JP6112920B2 - Nrf2 activator - Google Patents

Description

  The present invention relates to an Nrf2 activator.

  Active oxygen species such as free radicals and active oxygen generated in cells as a by-product of ultraviolet irradiation and oxygen respiration react easily with lipids, proteins, DNA, etc., which are constituents of living organisms, and give modification and damage to cells. It is known to cause dysfunction and cell death. Chronic exposure to reactive oxygen species causes various diseases such as cancer, inflammation, arteriosclerosis, hypertension, liver dysfunction, diabetes, ischemia-reperfusion injury, ulcers, spots and wrinkles It is known that the risk increases (for example, Non-Patent Documents 1 and 2).

  On the other hand, in recent years, it has become clear that a series of proteins called antioxidant proteins and second phase enzymes cooperate in defense against oxidative stress in the living body and detoxification of xenobiotics. For example, glutathione S-transferase (GST), NAD (P) H: quinone oxidoreductase 1 (NQO1), glutamylcysteine ligase (GCLC), heme oxygenase 1 (HMOX1), thioredoxin reductase 1 (TXNRD1) and the like are known. ing. GST catalyzes the formation of a complex of glutathione and a xenobiotic compound in vivo, and acts to protect against electrophilic chemical substances. NQO1 is involved in the two-electron reduction reaction of quinone, and can avoid the oxidative damage caused by the one-electron reduction of quinone. On the other hand, GCLC is a rate-limiting enzyme in glutathione synthesis and is important for supplying glutathione, which is an antioxidant. Furthermore, HMOX1 is an enzyme involved in heme metabolism, and biliverdin and bilirubin generated by heme degradation have a strong antioxidant effect.

  There is a common sequence called an antioxidant responsive element (ARE) in the promoters of these antioxidant proteins and second-phase enzyme genes. Nuclear factor (erythroid-derived 2) -like 2 (Nrf2 ) Has been shown to induce its expression (eg, Non-Patent Document 3).

  Nrf2 binds to KEAP1 (Kelch-like ECH-associated protein 1) present in the cytoplasm in a steady state without oxidative stress, is ubiquitinated by the Cul3-KEAP1 complex, and is degraded by the proteasome. When exposed to an electrophile, KEAP1 is inactivated by modification of the cysteine residue and ubiquitination of Nrf2 is stopped. As a result, Nrf2 stabilizes and translocates into the nucleus to form a heterodimer with small Maf, which binds to the antioxidant responsive element (ARE) in the promoter region of the genes of the above-mentioned enzymes. Induces gene expression of the second phase enzyme group (detoxification enzyme group, antioxidant protein group). As a result, elimination of active oxygen species and detoxification of electrophilic substances are promoted, and the living body can return from the oxidative stress state to the steady state (for example, Non-Patent Document 4). Thus, Nrf2 plays a central role in biological defense mechanisms against exposure to reactive oxygen species and electrophilic compounds.

  Therefore, the activation of Nrf2 is considered to be effective for preventing or improving various diseases involving oxidative stress by enhancing the antioxidant defense and detoxification ability of the living body. Is underway. For example, resveratrol, curcumin, catechin, epigallocatechin gallate and the like have been reported to have an Nrf2 activating action (Non-patent Document 5), and 2 ', 3 contained in perilla extracts Specific chalcone compounds such as '-dihydroxy-4', 6'-dimethoxychalcone (Non-patent Document 6), chalcone derivatives having a methoxy group or a trifluoromethyl group on the benzene ring (Non-patent Document 7), Nrf2 activity has been reported.

Reuter S et al. (2010) Free Radic. Biol. Med. 49 1603-1616 Lee JM et al. (2005) FASEB 19 1061-1066 Rushmore TH (1991) J Biol Chem 266 11632-11639 Taguchi K et al. (2011) Genes Cells 16 123-140 Tkachev VO et al. (2011) Biochemistry (Moscow) 76 407-422 Izumi Y et al. (2012) Free Radic Biol Med 53 669-679 Kumar V et al. (2011) J Med Chem 54 4147-4159

  The present invention relates to providing pharmaceuticals, foods, cosmetics, or the like having an Nrf2 activating action and exhibiting the effect of enhancing the antioxidant defense and detoxifying ability of a living body, or materials to be blended with these.

