JP6067204B2 - Random genome insertion and deletion tool for Rhodococcus bacteria - Google Patents

Description

  The present invention relates to a method for inserting a linear DNA fragment having an arbitrary sequence in a genomic region in a bacterium belonging to the genus Rhodococcus, a method for randomly losing the function of genomic DNA of the bacterium, and the genus Rhodococcus produced by the method Regarding bacterial strains.

  The method of exploring gene function by identifying insertion regions after causing random insertion mutations in the genome of organisms using mobile genes such as transposons has long been performed. (See Non-Patent Document 1 for microorganisms). This method has become an indispensable technique for the creation of higher-performance microorganisms through the elucidation of the metabolic system in the production of substances by microorganisms.

  In general, a method of transforming a target microorganism using a plasmid in which a transposase gene and a sequence recognized by the transposase are incorporated on a plasmid is used. In this method, a region sandwiched between short sequences recognized by transposase (for example, an inverted repeat sequence of 19 bases in the case of Tn903) is inserted on the genome. However, the microorganisms that can use this system are limited to those that can replicate plasmids. For this reason, as a general-purpose system for dealing with a wider variety of microorganism species, a complex of a DNA fragment containing a transposon unit and an enzyme transposase is formed, and this is introduced by electroporation to obtain a transformant. A method has been proposed (Non-Patent Document 2).

In bacteria belonging to the genus Rhodococcus (hereinafter referred to as "Rhodococcus bacteria"), a plasmid incorporating the transposase gene contained in the transposon Himar1 found from the flies and the sequence recognized by the transposase was prepared, and random insertion suddenly occurred. A system for introducing mutations was constructed (Non-patent Document 3). Furthermore, a plasmid pTNR series incorporating the transposase gene contained in the insertion sequence IS1415 (non-patent document 4) found from Rhodococcus erythropolis NI86 / 21 strain and the sequence recognized by the transposase has been produced, and a more efficient system Is constructed (Non-Patent Documents 5 and 6).

  However, the number of possible mutation sites in these techniques is only one mutation by random insertion, and there is a technique that randomly causes loss of function such as deletion across multiple genes by a single operation. It was sought after.

Berg, C.M. & Berg, D.E.in Escherichia coli and Salmonella cellular and molecular biology (eds Neidhardt, F.C. et al.) 2588-2612 (ASM Press, Washington, DC; 1996). Goryshin IY, Jendrisak J, Hoffman LM, Meis R, Reznikoff WS. (2000) Insertional transposon mutagenesis by electroporation of released Tn5 transposition complexes. Nat Biotechnol. 18: 97-100 Ashour, J. and Hondalus, M.K. (2003) Phenotypic mutants of the intracellular actinomycete Rhodococcus equi created by in vivo Himar1 transposon mutagenesis. J. Bacteriol. 185: 2644-2652. I Nagy, G Schoofs, J Vanderleyden, and R De Mot. (1997) Transposition of the IS21-related element IS1415 in Rhodococcus erythropolis. J. Bacteriol. 179: 4635-4638. Sallam KI, Mitani Y., Tamura T. (2006) Construction of random transposition mutagensesis system in Rhodococcus erythropolis using IS1415. J. Biotechnol. 121: 13-22. Sallam KI, Tamura N, Tamura T. (2007) A multipurpose transposon-based vector system mediates protein expression in Rhodococcus erythropolis. Gene386: 173-82

  The present invention provides a method for inserting a linear DNA fragment having an arbitrary sequence into the genome region of Rhodococcus bacteria, a method for losing the function of intracellular DNA, and a Rhodococcus strain produced by the method For the purpose.

  As a result of intensive studies to solve the above problems, the present inventors have transformed Rhodococcus bacteria using linear DNA fragments containing one or more selectable marker genes. Thus, it was found that random deletion can be caused in intracellular DNA with the insertion of a linear DNA fragment. In addition, by using a fragment containing the plasmid replication origin in E. coli, it was possible to easily identify the insertion region (deletion region). Furthermore, it has been found that by using a fragment containing the SacB gene, random deletion from intracellular DNA can be repeatedly caused, and the present invention has been completed.

