably 10 to 45 including the polymorphic site (the 51st base) of the base sequences shown in Tables 8 to 10 (SEQ ID NOs: 110 to 199). Oligonucleotides having bases, more preferably 14-25 bases, are provided.

(4) Adrenergic receptor gene Information on human adrenergic receptor gene polymorphism that can be used in the present invention (SNPs in ADRB2 subtype gene, ADRB1 subtype gene and ADRA2A subtype gene found on the genome of Japanese healthy subjects) Are shown in Table 11 and Table 12. The gene polymorphisms shown in Table 11 and Table 12 are included in the adrenergic receptor gene polymorphisms of the present invention.

  In Table 11 and Table 12, “ADRB2” (italic notation) represents the ADRB2 subtype gene (ADRB2 gene, which is a subtype of the adrenergic receptor gene), and “ADRB1” (italic notation) represents the ADRB1 subtype gene ( “ADRA2A” (italic notation) represents the ADRA2A subtype gene (ADRA2A gene, which is a subtype of the adrenergic receptor gene).

“Position” means the position on the genome of an adrenergic receptor gene, and represents a 5 ′ flanking region, a 3 ′ flanking region, and an exon.
The “gene polymorphism name” is the name of the SNP at the position on the genome and is registered in the dbSNP database (accessible from http://www.ncbi.nlm.nih.gov/projects/SNP/). Yes (same in this specification). Basically, the ID of “rs” is given before 4 or more digits to identify which SNP.
The “major allele” and “minor allele” represent the major and minor alleles on the genome of Japanese healthy individuals, respectively.

The present invention provides an oligonucleotide containing any one of the polymorphisms that can specifically hybridize to a DNA fragment containing a gene polymorphism of an adrenergic receptor gene.
The oligonucleotide of the present invention is selected from, for example, the base sequence shown in any one of SEQ ID NOs: 200 to 267 or a base sequence complementary to the base sequence, which contains a gene polymorphism of the above-mentioned adrenergic receptor gene. Oligonucleotides (Tables 13 and 14).

  In Tables 13 and 14, “ADRB2” (italic notation), “ADRB1” (italic notation), and “ADRA2A” are the same as described above. 101 bases are displayed in Table 13 (SEQ ID NOs: 200 to 237) and Table 14 (SEQ ID NOs: 238 to 267), and the gene polymorphism site is displayed at the 51st position. The notations such as “A / G” and “C / T” are the same as described above.

The gene polymorphic site is the 51st base of the base sequence shown in any one of SEQ ID NOs: 200 to 267.
In the present invention, at least 10 bases, preferably 10 to 100 bases, more preferably 10 to 45 including the polymorphic site (the 51st base) of the base sequences shown in Tables 13 and 14 (SEQ ID NOs: 200 to 267). Oligonucleotides having bases, more preferably 14-25 bases, are provided.

  The oligonucleotide of the present invention can be used as an adrenergic receptor gene-specific probe and primer in the detection of an adrenergic receptor gene polymorphism described below.

(5) Cyclic AMP responsive element binding protein gene Cyclic AMP responsive element binding protein (CREB) is a signal transduction system downstream of G protein-coupled receptors such as mu opioid receptors. It is a protein that is activated depending on the intracellular cyclic AMP concentration and binds to a cyclic AMP responsive element (cAMP responsive element) of nuclear genomic DNA and is involved in the control of gene expression. In addition to cardiac muscle, various smooth muscles, fat cells, skeletal muscles, it is present in various tissues and organs such as the brain, and is also involved in neurogenesis, memory, dependence, etc. through various gene expression.

  Narcotic analgesics such as morphine act on a protein called an opioid receptor to cause analgesia. There are three types of opioid receptors, mu, delta, and kappa (μ, δ, κ), all of which are related to analgesic action. Since these receptors are Gi / o protein-coupled receptors, they activate GIRK channels and suppress calcium channels via Gi / o proteins, but also suppress adenylate cyclase. Activation of adenylate cyclase activates cyclic AMP-dependent protein kinase and causes activation of the protein through phosphorylation of the cyclic AMP response element binding protein (CREB) at the 133rd serine residue. Activated CREB binds to CREB-binding protein as a coactivator, and promotes gene expression by binding to cyclic AMP response element of genomic DNA.

  Cyclic AMP responsive element binding protein is a protein that is distributed in various tissues and organs including brain and heart and plays an important role in neurogenesis, memory, dependence expression, etc. through various gene expression. The cyclic AMP response element binding protein has a domain structure including Q-rich domain, Kinase-inducible domain (KID), basic region / leucine zipper (bZIP), and the like. Proteins bind to genomic DNA.

  Cyclic AMP response element binding protein functions in a dimeric state by combining two subunits. The types of receptor subtypes are roughly classified into CREB1, CREB3, CREB5, ATF2, etc., and their homologs are also known. It is expressed in various tissues and organs including brain and heart.

  Information on human cyclic AMP responsive element binding protein gene polymorphism that can be used in the present invention (CREB1 subtype gene, CREB3 subtype gene, CREB5 subtype gene and ATF2 subtype gene found on the genome of Japanese healthy subjects) Table 15 and Table 16 show the SNP). The gene polymorphisms shown in Table 15 and Table 16 include the cyclic AMP responsive element binding protein gene polymorphisms of the present invention.

  In Tables 15 and 16, “CREB1” (italic notation) represents a CREB1 subtype gene (CREB1 gene which is a subtype of cyclic AMP response element binding protein (CREB) gene), and “CREB3” (italic notation) Represents CREB3 subtype gene (CREB3 gene, which is a subtype of CREB gene), and "CREB5" (italic notation) represents CREB5 subtype gene (CREB5 gene, which is a subtype of CREB gene), and "ATF2" (Italic notation) represents an ATF2 subtype gene (ATF2 gene, which is another name for CREB2 gene, which is a subtype of CREB gene).

  “Position” means the position of the cyclic AMP responsive element binding protein gene on the genome, and represents a 5 ′ flanking region, a 3 ′ flanking region, an intron, and an exon.

Examples of the oligonucleotide of the present invention include an oligonucleotide selected from the base sequence shown in any one of SEQ ID NOs: 268 to 439 containing the polymorphism or a base sequence complementary to the base sequence ( Tables 17-20).
The oligonucleotide of the present invention can be used as a cyclic AMP response element binding protein gene-specific probe and primer in detection of a cyclic AMP response element binding protein gene polymorphism described later.

In Tables 17 to 20, “CREB1” (italic notation), “CREB3” (italic notation), “CREB5” (italic notation) and “ATF2” (italic notation) are the same as described above. In Tables 17 to 20 (SEQ ID NOs: 268 to 439), 101 bases are displayed, and the gene polymorphism site is displayed at the 51st position. The notations such as “A / G” and “C / T” are the same as described above.
In the present invention, at least 10 bases, preferably 10 to 100 bases, more preferably 10 to 45 bases, more preferably including the polymorphic site (the 51st base) of the above base sequence (SEQ ID NOs: 268 to 439). Oligonucleotides having 14-25 bases are provided.

(6) Genetic polymorphism marker The polymorphism determined as described above is used as a genetic polymorphism marker for evaluating the tendency of individual drug susceptibility, or for evaluating the tendency of individual disease vulnerability. It can be used as a genetic polymorphism marker for
In this specification, “individual” means a subject who evaluates drug sensitivity and disease vulnerability, and means an individual subject.
Specifically, “evaluating” may mean “knowing beforehand” or “predicting”. “High” and “low” include the presence or absence of drug sensitivity and disease vulnerability.