  When the present inventors examined in view of said subject, there existed Nrf2 activation effect | action excellent in the methoxy chalcone shown by following General formula (1), or the methyl hesperidin hydrolyzate containing the said methoxy chalcone, a series It has the effect of inducing gene expression of antioxidative protein groups of, and further promoting the production of glutathione and reducing the amount of intracellular active oxygen, which are useful for enhancing the antioxidant defense and detoxification ability of the living body. I found.

That is, the present invention relates to the following 1) to 3).
1) An Nrf2 activator comprising methoxychalcone represented by the following general formula (1) as an active ingredient.
2) A glutathione production promoter containing methoxychalcone represented by the following general formula (1) as an active ingredient.
3) An oxidative stress reducing agent containing methoxychalcone represented by the following general formula (1) as an active ingredient.

[Wherein, R represents a hydrogen atom or a methyl group. ]

  According to the Nrf2 activator, glutathione production promoter and oxidative stress-reducing agent of the present invention, the biological defense by the enhancement of the antioxidant defense, detoxification / metabolism, foreign body excretion, and stress response ability of the living body through the activation of Nrf2. It is possible to prevent, treat or improve diseases and symptoms that develop due to oxidative stress or invasion of xenobiotics, such as cancer, inflammation, arteriosclerosis, hypertension, liver dysfunction, diabetes, skin disorders, etc. Become.

The graph which shows the expression induction activity of an ARE downstream gene. The graph which shows the nuclear transfer promotion effect | action of Nrf2. The graph which shows the expression induction effect | action of an antioxidant gene via Nrf2. The graph which shows the expression induction effect | action of an antioxidant gene. The graph which shows the expression induction effect | action of an antioxidant gene. The graph which shows the glutathione amount increase effect. (A) is the result of MHES hydrolyzate treatment (Experiment 1), and (B) is the result of MHES hydrolyzate treatment + UVB irradiation (Experiment 2). The graph which shows an intracellular active oxygen reduction effect. (A) is the result of UVB irradiation (Experiment 1), (B) is the result of MHES hydrolyzate treatment + UVB irradiation, and (C) is the result of MHES hydrolyzate treatment + hydrogen peroxide treatment (Experiment 2).

  The methoxychalcone represented by the general formula (1) (hereinafter also simply referred to as “methoxychalcone”) includes 4′-hydroxy-3,4,2 ′, 6′-tetramethoxychalcone in which R is a methyl group; 4 ′, 6′-dihydroxy-3,4,2′-trimethoxychalcone in which R is a hydrogen atom is included, but in the present invention, these may be used alone or in combination. It may be used.

  All of the above methoxychalcones are known substances. For example, fractionation and purification of a hydrolyzate (preferably an acid hydrolyzate) of methyl hesperidin, which is used as a food additive or the like (Sakiba, Japan) Chemical synthesis, 1958, 79 (6), 736-740), chemical synthesis using aldol condensation reaction of acetophenones and benzaldehydes (Nishida J et al. (2007) Bioorg Med Chem 15 2396-2402) Etc. can be obtained.

Further, as methoxychalcone used as an active ingredient of the Nrf2 activator, glutathione production promoter and oxidative stress reducing agent of the present invention, in addition to the case of using methoxychalcone alone as described above, methyl hesperidin including these compounds The hydrolyzate (methyl hesperidin aglycone) can also be used.
It is known that the hydrolyzate of methyl hesperidin contains the following flavanone type compound (A) and chalcone type compound (B) (Sakiba, Japan Chemical Journal, 79 (6), 736-740). (1958)). Since the chalcone type compound (B) includes the methoxychalcone represented by the general formula (1) of the present invention, the hydrolyzate of methyl hesperidin used in the present invention contains a large amount of the chalcone type compound (B). Is preferred.

[Wherein, R ¹ and R ² independently represent a hydrogen atom or a methyl group. ]

