JP6105838B2 - Pain treatment - Google Patents

Description

  The present invention relates to a novel therapeutic agent for intractable pain such as neuropathy. Furthermore, it is related with the screening method of a novel pain therapeutic agent.

  Pain is classified into acute pain and chronic pain according to duration. Acute pain is pain associated with tissue damage and its duration is limited. Chronic pain continues after healing of the tissue disorder and often has no obvious organic cause. Acute exacerbation pain in chronic pain is similar to acute pain and is thought to be deeply related to endogenous pain substances. Chronic pain includes intolerable chronic pain such as traffic accidents or after-effects after surgery, end-stage cancer or diabetes. Pain is classified into nociceptive pain, neuropathic pain, and psychogenic pain depending on the cause. These independent pains gradually merge over time, resulting in chronic intractable pain that is difficult to classify.

  Neuropathic pain is defined in the 1994 ISAP (International Association for the Study of Pain) chronic pain classification as intractable pain due to peripheral or central nerve disorders or dysfunction. Neuropathic pain is a complex syndrome that results from compression, degeneration, and damage to the peripheral and central nervous systems, but cannot be explained by a single pathological process. It has not been elucidated. Therefore, the effectiveness of the guideline based on the therapeutic effect regarding neuropathic pain is not guaranteed except for a part.

  Neuropathic pain is pain that newly occurs after a wound has healed, unlike initial pain (acute pain) caused by a wound or the like. As neuropathic pain, there is known a symptom (called “allodynia”) that induces severe pain even by a stimulus that does not usually cause pain. Nonsteroidal anti-inflammatory analgesics and narcotic analgesics effective for acute pain have no effect on neuropathic pain, and a definitive treatment is not yet known. If neuropathic pain can be suppressed, it is possible to reduce the patient's physical pain and improve QOL in clinical terms.

Conventionally, for intractable pain such as neuropathic pain, existing narcotics and anti-inflammatory analgesics are combined with nerve block injection (anesthetic). However, any method is insufficient in effect. For example, using L5-SNL rats, a neuropathic pain model, there has been a report comparing the effects of neurotropin (NTP) and anti-inflammatory analgesics and antidepressants used to treat pain diseases (non-patent literature) 1). Here, it has been reported that neurotropin ^(R) and milnacipran have an analgesic effect only for 2 hours after drug administration, but it is not sufficient in sustaining the effect.

  Pain applied to the periphery is transmitted to the dorsal horn of the spinal cord through sensory nerves (primary neurons) in the dorsalroot ganglion (DRG), and synapses to secondary neurons in the dorsal horn I and II layers of the spinal cord. Secondary neurons transmit their signals to the central brain (brain). Chronic pain model in which the dorsal root ganglion peripheral side of the 5th lumbar spinal nerve of the spinal cord of the rat is ligated, and acute pain model in which the dead fungus of Mycobacterium tuberculosis causing allergic reaction (Complete Freund's Adjuvant: CFA) is injected into the sole of the rat There is a report that made a detailed analysis of events in the dorsal root ganglion. There, the expression level of brain-derived neurotrophic factor (hereinafter also simply referred to as “BDNF”) mRNA, which plays a role in complementing and enhancing synaptic transmission, is increased by CFA stimulation. In particular, it has been reported that exon 1 variants have been significantly increased (Non-patent Document 2). By administering subarachnoid decoy DNA that suppresses the expression of exon 1 variant of BDNF to chronic pain model ligating the spinal cord 5th lumbar spinal nerve of rat and acute pain model in which CFA was injected into the plantar of rat It has been disclosed that the rat has found no pain (Patent Document 1). The above suggests that BDNF may have a function of enhancing pain transmission in the spinal cord, and therefore, if this expression is suppressed, pain may be suppressed, that is, BDNF synthesized in primary neurons. It is based on the idea that pain added to the periphery may be alleviated if it can be suppressed.

Journal of Japan Society of Pain Clinicians Vol.15 No.4, 407-413 (2008) Kobayashi et al., Brain Res. 1206. 13-19 (2008)

International Publication WO2009 / 145067 Pamphlet

  The present invention provides a novel therapeutic agent for intractable pain such as neuropathy, which has a long-lasting effect and can reduce frequent administration compared to nerve block injections such as existing narcotics and anti-inflammatory analgesics. The issue is to provide. Furthermore, it aims at providing the screening method of a novel pain therapeutic agent.

  Brain-derived neurotrophic factor (BDNF) released from sensory nerves (primary neurons) and glial cells present in dorsal root ganglia (DRG) by pain stimulation is a receptor present on the postsynaptic membrane in the dorsal horn of the spinal cord The pain signal is transmitted to the secondary neuron, which is thought to transmit the signal to the brain. The present inventors thought that peripheral pain may be alleviated if it becomes possible to inhibit the binding of BDNF to the receptor. Therefore, as a result of intensive research to solve the above problems, modified BDNF receptors (TrkB: tyrosine kinase receptor B, also known as NTRK2: Neurotrophic Tyrosine Kinase, Receptor, type 2, and NGFR (p75)) The present inventors have found that the gene can be alleviated by producing a gene encoding the gene, that is, a polynucleotide, and introducing and expressing the gene in a chronic pain model rat, thereby completing the present invention.