That is, the present invention is as follows.
(1) A method in which a bacterium belonging to the genus Rhodococcus is transformed with a linear DNA fragment having an arbitrary sequence, and the linear DNA is inserted into the genome of the bacterium.
(2) The method according to (1), wherein the function of the bacterial genomic DNA can be randomly lost.
(3) The method according to (1), wherein the linear DNA fragment contains a gene encoding a desired protein and / or one or more selectable marker genes.
(4) The method according to (1), wherein the linear DNA fragment contains a plasmid replication origin in E. coli.
(5) The method according to (4), wherein the plasmid replication origin is derived from plasmid pMB1 and its derivatives.
(6) The method according to any one of (3) to (5), wherein the selection marker gene is a drug resistance gene or a combination of a drug resistance gene and a conditionally lethal gene.
(7) The method according to (6), wherein the drug resistance gene is a kanamycin resistance gene.
(8) The method according to (6), wherein the conditional lethal gene is a sacB gene.
(9) A transformant produced by the method according to any one of (1) to (8).
(10) Part or all of the fragment inserted by transformation by culturing the transformant produced by the method according to any one of (6) to (9) above under lethal conditions To produce strains that have fallen off.
(11) A strain produced by the method according to (10) above.

  By using the method of the present invention, it is possible to provide a method for inserting a linear DNA fragment having an arbitrary sequence into the genome of a bacterium belonging to the genus Rhodococcus. Further, the function of intracellular DNA can be randomly lost along with the insertion of the DNA fragment. That is, random deletion of intracellular DNA is caused with the insertion of a DNA fragment, the insertion region and the deletion length are easily identified by analyzing the nucleotide sequence of the insertion region, and the deletion is repeated. It becomes possible.

  Further, according to the present invention, deletion of a genomic region of several kb or more is possible, and a plurality of adjacent genes such as a gene that forms an operon can be simultaneously destroyed. This greatly expanded the range of technologies for gene function analysis and microorganism improvement.

It is a figure which shows preparation of MK07 and MK09. MK07 and MK09 were obtained by PCR using pK19B as a template. It is a figure which shows the base sequence of the genome insertion site of DNA fragment MK07. It is a figure which shows the genome insertion site and insertion mode of DNA fragment MK07. It is a figure which shows the base sequence of the genome insertion site of DNA fragment MK09. It is a figure which shows the genome insertion site and insertion mode of DNA fragment MK09. It is a figure which shows preparation of MK10. MK10 was obtained by PCR using pK19sacB1 as a template. It is a figure which shows the base sequence of the genome insertion site of DNA fragment MK07 complex. It is a figure which shows the genome insertion site and insertion mode of a DNA fragment MK07 complex. There is no deletion, and a 9 bp overlapping sequence is generated at the insertion site (transposon-type insertion).

  Hereinafter, the present invention will be described in detail. The following embodiment is an example for explaining the present invention, and is not intended to limit the present invention to this embodiment alone. The present invention can be implemented in various forms without departing from the gist thereof.

  The present invention relates to a method for inserting a linear DNA fragment into a bacterial genome by transforming a bacterium belonging to the genus Rhodococcus with a linear DNA fragment having an arbitrary sequence. Various desired genes such as fluorescent protein genes and various enzyme genes are linked to linear DNA, and the linear DNA is directly introduced into the bacterial genome simply by transforming bacteria using this gene. Can do. Therefore, the present invention can analyze the insertion state of the linear DNA fragment into the DNA in the bacterium by analyzing the base sequence of the linear DNA or its peripheral region after the transformation. . Furthermore, the present invention relates to a method for randomly losing the function of intracellular DNA (genomic DNA) of the bacterium as the linear DNA is inserted into the genome by performing the transformation.

(1) Preparation of DNA fragment for transformation In the present invention, examples of the linear DNA fragment having an arbitrary sequence to be inserted into a bacterium belonging to the genus Rhodococcus include, for example, nucleic acids having random sequences, genes encoding useful proteins, drug resistance Examples include genes, reporter genes, gene expression regulatory genes, promoter sequences, plasmid DNA, bacteriophage DNA, and combinations thereof. In order to confirm whether or not the strain is transformed with these DNA fragments, the DNA fragment contains one or a plurality of selectable marker genes (for example, linked). Is preferred. The length of the arbitrary sequence is not particularly limited, and is 100 to 20,000 bases, preferably 500 to 10,000 bases, more preferably 800 to 3,000 bases.

  In the present invention, the mode of losing the function is not particularly limited. The mode of losing the DNA function around the insertion site by inserting the linear DNA fragment into the genome, or the linear There is an embodiment in which all or part of the DNA in the vicinity of the insertion site is deleted by inserting the DNA fragment into the genome.