4). The present invention relates to a drug consisting of a GIRK channel gene, a mu opioid receptor gene, a voltage-dependent calcium channel gene, an adrenergic receptor gene, and a cyclic AMP response element binding protein gene. The combination of each polymorphism of at least two genes selected from the above and the drug susceptibility of an individual are associated with each other. The protein encoded by each gene, that is, the drug to be analyzed is shown below.

  By the way, the following proteins (1), (3) to (5) are related to a signal transduction pathway downstream of the opioid receptor, and have some or relatively strong functional relationship with the opioid receptor function or its regulation. Have Therefore, for example, the opioid receptor function-modifying drug (2) can be analyzed by using any group of polymorphisms. Similarly, as long as any protein has some or relatively strong functional relationship to the regulation of other proteins, etc., it can be analyzed using any group of polymorphisms in various functional modifiers.

(1) GIRK channel
Drugs related to GIRK channels (GIRK channel function modifiers) include morphine, DAMGO, codeine, methadone, carfentanil, fentanyl, heroin, naloxone, naltrexone, nalolphine, levalorphan, pentazocine, buprenorphine, oxycodone, hydrocodone, levorphanol, etorphine , Dihydroethorphine, hydromorphone, oxymorphone, tramadol, diclofenac, indomethacin, ethanol, methanol, propanol, butanol, flupirtine, laughter, F3 (1 chloro 1,2,2 trifluorocyclobutane), halothane, estradiol, dithiothreitol , Thioridazine, pimozide, fluoxetine, paroxetine, desipramine, imipramine, clomipramine, tetramid, iso And at least one selected from the group consisting of fullerene, ginsenoside, ifenprodir, bupivacaine, terthiapine, clozapine, haloperidol, SCH23390 and cocaine.

(2) μ opioid receptor Drugs related to μ opioid receptors (mu opioid receptor function modifiers) include stimulants such as methamphetamine, dopamine receptor agonists, dopamine receptor antagonists, μ, κ, δ opioid receptors Agonists, μ, κ, δ opioid receptor antagonists, alcohol and the like can be mentioned. For example, methamphetamine, methylenedioxymethamphetamine, amphetamine, dextroamphetamine, dopamine, morphine, DAMGO, codeine, methadone, carfentanil, fentanyl, heroin, cocaine, naloxone, naltrexone, nalolphine, levalorphan, pentazocine, buprenorcodine, codon And at least one selected from the group consisting of levorphanol, etorphine, dihydroetorphine, hydromorphone, oxymorphone, ethanol, methanol, diethyl ether and tramadol.

(3) Voltage-dependent calcium (Ca ²⁺ ) channel Drugs related to voltage-dependent calcium channels (potential-dependent calcium channel function modifiers) include, for example, ω-agatoxin IVA, ω-agatoxin TK, amlodipine, (±) -Bay K 8664, (R)-(±) -Bay K 8664, Sinalong, ω-conotoxin, GVIA, ω-conotoxin MVIIC, diltiazem, felodipine, flunarizine, FPL64176, gabapentin, isradipine, norbasque, adalate, amrodin, conil, herbesser, perdipine , Carslot, Nivazil, Lercanidipine, Loperamide, Mibefradil, Ethosuximide, Nefilacetam, Nigurodipine, Nimodipine, Nitrangepine, NNC55-0396, Ruthenium Red, SNX482, SR3380-5, Ctoxin, Amiloride, Low Concentration Ni ²⁺ , Ethosuximide, Zonisamido And at least one selected from the group consisting of hydroviridine, benzothiazepine, alkylamine, nifedipine, diconotide, SNX-482, pregabalin, nicardipine, cilnidipine, verapamil, bimicard, emaverine, hipoca, and romeridine (flunarizine).

(4) Adrenergic receptor Examples of drugs related to adrenergic receptors (adrenergic receptor function modifiers) include adrenaline, noradrenaline, dopamine, phenylephrine, naphazoline, α-methylnoradrenaline, oxymetazoline, xylometazoline, clonidine, guanfacine, and guanabenz. , Guanoxabenz, guanethidine, xylazine, methyldopa, fadormidine, amidephrine, amitraz, anisodamine, apraclonidine, brimonidine, silazoline, detomidine, dexmedetomidine, epinephrine, ethylephrine, indanidine, lofexidine, midetomidine, midetomidine , Norphenephrine, octopamine, oxymetazo , Phenylpropanolamine, rilmenidine, romifidine, synephrine, talipexol, tizanidine, dibenamine, ergotamine, ergomethrin, phentolamine, torazoline, bunazosin, naphthopidyl, prazosin, terazosin, doxazosin, tamsulosin, silodosin, alfuzosin, trimazine, Clomipramine, doxepin, trimipramine, α-methyldopa, yohimbine, efaloxane, idazoxan, lauorcine, atipamezole, dobutamine, isoproterenol, xamoterol, epinephrine, isoprenaline, salbutamol (albuterol), levosalbutamol (tervalbuterol), terbutaline , Fenoterol, vitorte Roll, pyrbuterol, procaterol, salmeterol, formoterol, bambuterol, clenbuterol, isoetarine, ritodrine, vitorterol mesylate, L-796568, amibegron, solavegron, albutamine, befnolol, bromoacetylalprenololmenthane, broxaterol, cimatedenoline, silmaterolazoline Dopexamine, ethylephrine, hexoprenalin, hygenamine, isoxsuprine, mabuterol, methoxyphenamine, nilidrin, oxyfedrine, prenalterol, ractopamine, reproterol, limiterol, tretoquinol, tulobuterol, zilpaterol, gintenolol, alprenolol, bucindolol, bucindolol, bucindolol , Pindolol, timolol Dichloroisoprenaline, alprenolol, carteolol, indenolol, bunitrolol, penbutolol, propranolol, nadolol, nipradilol, chilisolol, acebutolol, ceriprolol, metoprolol, atenolol, bisoprolol, betaxolol, practolol, bevantolol, IC, esmololol, IC -118,551, SR 59230A, mepindolol, oxprenolol, landiolol, levobunolol, metipranolol, labetalol, carvedilol, arotinolol, amosuralol, amphetamine, droxidopa, tyramine, ephedrine, pseudoephedrine, atomoxetine, tomoxirexine, toxoxyrebo Amineptin, bu Lopion, dexmethylphenidate, fencamphamin, fencamine, lefetamine, methylphenidate, piperdolol, prolintan, pyrovalerone, diphemetrex, desvenlafaxine, duloxetine, milnacipran, venlafaxine, buttriptyline, desipramine, Dosrepin, imipramine, lofepramine, nortriptyline, protriptyline, amoxapine, maprotiline, mianserin, cyclobenzaprine, mesocarb, nefadozone, nefopam, sibutramine, tapentadol, tramadol, ziprasidone, adhiperifolin, hyperforin, cocaine, desoxypiprado Roll, diphenylprolinol, tylene oxypylobalerone, cyclazine dol, esreboxetine, Nifaxine, Nisoxetine, Radafaxin, Tandamine, WYE-103231, 1- (Indolin-1-yl) -1-phenyl-3-propan-2-olamines, 1- or 3- (3-Amino-2-hydroxy-1- phenyl propyl) -1,3-dihydro-2H-benzimidazol-2-ones, (+)-S-21, thienyl-based, bisifazine, brasofensin, diclofensin, DOV-21,947, DOV-102,677, DOV- 216,303, indatraline, NS-2359, oxaprotiline, SEP-225,289, SEP-227,162, tesofensin, and Dutchville.