  As shown in Examples described later, the methoxychalcone and methyl hesperidin hydrolyzate of the present invention promotes the expression of the Nrf2 gene, and further, HMOX1 (heme oxygenase 1), GCLC ( Glutamylcysteine ligase), NQO1 (NAD (P) H: quinone oxidoreductase 1) and the like are promoted. That is, the methoxychalcone and methyl hesperidin hydrolyzate of the present invention can induce the expression of phase II enzymes related to antioxidant defense, detoxification / metabolism, foreign body excretion, stress response mechanism controlled by Nrf2, Protection from oxidative stress (reduction of oxidative stress) and xenobiotic detoxification can be enhanced. This is confirmed by the methyl hesperidin hydrolyzate promoting glutathione production and reducing the amount of intracellular active oxygen (see Examples 6 and 7). If the oxidative stress defense system and the foreign body metabolism system are enhanced, it becomes possible to prevent, treat or ameliorate a disease or symptom caused by oxidative stress or invasion of a xenobiotic. Such diseases or symptoms include, for example, inflammation, cancer, skin disorders (spots, wrinkles, etc.), age-related macular degeneration, Helicobacter pylori protection, neurodegenerative diseases, environmental chemical detoxification, liver dysfunction, autoimmune diseases , Diabetes, arteriosclerosis, hypertension, ischemia-reperfusion injury, ulcer and the like (see Non-patent Documents 1 and 2).

  Therefore, the methoxychalcone and methyl hesperidin hydrolyzate of the present invention promotes glutathione production in vivo in order to activate Nrf2 and to induce expression of a second phase enzyme group controlled by Nrf2. It can be used to reduce oxidative stress, and to prevent, treat or ameliorate diseases caused by oxidative stress or invasion of xenobiotics. Here, the use can be in humans or non-human animals, or specimens derived therefrom, and can be either therapeutic or non-therapeutic. Note that “non-therapeutic” means a concept that does not include medical practice, that is, a concept that does not include a method for operating, treating, or diagnosing a person, more specifically, a doctor or a person who has received instructions from a doctor It is a concept that does not include a method of performing surgery, treatment or diagnosis.

  That is, the methoxychalcone and methyl hesperidin hydrolyzate of the present invention promotes glutathione production in vivo in order to activate Nrf2 and to induce expression of a second phase enzyme group controlled by Nrf2. In order to reduce oxidative stress, and to prevent or ameliorate diseases caused by oxidative stress or xenobiotics, raw materials for use in or as pharmaceuticals, quasi drugs, cosmetics, supplements, food or feed Or it can be made into a formulation, and can be used in order to manufacture these agents.

Here, “Nrf2 activation” means that Nrf2 transcription is promoted to promote Nrf2 expression, Nrf2 translation is promoted, Nrf2 mRNA and protein degradation is inhibited, and Keap1 binding is inhibited. Means promoting Nrf2 expression, promoting Nrf2 nuclear translocation, promoting Nrf2 binding to the target DNA sequence, and so on. .
“Promoting glutathione production” means promoting glutathione production in vivo. Glutathione participates in the body's oxidation-reduction anti-system via NADP, NAD, etc. in the living body, contributes to energy production, and since it has a thiol group in its molecule, it is oxidized by itself, It has a function of protecting the living body from oxidative stress exerted on the living body. Furthermore, glutathione enhances the enzyme activity involved in various conjugated detoxification reactions in the living body and exhibits an excellent detoxification action. Therefore, the promotion of glutathione production can prevent, treat, or improve diseases caused by activation of functions such as cell proliferation, metabolism, and repair, oxidative stress, or foreign substance invasion.
“Reducing oxidative stress” means reducing the amount of peroxides such as proteins, lipids, DNA, etc. by reducing active oxygen species such as free radicals and active oxygen generated in the living body. Reactive oxygen species generated by tobacco and aging cause cell / tissue damage, inflammation, etc., leading to deterioration of various diseases and skin aging. By reducing oxidative stress, prevention, treatment or improvement of oxidative stress-related diseases such as skin aging (stains, wrinkles, sagging, etc.), diabetes and arteriosclerosis can be achieved.

  The dosage forms of the above-mentioned pharmaceuticals (including quasi drugs or supplements) containing the methoxychalcone or methyl hesperidin hydrolyzate of the present invention are tablets, capsules, granules, powders, syrups, intravenous injections, muscles Injections, suppositories, inhalants, transdermal absorption agents, eye drops, nasal drops, poultices, poultices, ointments, lotions, creams, tinctures, liniments, suspensions, lotions, bops, pastes, gels , Sprays, aerosols or oils, oral preparations (dentifrices, liquid dentifrices, mouthwashes, gingival massage creams, oral ointments, gargle tablets, troches, throat lozenges, etc.). As an administration form when used as a pharmaceutical, quasi-drug, or supplement, it can be used by any route such as oral administration, parenteral administration, or topical administration.