That is, this invention consists of the following.
1. A therapeutic agent for pain comprising a substance capable of inhibiting the binding between brain-derived neurotrophic factor (BDNF) and its receptor as an active ingredient.
2. 2. The pain therapeutic agent according to 1 above, wherein BDNF is BDNF released to the dorsal horn of the spinal cord.
3. 3. The pain therapeutic agent according to 1 or 2 above, wherein BDNF is BDNF released from sensory nerves and / or glial cells.
4). 4. The pain therapeutic agent according to any one of the preceding items 1 to 3, wherein the substance capable of inhibiting the binding between BDNF and its receptor is a modified BDNF receptor.
5. 5. The pain therapeutic agent according to 4 above, wherein the modified BDNF receptor is any one selected from secreted TrkB, membrane-bound TrkB, and secreted NGFR (p75).
6). 6. The pain therapeutic agent according to 4 or 5 above, wherein the modified BDNF receptor comprises any of the following amino acid sequences:
1) an amino acid sequence represented by any one of SEQ ID NOs: 2, 4, 6, 8, 10 or 12 in the sequence listing;
2) An amino acid sequence in which one to a plurality of amino acids are substituted, deleted, added or introduced in the amino acid sequence shown in 1) above.
7). 7. The substance according to 5 or 6 above, wherein the substance capable of inhibiting the binding between BDNF and its receptor is a polynucleotide encoding any one selected from secreted TrkB, membrane-bound TrkB and secreted NGFR (p75). For treating pain.
8). The pain treatment according to item 7 above, wherein the polynucleotide encoding any one selected from secretory TrkB, membrane-bound TrkB, and secretory NGFR (p75) is a polynucleotide comprising any one of the following base sequences: Agent:
1) a polynucleotide comprising a base sequence represented by any one of SEQ ID NOs: 1, 3, 5, 7, 9, or 11 in the sequence listing;
2) a polynucleotide comprising a base sequence complementary to the polynucleotide shown in 1) above;
3) A polynucleotide that can hybridize under stringent conditions to the polynucleotide shown in 1) or 2) above;
4) A polynucleotide obtained by substituting, deleting, adding or introducing one or more nucleotides among the polynucleotides shown in 1) or 2) above.
9. 9. The pain therapeutic agent according to 7 or 8 above, comprising a vector in which any of the polynucleotides according to 7 or 8 is incorporated.
10. A screening method for a novel therapeutic agent for pain, which comprises selecting a substance capable of inhibiting the binding between BDNF and its receptor.
11. The screening method for a novel pain therapeutic agent according to item 10 above, which comprises the following steps 1) and 2):
1) a step of culturing a cell capable of expressing a BDNF receptor having a transmembrane domain together with a candidate substance and BDNF;
2) A step of confirming BDNF bound on the surface of the cell.
12 The screening method for a novel therapeutic agent for pain according to 10 above, which comprises the following steps 1) to 3):
1) a step of culturing a cell capable of expressing a BDNF receptor having a transmembrane domain together with a candidate substance;
2) A step of further adding BDNF to the culture system;
3) A step of confirming BDNF bound on the surface of the cell.

  As a substance that can inhibit the binding between BDNF and its receptor, the receptor TrkB or NGFR (p75) modified protein, or a gene expressing the modified protein, can be used to reduce pain in chronic pain rats. Was recognized. Specifically, a secretory TrkB gene expression vector pCMVscript-tTrkB (-) Tm-EGFP having no transmembrane domain, or a membrane-bound receptor gene expression vector pCMVscript-tTrkB (+) Tm- having a transmembrane domain In chronic pain rats into which EGFP was introduced, it was confirmed that each protein was expressed, and a pain reducing effect was observed continuously for 3 to 4 days. Therefore, by expressing a gene encoding a modified protein of the BDNF receptor (TrkB and / or NGFR (p75)) in vivo, it is possible to prevent BDNF from binding to the receptor in vivo. Can reduce pain.

  Furthermore, since the mechanism of action of the pain therapeutic agent of the present invention is due to an action that can inhibit the binding between the brain-derived neurotrophic factor and its receptor, the binding between the brain-derived neurotrophic factor and its receptor is prevented. By screening for substances that can be inhibited, a novel pain therapeutic agent can be screened.

It is a conceptual diagram of secretory TrkB, membrane-bound TrkB, and secretory NGFR (p75). It is a production schematic diagram of a modified TrkB gene expression vector. (Example 1-1) FIG. 3 is a schematic diagram of production of a modified NGFR (p75) gene expression vector. (Example 1-2) It is a figure which shows the expression confirmation experiment result of modified TrkB and modified NGFR (p75) in a cultured cell system. (Experimental example 1-1) It is a figure which shows the expression confirmation experiment result of the secretory BDNF receptor (modified TrkB, modified NGFR (p75)) in a cultured cell system. (Experimental example 1-2) It is a figure which shows the confirmation experiment result of the BDNF binding ability of the secretory BDNF receptor (modified TrkB, modified NGFR (p75)) in a cultured cell system. (Experimental Example 1-3) It is a figure which shows the confirmation experiment result of the BDNF binding ability of the membrane-bound BDNF receptor (modified TrkB) in a cultured cell system. (Experimental Example 1-4) It is a figure which shows the pain behavior evaluation schedule of a chronic pain rat. (Experimental Example 1-5) It is a figure which shows the pain suppression data of the chronic pain rat by secretory TrkB. (Experimental Example 1-5) It is a figure which shows the pain suppression data of the chronic pain rat by membrane bound type TrkB. (Experimental Example 1-5) It is a figure which shows the expression confirmation experiment result of the modified TrkB gene in a chronic pain rat. (Experimental example 1-6) It is a figure which shows the experimental result of the system which screens a pain therapeutic agent. (Example 2)

  The present invention relates to an agent for treating pain, comprising as an active ingredient a substance capable of inhibiting the binding between BDNF and its receptor. The “substance that can inhibit the binding of BDNF and its receptor” as the active ingredient of the present invention is preferably BDNF that acts on the dorsal horn of BDNF, more specifically sensory nerves and / or glial cells. BDNF released from the above may inhibit binding to its receptor.

  Here, preferably BDNF acting on the dorsal horn of the spinal cord, more specifically BDNF released from sensory nerves and / or glial cells, etc., the active ingredient contained in the pain therapeutic agent of the present invention is used for pain. This is because pain can be reduced and treated by acting on the related BDNF. BDNF is a secreted protein having a molecular weight of 13.5 kD and forms a homodimer. BDNF binds with high affinity to the specific receptor TrkB on the target cell surface, which is its receptor, and exerts its physiological action through an intracellular signal transduction mechanism. BDNF is also known to be present in high concentrations in the hippocampus. Since BDNF may have a function of enhancing pain transmission in the dorsal horn of the spinal cord, in the present invention, it was considered that pain can be suppressed by suppressing the binding between BDNF and its receptor.

  In the present invention, the substance capable of inhibiting the binding between BDNF and its receptor is a modified BDNF receptor. When BDNF released from sensory nerves and / or glial cells binds to a modified BDNF receptor, the BDNF binds to a specific receptor (TrkB or NGFR (p75)) on the target cell surface. This is to suppress the exertion of its physiological action through the intracellular signal transduction mechanism due to the binding of BDNF and a specific receptor. Such a modified BDNF receptor can be any one or more selected from secreted TrkB, membrane-bound TrkB and secreted NGFR (p75) (see FIG. 1).

  In the above, secreted TrkB as a modified BDNF receptor is an extracellular protein of TrkB that has an amino acid sequence immediately before the transmembrane domain of normal TrkB and does not have a transmembrane domain. It is secreted and can capture BDNF (see FIGS. 1 and 2). Similarly, membrane-bound TrkB is an extracellular protein consisting of an amino acid sequence containing the transmembrane domain of normal TrkB and containing at least amino acids immediately after the transmembrane domain, and can capture BDNF on the cell membrane (FIG. 1). 2). The membrane-bound TrkB is not particularly limited as long as it does not exert physiological action in the cell via a signal transduction mechanism. For example, when producing membrane-bound TrkB by gene recombination technology, it may contain a preferred amino acid for gene amplification. Specifically, it may contain about 1 to 20, preferably about 1 to 13 amino acids immediately after the transmembrane domain. Secreted NGFR (p75) consists of an amino acid sequence just before the transmembrane domain of normal NGFR (p75), and is an extracellular protein of NGFR (p75) that does not have a transmembrane domain, and is secreted extracellularly. BDNF can be captured (see FIGS. 1-3).