(5) Cyclic AMP response element binding protein Drugs related to cyclic AMP response element binding protein (cyclic AMP response element binding protein functional modifier) include phosphodiesterase 4 (PDE4), calcineurin, protein kinase A, protein kinase C, Examples thereof include at least one selected from the group consisting of p90 ribosomal S6 kinase 1 (RSK1), calmodulin kinase, glycogen synthase kinase 3β and CREB-regulated transcription coactivator 1 (CRTC1).

(6) Nicotine receptor function modifiers Nicotine receptor function modifiers are from the group consisting of carbachol, ABT-594, varenicline, sisamethonium, hexamethonium, pancuronium, vecuronium, tubocurarine, trimetaphane, mecamylamine and champix. There may be mentioned at least one selected.

5. Polymorphism analysis In the present invention, at least one of five genes including a GIRK channel gene, a mu opioid receptor gene (OPRM1), a voltage-dependent calcium channel gene, an adrenergic receptor gene, and a cyclic AMP response element binding protein gene is selected. Two types of genes are selected, and a polymorphism of each gene is selected from the selected genes. For this reason, since the obtained data has a plurality of variables, it can be a target of multivariate analysis.

  Multivariate analysis is a statistical analysis method that analyzes the correlation between these variables based on data on multiple variables. In the present invention, multiple regression analysis, multicomponent analysis, cluster analysis, principal component analysis Analysis, factor analysis, etc. can be employed.

  First, genomic DNA is extracted from a biological sample (eg, blood) of a subject such as a human, and gene polymorphisms in each gene are identified. Next, each subject is subjected to multivariate analysis such as multiple regression analysis. Examples of variables to be analyzed include information on each polymorphism, pain sensitivity data before administration of an analgesic before surgery, pain management data after surgery, and the like.

  In the present invention, age (year), sex, height (cm), weight (kg), etc. can be further added to the above-described genetic polymorphic variables, and in addition, preoperative analgesics (for example, fentanyl) The variable of the measured value of the pain detection latency (seconds; logarithmic conversion) by immersion in ice water before hand can be appropriately added. There is no particular limitation on the number of variables, but if there are too many variables, there is a possibility that the degree of fitness for unknown data will be low, so for example, generally 5 to 10 as shown in the embodiments of the present invention. It is possible to use degrees of independent variables and dependent variables that depend on these independent variables. The dependent variable is a number that changes in response to changes in the independent variable, for example, age (year), gender, height (cm), weight (kg), before preoperative analgesic (eg fentanyl) administration When the measured value of pain perception latency (seconds; logarithmic conversion) and immersion of the above-mentioned genetic polymorphism variables as independent variables in mice, the required dose of fentanyl per body weight for 24 hours after surgery (μg / kg; logarithm) Transformation) can be the dependent variable.

It is preferable to set dummy variables for sex and genotype. The dummy variable means that when one variable X has m categories, this is represented by m variables D1, D2,..., Dm. For example, if the variable X is gender, there are two variables. Therefore, analysis is performed by replacing males with D1 = 0 and females with D2 = 1. As for the genotype, for example, the A / A genotype can be set to 1, and the A / G and G / G genotypes can be set to 0. Can be changed. For example, in a previous study on a gene a having the A / A, A / G, and G / G genotypes, the phenotype values in the A / A genotype and the phenotypes in the A / G and G / G genotypes When knowledge showing a significant difference between values is obtained, as described above, the A / A genotype can be set to 1, the A / G and G / G genotypes can be set to 0, and C In a previous study on another gene b with genotypes of / C, C / T, and T / T, the phenotype values in the C / C and C / T genotypes and the phenotype values in the T / T genotypes Can be set such that the C / C and C / T genotypes are 1 and the T / T genotype is 0.
An example of calculating the necessary amount of analgesic by performing multiple regression analysis is shown below.

The following steps (i) to (iii) make it possible to predict the required fentanyl dose (μg / kg; logarithmic conversion) for 24 hours after surgery for each patient's body weight. Further, the steps (iv) and (v) A single dose of analgesic taking into account individual differences in analgesic susceptibility estimated by such a large amount of analgesic required 24 hours after surgery through the following steps (i) to (v) (Μg) can be set. This indicates that clinical application as an individualized pain treatment can be realized.
(i) Set a dummy variable (gender variable) for each subject's gender. Replace male with 0 and female with 1, respectively.
(ii) Set a dummy variable for each subject's genotype.
For example, the A / A genotype is 1 in OPRM1 rs9384179 (polymorphic variable 1), the A / G and G / G genotypes are 0, and the A / A genotype is 1 in CACNA1E rs3845446 (polymorphic variable 2). , A / G and G / G genotype 0, ADRB2 rs11959113 (polymorphic variable 3) A / A and A / G genotype 1, G / G genotype 0, GIRK2 rs2835859 (polymorphism) Variable 4) T / T genotype 1, T / C and C / C genotype 0, CREB1 rs2952768 (polymorphic variable 5) C / C genotype 1, T / C and T / Replace the T genotype with 0, respectively.
(iii) Using the following multiple regression equation, the predicted value y (μg / kg) of the required amount of fentanyl administered within 24 hours after surgery per log-transformed body weight is calculated.
y = -0.667 + (-0.006) x [age (year)] + 0.194 x [sex variable] + 0.012 x [height (cm)]
+ (-0.007) x [body weight (kg)] + (-0.088) x [logarithmic and preoperative pain detection latency threshold (seconds)]
+ 0.213 × [Polymorphic variable 1 value] + 0.241 × [Polymorphic variable 2 value] + 0.183 × [Polymorphic variable 3 value]
+ 0.247 × [4 polymorphic variables] + 0.542 × [5 polymorphic variables]
(iv) Based on the relational expression of [y = Ln (1 + x '')], after calculating the predicted value x '' (μg / kg) of fentanyl required dose within 24 hours after surgery per body weight, Based on the relational expression x ′ = x ″ / 4], a single dose x ′ (μg / kg) per body weight is set. In subjects (patients) with x 'values of 0.2 (μg / kg) or less and 1 (μg / kg) or more, the settings were corrected to 0.2 (μg / kg) and 1 (μg / kg), respectively. Always make 0.2 ≤ x '≤ 1.
(v) x (μg) is set for each subject based on the relational expression [x = {body weight (kg)} × x ′].

In (iii) above, age (year), gender, height (cm), body weight (kg), and pain detection latency (second; logarithmic conversion) due to immersion in ice water in hands before administration of preoperative analgesic (fentanyl) Set the coefficient of the variable term of the measured value of 0 to [Polymorphic variable 1 value], [Polymorphic variable 2 value], [Polymorphic variable 3 value], [Polymorphic variable 4 value], [Polymorphic variable 5] Value of any of 2 to 5 polymorphic variables and constant terms in [Value] can also be used to predict the fentanyl administration requirement within 24 hours postoperatively per body weight logarithmically converted by the same prediction formula The value y (μg / kg) can be calculated.
When a dose is determined as a result of multivariate analysis, the dose also serves as an index of drug sensitivity.

  By the way, in the method of the present invention, polymorphism is analyzed using samples derived from a plurality of subjects. Therefore, when evaluating drug sensitivity or the like of an individual (individual), it is possible to know the drug sensitivity of each subject individual by examining in which position the individual exists or belongs as a result of multivariate analysis. In addition, a multivariate analysis of polymorphism and drug sensitivity is performed in a predetermined number of subjects (primary population), and the obtained measurement values are used as basic data, and the basic data and the detection target. A polymorphism derived from one or more subjects can be compared.

  Furthermore, the data derived from the above measured subjects are incorporated into the values of the population, and the data such as polymorphism information and drug sensitivity are processed again (re-execution of multiple regression analysis based on the incorporated polymorphism information, etc.) The number of subject subjects (populations) can be increased. By increasing the number of examples, the accuracy of analysis can be increased.