In order to prepare pharmaceutical preparations of such various dosage forms, the methoxychalcone or methyl hesperidin hydrolyzate of the present invention alone or other pharmaceutically acceptable excipients, binders, bulking agents, Disintegrant, surfactant, lubricant, dispersant, buffer, preservative, flavoring agent, fragrance, coating agent, carrier, diluent, osmotic pressure regulator, fluidity promoter, absorption aid, pH adjustment Agents, emulsifiers, preservatives, stabilizers, antioxidants, colorants, UV absorbers, wetting agents, thickeners, brighteners, activity enhancers, anti-inflammatory agents, fungicides, corrigents, flavoring agents, increasing amounts Agents, surfactants, dispersants, buffers, preservatives, fixing agents, fragrances, coating agents, and the like can be used in appropriate combinations.
In addition, known medicinal ingredients can be appropriately mixed in the preparation. Examples of such components include vitamins such as vitamin C and E, amino acids and peptides and derivatives thereof, nucleic acids and derivatives thereof, saccharides and derivatives thereof, and other carotenoids, soybean isoflavones, catechins, and antioxidants such as chlorogenic acid. Etc.

  The content of the active ingredient in the preparation is, as methoxychalcone, preferably 0.001% by mass or more, more preferably 0.01% by mass or more, preferably 90% by mass or less, based on the total mass of the preparation. Preferably it is 60 mass% or less. Moreover, Preferably it is 0.001-90 mass%, More preferably, it is 0.01-60 mass%.

  When the methoxychalcone or methyl hesperidin hydrolyzate of the present invention is used as a pharmaceutical or in combination with a pharmaceutical, the dosage may vary according to the condition, body weight, sex, age or other factors of the subject, but orally In the case of administration, the daily dose per adult is usually preferably 0.001 g or more, more preferably 0.01 g or more, preferably 10 g or less, more preferably 3 g or less as methoxychalcone. . Moreover, Preferably it is 0.001-10g, More preferably, it is 0.01-3g. The above-mentioned preparation can be administered according to an arbitrary administration schedule, but is preferably divided into once to several times a day and continuously administered for several weeks to several months. The subject of administration or ingestion is a human who needs or desires the enhancement of antioxidant defense and detoxification ability of the living body, for example, patients with cancer, inflammation, arteriosclerosis, hypertension, liver dysfunction, diabetes, skin disorders, etc. And their reserves.

  The quasi-drug or cosmetic containing the methoxychalcone or methyl hesperidin hydrolyzate of the present invention can be in the form of a skin external preparation, a cleaning agent, a makeup cosmetic or the like. , Emulsions, gels, creams, ointments, powders, granules and the like. Such quasi-drugs and cosmetics in various dosage forms include the methoxychalcone or methyl hesperidin hydrolyzate of the present invention alone or within a range that does not affect the effect thereof, quasi-drugs and skin. It can be prepared by blending various components, medicinal components and the like that can be blended in cosmetics, cleaning agents and the like. For example, various oils, resins, surfactants, gelling agents, preservatives, antioxidants, solvents, alcohol, water, chelating agents, thickeners, UV absorbers, emulsion stabilizers, pH adjusters, dyes, powders , Fragrances, solubilizers, detergents, plant extracts, moisturizing ingredients such as ceramides, skin anti-aging agents, whitening agents, and the like, can be prepared as appropriate.

  The content of the active ingredient in the preparation is, as methoxychalcone, in the total amount, preferably 0.001% by mass or more, more preferably 0.01% by mass or more, still more preferably 0.1% by mass or more, preferably Is 20% by mass or less, more preferably 10% by mass or less, and still more preferably 5% by mass or less. Moreover, Preferably it is 0.001-20 mass%, More preferably, it is 0.01-10 mass%, More preferably, it is 0.1-5 mass%.

  As the food containing the methoxychalcone or methyl hesperidin hydrolyzate of the present invention, in addition to general food and drink, for example, enhancement of antioxidant defense and detoxification ability, for example, skin inflammation, spots, wrinkles, sagging due to ultraviolet rays Including functional foods such as beauty foods, foods for the sick, functional nutritional foods, or foods for specified health, which are based on the concept of suppressing formation or suppressing oxidative stress disorder caused by tobacco, etc. Is done.