  In the above, the gene encoding human TrkB is specified by the base sequence shown in GenBank Accession number = NM_006180, and the corresponding gene encoding rat TrkB is specified by the base sequence shown in GenBank Accession number = NM_012731. The gene encoding human NGFR (p75) is identified by the nucleotide sequence shown in GenBank Accession number = NM_002507, and the gene encoding the corresponding rat NGFR (p75) is identified by the nucleotide sequence shown in GenBank Accession number = NM_012610. Is done.

The base sequence and amino acid sequence of the modified BDNF receptor (secretory TrkB, membrane-bound TrkB and secreted NGFR (p75)) in the present invention are as shown in Table 1 below.

  In the above, for secretory TrkB, in the case of human TrkB, the gene encoding the modified protein up to just before the transmembrane domain of normal TrkB is GenBank Accession number = base sequence from 939 to 2227 of the base sequence shown in NM_006180 (SEQ ID NO: 1), and in the case of rats, it is specified by the 662 to 1947th base sequence of the base sequence shown in GenBank Accession number = NM_012731 (SEQ ID NO: 3). Similarly, for membrane-bound TrkB, the gene encoding the modified protein up to immediately after the transmembrane domain of normal TrkB is, in the case of human TrkB, the 939-2300th bases of the base sequence shown in GenBank Accession number = NM_006180 It is specified by the sequence (SEQ ID NO: 5), and in the case of rat, it is specified by the 662 to 2020th base sequence of the base sequence shown in GenBank Accession number = NM_012731 (SEQ ID NO: 7). Furthermore, for secretory NGFR (p75), the gene encoding the modified protein up to just before the transmembrane domain of normal NGFR (p75), in the case of human TrkB, GenBank Accession number = 126 of the nucleotide sequence shown in NM_002507 It is specified by the 875th base sequence (SEQ ID NO: 9), and in the case of rat, it is specified by the 114-866th base sequence of the base sequence shown in GenBank Accession number = NM — 012610 (SEQ ID NO: 11).

More specifically, the modified BDNF receptor of the present invention consists of any of the amino acid sequences shown below.
1) an amino acid sequence represented by any one selected from SEQ ID NOs: 2, 4, 6, 8, 10, and 12 in the sequence listing;
2) An amino acid sequence in which one to a plurality of amino acids are substituted, deleted, added or introduced in the amino acid sequence shown in 1) above.
In the above, as shown in Table 1, SEQ ID NOs: 2, 6, and 10 are based on human-derived proteins, and SEQ ID NOs: 4, 8, and 12 are based on rat-derived proteins.

  In the present invention, the pain therapeutic agent comprising any one or more selected from the secretory TrkB, membrane-bound TrkB, and secretory NGFR (p75) shown above as an active ingredient is a modified BDNF receptor ( Protein) and can be used as a protein preparation.

  The protein preparation of the present invention can contain a pharmaceutically acceptable carrier. In addition, such protein preparations can usually be administered by parenteral administration routes, for example, can be administered as injections (subcutaneous injection, intravenous injection, intramuscular injection, intraperitoneal injection, etc.) , Transmucosal, nasal, transpulmonary, etc. Such protein preparations may be solution preparations or lyophilized for dissolution and reconstitution before use. As an excipient for lyophilization, sugar alcohols and sugars such as mannitol and glucose can be used. If it is a solution formulation, it is usually supplied in sealed, sterilized plastic or glass vials, ampoules, containers of defined volume such as syringes, and large volumes of containers such as bottles. it can. The amount of protein as an active ingredient contained in such a preparation varies depending on the severity, administration site, number of administrations, desired treatment period, patient age, body weight, etc., and can be determined as appropriate. When the pain therapeutic agent containing the protein of the present invention as an active ingredient is a solution preparation, generally the protein is 0.01 μg to 200 mg / ml, preferably 0.5 μg to 100 mg / ml, relative to the total amount of the solution preparation. Can be included.

  In the present invention, a gene encoding the above-mentioned modified protein of the BDNF receptor, that is, a polynucleotide capable of expressing the modified BDNF receptor can also be used as an active ingredient of the pain therapeutic agent of the present invention. Examples of such a polynucleotide include a polynucleotide encoding any modified protein selected from secreted TrkB, membrane-bound TrkB, and secreted NGFR (p75). As used herein, the term “polynucleotide” is used interchangeably with “gene”, “nucleic acid” or “nucleic acid molecule” and is intended to be a polymer of nucleotides. As used herein, the term base sequence is used interchangeably with “nucleic acid sequence” or “nucleotide sequence” and as a sequence of deoxyribonucleotides (abbreviated as A, G, C, and T). Indicated. However, although the base sequences used in this specification are abbreviated as A, G, C and T, it means that they are used not only as deoxyribonucleotides but also as ribonucleotides corresponding thereto. As the polymer, deoxyribonucleotide, ribonucleotide, or a mixed type thereof is intended.

The polynucleotide encoding any modified protein selected from secreted TrkB, membrane-bound TrkB, and secreted NGFR (p75) is a polynucleotide comprising any of the following base sequences:
1) a polynucleotide comprising a base sequence represented by any one of SEQ ID NOs: 1, 3, 5, 7, 9, and 11 in the sequence listing;
2) a polynucleotide comprising a base sequence complementary to the polynucleotide shown in 1) above;
3) A polynucleotide that can hybridize under stringent conditions to the polynucleotide shown in 1) or 2) above;
4) A polynucleotide obtained by substituting, deleting, adding or introducing one or more nucleotides among the polynucleotides shown in 1) or 2) above.
Furthermore, the polynucleotide of the present invention may have a base sequence capable of expressing any one of the amino acid sequences shown in SEQ ID NOs: 2, 4, 6, 8, 10, and 12 in the sequence listing by codon conversion. .
In the above, SEQ ID NOs: 1, 5, and 9 are based on human-derived genes, and SEQ ID NOs: 3, 7, and 11 are based on rat-derived genes.

  In the above, generally known hybridization conditions can be selected. Examples include 50% formamide, 5 × SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate, pH 7.6, 5 × Denhart's solution, 10% dextran sulfate, and 20 μg / ml DNA. Hybridization in solution at 42 ° C overnight, followed by primary washing in 2 x SSC and 0.1% SDS at room temperature, followed by secondary washing in 0.1 x SSC and 0.1% SDS at about 65 ° C .