6). Use of analysis results The results analyzed as described above are based on GIRK channels, μ opioid receptors, voltage-gated calcium channels, adrenergic receptors or cyclic AMP response element binding proteins. It can be used as an indicator such as a method for selecting a treatment or prevention method for a disease, a method for determining an appropriate dose of a therapeutic drug, or a method for predicting side effects. It is possible to predict and evaluate drug sensitivity by determining the genotype of an individual using the oligonucleotide or microarray of the present invention.

  In addition, using the gene polymorphism or method of the present invention, it is possible to evaluate differences in prediction accuracy based on differences in drug sensitivity due to differences in race. The subject is not particularly limited, and examples include Japanese and Westerners. In the present invention, the subject is preferably a Japanese or a person who has the same genetic polymorphism tendency as Japanese.

  By the way, morphine is used as an analgesic, but since it also has a respiratory suppressive action, it is necessary to carefully determine the administration dose. Analyzing the correlation between the novel gene polymorphisms revealed by the present invention and morphine susceptibility, and predetermining which morphine susceptibility of which individual polymorphism has which genotype, morphine administration subjects By examining a patient's mu opioid receptor gene polymorphism or other gene polymorphisms, the morphine sensitivity of the patient can be clarified to determine the dose.

7). Correlation between each gene polymorphism and drug sensitivity or disease vulnerability It is considered that when a gene polymorphism occurs in each gene, the function and expression level of the protein may change. Thus, there may be a correlation between the polymorphism and various phenotypes related to the protein encoded by the gene.

  Here, examples of the phenotype include a phenotype related to drug sensitivity (drug sensitivity) and a phenotype related to disease onset (disease vulnerability). Drug sensitivity includes drug effectiveness, drug side effects, drug effective duration, and the like. Disease vulnerability includes drug sensitivity, pain sensitivity, vulnerability to drug dependence, and the like.

The correlation between each gene polymorphism and the phenotype can be examined, for example, as in the following (1) to (3).
(1) Gene polymorphism analysis is performed using a sample derived from a subject (a healthy person or a patient), and a gene polymorphism is selected.
(2) Next, a multivariate analysis of the association between the selected gene polymorphism and pain sensitivity is performed. For multivariate analysis, it is effective to use statistical methods such as multiple regression analysis.
(3) If there is a genetic polymorphism significantly related to drug sensitivity in a subject, it can be evaluated that this genetic polymorphism correlates with a genetic factor (genetic predisposition) of drug sensitivity. In addition, if there is a genetic polymorphism that has a significant difference in genetic polymorphism frequency between healthy subjects and subjects, it can be evaluated that this genetic polymorphism correlates with a genetic factor (genetic predisposition) of disease vulnerability. it can.

  However, since it is suggested that the tendency of genetic polymorphism is influenced by race, birthplace, etc., genetic polymorphism similar to the population used to find related genetic polymorphism (eg SNP) It is desirable to perform evaluation using the gene polymorphism in a population exhibiting

8). Polymorphism Detection Method A genomic sample from a subject can be extracted from a biological sample such as blood, saliva, skin, etc., but is not limited to this as long as the genomic sample can be collected. Methods for extracting and purifying genomic DNA are well known. For example, genomic DNA is purified from specimens such as blood, saliva and skin collected from humans using the phenol method or the like. At that time, a commercially available genomic DNA extraction kit or apparatus such as GFX Genomic Blood DNA Purification Kit may be used. If the SNP to be investigated is in the open reading frame, mRNA or total RNA may be extracted instead of genomic DNA. Hereinafter, an example of the gene polymorphism detection method of the above-mentioned test sample is shown.

(1) Detection using PCR method
In order to amplify a test sample by PCR, it is preferable to use a DNA polymerase having high fidelity, for example, KOD Dash polymerase (TOYOBO). The primer to be used is designed and synthesized so that the gene polymorphism is included at an arbitrary position of the primer so that the target SNP in the test sample can be amplified.
After completion of the amplification reaction, the amplification product is detected and the presence or absence of the polymorphism is determined.

The method for obtaining genetic polymorphism information is, for example, as follows.
(I) Genomic DNA is purified from a sample (eg, blood) collected from a human using the phenol method or the like. At that time, a commercially available genomic DNA extraction kit or apparatus such as GFX Genomic Blood DNA Purification Kit (manufactured by GE Healthcare Biosciences) may be used.
(Ii) Next, using the obtained genomic DNA as a template, the genomic DNA is amplified in several parts by PCR, and used as a template DNA for sequencing. Since the present invention targets gene polymorphism, it is desirable to use an enzyme used in the PCR method with as high a fidelity as possible.
(Iii) The region around each gene polymorphism is amplified by PCR using a primer designed based on the sequence information published in GenBank by about 500 to 1000 bp.
(Iv) The base sequence of the entire region of these PCR fragments is decoded by a sequencing method using a primer designed based on the sequence information published in GenBank by about 500 to 700 bp, and the target gene polymorphism information is obtained. Can be obtained.

(2) Detection by nucleotide sequence determination method In the present invention, the polymorphism of the present invention can also be detected by a nucleotide sequence determination method based on the dideoxy method. A commercially available ABI series (Amersham Bioscience) is used as a sequencer used for base sequence determination.
(3) Detection by DNA microarray
The DNA microarray has a nucleotide probe immobilized on a support, and includes a DNA chip, a Gene chip, a microchip, a bead array, and the like.

  First, a polynucleotide of a test sample is isolated, amplified by PCR, and labeled with a fluorescent reporter group. Subsequently, labeled DNA / mRNA and total RNA are incubated with the array. The array is then inserted into a scanner and the hybridization pattern is detected. Hybridization data is collected as luminescence from fluorescent reporter groups attached to the probe array (ie, incorporated into the target sequence). A probe that perfectly matches the target sequence produces a stronger signal than one that has a portion that does not match the target sequence. Since the sequence and position of each probe on the array is known, the sequence of the target polynucleotide reacted with the probe array can be determined by complementation.

The method for obtaining genetic polymorphism information is as follows.
(I) Genomic DNA is purified from a sample (eg, blood) collected from a human using the phenol method or the like. At that time, a commercially available genomic DNA extraction kit or apparatus such as GFX Genomic Blood DNA Purification Kit (manufactured by GE Healthcare Biosciences) may be used.
(Ii) Next, the obtained genomic DNA is dissolved in TE buffer (10 mM tris-HCl, 1 mM EDTA, pH 8.0) and adjusted to 100 ng / μl.
(Iii) Genome-wide genotyping is performed according to the manufacturer's protocol by the Infinium assay II method using the iScan system (Illumina, San Diego, CA) manufactured by Illumina.
(Iv) Perform genome-wide genotyping data analysis using BeadStudio Genotyping module v3.3.7 (Illumina), etc., and perform quality control of the gene polymorphism data of each sample.
(V) From these whole genome genotyping data, using the annotation information of the target gene name as a clue, select the gene polymorphism contained in the gene region and flanking region, such as BeadStudio Genotyping module v3.3.7 (Illumina) All the polymorphism information is extracted using the output function of.

(4) Detection by TaqMan PCR method
The TaqMan PCR method uses a fluorescently labeled allele-specific oligo and a PCR reaction with Taq DNA polymerase. Allele-specific oligos (referred to as TaqMan probes) used in the TaqMan PCR method can be designed based on the gene polymorphism information.
(5) Detection of gene polymorphism by invader method The invader method is a method for detecting a gene polymorphism by hybridizing an allele-specific oligo and a template. Kits for performing the invader method are commercially available, and gene polymorphism can be easily detected by this method.