The DNA fragment for transformation can be obtained by chemical synthesis, or can be obtained by cutting out from a vector with a restriction enzyme or the like. In addition, the region corresponding to the region of the DNA fragment for transformation in the vector can be prepared by amplification by the PCR method.
As the vector, a plasmid vector, bacteriophage vector, retrotransposon vector and the like can be used. Various modifications are made according to the purpose, for example, by introducing a selection marker, various genes such as a reporter gene and a promoter sequence, or a replication origin into an existing vector to prepare a vector for preparing a DNA fragment for transformation. be able to.

  Examples of existing plasmid vectors include, but are not limited to, pK18, pK19, pK18mob, pK19mob, pHSG298, pHSG299, pHSG398, pHSG399, pUC18, pUC19, pUC118, and pUC119.

  The DNA fragment used in the present invention preferably contains one or more selectable marker genes. The selection marker is a drug resistance gene used for positive selection, or a combination of a drug resistance gene used for positive selection and a conditional lethal gene used for negative selection. In the present invention, it is preferable to use the first and second kinds of selection markers.

  Examples of the first selection marker include kanamycin resistance gene, neomycin resistance gene, chloramphenicol resistance gene, trimethoprim resistance dihydrofolate reductase gene, thiostrepton resistance gene, ampicillin resistance gene and the like. Preferably there is.

  The first selectable marker gene may be used by combining a plurality of genes at the same time. When combining multiple genes, (i) a mode in which a plurality of identical genes are linked in tandem, (ii) a mode in which a plurality of identical genes are linked to an arbitrary location, (iii) a plurality of different types (Iv) a mode in which a plurality of different types of genes are linked to an arbitrary place, or (v) a combination of the above modes (i) to (iv).

  The second selectable marker is not particularly limited as long as it is a conditionally lethal gene, and examples thereof include a gene encoding an enzyme having levansucrase activity. An example of such a gene is the SacB gene.

  The SacB gene is a gene encoding a SacB protein that is one of enzymes having levansucrase activity. SacB protein breaks down sucrose to produce levan. For some Gram-positive bacteria and Gram-negative bacteria, it is possible to efficiently select the target genetically modified cell line by eliminating (negative selection) the cell line into which the SacB gene has been introduced in the presence of sucrose. (Jagar W et al., Journal of bacteriology 1992; 5462-5465, Pelicic V et al., Journal of bacteriology 1996; 1197-1199). The reason why SacB gene expression imparts lethality to cells in the presence of sucrose has not been clarified.

  Examples of the gene encoding levansucrase similar to the SacB gene include the following, but any gene encoding levansucrase can be used without being limited thereto.

  fefA gene (accession number: AJ508391, levansucrase from Lactobacillus sanfranciscensis), lev gene (accession number: Q8GGV4, levansucrase from Lactobacillus reuteri), mlft gene (accession number: AAT81165, levanconostoc mesenteroides-derived levansucrase), lsc gene (Accession number: O68609, levansucrase derived from Pseudomonas syringae), lsxA gene (accession number: BAA93720, levansucrase derived from Gluconacetobacter xylinus).

  When combining multiple genes, as in the case of the first marker gene, (i) a mode in which a plurality of identical genes are linked in tandem, (ii) a mode in which a plurality of identical genes are linked at an arbitrary location (Iii) a mode in which a plurality of different types of genes are linked in tandem, (iv) a mode in which a plurality of different types of genes are linked to an arbitrary location, or (v) any one of (i) to (iv) above A combination of embodiments may be mentioned.

In the present invention, the linear DNA fragment can include a plasmid replication origin in E. coli. As a result, the linear DNA fragment inserted on the transformant genome can be recovered as an E. coli plasmid in a form including the genomic sequence surrounding the insertion site.
Examples of the plasmid replication origin include those derived from plasmid pMB1, those derived from broad-area host plasmid RK2, and derivatives thereof.

(2) Transformation of Rhodococcus bacteria with DNA fragment for transformation Examples of Rhodococcus bacteria include Rhodococcus erythropolis PR4 strain (NBRC), Rhodococcus rhodochrous ATCC12674, Rhodococcus rhodochrous ATCC12674, Rhodococcus rhodochrous ATCC12674, Rhodococcus rhodochrous rhodochrous) ATCC17895, Rhodococcus rhodochrous ATCC19140, and the like. The PR4 strain is available from NBRC (National Institute of Technology and Evaluation, Biological Genetic Resources Department), and the ATCC strain is available from the American Type Culture Collection.

  The method for transforming Rhodococcus bacteria is not particularly limited as long as it is a method for introducing a DNA fragment into the bacterium. For example, electroporation method and the like can be mentioned. These transformation techniques are well known in the art. For details of the transformation method, see `` Hashimoto Y, Nishiyama M, Yu F, Watanabe I, Horinouchi S, Beppu T. (1992) Development of a host-vector system in a Rhodococcus strain and its use for expression of the Reference can be made to "cloned nitrile hydratase gene cluster. J Gen Microbiol. 138: 1003-1010."