  The form of the food may be solid, semi-solid or liquid. Examples of food include confectionery such as breads, noodles, cookies, jelly, dairy products, frozen foods, instant foods, processed starch products, processed meat products, other processed foods, coffee beverages, soups, Examples include seasonings, dietary supplements, and the like, and raw materials thereof. Further, like the above-mentioned preparation for oral administration, it may be in tablet form, pill form, capsule form, liquid form, syrup form, powder form, granule form and the like.

  Such foods include methoxychalcone or methyl hesperidin hydrolyzate, other food and drink materials, solvents, softeners, oils, emulsifiers, preservatives, fragrances, stabilizers, colorants, UV absorbers, antioxidants An agent, a humectant, a thickener, a sticking agent, a dispersant, a wetting agent, and the like can be blended and combined as appropriate.

In addition, various vitamins, amino acids and peptides and derivatives thereof, nucleic acids and derivatives thereof, saccharides and derivatives thereof, carotenoids, soybean isoflavones, catechins, antioxidant components such as chlorogenic acid, and the like can be appropriately blended.
The content of the active ingredient in the food varies depending on the form of use, but as methoxychalcone, it is usually preferably 0.0001% by mass or more, more preferably 0.001% by mass or more. And preferably it is 50 mass% or less, More preferably, it is 10 mass% or less. Moreover, Preferably it is 0.0001-50 mass%, More preferably, it is 0.001-10 mass%.

  Examples of the feed containing the methoxychalcone or methyl hesperidin hydrolyzate of the present invention include feeds for small animals used for rabbits, rats, mice, etc., feeds for pet foods used for dogs, cats, etc. It can be prepared in the same form.

  The content of the active ingredient in the feed is preferably 0.0001% by mass or more, more preferably 0.001% by mass or more, as methoxychalcone. And preferably it is 10 mass% or less, More preferably, it is 1 mass% or less. Preferably it is 0.0001-10 mass%, More preferably, it is 0.001-1 mass%.

Regarding the above-described embodiment, the following aspects are further disclosed in the present invention.
<1> A Nrf2 activator comprising methoxychalcone represented by the following general formula (1) as an active ingredient.
<2> A glutathione production promoter containing methoxychalcone represented by the following general formula (1) as an active ingredient.
<3> An oxidative stress reducing agent comprising methoxychalcone represented by the following general formula (1) as an active ingredient.
<4> Use of methoxychalcone represented by the following general formula (1) for producing an Nrf2 activator.
<5> Use of methoxychalcone represented by the following general formula (1) for producing a glutathione production promoter.
<6> Use of methoxychalcone represented by the following general formula (1) for producing an oxidative stress reducing agent.
<8> A methoxychalcone represented by the following general formula (1) for use in Nrf2 activation.
<9> A methoxychalcone represented by the following general formula (1) for use in promoting glutathione production.
<10> A methoxychalcone represented by the following general formula (1) for use in reducing oxidative stress.
<11> A method for activating Nrf2, wherein the methoxychalcone represented by the general formula (1) is administered to a human or an animal.
<12> A method for promoting glutathione production, wherein the methoxychalcone represented by the general formula (1) is administered to a human or an animal.
<13> A method for reducing oxidative stress, wherein the methoxychalcone represented by the general formula (1) is administered to a human or an animal.
<14> In <1> to <13>, methoxychalcone is a methyl hesperidin hydrolyzate.
<15> In <8> to <10>, the use is a non-therapeutic use.
<16> In <11> to <13>, the method is a non-therapeutic method.

[Wherein, R represents a hydrogen atom or a methyl group. ]

  EXAMPLES Hereinafter, although this invention is demonstrated further in detail based on an Example, this invention is not limited to this.

Production Example 1 Preparation of Evaluation Sample Preparation of methyl hesperidin hydrolyzate and methoxychalcone (i) Preparation of methyl hesperidin hydrolyzate 5.0 g of methyl hesperidin (MHES) (manufactured by Alps Pharmaceutical Co., Ltd.) was dissolved in 250 mL of 50% EtOH, Concentrated hydrochloric acid (15 mL) was added, and the mixture was heated to reflux for 16 hours. After cooling, the mixture was neutralized with an aqueous sodium hydroxide solution. Ethanol was distilled off with an evaporator, followed by extraction with ethyl acetate, washing, drying, filtration, and concentration to obtain a crude product (MHES hydrolyzate).
(Ii) Preparation of 4′-hydroxy-3,4,2 ′, 6′-tetramethoxychalcone and 4 ′, 6′-dihydroxy-3,4,2′-trimethoxychalcone MHES obtained in (i) The hydrolyzate was fractionated by silica gel column chromatography (hexane-ethyl acetate-methanol). Further, the desired fraction was recrystallized to obtain 156 mg of 4′-hydroxy-3,4,2 ′, 6′-tetramethoxychalcone (Compound 1) and 4 ′, 6′-dihydroxy-3,4,2 ′. -Isolated 112 mg of trimethoxychalcone (compound 2).