  Regarding the basic operation of genetic engineering or biotechnology using the above-mentioned polynucleotide, commercially available experimental documents such as the gene manual Kodansha, Yasutaka Takagi edited by the gene manipulation experiment method Kodansha, Molecular Cloning, Cold Spring Cold Spring harbor Laboratory (1982), Molecular Cloning, 2nd ed., Cold Spring harbor Laboratory (1989), Methodologies in Enzymology (Methods in Enzymol.), 194 (1991), a separate experiment in experimental medicine, genetic experiment method using yeast, Yodosha (1994) and the like.

  When the above-described polynucleotide is used as an active ingredient of the therapeutic agent for pain of the present invention, it can be used for gene therapy. When used for gene therapy, it is preferable to use a highly safe DNA or RNA virus vector or plasmid vector that can express a protein in mammalian cells including humans. Preferred viral vectors for gene therapy include adenovirus, adeno-associated virus (AAV), retrovirus, pox virus, herpes virus, herpes simplex virus, lentivirus, Sendai virus, Epstein-Barr virus (EBV), vaccinia virus, polio A virus, a symbis virus, SV40 etc. are mentioned. More preferably, adeno-associated virus (AAV) or adenovirus is mentioned. Although various serotypes exist in adenovirus, it is preferable to use type 2 or type 5 human adenovirus in the present invention. Adenoviruses are known to have a higher infection efficiency than other viral vectors, can infect non-dividing cells, and are not integrated into the cell's genome. More preferably, it is used.

  It is possible to introduce a gene into a living body or a cell by introducing any of the above-described polynucleotides into the above viral vector and infecting the living body or cell. Virus vector production methods and gene introduction methods are available in separate experimental medicine, basic gene therapy technology, Yodosha (1996), or separate experimental medicine, gene transfer & expression analysis experimental methods, Yodosha (1997), etc. Can be referred to.

  Expression vectors can also be introduced in vivo as naked plasmids. As a preferable plasmid in gene therapy, pCAGGS [Gene, 108, 193-200 (1991)], pBK-CMV, pcDNA3.1, pZeoSV (Invitrogen, Stragene) and the like can be used. Naked plasmids for gene therapy are, for example, transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, a method of introducing DNA into cells together with a carrier (metal particles) with a gene gun It can be introduced into cells by a method known per se [Wu et al., J. Blol. Chem. 267, 963-967 (1992), Wu et al., J. Blol. Chem. 263, 14621- 14624, (1988), Proc. Natl. Acad. Sci., USA, 88, 2726-2730 (1991)].

  Artificial vectors include liposomes, microcapsules, cytofectins, DNA-protein complexes, biopolymers, and the like. Methods for introducing DNA using liposomes include the liposome method, HVJ-liposome method, cationic liposome method, lipofectin method, lipofectamine method and the like. The microcapsules are film-coated particles, and are composed of particles coated with a coating material made of a mixture of a film-forming polymer derivative, a hydrophobic plasticizer, a surfactant or / and a lubricant nitrogen-containing polymer.

  As a preparation form of the above-mentioned gene therapy agent, various preparation forms suitable for each administration form described above can be applied. For example, when an injection containing the polynucleotide of the present invention as an active ingredient is used, the injection can be prepared by a conventional method. The base used for the gene therapy agent is not particularly limited as long as it is a base usually used for injections, and is a salt solution of distilled water, sodium chloride, or a mixture of sodium chloride and an inorganic salt, mannitol, lactose, A solution such as dextran and glucose, an amino acid solution such as glycine and arginine, an organic acid solution or a mixed solution of a salt solution and a glucose solution, and the like can be mentioned. In addition, according to a conventional method, a solution using an osmotic pressure adjusting agent, a pH adjusting agent, a vegetable oil such as sesame oil or soybean oil, or a surfactant such as lecithin or a nonionic surfactant in these bases. Injectables may be prepared as suspensions and dispersions. These injections can be made into preparations for use and dissolution by operations such as pulverization and freeze-drying. The content of the polynucleotide in the preparation varies depending on the administration site, the number of administrations, the desired treatment period, the age, weight, etc. of the patient, and can be adjusted as appropriate.

  In any case of a preparation used as a pain therapeutic agent of the present invention, for example, a protein preparation or a gene therapeutic agent, a stabilizer is preferably added upon formulation. Examples of the stabilizer include albumin, globulin, gelatin, mannitol, glucose, dextran, ethylene glycol and the like. Furthermore, the preparation of the present invention may be blended with additives necessary for formulation, for example, excipients, solubilizers, antioxidants, soothing agents, tonicity agents and the like. In the case of a liquid preparation, it is desirable to store it after removing moisture by freeze storage or freeze drying. The freeze-dried agent is used after re-dissolving it by adding distilled water for injection. In the case of a sustained release agent, examples of sustained release carriers include soluble collagen or soluble collagen derivatives, proteins such as gelatin, porous ceramics, polyamino acids, polylactic acid, chitin or chitin derivatives, water-swellable polymer gels Etc. can be used.

  The present invention also extends to a screening method for a novel therapeutic agent for pain characterized by selecting a substance capable of inhibiting the binding between BDNF and its receptor. Pain stimulation secretes BDNF and binds to BDNF receptors on the nerve cell membrane, resulting in transmission of pain signals to the central nerve. Substances that can inhibit the binding of BDNF to its receptor, such as modified TrkB, more specifically secreted TrkB, membrane-bound TrkB, secreted NGFR (p75), etc. are secreted by pain stimulation. It was revealed in the present invention that it has a pain-suppressing effect by inhibiting the binding of BDNF and BDNF receptor on the nerve cell membrane. Accordingly, the inventors have completed an invention relating to a screening method characterized by selecting a substance that inhibits the binding of BDNF and a BDNF receptor, focusing on the binding between BDNF and its receptor.

The screening method of the present invention is based on a method comprising the following steps 1) and 2).
1) a step of culturing a cell capable of expressing a BDNF receptor having a transmembrane domain together with a candidate substance and BDNF;
2) A step of confirming BDNF bound on the surface of the cell.
In the above, the order of addition of the candidate substance and BDNF to the culture solution may be added simultaneously, or BDNF may be added after the addition of the candidate substance. For example, it can be based on a method including the following steps 1 ′) to 3 ′).
1 ′) culturing a cell capable of expressing a BDNF receptor having a transmembrane domain with a candidate substance;
2 ′) a step of further adding BDNF to the culture system;
3 ′) A step of confirming BDNF on the cell surface.

  In the above, the candidate substance that can be a novel pain therapeutic agent may be a low molecular weight compound, or a polypeptide or protein. Examples of proteins include modified BDNF receptors, and specifically include secreted TrkB, membrane-bound TrkB, secreted NGFR (p75), and the like.