(3) Confirmation of genomic region into which DNA fragment is inserted In the transformant obtained as described above (referred to as “transformant of the present invention”), in order to confirm the genomic region into which a DNA fragment has been inserted, It is necessary to prepare a fragment containing the sequence to be confirmed from genomic DNA. Therefore, in the present invention, for example, the following can be performed.

  Genomic DNA is prepared from the transformant of the present invention, cleaved with an appropriate restriction enzyme, and ligated to an E. coli vector by a ligation reaction. Using this, E. coli is transformed (transformation for sequence confirmation), and a transformant containing a vector to which the DNA fragment is bound using a selection marker on the inserted DNA fragment is obtained ("conformant for confirmation"). Called).

  When the DNA fragment contains a plasmid replication origin and a marker gene, the genomic DNA is cleaved with a restriction enzyme, and then a self-ligation reaction is performed to form a cyclized DNA. Those containing the genomic region into which the DNA fragment has been inserted have components of the E. coli plasmid vector (replication start point, marker gene). Confirm that the DNA fragment is contained by transforming E. coli with a ligation solution. A transformant for use is obtained.

  In the present invention, by analyzing the base sequence in the peripheral region of the linear DNA, the insertion state of the linear DNA fragment into the DNA in the bacterium (insertion location, insertion form, gene information of the inserted location, etc.) ) Can be analyzed.

  For example, from the transformant for confirmation prepared as described above, the inserted DNA fragment and the surrounding genomic sequence are recovered in the form of a plasmid. A sequencing primer is designed using the sequence of the terminal region of the inserted DNA fragment, and sequencing is performed to decode the genomic sequence where the DNA fragment is inserted. By comparing this sequence with published genome sequence information of Rhodococcus bacteria, the insertion region, the length of the deletion, and the like can be examined. In the present invention, it can be confirmed by analysis of the base sequence that a deletion of several bp to several tens of kb or more occurs on the genome when a DNA fragment is inserted.

(4) Absence of DNA fragment from transformant inserted with DNA fragment containing SacB gene In the present invention, the transformant prepared as described above is cultured under lethal conditions, and transformed. A strain in which a part or all of the inserted fragment is dropped can be prepared.

  In the present invention, it is characterized in that an arbitrary sequence is randomly inserted into the genome, but under the above-mentioned lethal condition culture, the region containing the sacB gene is deleted, and along with this, all of the inserted DNA fragment or A part is deleted. At this time, if the entire inserted DNA fragment is deleted, a selection marker gene such as a drug resistance gene has also been deleted. In principle, the same drug resistance gene can be used as a selection marker gene to repeat transformation without limitation. It can be carried out. Deletion of the genomic region occurs when the DNA fragment is inserted, and deletion occurs when the DNA fragment is dropped. By repeating this operation, it is possible to produce a microorganism in which all genomic regions unnecessary for a specific purpose are deleted. Even if not all of the inserted DNA fragment is deleted, the above-described repetitive operation can be performed as long as the function of the selectable marker gene such as a drug resistance gene is lost.

Here, “lethal conditions” means that the transformant is dead or unable to grow.
The lethal conditions are, for example, conditions for growing in a medium containing sucrose when the sacB gene is used as a conditional lethal marker.

  In the transformant thus obtained, part or all of the inserted DNA fragment is deleted. The mode of deletion of the inserted DNA fragment, that is, how it is deleted can be examined by a PCR method using primers designed based on the sequence around the insertion site. Then, the nucleotide sequence of the fragment amplified by PCR or the like is examined, and the deletion form can be examined by comparing this sequence with the published genome sequence information of Rhodococcus bacteria.

  Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these examples.

Preparation of DNA fragments MK07 and MK09 for transformation (1) Preparation of template plasmid In order to remove the mob region from the plasmid pK19mob, pK19mob was cleaved with restriction enzymes NspV (Takara Bio Inc.) and PagI (Fermentus Inc.). Restriction enzyme treatment was performed with the following composition.

Restriction enzyme treatment conditions
pK19mob 20μl
10x M buffer (Takara Bio) 5μl
BSA 5μl
NspV 2μl
PagI 2μl
DW 16μl
Total 50μl
The reaction was carried out at 37 ° C. for 2 hours. After the reaction was completed, 5 μl of 3M sodium acetate and 125 μl of ethanol were added, followed by centrifugation at 4 ° C. and 15000 rpm for 15 minutes to obtain a precipitate. 200 μl of 70% ethanol was added, centrifuged at 15000 rpm for 1 minute at 4 ° C. to remove the supernatant, the precipitate was dried and dissolved in 50 μl of sterile water.