9. Kit The present invention provides a kit for evaluating drug / pain sensitivity or disease vulnerability. The gene polymorphism detection kit of the present invention contains one or more components necessary for carrying out the present invention.
For example, the kit of the present invention preferably contains a reaction component necessary for storing or supplying an enzyme and / or a gene polymorphism detection. Such components include, but are not limited to, for example, the oligonucleotides of the present invention, enzyme buffers, dNTPs, control reagents (eg, tissue samples, target oligonucleotides for positive and negative controls), labels And / or detection reagents, solid supports, instructions and the like. Further, the kit of the present invention may be a partial kit containing only a part of necessary components, and in that case, the user can prepare other components.

The kit of the present invention can also be provided as a microarray in which the oligonucleotide is immobilized on a support. The microarray is obtained by fixing the oligonucleotide of the present invention on a support, and includes a DNA chip, a Gene chip, a microchip, a bead array, and the like.
The kit of the present invention comprises a GIRK channel gene, mu opioid receptor gene, voltage-dependent calcium channel gene, adrenergic receptor gene and cyclic AMP responsive element binding protein gene polymorphism that can be used in the present invention. It is preferable to include an oligonucleotide that can specifically hybridize to a DNA fragment containing a polymorphism.

When genetic polymorphism is determined by the kit of the present invention, for example, blood is collected before the drug is used in a patient or the like (for example, before surgery, at the time of cancer pain, etc.), and DNA containing the protein gene is isolated. The released DNA is reacted with the oligonucleotide in the kit to determine the genotype.
From the determined genotype and gene polymorphism, an administration plan such as the type or dose of the drug can be prepared. As a result, a drug effect suitable for the individual can be obtained, which is useful for custom medicine. For example, when morphine is used, an analgesic effect suitable for an individual can be obtained and side effects can be minimized.

  Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these examples.

(1) Method Genomic DNA was extracted from blood of humans (healthy Japanese: 229 people in total), human GIRK channel gene subtype GIRK2 rs2835859, human mu opioid receptor gene subtype OPRM1 rs9384179, human potential Dependent calcium channel gene subtype CACNA1E rs3845446, human adrenergic receptor gene subtype ADRB2 rs11959113, and human cyclic AMP responsive element binding protein gene subtype CREB1 rs2952768 The type was identified.

  A total of 229 patients who underwent mandibular plastic surgery were used for multiple regression analysis. Before the preoperative analgesic (fentanyl) was administered, the pain sensitivity was measured by measuring the latency of pain perception by immersion in ice water in the hands. For postoperative pain management, the required dose of fentanyl was measured 24 hours after surgery using a PCA (Patient controlled analgesia) pump.

  The above polymorphism variables include age (year), gender, height (cm), body weight (kg), and pain detection latency (seconds; logarithmic conversion) by immersion in ice water before hand administration of preoperative analgesic (fentanyl). A variable regression analysis was performed using as a dependent variable the fentanyl required dose (μg / kg; logarithmic conversion) per 24 hours post-operatively per body weight using a maximum of 10 independent variables. For sex, a dummy variable was set, replacing 0 for men and 1 for women. In addition, a dummy variable was set for the genotype of each study patient, and the A / A genotype of OPRM1 rs9384179 (polymorphic variable 1) used in this study was 1, A / G and G / G. Genotype 0, CACNA1E rs3845446 (polymorphic variable 2) A / A genotype 1, A / G and G / G genotype 0, ADRB2 rs11959113 (polymorphic variable 3) A / A and A / G genotype 1, G / G genotype 0, T / T genotype 1 in GIRK2 rs2835859 (polymorphic variable 4), T / C and C / C genotype 0, CREB1 rs2952768 In (polymorphic variable 5), the C / C genotype was replaced with 1, and the T / C and T / T genotypes were replaced with 0, respectively.

(2) Results Genomic DNA was extracted from the blood of a total of 229 patients undergoing mandibular plastic surgery. One polymorphism in the GIRK2 gene region (rs2835859), one polymorphism in the OPRM1 gene region (rs9384179), CACNA1E One polymorphism in the gene region (rs3845446), one polymorphism in the ADRB2 gene region (rs11959113), and one polymorphism in the CREB1 gene region (rs2952768) were determined. In addition to these genetic polymorphism results, age, gender, height, weight, and the measurement value of pain perception latency by immersion in ice water before hand administration of preoperative analgesic (fentanyl) were added as independent variables. A multiple regression analysis was performed with the required fentanyl dose (logarithmic conversion) 24 hours after surgery as a dependent variable.

As a result, for rs2835859 polymorphism (P = 0.0446), rs9384179 polymorphism (P = 0.0306), rs3845446 polymorphism (P = 0.00224), rs11959113 polymorphism (P = 0.0173), and rs2952768 polymorphism (P = 0.0000790) In both cases, the slope of the regression coefficient was not significantly 0 (see Table 21), and this regression equation was found to be useful for predicting the analgesic requirement 24 hours after surgery (R ² = 0.230). , P = 0.00000000928).

In addition, the relationship between the analgesic drug amount value (μg / kg; logarithmic conversion) predicted by the prediction formula for the required amount of analgesic drug 24 hours after surgery is shown in FIG.
Similarly, genomic DNA was extracted from the blood of a total of 229 patients undergoing mandibular plastic surgery. One polymorphism in the OPRM1 gene region (rs9384179), one polymorphism in the CACNA1E gene region (rs3845446), ADRB2 gene One polymorphism in the region (rs11959113) and one polymorphism in the CREB1 gene region (rs2952768) were determined. In addition to these genetic polymorphism results, age, gender, height, weight, and the measurement value of pain perception latency by immersion in ice water before hand administration of preoperative analgesic (fentanyl) were added as independent variables. A multiple regression analysis was performed with the required fentanyl dose (logarithmic conversion) 24 hours after surgery as a dependent variable.

As a result, it was found that this regression equation was useful for predicting the analgesic requirement 24 hours after surgery (R ² = 0.216, P = 0.0000000202). FIG. 2 shows the relationship between the analgesic drug amount (μg / kg; logarithmic conversion) predicted by the prediction formula for the required amount of analgesic drug 24 hours after surgery and the actual measurement value. Note that the slope of the regression coefficient of each polymorphism was not significantly 0 (see Table 22, Significance Probability).

  Similarly, genomic DNA was extracted from the blood of a total of 229 patients undergoing mandibular plastic surgery, one polymorphism in the CACNA1E gene region (rs3845446), one polymorphism in the ADRB2 gene region (rs11959113), and CREB1 One polymorphism in the gene region (rs2952768) was determined. In addition to these genetic polymorphism results, age, gender, height, weight, and the measurement value of pain perception latency by immersion in ice water before hand administration of preoperative analgesic (fentanyl) were added as independent variables. A multiple regression analysis was performed with the required fentanyl dose (logarithmic conversion) 24 hours after surgery as a dependent variable.

As a result, it was found that this regression equation was useful for predicting analgesic requirement 24 hours after surgery (R ² = 0.200, P = 0.0000000480). Fig. 3 shows the relationship between the analgesic drug amount (μg / kg; logarithmic conversion) predicted by the prediction formula for the required amount of analgesic drug 24 hours after surgery and the actual measurement value. Note that the slope of the regression coefficient of each polymorphism was not significantly 0 (see Table 23, Significance Probability Item).