  In the above, the BDNF receptor having a transmembrane domain is not particularly limited as long as it is a receptor capable of capturing BDNF on the cell membrane. For example, the above-mentioned membrane-bound TrkB may be used. The amino acid sequence of the membrane-bound TrkB of the present invention and the base sequence of the encoding polynucleotide have been described above.

  Cells capable of expressing a BDNF receptor having a transmembrane domain may be prepared at the time of screening, or may be prepared in advance. A cell capable of expressing a BDNF receptor having a transmembrane domain can be, for example, a cell into which a vector into which a gene encoding membrane-bound TrkB is inserted is introduced. The cell type is not particularly limited as long as it is a cell into which the vector can be introduced. Examples include cells derived from mammals, and specific examples include HEK293 cells and CHO cells, but are not limited thereto.

  In the step of culturing a cell capable of expressing a BDNF receptor having a transmembrane domain together with a candidate substance, the cell may be cultured in advance in a culture vessel and then added with the candidate substance, or the cell and the candidate substance may be cultured. May be added to the culture vessel and cultured.

  BDNF is further added to the culture system to bind BDNF receptor and BDNF expressed on the cell membrane. The novel pain therapeutic agent of the present invention can be screened by confirming BDNF bound to the BDNF receptor and selecting a substance that can inhibit the binding of BDNF to the BDNF receptor. Confirmation of BDNF bound to the BDNF receptor can be confirmed, for example, by acting an anti-BDNF antibody. Specifically, BDNF can be confirmed by reacting a labeled anti-BDNF antibody with BDNF bound to a BDNF receptor. Alternatively, it can be confirmed by reacting an anti-BDNF antibody with BDNF bound to a BDNF receptor and further using a labeled antibody against the anti-BDNF antibody. The label may be any known labeling substance and is not particularly limited. For example, a fluorescent material or a luminescent material can be used. Alternatively, a labeled protein fusion type BDNF in which a labeled protein and BDNF are fused may be used. For example, a fluorescent protein fusion type BDNF obtained by fusing a fluorescent protein such as green fluorescent protein (GFP) and BDNF can be used. In the step of culturing together with the candidate substance and the step of adding BDNF, the candidate substance may be added to the culture vessel in advance and then cultured with BDNF. At the same time, the candidate substance and BDNF are added to the culture vessel and cultured. Also good.

  For example, when a cell capable of expressing a BDNF receptor having the transmembrane domain is cultured using a system containing different candidate substances in each well of a multititer plate, the label must be detected when the above procedure is followed. For example, the added candidate substance is judged to be a substance that inhibits the binding of BDNF to a receptor on the membrane, and is considered to be a therapeutic agent for pain.

  In order to assist the understanding of the present invention, the present invention will be specifically described with reference to examples and experimental examples, but it goes without saying that the present invention is not limited thereto.

Example 1-1 Preparation of Modified TrkB Expression Vector Based on the rat TrkB gene (GenBank Accession number = NM_012731) corresponding to the human TrkB gene (GenBank Accession number = NM_006180), the modified gene was obtained using PCR. It produced (FIG. 2). MRNA was extracted from rat brain tissue and then reverse transcribed using reverse transcriptase to synthesize single-stranded cDNA. Sense primer (SEQ ID NO: 13, including restriction enzyme BamHI recognition sequence) set in the protein synthesis start region and antisense primer (SEQ ID NO: 14, including restriction enzyme EcoRI recognition sequence) set immediately before the transmembrane domain The gene region encoding up to the transmembrane domain of TrkB was amplified by PCR using rat single-stranded cDNA.

  In addition, one rat was prepared using a sense primer (SEQ ID NO: 13) set in the protein synthesis initiation region and an antisense primer (SEQ ID NO: 15, including restriction enzyme EcoRI recognition sequence) set immediately after the transmembrane domain. The gene region encoding up to immediately after the transmembrane domain of TrkB was amplified by PCR using strand cDNA.

Sense primer: GGATCCGCCATGTCGCCCTGGCCGAGGTG (SEQ ID NO: 13)
Antisense primer: GAATTCATGCTCCCGATTGGTTTGGTC (SEQ ID NO: 14)
Antisense primer: GAATTCTGGGCCTTTCATGCCAAACTTG (SEQ ID NO: 15)

Each PCR amplification product was cloned into pBluescript® KS (STRATAGENE ⁾ that had been blunt-ended with the restriction enzyme EcoRV, and it was confirmed by sequencing analysis that the nucleotide sequence was correct. After that, each TrkB gene was cut out by restriction enzymes BamHI and EcoRI, and pCMVscript-EGFP cut by BamHI and EcoRI (pCMVscript ^(R) vector into which fluorescent proteins EGFP, FLAG-tag and S-tag were inserted (STRATAGENE)) ) Was inserted. Sequencing analysis confirmed that each inserted TrkB gene region has the same amino acid frame as the fluorescent proteins EGFP, FLAG-tag, and S-tag, ie, correctly expressed as a fusion protein. .

  Amino acids up to just before the transmembrane domain of normal TrkB to express the TrkB extracellular protein (truncated TrkB (-) Transmembrane type; tTrkB (-) Tm), which does not have the normal TrkB transmembrane domain, A vector into which a gene encoding a fusion protein fused with the fluorescent protein EGFP was inserted was called pCMVscript-tTrkB (-) Tm-EGFP. Hereinafter, TrkB having no transmembrane domain is referred to as “secreted TrkB”. The secretory TrkB consists of the amino acid sequence shown in SEQ ID NO: 4, and the gene encoding the secretory TrkB consists of the base sequence shown in SEQ ID NO: 3.

  Similarly, in order to express an extracellular protein of TrkB having a transmembrane domain (truncated TrkB (+) Transmembrane type; tTrkB (+) Tm), an amino acid sequence comprising 13 amino acids immediately after the transmembrane domain of normal TrkB And the vector which inserted the gene which codes the fusion protein which fluorescent protein EGFP fused on the back side was set to pCMVscript-tTrkB (+) Tm-EGFP. Hereinafter, TrkB having a transmembrane domain is referred to as “membrane-bound TrkB”. The membrane-bound TrkB includes the amino acid sequence shown in SEQ ID NO: 8, and the gene encoding the membrane-bound TrkB includes the base acid sequence shown in SEQ ID NO: 7.

(Example 1-2) Preparation of modified NGFR (p75) expression vector Based on the rat NGFR (p75) gene (GenBank Accession number = NM_012610) corresponding to the human NGFR (p75) gene (GenBank Accession number = NM_002507) The modified gene was prepared using PCR (FIG. 3). Sense primer (SEQ ID NO: 16, including restriction enzyme EcoRI recognition sequence) set in the protein synthesis start region, and antisense primer (SEQ ID NO: 17, including restriction enzyme XhoI recognition sequence) set immediately before the transmembrane domain The gene region encoding up to just before the transmembrane domain of NGFR (p75) was amplified by PCR using rat single-stranded cDNA.