  PK19mob cleaved with NspV and PagI was blunt-ended using DNA Blunting Kit (Takara Bio Inc.) as follows.

  1 μl of 10 × buffer and 4 μl of sterilized water were added to 4 μl of pK19mob to make 9 μl, treated at 70 ° C. for 5 minutes, and then reacted at 37 ° C. 1 μl of T4 polymerase was added to this solution and reacted at 37 ° C. for 5 minutes. After 5 minutes, stir using a vortex mixer, add 1 μl of this solution to 5 μl of Ligation solution A, 1.5 μl of Ligation solution B (Ligation Kit: Takara Bio Inc.) and 0.5 μl of sterilized water. A time ligation reaction was performed. In this step, self-ligation of the target fragment occurred, and a plasmid from which the mob region was removed was formed.

Next, E. coli XL10-Gold was transformed with the DNA obtained by the ligation.
First, about 140 μl of XL10-Gold competent cell (Agilent Technology Co., Ltd.) was thawed on ice, 4 μl of 2-mercaptoethanol was added, and left on ice for 10 minutes. Next, dispense 30 μl of XL10-Gold into a sterilized test tube, add 4 μl of the ligated solution, let stand on ice for 30 minutes, then warm to 42 ° C. for 30 seconds, and again on ice for 2 minutes. Left to stand. Thereafter, 0.5 ml of SOC medium was added to each test tube, and cultured at 37 ° C. for 1 hour, and then placed on an LB agar medium (hereinafter referred to as LB Km50 agar medium) containing kanamycin sulfate (Km) (50 μg / ml). The whole amount was applied. After overnight culture at 37 ° C., colonies were confirmed and streaked on the same agar medium.

The obtained colonies were inoculated into 2 ml of LB liquid medium containing kanamycin (50 μg / ml) and cultured overnight at 37 ° C. with shaking. On the next day, the culture solution was transferred to a microtube, and the cells were collected by centrifugation at 15000 rpm for 5 minutes at 4 ° C., and a plasmid was prepared using QIAprep miniprep Kit (Qiagen). It was confirmed with a DNA sequencer (Beckman Coulter, Inc.) that the obtained plasmid had the mob region removed.
The resulting plasmid was named pK19B.

(2) Preparation of DNA fragments MK07 and MK09
A DNA fragment containing the kanamycin resistance gene and the plasmid replication initiation region was amplified using pK19B as a template.
PCR condition reaction solution composition
Prime star max pre-mix (Takara Bio) 25μl
Primer 1 1μl
Primer 2 1μl
Template DNA (pK19B) 1μl
DW 22μl
Total 50μl
Reaction temperature
98 ℃ 10sec
98 ℃ 5sec
30 cycles or less
55 ℃ 10sec
72 ° C 1min
72 ℃ 4min
30cycles
The primer sequences are as follows.
<Primer for MK07 fragment>
Primer 1: TN-1
GG CTGTCTCTTATACACATCT CAACCTGCCGCAAGCACTCAGGGCGC (SEQ ID NO: 1)
Primer 2: TN-2
GG CTGTCTCTTATACACATCT CAACCTGTCGTGCCAGCTGCATTAATG (SEQ ID NO: 2)
* Underlined transposase recognition sequence (Reference: Nature Biotechnology 18:97 (2000))
<Primer for MK09 fragment>
Primer 1: TN-3 CTGCCGCAAGCACTCAGGGCGC (SEQ ID NO: 3)
Primer 2: TN-4 CCTGTCGTGCCAGCTGCATTAATG (SEQ ID NO: 4)

After completion of the reaction, amplification of DNA of the expected size was confirmed by 0.7% agarose gel electrophoresis.

  PCR amplified fragments were purified using Wizard SV Gel and PCR Clean-up system (Promega Corporation). To 50 μl of the fragment solution, 450 μl of TE buffer, 250 μl of 5M NaCl, and 250 μl of 30% PEG8000 / 1.5M NaCl were added to make a total volume of 1 ml, mixed, and then allowed to stand at 4 ° C. for 1 hour. Thereafter, a precipitate was obtained by centrifugation at 4 ° C. and 15000 rpm for 10 minutes, and then centrifuged again at 4 ° C. and 15000 rpm for 1 minute to remove the supernatant adhering to the wall. The resulting precipitate was dissolved in 10 μl of TE buffer to obtain DNA fragments MK07 (SEQ ID NO: 5) and MK09 (SEQ ID NO: 6) (FIG. 1). After measuring the DNA concentration, it was adjusted to a concentration of 150 μg / ml.