  Similarly, genomic DNA was extracted from the blood of a total of 229 patients undergoing mandibular plastic surgery, and one polymorphism in the CACNA1E gene region (rs3845446) and one polymorphism in the CREB1 gene region (rs2952768) were determined. did. In addition to these genetic polymorphism results, age, gender, height, weight, and the measurement value of pain perception latency by immersion in ice water before hand administration of preoperative analgesic (fentanyl) were added as independent variables. A multiple regression analysis was performed with the required fentanyl dose (logarithmic conversion) 24 hours after surgery as a dependent variable.

As a result, it was found that this regression equation was useful for predicting the analgesic requirement for 24 hours after surgery (R ² = 0.182, P = 0.000000150). FIG. 4 shows the relationship between the analgesic drug amount value (μg / kg; logarithmic conversion) predicted by the prediction formula for the required amount of analgesic drug 24 hours after surgery and the actual measurement value. Note that the slope of the regression coefficient of each polymorphism was not significantly 0 (see Table 24, Significance Probability Item).

  The present inventor has studied the genetic mechanism of analgesic dose individual differences and dependent vulnerability individual differences for GIRK channels, mu opioid receptors, voltage-dependent calcium channels, adrenergic receptors, cyclic AMP response element binding proteins, etc. As a result of the examination, we have identified a number of genetic polymorphisms significantly related to analgesia and pain. In the present invention, a method for practicing personalized pain therapy was devised by predicting the analgesic sensitivity and the necessary amount of postoperative analgesics by determining these gene polymorphisms before surgery. As a result, it was found that all of the polymorphisms used were significantly useful in predicting analgesic requirements for 24 hours after surgery.

  Therefore, by using the present invention, the above-mentioned genetic polymorphism variables include age (year), gender, height (cm), body weight (kg), and pain caused by immersion in ice water in hands before administration of a preoperative analgesic (fentanyl). Using a total of up to 10 variables including the measured latency (seconds; logarithmic conversion) variables, the fentanyl administration requirement (μg / kg; logarithmic conversion) per 24 hours postoperatively per body weight of each patient It was shown to be predictable.

  Specifically, the following steps (i) to (iii) make it possible to predict the required amount of fentanyl administration (μg / kg; logarithmic conversion) per 24 hours after surgery per body weight of each patient, and (iv) and ( Considering individual differences in analgesic sensitivity estimated by the amount of analgesic required 24 hours after surgery by going through the following steps (i) to (v) with the addition of step v) It was shown that a single dose (μg) of an analgesic can be set and clinical application as an individualized pain treatment can be realized.

(i) A dummy variable (gender variable) was set for the sex of each study subject. Replaced male with 0 and female with 1, respectively.
(ii) Based on the results of previous studies, dummy variables were set for the genotype of each study subject. When predicting using the above 3 polymorphisms, the A / A genotype is 1 in OPRM1 rs9384179 (polymorphic variable 1), the A / G and G / G genotypes are 0, and CACNA1E rs3845446 (multiple Genotype of A / A in type variable 2), 0 genotype of A / G and G / G, genotype of A / A and A / G in ADRB2 rs11959113 (polymorphic variable 3), G / G genotype 0, GIRK2 rs2835859 (polymorphic variable 4) T / T genotype 1, T / C and C / C genotype 0, CREB1 rs2952768 (polymorphic variable 5) C / The C genotype was replaced with 1, and the T / C and T / T genotypes were replaced with 0, respectively.
(iii) The predicted value y (μg / kg) of the required dose of fentanyl within 24 hours after surgery per log-transformed body weight was calculated using the following multiple regression equation.
y = -0.667 + (-0.006) x [age (year)] + 0.194 x [sex variable] + 0.012 x [height (cm)]
+ (-0.007) x [body weight (kg)] + (-0.088) x [logarithmic and preoperative pain detection latency threshold (seconds)]
+ 0.213 × [Polymorphic variable 1 value] + 0.241 × [Polymorphic variable 2 value] + 0.183 × [Polymorphic variable 3 value]
+ 0.247 × [4 polymorphic variables] + 0.542 × [5 polymorphic variables]
(iv) Based on the relational expression of [y = Ln (1 + x '')], after calculating the predicted value x '' (μg / kg) of fentanyl required dose within 24 hours after surgery per body weight, Based on the relational expression x ′ = x ″ / 4], a single dose x ′ (μg / kg) per body weight was set. In patients whose x 'value is 0.2 (μg / kg) or less and 1 (μg / kg) or more, the setting is corrected to 0.2 (μg / kg) and 1 (μg / kg), respectively, and always 0.2 ≤ x '≤ 1
(v) x (μg) was set for each study patient based on the relational expression [x = {body weight (kg)} x x '].
In (iii) above, age (year), gender, height (cm), body weight (kg), and pain detection latency (second; logarithmic conversion) due to immersion in ice water in hands before administration of preoperative analgesic (fentanyl) Set the coefficient of the variable term of the measured value of 0 to [Polymorphic variable 1 value], [Polymorphic variable 2 value], [Polymorphic variable 3 value], [Polymorphic variable 4 value], [Polymorphic variable 5] Value], by appropriately setting any 2 to 5 polymorphic variables and constant terms, the amount of fentanyl administration required within 24 hours postoperatively per body weight logarithmically converted by the same prediction formula The predicted value y (μg / kg) can be calculated. The statistics including the constant term and the value of coefficient B of each polymorphic variable in that case are shown in Tables 25-50.

(1) Method Genomic DNA was extracted from blood of humans (Japanese patients: 145 in total), human GIRK channel gene subtype GIRK2 rs2835859, human mu opioid receptor gene subtype OPRM1 rs9384179, human voltage dependent Polymorphisms of rs3845446 of the subtype CACNA1E of the calcium channel gene, rs11959113 of the subtype ADRB2 of the human adrenergic receptor gene, and rs2952768 of the subtype CREB1 of the human cyclic AMP responsive element binding protein gene (cAMP responsive element binding protein) Was identified.

A total of 145 patients who underwent abdominal surgery were used as subjects for single regression analysis. The amount of analgesic administration required for pain management at 24 hours after surgery (μg / kg; logarithmic conversion) was measured.
As analgesics, pentazocine and pethidine mainly administered intravenously, buprenorphine, diclofenac and indomethacin mainly administered as suppositories, flurbiprofen axetil injected intravenously, and epidural morphine The analgesic was used.

The fentanyl-converted total analgesic amount means the total analgesic amount (mg) when each administered analgesic is converted to fentanyl. The conversion of each analgesic to fentanyl is equivalent to 0.3 mg fentanyl, with a titer of 90 mg pentazocine, 360 mg pethidine (opistan), 1 mg buprenorphine (lepetane), 300 mg diclofenac (voltaren), 300 mg flurbiprofen axetil (ropion) , Converted to 6 mg epidural morphine.

Using the present invention, the variables of age (year), gender, height (cm), and weight (kg) are added to the above-described genetic polymorphism variables, and a total of nine independent variables are used to determine the weight of each patient. It was shown that fentanyl required dosage (μg / kg; logarithmic conversion) and analgesic sensitivity, which seems to be inversely related thereto, can be predicted 24 hours after the mandibular plastic surgery.

Specifically, fentanyl required dosage (μg / kg; logarithmic conversion) for 24 hours after mandibular plastic surgery per body weight of each patient and analgesia considered to be inversely related to it by the following processes (i) to (iii) Drug sensitivity can be predicted.