(Iii) Preparation of 2 ′, 4 ′, 6′-trihydroxy-3,4-dimethoxychalcone 2.0 g of 2 ′, 4 ′, 6′-trihydroxyacetophenone monohydrate was dissolved in 50 mL of THF, and 0 Cooled to ° C. Thereto were added 19 mL of diisopropylethylamine and 3.3 mL of chloromethyl methyl ether, and the mixture was stirred at room temperature for 9.5 hours. After cooling again, water was added and the organic layer was extracted with ethyl acetate, washed, filtered and concentrated to obtain a crude product. This was purified by silica gel column chromatography (hexane-ethyl acetate) to obtain 1.7 g of 2′-hydroxy-4 ′, 6′-bismethoxymethoxyacetophenone.
1 g of 2′-hydroxy-4 ′, 6′-bismethoxymethoxyacetophenone obtained above was dissolved in 20 mL of methanol, and 728 mg of veratraldehyde and 2.9 g of potassium hydroxide were dissolved in 2 mL of water. In addition, the mixture was stirred at room temperature for 55 hours. Thereafter, it was neutralized with hydrochloric acid, extracted with ethyl acetate, washed and dried to obtain a crude product. This was purified by silica gel column chromatography (hexane-ethyl acetate) to obtain 1.1 g of 6′-hydroxy-3,4-dimethoxy-2 ′, 4′-bismethoxymethoxychalcone.
1.1 g of 6′-hydroxy-3,4-dimethoxy-2 ′, 4′-bismethoxymethoxychalcone was dissolved in 60 mL of methanol, 30 mL of 1M hydrochloric acid was added, and the mixture was heated to reflux for 50 minutes. After cooling, the mixture was diluted with water and extracted with ethyl acetate. The organic layer was washed and dried to obtain a crude product. This was purified by silica gel column chromatography (hexane-ethyl acetate) to obtain 585 mg of 2 ′, 4 ′, 6′-trihydroxy-3,4-dimethoxychalcone (Comparative Compound 1).
(Iv) Preparation of 5,7-dihydroxy-3 ′, 4′-dimethoxyflavanone and 7-hydroxy-5,3 ′, 4′-trimethoxyflavanone The methyl hesperidin hydrolyzate obtained in (i) Fractionation was performed by chromatography (hexane-ethyl acetate-methanol). Further, the desired fraction was recrystallized to obtain 865 mg of 5,7-dihydroxy-3 ′, 4′-dimethoxyflavanone (Comparative Compound 2) and 7-hydroxy-5,3 ′, 4′-trimethoxyflavanone (Comparative). Compound 3) 476 mg was isolated.

Example 1 ARE-Luc activity (1) Method 1) Plasmid preparation A sequence (GCLC: TCCCCGTGACTCAGCGCTTTG (SEQ ID NO: 1), NQO1: GATTCTGCTGAGTCACTGTGA (SEQ ID NO: 2)) that has been verified as an ARE sequence in humans is expressed as pGL3-promoter. A plasmid incorporated into vector (Promega) was prepared as follows.
An NheI and XhoI recognition site was added to the end, and a 3 × ARE tandem repeat sequence oligo containing a linker was designed and synthesized. After annealing, it was ligated with pGL3-promoter vector previously treated with NheI and XhoI, and transformed into E. coli (ECOS ^™ Competent E. coli DH5α). A plasmid was extracted from a colony of ampicillin selective medium, and the sequence was confirmed.