Transformation of Rhodococcus erythropolis NBRC100887 (Rhodococcus erythropolis PR4) with DNA fragment MK07 (1) Preparation of competent cells Rhodococcus erythropolis NBRC100887 (Rhodococcus erythropolis PR4) strain in logarithmic growth phase of cell line Bacteria were washed three times with ice-cooled sterilized water and suspended in sterilized water to produce competent cells.
(2) Preparation of transformant The DNA fragment prepared in Example 1 was diluted 6-fold with TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0), and 1 μl was taken. 10 μl of each of the produced cell suspensions of competent cells were mixed and ice-cooled. Each mixed solution was put in a cuvette for a gene introduction device Gene Pulser (BIO RAD), and electric pulse treatment was performed at 20 KV / cm, 200 OHMS using a Gene Pulser. The electric pulse treatment solution was allowed to stand for 10 minutes under ice cooling, and heat shock was performed at 37 ° C. for 10 minutes. After that, add 500 μl of LB medium (1% bactotryptone, 0.5% bacto yeast extract, 1% NaCl) to the cuvette, let stand at 30 ° C. for 5 hours, apply to LB Km50 agar medium, 30 ° C. Cultured for 3 days.
As a result, transformants could be obtained, and the transformation efficiency was 2.2 × 10 ⁴ colonies / μg DNA (Table 1).

Analysis of DNA fragment MK07 insertion site (1) Preparation of genomic DNA
Six transformants obtained using the DNA fragment MK07 were subjected to shaking culture at 30 ° C. for 2 days in 10 ml of LB Km10 liquid medium. The culture solution is collected by centrifugation at 4 ° C and 8000 rpm for 10 minutes, suspended in 4.8 ml of 50 mM EDTA, and then TENS solution containing 20 mg / ml lysozyme (50 mM Tris, 10 mM EDTA, 50 mM NaCl, 20% sucrose 1.2 ml) and shaken overnight at 37 ° C. From the cell suspension after lysozyme treatment, 1 ml was dispensed into a microtube and centrifuged at 4 ° C. and 15000 rpm for 5 minutes to obtain a precipitate. From the precipitate, genomic DNA was obtained using Wizard Genomic DNA Purification Kit (Promega Corporation).
(2) Genomic DNA restriction enzyme treatment 10 μl of genomic DNA obtained in this way was added 2 μl of 10x K Buffer (Takara Bio Inc.), 7.5 μl of sterile water, 0.5 μl of restriction enzyme BamHI (Takara Bio Inc.). In addition, the mixture was reacted at 37 ° C. for 4 hours. After confirming that the genomic DNA was cleaved by 0.7% agarose gel electrophoresis, it was treated with phenol / chloroform. After ethanol precipitation, it was air-dried and dissolved in 10 μl of sterilized water.
(3) Self-ligation (circularization) of DNA fragments and transformation of Escherichia coli 2 μl of Ligation Mix of DNA Ligation Kit <Mighty Mix> (Takara Bio Inc.) is added to 2 μl of genomic DNA fragments and allowed to react overnight at 4 ° C. Thus, self-ligation of the DNA fragment was performed. Using the solution after ligation, E. coli XL10-Gold was transformed as follows.

About 140 μl of XL10-Gold competent cell was thawed on ice, 4 μl of 2-mercaptoethanol was added, and the mixture was allowed to stand on ice for 10 minutes. 30 μl of XL10-Gold competent cells were dispensed into a sterilized test tube, 3 μl of the ligated solution was added, and the mixture was allowed to stand on ice for 30 minutes. Next, the solution was treated at 42 ° C. for 30 seconds and again left on ice for 2 minutes. Thereafter, 0.5 ml of NZY ⁺ medium (Sigma Aldrich Japan Co., Ltd.) was added to each test tube, and cultured at 37 ° C. for 1 hour, and then the entire amount was plated on LB Km50 agar medium. The DNA fragment MK07 used for transformation contains the kanamycin resistance gene and ori involved in plasmid replication in E. coli, and is transformed by a circularized product of the genomic DNA fragment containing the region into which MK07 was inserted. Only the obtained E. coli can grow on the LB Km50 agar medium.