Sense primer: GAATTCACCATGAGGAGGGCAGGTGCTGCC (SEQ ID NO: 16)
Antisense primer: CTCGAGGTTGTCGGTGGTGCCG (SEQ ID NO: 17)

The PCR amplification product was cloned into pBluescript® KS (STRATAGENE ⁾ that had been blunt-ended with the restriction enzyme EcoRV, and it was confirmed by sequencing analysis that the nucleotide sequence was correct. Subsequently, the NGFR (p75) gene was excised with restriction enzymes EcoRI and XhoI, and pCM-Vscript-EGFP (pCMVscript ^(R) vector (STRATAGENE ⁾ containing fluorescent proteins EGFP, FLAG-tag, and S-tag cleaved with EcoRI and XhoI. Company))). Sequencing analysis confirmed that the inserted NGFR (p75) gene region has the same amino acid frame as the fluorescent proteins EGFP, FLAG-tag, and S-tag, ie, correctly expressed as a fusion protein. . Here, an expression vector for a gene encoding an extracellular protein of NGFR (p75) having no transmembrane domain was designated as pCMVscript-tNGFR (−) Tm-EGFP. Hereinafter, NGFR (p75) having no transmembrane domain is referred to as “secreted NGFR (p75)”. The amino acid sequence of the secretory NGFR (p75) is shown in SEQ ID NO: 12, and the gene encoding the secretory NGFR (p75) consists of the base sequence shown in SEQ ID NO: 11 in the sequence listing.

(Experimental Example 1-1) Experiment for Confirming Expression of Modified Receptor in Cultured Cell System In this experimental example, it was observed with a cultured cell system how each modified receptor was expressed in cells. Modified receptor expression vectors prepared in Examples 1-1 and 1-2 pCMVscript-tTrkB (-) Tm-EGFP, pCMVscript-tTrkB (+) Tm-EGFP, pCMVscript-tNGFR (-) Tm-EGFP, or The control vector pCMVscript-EGFP was introduced into human normal cells HEK293 using Lipofectamine ^™ 2000 (Invitrogen) as a gene introduction reagent. 24 hours after introduction, expression of each modified receptor of the fluorescent protein EGFP fusion type was observed with an Olympus IXL71 inverted fluorescence microscope.

  As a result, it was observed that the fluorescent protein EGFP was expressed throughout the cells in the cells into which the control vector pCMVscript-EGFP was introduced (upper left of FIG. 4). In the cells into which the expression vector pCMVscript-tTrkB (+) Tm-EGFP of membrane-bound TrkB was introduced, it was observed that the fluorescent protein EGFP was localized near the cell membrane (upper right of FIG. 4). This suggests that membrane-bound TrkB is indeed expressed in the cell membrane.

  On the other hand, in the cells into which the secreted TrkB expression vector pCMVscript-tTrkB (-) Tm-EGFP and the secreted NGFR (p75) expression vector pCMVscript-tNGFR (-) Tm-EGFP were introduced, the fluorescent protein EGFP was almost observed in the cells. None (bottom left and right in FIG. 4). This means that modified tTrkB (-) Tm and tNGFR (-) Tm, which do not have a transmembrane domain, are secreted extracellularly, resulting in a decrease in intracellular fluorescent protein. it was thought.

(Experimental Example 1-2) Secretion Confirmation Experiment of Secretory Receptor in Cultured Cell System In this experimental example, a confirmation experiment was conducted as to whether secreted TrkB and secreted NGFR (p75) are secreted outside the cell.

Secretion type modified receptor expression vector pCMVscript-tTrkB (-) Tm-EGFP, pCMVscript-tNGFR (-) Tm-EGFP, or control vector pCMVscript-EGFP, Lipofectamine ^TM 2000 (Invitrogen) Each was introduced into 8 μg human normal cells HEK293 (90 mm dish) and replaced with fresh medium after 6 hours. 72 hours after gene transfer, the culture solution (supernatant) is collected in a 15 ml conical tube, centrifuged at 3000 rpm for 5 minutes, the cells removed, the supernatant transferred to a new conical tube, and the sample of this experimental example A liquid was used.

1 ml of each sample solution was collected in an Eppendorf tube, 10 μl of protease inhibitor (Sigma) and 50 μl S-protein agarose beads (Novagen) were added, and the mixture was rotated with a rotator at 4 ° C. for 16 hours. Centrifugation was performed at 5000 rpm for 3 minutes, and S-tag and S-tag fusion receptor bound to S-protein agarose beads were isolated (Pull-Down). The precipitate was washed with 1 ml of phosphate buffer (PBS) and centrifuged in the same manner. This was repeated 4 times. Add 50 μl of SDS-Sample Buffer to the precipitate, heat at 100 ° C. for 5 minutes, electrophorese 10 μl on 12% SDS polyacrylamide gel, and PVDF ((Polyvinylidene difluoride) with iBlot ^TM Gel Transfer System (Invitrogen) Proteins were blotted on the membrane, and the transferred PVDF membrane was blocked with blocking buffer (3% BSA, 0.5% Tween20, 1xPBS), followed by anti-FLAG mouse monoclonal antibody M2 against FLAG-tag (Sigma). After washing, labeling with anti-mouse Vecstain ^(R) ABC-AP kit (Vector Laboratories) and addition of CDP-star ^(R) (Roche), a substrate for alkaline phosphatase (ALP), resulted Fluorescence was captured with Lumino Image Analyzer LAS-1000 (manufactured by FUJIFILM).

  As a result, in the culture medium of cells into which pCMVscript-tTrkB (-) Tm-EGFP and pCMVscript-tNGFR (-) Tm-EGFP were introduced, a band was detected in the vicinity of the estimated size. No band was detected (Fig. 5). This revealed that secreted TrkB and secreted NGFR (p75) were recovered from the culture medium of the cells into which the modified receptor gene was introduced and secreted outside the cell.