GCLC 3xARE F
CTAGCTCCCCGTGACTCAGCGCTTTGCCCTCCCCGTGACTCAGCGCTTTGCCCTCCCCGTGACTCAGCGCTTTGC (SEQ ID NO: 3)
GCLC 3xARE R
TCGAGCAAAGCGCTGAGTCACGGGGAGGGCAAAGCGCTGAGTCACGGGGAGGGCAAAGCGCTGAGTCACGGGGAG (SEQ ID NO: 4)
NQO1 3xARE F
CTAGCCAGTCACAGTGACTCAGCAGAATCTCCCCAGTCACAGTGACTCAGCAGAATCTCCCCAGTCACAGTGACTCAGCAGAATCTC (SEQ ID NO: 5)
NQO1 3xARE R
TCGAGAGATTCTGCTGAGTCACTGTGACTGGGGAGATTCTGCTGAGTCACTGTGACTGGGGAGATTCTGCTGAGTCACTGTGACTGG (SEQ ID NO: 6)

2) Luciferase assay Normal human neonatal foreskin keratinocytes (NHEK) (Invitrogen) were seeded on a 24-well plate, and when they became subconfluent, ARE-Luc plasmid and phRL-TK (Promega) as an internal standard were used as SuperFection Transfection Reagent ( QIAGEN). Thereafter, the MHES hydrolyzate was treated at a final concentration of 3.3, 6.6, 16.5 μg / ml (about 10, 20, 50 μM), and after 16 hours using Dual-Luciferase Reporter Assay System (Promega). Luciferase activity was measured. ARE-Luc activity (firefly luciferase activity) was corrected by phRL-TK activity (Renilla luciferase activity).

(2) Results Increased activity of GCLC-Luc and NQO1-Luc depending on the MHES hydrolyzate concentration was observed (FIG. 1).

Example 2 Nrf2 Nuclear Translocation Promoting Action (1) Method Normal human newborn foreskin epidermal keratinocytes (NHEK) (Invitrogen) were seeded in a 10 cm dish and became subconfluent. Treated with 5 μg / ml (about 50 μM) for 16 hours. The cells were divided into a cytoplasmic fraction and a nuclear fraction using a PBS extract and a Nuclear Extract Kit (Active Motif). 10 μg of nucleoprotein was subjected to Western blotting. Anti-Nrf2 (Santa Cruz: sc-722) and anti-Histon H1 (Santa Cruz: sc-10806) were used as the primary antibody, and Anti Rabbit IgG, HRP Linked (GE Healthcare) was used as the secondary antibody.
(2) Results An increase in the amount of NRF2 in the nucleus was observed by treatment with MHES hydrolyzate (FIG. 2).

Example 3 Antioxidant Gene Expression (1)
(1) Method Normal human neonatal foreskin epidermal keratinocytes (NHEK) (Invitrogen) are seeded on a 12-well plate, and when they become subconfluent, Nrf2 siRNA (Santa Cruz: sc-37030) or Control siRNA (Santa Cruz: sc- 37007) was transfected with HiPerFect Transfection Reagent (QIAGEN). The next day, the MHES hydrolyzate was treated with a final concentration of 16.5 μg / ml (about 50 μM) for 10 hours. RNA was extracted from the cells, and the gene expression level was analyzed by quantitative RT-PCR.
(2) Results HMOX1 (heme oxygenase (decycling) 1), GCLC (glutamate-cysteine ligase, catalytic subunit), NQO1 (NAD (P) H dehydrogen), etc. by MHES hydrolyzate treatment Induced (Figure 3). Further, the antioxidant gene expression inducing action by the MHES hydrolyzate was not observed by Nrf2 knockdown (FIG. 3). From this, it became clear that MHES hydrolyzate promotes antioxidant gene expression via Nrf2.

Example 4 Antioxidant Gene Expression (2)
(1) Method Normal human newborn foreskin epidermal keratinocytes (NHEK) (Invitrogen) were seeded on a 12-well plate, and an experiment was performed when the cells became subconfluent. The MHES hydrolyzate, Compound 1, Compound 2, and Comparative Compound 1-3 were treated to a final concentration of 50 μM, and the cells were collected after 8 hours. Each RNA was extracted and subjected to quantitative RT-PCR.
(2) Results High HMOX1 and GCLC gene expression inducing actions were observed in MHES hydrolyzate and compounds 1 and 2 (FIG. 4).