(4) Preparation of plasmid and determination of base sequence After the above transformed Escherichia coli was cultured overnight at 37 ° C., a plurality of colonies appeared were streaked on the same agar medium. Two colonies were each inoculated into 2 ml of LB Km50 liquid medium and cultured overnight at 37 ° C. with shaking. The culture solution was transferred to a microtube, centrifuged at 4 ° C. and 15000 rpm for 5 minutes, and a plasmid was prepared using QIAprep miniprep Kit (Qiagen).

  By determining the nucleotide sequence of the obtained plasmid using oligonucleotides TN-5 (SEQ ID NO: 7) and TN-6 (SEQ ID NO: 8) as primers, the insertion region and insertion mode of MK07 in the transformant genome I investigated. The entire genome sequence of Rhodococcus erythropolis NBRC10088 has been released, and the insertion region and the insertion form can be examined by comparing with the sequence information. As a result, as shown in FIG. 2 and FIG. 3, the end of MK07 may be partially missing, but almost the entire MK07 causes random insertion into the genome, and the genomic deletion (several bp) It was revealed that it was accompanied by ˜several tens kb, and several hundred bp to several kb in FIG. Combined with the fact that the generation of short direct repeats observed at the time of transposon insertion was not observed, it is considered that genomic DNA was inserted by a mechanism different from that of transposon.

  In the base sequence displayed in FIG. 2, the underlined portion represents the sequence of the terminal portion of MK07, and the other sequences represent the genomic region sequences. EndA indicates the upstream end of the kanamycin resistance gene, and EndB indicates the downstream end.

Oligonucleotide TN-5: GCAGCCGATTGTCTGTTGTG (SEQ ID NO: 7)
Oligonucleotide TN-6: GTTTCGCCACCTCTGACTTG (SEQ ID NO: 8)

Transformation of Rhodococcus erythropolis NBRC100887 (Rhodococcus erythropolis PR4) with DNA fragment MK09 In the same manner as in Example 2, NBRC100887 was transformed with MK09.
As a result, transformants could be obtained, and the transformation efficiency was 1.5 × 10 ⁴ colonies / μg DNA (Table 1).

  In MK09, unlike MK07, although there was no specific sequence at both ends, which is the recognition site for Tn5 Transposase, it showed the same level of transformation efficiency. It was revealed that no specific sequence is required.

Analysis of DNA fragment MK09 insertion site In the same manner as in Example 3, the genomic insertion region and the insertion form of MK09 in the transformant were examined. As a result, as shown in FIG. 4 and FIG. 5, the end of MK09 may be partially missing, but almost the entire MK09 causes random insertion into the genome, and the genomic deletion (several bp) It was revealed that it was accompanied by ˜several tens kb, and in FIG.

  In the base sequence shown in FIG. 4, the underlined portion represents the sequence of the terminal portion of MK09, and the other sequences represent the genomic region sequences. The meanings of EndA and EndB are the same as described above.

Preparation of DNA fragment MK10 for transformation containing lethal selectable marker sacB gene
Preparation of template plasmid <Preparation of pK19mobsacB1>
Using the plasmid pDNR-1r (Clontech Laboratories Inc.) containing the sabB gene as a template, the sacB gene was amplified by the PCR method in the same manner as in Example 1 to obtain a sacB gene fragment of about 1.9 kb. As amplification primers, primers SAC-01 (SEQ ID NO: 9) and SAC-02 (SEQ ID NO: 10) to which an NspV cleavage site was added were used.
Primer:
SAC-01: 5'-GGTTCGAATACCTGCCGTTCACTATTATTTAGTG-3 '(SEQ ID NO: 9)
SAC-02: 5′-GGTTCGAATCGGCATTTTCTTTTGCGTTTTTATTTG -3 ′ (SEQ ID NO: 10)
The amplified DNA fragment was digested with the restriction enzyme NspV and purified using Wizard SV Gel and PCR Clean-up system (Promega Corporation) in the same manner as in Example 1 to obtain a DNA fragment containing the sacB gene.

  On the other hand, the DNA fragment of plasmid pK19mob was cleaved with restriction enzyme NspV and dephosphorylated using Shrimp Alkaline Phosphatase (Takara Bio Inc.). The treatment solution was ethanol precipitated and the DNA fragment was purified. This DNA fragment and a DNA fragment containing the sacB gene were bound by a ligation reaction, and E. coli XL10-Gold was transformed. A plasmid was prepared in the same manner as in Example 1 from the transformant exhibiting kanamycin resistance. A plasmid in which the sacB gene was introduced downstream and in the same direction as the kanamycin resistance gene was obtained and named pK19mobsacB1.