(Experimental Example 1-3) Confirmation Experiment of BDNF Binding Ability of Secretory Receptor in Cultured Cell System In this experimental example, a confirmation experiment was conducted on the binding of secreted TrkB and secreted NGFR (p75) to BDNF. .
1 ml of each sample solution prepared in Experimental Example 2 was collected in an Eppendorf tube, 10 μl of protease inhibitor (Sigma) and 0.5 μg of BDNF (Abcom, mature type) were added, and the mixture was rotated on a rotator at 4 ° C. for 16 hours. . Thereafter, 50 μl of S-protein agarose beads (Novagen) were added and rotated on a rotator at 4 ° C. for 3 hours. Centrifugation was performed at 5,000 rpm for 3 minutes, and S-tag and S-tag fusion receptor bound to S-protein agarose beads (Novagen) were isolated (Pull-Down). If BDNF binds to the secretory receptor, BDNF is detected when the secretory receptor is isolated. The precipitate was washed with 1 ml of PBS and centrifuged in the same manner. This was repeated 4 times. Add 50 μl of SDS-Sample Buffer to the precipitate, heat at 100 ° C. for 5 minutes, electrophorese 10 μl on 12% SDS polyacrylamide gel, and blot protein on PVDF membrane using iBlot ^TM Gel Transfer System (Invitrogen) Went. The transferred PVDF membrane was blocked with a blocking buffer (3% BSA, 0.5% Tween 20, 1 × PBS), and then reacted with an anti-BDNF-rabbit antibody (Abcom) against BDNF. After washing, label with anti-rabbit Vecstain ^(R) ABC-AP kit (Vector Laboratories), add alkaline phosphatase substrate CDP-star ^(R) (Roche), and fluoresce the resulting fluorescence with Lumino Image Analyzer LAS. -1000 (FUJIFILM)

  As a result, when secreted TrkB or secreted NGFR (p75) was isolated from a system into which pCMVscript-tTrkB (-) Tm-EGFP and pCMVscript-tNGFR (-) Tm-EGFP were introduced, BDNF was detected. BDNF was not detected in the system into which was introduced (FIG. 6). From this, it was proved that secreted TrkB and secreted NGFR (p75) expressed by gene transfer were certainly secreted extracellularly and bound to BDNF. In addition, it can be said that secreted TrkB or secreted NGFR (p75) can be used as an active ingredient of a protein preparation targeting BDNF.

  Furthermore, it was shown that the binding between secretory NGFR (p75) and BDNF is weaker than that between secreted TrkB and BDNF. This was consistent with the low affinity of NGFR (p75) and BDNF binding.

(Experimental Example 1-4) Confirmation Experiment of BDNF Binding Ability of Membrane-bound Receptor in Cultured Cell System In this experimental example, a confirmation experiment was conducted on the binding property between membrane-bound TrkB and BDNF.
The membrane-bound TrkB expression vector pCMVscript-tTrkB (+) Tm-EGFP or the control vector pCMVscript-EGFP was transfected into HEK293 cells (35 mm dish) each 2 μg, and the following day, a portion was transferred to an 8-chamber slide and cultured. . The next day, BDNF (Abcom, mature type) was added to the cells and cultured (50 ng / 100 μl). After 1 hour, washed with PBS, OPTI medium (Invitrogen) containing anti-BDNF rabbit antibody (Abcom) (1: 1000 dilution), Cy3-labeled anti-rabbit antibody (1: 1000 dilution), and 10% FBS For 3 hours. Thereafter, fluorescence observation was performed with an Olympus IXL71 inverted fluorescence microscope (FIG. 7).

  In FIG. 7, AB represents a control vector pCMVscript-EGFP-introduced cell, CF represents a membrane-bound TrkB expression vector pCMVscript-tTrkB (+) Tm-EGFP-introduced cell, and number 1 represents the EGFP fluorescent protein (green) station. The number 2 indicates the localization of BDNF (red). It was revealed that membrane-bound TrkB can surely capture BDNF on the cell membrane surface.

(Experimental Example 1-5) Confirmation Experiment of Pain Relieving Effect of Modified Receptor Gene in Chronic Pain Model Rat Secreted TrkB Expression Vector pCMVscript-tTrkB (-) Tm-EGFP, Membrane-bound TrkB Expression Vector pCMVscript-tTrkB (+ ) Tm-EGFP or control vector pCMVscript-EGFP was administered to chronic pain model rats (6 rats each) to confirm the pain-reducing effect.
A rat model of chronic pain was prepared by ligating the dorsal root ganglion (DRG) of the left spinal cord fifth lumbar spinal nerve of the rat, and at the same time, the tip of the catheter was placed near the end of the fourth lumbar spinal nerve in the spinal cord. The other end of the catheter was removed from the back of the head through the skin. The day of surgery was defined as day 0.

After confirming the establishment of hyperalgesia due to nerve ligation, each plasmid solution (3 μg / μl) was prepared using the transfection reagent GenomeONE ^TM on the 5th, 6th and 7th days, and 14 μl (42 μg) Was injected into the subarachnoid from the catheter. After administration, the remaining drug in the catheter was pushed out with 15 μl of physiological saline.

  The observation of pain behavior in rats was continued for another week after the third (final) administration on the seventh day from the preparation of the chronic pain model (FIG. 8). Pain behavior was evaluated by the pain threshold for mechanical stimulation (50% response threshold). Specifically, the rat was placed on a wire net surrounded by a 10 x 20 cm square wall and left for 30 minutes or more until it became resting. Under the wire mesh, five types of nylon filaments (von Frey filaments) with different thicknesses were gently pressed against the center of the sole of the hind limbs in order from the thin one, and the presence or absence of escape behavior due to stimulation was observed. The threshold indicating escape behavior was determined by the method of Chaplan et al. (Chaplan SR, Bach FW, Pogrel JW, Chung JM, Yaksh TL. Quantitative assessment of tactile allodynia in the rat paw. J Neurosci Methods. 53 (1): 55-63, ( 1994)). The threshold indicates the stiffness of the filament in gram, and the lower the value, the more sensitive it is to pain.

As a result, in the control vector administration group, the ligated left foot (affected foot) showed a decrease in pain threshold and it was confirmed that pain was felt, but the unligated right foot (healthy foot) had pain. It was confirmed that it did not feel. In the administration group of the secretory TrkB expression vector pCMVscript-tTrkB (−) Tm-EGFP, suppression of pain was observed from the 8th day to the 9th day in the affected foot (FIG. 9). In the group administered with the expression vector pCMVscript-tTrkB (+) Tm-EGFP of membrane-bound TrkB, suppression of pain was observed from the 10th day to the 15th day in the affected foot (FIG. 10).
From the above results, it was revealed that administration of this modified receptor gene can suppress pain, and that gene administration has no effect on behavioral evaluation on the healthy side.

On the other hand, Non-Patent Document 1 (Comparison of antiallodynic action of inflammatory skin extract (neurotropin ^(R) ) inoculated with vaccinia virus in L5 spinal nerve ligated rats with anti-inflammatory analgesics and antidepressants Vol. .15 No.4, 407-413 (2008)), it was reported that neurotropin ^(R) and milnacipran had an analgesic effect only 2 hours after drug administration. The effect was not sustained, and it was confirmed that the pain-treating agent of the present invention maintained the pain suppressing effect.