Example 5 Antioxidant Gene Expression (3)
(1) Method Normal human newborn foreskin epidermal keratinocytes (NHEK) (Invitrogen) were seeded on a 12-well plate, and an experiment was performed when the cells became subconfluent. In addition to MHES hydrolyzate, Compound 1 and Compound 2, sulforaphane, curcumin, resveratrol, catechin, epigallocatechin gallate (EGCG), chlorogen known as components having Nrf2 activating action (Non-Patent Document 5) The acid was treated to a final concentration of 20 μM, and the cells were collected after 8 hours. Each RNA was extracted and subjected to quantitative RT-PCR.
(2) Results It was revealed that the antioxidant gene expression-inducing action of the MHES hydrolyzate, Compound 1 and Compound 2 is equivalent to or higher than that of sulforaphane, curcumin, resveratrol, etc. (FIG. 5).

Example 6 Glutathione Production Promoting Action (1) Method Normal human neonatal foreskin keratinocytes (NHEK) (Invitrogen) were seeded on a 12-well plate, and an experiment was conducted when the cells became subconfluent.
(Experiment 1) The MHES hydrolyzate was treated at a final concentration of 16.5 μg / ml (about 50 μM) for 0, 4, 8, and 24 hours.
(Experiment 2) The MHES hydrolyzate was treated at a final concentration of 16.5 μg / ml (about 50 μM) for 16 hours, then irradiated with UVB (20 mJ / cm 2), and the cells were collected after 0, 3 and 6 hours.
After washing the cells with PBS, 5% MPA (Metaphosphoric acid) was added, and the cells were broken by freeze-thawing operation. The protein was collected in a 1.5 ml tube, deproteinized by centrifugation, and the supernatant was used for GSH measurement. The pellet was resuspended with RIPA, protein was quantified, and used as a GSH correction value. Total glutathione (tGSH = GSH + GSSG) was quantified using a glutathione measurement kit (JaICA).
(2) Results After the MHES hydrolyzate treatment, a time-dependent increase in glutathione amount was observed (FIG. 6 (A)). Although the amount of intracellular glutathione decreased by UVB irradiation, it was revealed that the amount of intracellular glutathione could be maintained by treating with MHES hydrolyzate in advance (FIG. 6B).

Example 7 Intracellular Reactive Oxygen Reduction Action (1) Method Normal human neonatal foreskin keratinocytes (NHEK) (Invitrogen) were seeded in Biocoat Poly-D-Lycine 96-well Black / Clear plate and experimented when subconfluent. Went. The MHES hydrolyzate was treated at a final concentration of 16.5 μg / ml (= about 50 μM) for 16 hours. H ₂ DCFDA (2 ′, 7′-dichlorodihydrofluorescein diacetate) (Invitrogen) was replaced with HBSS (Hank's Balanced salt solution) (Invitrogen) prepared to a final concentration of 10 μM, and treated at 37 ° C. for 20 minutes.
(Experiment 1) After the H ₂ DCFDA treatment, UVB (0, _20, 60 mJ / cm ² ) irradiation was performed, and after 15 minutes, the fluorescence intensity was measured with a fluorescence microplate reader.
(Experiment 2) After the H ₂ DCFDA treatment, 30% hydrogen peroxide solution (Sigma) was treated so that the final concentration of H ₂ O ₂ would be 0, 100, 200, 500 μM, and 30 minutes later using a fluorescent microplate reader The fluorescence intensity was measured.
(2) Results The amount of intracellular active oxygen increased by UVB irradiation (FIG. 7 (A)). Pretreatment of the MHES hydrolyzate reduced the amount of intracellular active oxygen induced by UVB (FIG. 7B). In addition, MHES hydrolyzate also reduced the amount of intracellular active oxygen in H ₂ O ₂ treated cells (FIG. 7C). From the above, it became clear that the MHES hydrolyzate has an oxidative stress reducing action.

Claims (4)

A Nrf2 activator comprising methoxychalcone represented by the following general formula (1) as an active ingredient.
[Wherein, R represents a hydrogen atom or a methyl group. ] A glutathione production promoter comprising methoxychalcone represented by the following general formula (1) as an active ingredient.
[Wherein, R represents a hydrogen atom or a methyl group. ] An oxidative stress reducing agent comprising methoxychalcone represented by the following general formula (1) as an active ingredient.
[Wherein, R represents a hydrogen atom or a methyl group. ]   The Nrf2 activator according to claim 1, the glutathione production promoter according to claim 2, or the oxidative stress reducing agent according to claim 3, wherein the methoxychalcone is a methyl hesperidin hydrolyzate.