(i) Set a dummy variable (gender variable) for the gender of each study subject. Replaced male with 0 and female with 1, respectively.
(ii) Based on the results of previous studies, dummy variables were set for the genotype of each study subject. When predicting using the above 5 polymorphisms, the A / A genotype is 1, the A / G and G / G genotypes are 0, and CACNA1E rs3845446 (polymorphism) in OPRM1 rs9384179 (polymorphic variable 1). Genotype of A / A in type variable 2), 0 genotype of A / G and G / G, genotype of A / A and A / G in ADRB2 rs11959113 (polymorphic variable 3), G / G genotype 0, GIRK2 rs2835859 (polymorphic variable 4) T / T genotype 1, T / C and C / C genotype 0, CREB1 rs2952768 (polymorphic variable 5) C / The C genotype was replaced with 1, and the T / C and T / T genotypes were replaced with 0, respectively.
(iii) The predicted value y (μg / kg) of the required dose of fentanyl within 24 hours after surgery per log-transformed body weight was calculated using the following multiple regression equation.
y = -0.667 + (-0.006) x [age (year)] + 0.194 x [sex variable] + 0.012 x [height (cm)] + (-0.007) x [weight (kg)] + 0.213 x [polymorphism] Variable 1 value] + 0.241 × [Polymorphic variable 2 value] + 0.183 × [Polymorphic variable 3 value] + 0.247 × [Polymorphic variable 4 value] + 0.542 × [Polymorphic variable 5 value]

(2) Results Genomic DNA was extracted from the blood of a total of 145 patients undergoing abdominal surgery. One polymorphism in the GIRK2 gene region (rs2835859), one polymorphism in the OPRM1 gene region (rs9384179), CACNA1E gene One polymorphism in the region (rs3845446), one polymorphism in the ADRB2 gene region (rs11959113), and one polymorphism in the CREB1 gene region (rs2952768) were determined. In addition to these genetic polymorphism results, age, gender, height, and weight variables were added as independent variables, and fentanyl was administered 24 hours after mandibular plastic surgery per body weight, which is considered to be inversely related to the analgesic sensitivity of each patient. The required amount (μg / kg; logarithmic conversion) was predicted, and it was used as an independent variable, and the analgesic administration necessary amount (μg / kg; logarithmic conversion) for 24 hours after abdominal surgery was subjected to a single regression analysis as the dependent variable. .

As a result, regarding the fentanyl required dose (μg / kg; logarithmic conversion) 24 hours after mandibular plastic surgery, the slope of the regression coefficient is not significantly 0 (see Table 51). The fentanyl required dose (μg / kg; logarithmic conversion) 24 hours after mandibular plastic surgery calculated using the regression equation is considered to be able to predict the analgesic sensitivity of each patient, and postoperatively in abdominal surgery It was found to be significantly useful in predicting the 24 hour analgesic dose requirement (R ² = 0.030, P = 0.0358).

In addition, the predicted value (μg / kg; logarithmic conversion) when using 5 polymorphisms for fentanyl required dosage 24 hours after mandibular plastic surgery and the required analgesic dosage 24 hours after abdominal surgery The relationship with the values is shown in FIG.

(1) Method Genomic DNA was extracted from blood of humans (Japanese patients: 145 in total), human GIRK channel gene subtype GIRK2 rs2835859, human mu opioid receptor gene subtype OPRM1 rs9384179, human voltage dependent Polymorphisms of rs3845446 of the subtype CACNA1E of the calcium channel gene, rs11959113 of the subtype ADRB2 of the human adrenergic receptor gene, and rs2952768 of the subtype CREB1 of the human cyclic AMP responsive element binding protein gene (cAMP responsive element binding protein) Was identified.

A total of 145 patients who underwent abdominal surgery were used as subjects for single regression analysis. The total necessary amount of analgesics (μg / kg; logarithmic conversion) for pain management in the perioperative period including the period of 24 hours after the operation was measured during the operation.

Analgesics such as pentazocine and pethidine administered mainly intravenously, buprenorphine, diclofenac and indomethacin administered mainly as suppositories, and flurbiprofen axetil injected intravenously and epidural morphine Drugs were used.

The fentanyl-converted total analgesic amount means the total analgesic amount (mg) when each administered analgesic is converted to fentanyl. The conversion of each analgesic to fentanyl is equivalent to 0.3 mg fentanyl, with a titer of 90 mg pentazocine, 360 mg pethidine (opistan), 1 mg buprenorphine (lepetane), 300 mg diclofenac (voltaren), 300 mg flurbiprofen axetil (ropion) , Converted to 6 mg epidural morphine.

Using the present invention, the variables of age (year), gender, height (cm), and weight (kg) are added to the above-described genetic polymorphism variables, and a total of nine independent variables are used to determine the weight of each patient. It was shown that fentanyl required dosage (μg / kg; logarithmic conversion) and analgesic sensitivity, which seems to be inversely related thereto, can be predicted 24 hours after the mandibular plastic surgery.

Specifically, fentanyl required dosage (μg / kg; logarithmic conversion) for 24 hours after mandibular plastic surgery per body weight of each patient and analgesia considered to be inversely related to it by the following processes (i) to (iii) Drug sensitivity can be predicted.

(i) A dummy variable (gender variable) was set for the sex of each study subject. Replaced male with 0 and female with 1, respectively.
(ii) Based on the results of previous studies, dummy variables were set for the genotype of each study subject. When predicting using the above 5 polymorphisms, the A / A genotype is 1, the A / G and G / G genotypes are 0, and CACNA1E rs3845446 (polymorphism) in OPRM1 rs9384179 (polymorphic variable 1). Genotype of A / A in type variable 2), 0 genotype of A / G and G / G, genotype of A / A and A / G in ADRB2 rs11959113 (polymorphic variable 3), G / G genotype 0, GIRK2 rs2835859 (polymorphic variable 4) T / T genotype 1, T / C and C / C genotype 0, CREB1 rs2952768 (polymorphic variable 5) C / The C genotype was replaced with 1, and the T / C and T / T genotypes were replaced with 0, respectively.
(iii) The predicted value y (μg / kg) of the required dose of fentanyl within 24 hours after surgery per log-transformed body weight was calculated using the following multiple regression equation.
y = -0.667 + (-0.006) x [age (year)] + 0.194 x [sex variable] + 0.012 x [height (cm)] + (-0.007) x [weight (kg)] + 0.213 x [polymorphism] Variable 1 value] + 0.241 × [Polymorphic variable 2 value] + 0.183 × [Polymorphic variable 3 value] + 0.247 × [Polymorphic variable 4 value] + 0.542 × [Polymorphic variable 5 value]

(2) Results Genomic DNA was extracted from the blood of a total of 145 patients undergoing abdominal surgery. One polymorphism in the GIRK2 gene region (rs2835859), one polymorphism in the OPRM1 gene region (rs9384179), CACNA1E gene One polymorphism in the region (rs3845446), one polymorphism in the ADRB2 gene region (rs11959113), and one polymorphism in the CREB1 gene region (rs2952768) were determined. In addition to these genetic polymorphism results, age, gender, height, and weight variables were added as independent variables, and fentanyl was administered 24 hours after mandibular plastic surgery per body weight, which is considered to be inversely related to the analgesic sensitivity of each patient. The required amount (μg / kg; logarithmic conversion) was predicted, and it was used as an independent variable, and the total analgesic administration necessary amount (μg / kg; logarithmic conversion) during abdominal surgery was subjected to a single regression analysis as the dependent variable. .

As a result, regarding the fentanyl administration requirement (μg / kg; logarithmic conversion) (P = 0.00005118) 24 hours after mandibular plastic surgery, the slope of the regression coefficient is not significantly 0 (see Table 52). The fentanyl administration requirement (μg / kg; logarithmic conversion) 24 hours after mandibular plastic surgery calculated using the regression equation is considered to be able to predict the analgesic sensitivity of each patient. It was found to be useful in predicting the total amount of analgesics needed for the period (R ² = 0.109, P = 0.0000512).