(Experimental Example 1-6) Experiment for Confirming Expression of Modified Receptor Gene in Rats with Chronic Pain Chronic pain rats were prepared in the same manner as in Experimental Example 5 to confirm transgene expression in rat tissues. Chronic pain rats treated with secreted TrkB expression vector pCMVscript-tTrkB (-) Tm-EGFP, membrane-bound TrkB expression vector pCMVscript-tTrkB (+) Tm-EGFP or control vector pCMVscript-EGFP, gene introduction reagent GenomeOne ^TM (Ishihara The left and right 2nd-6th lumbar nerve DRGs were extracted between 9 and 21 days after ligation surgery in control chronic pain rats that received only (industrial) and control normal rats that received nothing (non-ligated) . Immediately after excision, the tissue was stored in a -80 ° C freezer in the presence of RNAlater ^(R) (Qiagen ⁾ , a tissue preservation reagent. The tissue was pulverized with a homogenizer, and RNA was extracted with ISOGEN (Nippon Gene) as an RNA extraction reagent. CDNA was synthesized from the obtained RNA using a ReverTra Ace ^(R) cDNA synthesis kit (TOYOBO). After preparing a reaction solution using EGFP detection primers (SEQ ID NOs: 18 and 19) and an internal control gene GAPDH (SEQ ID NOs: 20 and 21), the reaction solution was introduced using an Applied Biosystems ^(R) 7300 real-time PCR system (Applied Biosystems). The amount of gene expression was quantified. The expression ratio of the EGFP gene relative to the internal control gene GAPDH was calculated and expressed as the average value of all DRGs (FIG. 11).

EGFP detection primer Sense primer; GGGCCCACCATGGTGAGCAAGG (SEQ ID NO: 18)
Antisense primer; GATGAACTTCAGGGTCAGCTTG (SEQ ID NO: 19)
Internal control gene (GAPDH)
Sense primer; GACAACTTTGGCATCGTGGA (SEQ ID NO: 20)
Antisense primer; ATGCAGGGATGATGTTCTGG (SEQ ID NO: 21)

(Example 2) Screening method for novel pain therapeutic agent In this example, a screening system for a novel pain therapeutic agent was shown. The screening was performed by a system including the following steps 1) and 2).
1) A step of culturing a cell capable of expressing a BDNF receptor having a transmembrane domain together with a candidate substance and BDNF.
2) A step of confirming BDNF bound on the surface of the cell.

  Membrane-bound TrkB was used as the BDNF receptor having the transmembrane domain of 1) above. Cells capable of expressing a BDNF receptor having a transmembrane domain were prepared by using the above-mentioned membrane-bound TrkB expression vector pCMVscript-tTrkB (+) Tm-EGFP of Example 1-1 according to HEK293 according to Experimental Example 1-1. It was constructed by transfecting cells. The cells were cultured for 72 hours in a 60 mm diameter dish using OPTI-MEM containing 10% FBS.

  In this example, secreted TrkB was used as a candidate substance of 1) above. A sample (candidate substance (+)) containing secreted TrkB was introduced into HEK293 cells by introducing a tTrkB (−) Tm expression vector capable of expressing secreted TrkB according to Experimental Example 1-2. The supernatant was collected in a 15 ml conical tube and used as the supernatant after centrifugation at 3000 rpm for 5 minutes. Further, as a control, a sample not containing a candidate substance (candidate substance (−)) was prepared by introducing an empty expression vector into which a gene was not introduced into HEK293 cells in the same manner, and using it as a supernatant after culture and centrifugation. 2 ml of candidate substance (+) or candidate substance (-) was added to the culture system. BDNF (Abcom, mature type) (100 ng / ml) was further added to each culture system.

  Confirmation of BDNF bound on the surface of the cell in 2) above is performed by adding a candidate substance and BDNF 1 hour later, anti-BDNF rabbit antibody (Abcom) (1: 1000 dilution), and Cy3-labeled anti-rabbit antibody (1 (1000 dilution) was further added, and after culturing for 3 hours, fluorescence observation was performed with an Olympus IXL71 inverted fluorescence microscope.

  In FIG. 12, CD shows the result of adding secreted TrkB as a positive control for the candidate substance, and AB shows the result of the control experiment. Number 1 shows the localization of TrkB-EGFP fluorescent protein, and number 2 shows the localization of BDNF. By confirming the localization of BDNF, it became clear that it was possible to select substances that inhibit the binding of BDNF and its receptor. Using this system, it became possible to screen the binding inhibitor of BDNF and receptor, that is, a novel pain therapeutic agent. Regarding the order of addition of the candidate substance and BDNF to the culture solution, the same results were observed whether they were added at the same time or BDNF was added 1 hour after the addition of the candidate substance.

  As described in detail above, after producing each gene expression vector, we confirmed the expression in an in vitro cultured cell system and confirmed whether BDNF could be captured. Was found to be able to capture BDNF. As a result of administration experiments in an in vivo pain model rat system, administration of a gene encoding a secretory TrkB having no transmembrane domain or a gene encoding a membrane-bound TrkB having a transmembrane domain resulted in chronic pain rats It was confirmed that the pain can be reduced. Therefore, by expressing a gene encoding a modified protein of the BDNF receptor (TrkB and / or NGFR (p75)) in vivo, it is possible to prevent BDNF from binding to the receptor in vivo. Can reduce pain. The effect was maintained for 3 to 4 days, while existing analgesics and the like had an effect of about 2 hours. From this, it was considered that the receptor-modified protein of BDNF, that is, secreted TrkB, membrane-bound TrkB and / or secreted NGFR (p75) has an effect on chronic pain. Therefore, it can be said that secreted TrkB, membrane-bound TrkB and / or secreted NGFR (p75) can be used as an active ingredient of a protein preparation targeting BDNF.

  Furthermore, since the mechanism of action of the pain therapeutic agent of the present invention is due to an action that can inhibit the binding between the brain-derived neurotrophic factor and its receptor, the binding between the brain-derived neurotrophic factor and its receptor is prevented. By screening for substances that can be inhibited, a novel pain therapeutic agent can be screened.

Claims (2)

A therapeutic agent for pain comprising, as an active ingredient, a vector in which a polynucleotide capable of expressing a protein comprising the amino acid sequence shown in any one of SEQ ID NOs: 2, 4, 6 or 8 in the sequence listing is incorporated . A polynucleotide capable of expressing a protein consisting of the amino acid sequence shown in any one of SEQ ID NO: 2, 4, 6 or 8 in the sequence listing is based on the nucleotide sequence shown in any one of SEQ ID NO: 1, 3, 5 or 7 in the sequence listing. The therapeutic agent for pain according to claim 1, which is a polynucleotide.