In addition, the predicted value (μg / kg; logarithmic conversion) when using 5 polymorphisms related to the fentanyl dosage required 24 hours after the mandibular plastic surgery and the total analgesic dosage required for the perioperative period in abdominal surgery The relationship with values is shown in FIG.

  According to the present invention, a method for evaluating drug sensitivity or disease vulnerability can be provided. This evaluation method makes it possible to easily know or predict the proper prescription amount and proper prescription schedule for narcotic drugs such as morphine, and is extremely useful for tailor-made pain treatment and drug dependence treatment.

Sequence number 28: n represents (ac) _n .
Sequence number 37: n represents (gt) _n .
Sequence number 41: n represents (attatcatattatgacatatatcataatatat) _n .
Sequence number 62: n represents (a) _n .
Sequence number 68: n represents del (322 bp).
Sequence number 70: n represents del (a).
Sequence number 76: n represents (a) _n .
Sequence number 84: n represents (a) _n .
Sequence number 91: n represents (ca) _n .
Sequence number 93: n represents del (tctc).
Sequence number 96: n represents ins (tttc).
Sequence number 107: n represents (t) _n .

Claims (7)

A combination of each gene polymorphism of at least two genes selected from the group consisting of a GIRK channel gene, a mu opioid receptor gene, a voltage-dependent calcium channel gene, an adrenergic receptor gene and a cyclic AMP responsive element binding protein gene; A method for evaluating drug sensitivity, characterized by relating to drug sensitivity of
The gene polymorphism of the GIRK channel gene is rs2835859 of subtype GIRK2, the gene polymorphism of the mu opioid receptor gene is rs9384179 or rs598160 of subtype OPRM1, and the gene polymorphism of the voltage-dependent calcium channel gene is Rs3845446 of subtype CACNA1E, gene polymorphism of the adrenergic receptor gene is rs11959113 of subtype ADRB2, gene polymorphism of the cyclic AMP response element binding protein gene is rs2952768 of subtype CREB1,
The drug is an opioid receptor function modifier;
The evaluation method.   The method according to claim 1, wherein the tendency of drug sensitivity of an individual is evaluated based on the analysis result of the genetic polymorphism, or the required amount of drug is predicted. The following steps:
(1) A step of performing genetic polymorphism analysis using a sample derived from a subject and selecting a genetic polymorphism,
(2) a multivariate analysis of the association between the genotype of the gene polymorphism selected in step (1) and drug sensitivity, and (3) a gene polymorphism significantly associated with drug sensitivity in the subject. The method of Claim 1 or 2 including the process used for evaluation of a drug sensitivity.   The gene polymorphism is at least one selected from the group consisting of a single nucleotide polymorphism, an insertion polymorphism, a deletion polymorphism, and a nucleotide repeat polymorphism, according to any one of claims 1 to 3. the method of. The evaluation of the drug sensitivity is based on the following formulas (1) and (2), by calculating a predicted value x '' (μg / kg) of the required dose of drug within 24 hours after operation per body weight of the individual. The method according to any one of claims 1 to 4, wherein:
Formula (1):
y = a + b x [age (year)] + c x [sex variable] + d x [height (cm)] + e x [weight (kg)] + f x [logarithmically transformed preoperative pain detection Latency threshold (seconds)]
+ A × [Polymorphic variable 1 value] + B × [Polymorphic variable 2 value] + C × [Polymorphic variable 3 value]
+ D × [4 polymorphic variables] + E × [5 polymorphic variables]
[In Formula (1),
y is the predicted value y (μg / kg) of fentanyl administration requirement within 24 hours after surgery per log-transformed body weight,
The constant a and the coefficients b to f and A to E are any of the combinations shown in the following table,
The gender variable is 0 for men and 1 for women.
The preoperative pain detection latency threshold is a measurement of the pain detection latency (seconds) due to immersion in ice water in the hands before drug administration before surgery.
The polymorphic variable 1 value is 1 when the genotype of the rs9384179 or rs598160 is A / A, 0 when A / G and G / G,
The polymorphic variable binary value is 1 when the genotype in rs3845446 is A / A, 0 when A / G and G / G,
The polymorphic variable 3 value is 1 when the genotype in the rs11959113 is A / A and A / G, and 0 when G / G,
The polymorphic variable 4 value is 1 when the genotype in the rs2835859 is T / T, 0 when T / C and C / C,
The polymorphic variable 5 value is 1 when the genotype of the rs2952768 is C / C, and is 0 when T / C and T / T. ]
Formula (2):
y = Ln (1 + x``)
[In formula (2), x ″ and y are as described above. ] The method according to any one of claims 1 to 5, wherein at least two selected from the following oligonucleotides (a) to (e) are selected and used.
(a) a base sequence having a length of 14 to 100 bases including the 51st base in the base sequence represented by SEQ ID NO: 440, or the base, which can specifically hybridize to a DNA fragment containing a GIRK channel gene polymorphism Oligonucleotide consisting of a base sequence complementary to the sequence
(b) a base having a length of 14 to 100 bases including the 51st base in the base sequence shown in SEQ ID NO: 39 or 51, which can specifically hybridize to a DNA fragment containing a gene polymorphism of a mu opioid receptor Oligonucleotide consisting of a sequence or a base sequence complementary to the base sequence
(c) a base sequence having a length of 14 to 100 bases including the 51st base in the base sequence shown in SEQ ID NO: 178, which can specifically hybridize to a DNA fragment containing a gene polymorphism of a voltage-dependent calcium channel Or an oligonucleotide having a base sequence complementary to the base sequence
(d) a base sequence having a length of 14 to 100 bases including the 51st base in the base sequence represented by SEQ ID NO: 212, which can specifically hybridize to a DNA fragment containing a gene polymorphism of an adrenergic receptor, or the Oligonucleotide consisting of a base sequence complementary to the base sequence
(e) 14 to 100 bases long including the 51st base in the base sequence shown in SEQ ID NO: 281 that can specifically hybridize to a DNA fragment containing a gene polymorphism of a cyclic AMP response element binding protein Oligonucleotide consisting of a base sequence or a base sequence complementary to the base sequence A kit for evaluating drug sensitivity comprising at least two selected from the following oligonucleotides (a) to ( e ), wherein the drug is an opioid receptor function-modifying drug.
(a) a base sequence having a length of 14 to 100 bases including the 51st base in the base sequence represented by SEQ ID NO: 440, or the base, which can specifically hybridize to a DNA fragment containing a GIRK channel gene polymorphism Oligonucleotide consisting of a base sequence complementary to the sequence
(b) a base having a length of 14 to 100 bases including the 51st base in the base sequence shown in SEQ ID NO: 39 or 51, which can specifically hybridize to a DNA fragment containing a gene polymorphism of a mu opioid receptor Oligonucleotide consisting of a sequence or a base sequence complementary to the base sequence
(c) a base sequence having a length of 14 to 100 bases including the 51st base in the base sequence shown in SEQ ID NO: 178, which can specifically hybridize to a DNA fragment containing a gene polymorphism of a voltage-dependent calcium channel Or an oligonucleotide having a base sequence complementary to the base sequence
(d) a base sequence having a length of 14 to 100 bases including the 51st base in the base sequence represented by SEQ ID NO: 212, which can specifically hybridize to a DNA fragment containing a gene polymorphism of an adrenergic receptor, or the Oligonucleotide consisting of a base sequence complementary to the base sequence
(e) 14 to 100 bases long including the 51st base in the base sequence shown in SEQ ID NO: 281 that can specifically hybridize to a DNA fragment containing a gene polymorphism of a cyclic AMP response element binding protein Oligonucleotide consisting of a base sequence or a base sequence complementary to the base sequence