<Preparation of pK19sacB1>
In order to remove the mob region from the plasmid pK19mobsacB1, pK19mobsacB1 was first partially cleaved with the restriction enzyme NspV (Takara Bio Inc.), and then cleaved with PagI (Fermentus). The reaction conditions were the same as in Example 1, but for the partial cleavage, an appropriate time was selected by adjusting the reaction time.

  After completion of the reaction, 0.7% agarose gel electrophoresis was performed, and the NspV-PagI fragment was excised from the gel and purified using Wizard SV Gel and PCR Clean-up system. The NspV-PagI fragment was blunt-ended and ligated in the same manner as in Example 1. However, the ligation reaction was performed in the presence of XbaI linker. In this step, self-ligation of the target fragment occurs to form a plasmid with the mob region removed, but at the same time an XbaI linker is inserted into the binding site of the fragment.

Using this solution, E. coli XL10-Gold was transformed in the same manner as in Example 1. After obtaining a transformant having kanamycin resistance in the same manner as in Example 1, a plasmid was prepared and it was confirmed that the mob region was removed. In addition, one XbaI linker was inserted.
The resulting plasmid was named pK19sacB1.

As in Example 1, a DNA fragment MK10 (SEQ ID NO: 12, FIG. 6) was obtained by amplifying a DNA fragment containing the kanamycin resistance gene, sacB gene, and plasmid replication initiation region using pK19sacB1 as a template and the following primers. It was. After measuring the DNA concentration, it was adjusted to a concentration of 150 μg / ml.
Primer 1: TN-1
GG CTGTCTCTTATACACATCT CAACCTGCCGCAAGCACTCAGGGCGC (SEQ ID NO: 1)
Primer 2: TN-7
GG CTGTCTCTTATACACATCT CAACCTGTCGTGCCAGCTGCATTAATG (SEQ ID NO: 11)

Transformation of NBRC100887 (Rhodococcus erythropolis PR4) with DNA fragment MK10 In the same manner as in Example 2, NBRC100887 was transformed with MK10.
As a result, a transformant could be obtained, and the transformation efficiency was 1.8 × 10 ³ colonies / μg.

Analysis of DNA Fragment MK10 Insertion Site In the same manner as in Example 3, the MK10 genomic insertion region and the insertion form of one of the transformants were examined. As a result, as shown in FIG. 2 and FIG. 3, the end of MK10 was partially missing, but almost the entire MK10 caused random insertion into the genome, and deletion of the genome (6,042 bp) It became clear that it was accompanied.

Deletion of inserted DNA fragment MK10 from the genome using the conditional lethal selection marker sacB gene Deletion of MK10 from the genome using sucrose-added medium Each of the six transformants was added to 200 μl of LB liquid medium. The suspension was suspended, 100 μl was plated on an LB agar medium containing 10% Sucrose, and cultured at 30 ° C. for 3 days. The appearing colonies were randomly acquired 3 to 6 strains, streaked on the same agar medium and LB Km50 agar medium, and growth was confirmed. The results are shown in Table 2.

  Although the frequency of returning to kanamycin sensitivity varies depending on the location and state of the genome, it is considered that kanamycin-sensitive strains (MK10-dropped strains) can be obtained from almost all transformants by increasing the number of colonies examined.

By removing in this way, a transformant lacking a specific region of the genome loses resistance to the selection marker kanamycin, and thus can be transformed again using MK10.
[Comparative Example 1]
Transformation of NBRC100887 (Rhodococcus erythropolis PR4) with DNA Fragment MK07 and Transposase Complex 6.7 μl of 75% glycerol was added to 3.3 μl of DNA fragment MK07 prepared in Example 1 to make a total volume of 10 μl. 2 μl of Transposase (EPICENTRE Biotechnologies) was added to 2 μl of this solution, and after sufficient stirring, a complex was formed by allowing to stand at room temperature for 30 minutes. Using 1 μl of the complex solution, the Rhodococcus erythropolis PR4 strain was transformed in the same manner as in Example 2. As a result, as shown in Table 1, the transformation efficiency was 8.4 × 10 ³ colonies / μg DNA.
Confirmation of genomic region into which MK07 complex was inserted In the same manner as in Example 3, the insertion region and the insertion mode of genomic strain were examined for 6 strains. As a result, unlike the case of using the DNA fragment MK07, most showed a typical Transposon-type insertion mode (FIGS. 7 and 8).
[Comparative Example 2]
Transformation of E. coli XL10-Gold with DNA fragment MK07
DNA fragments MK07 and MK09 were prepared in the same manner as in Example 1 except that the template plasmid pK19B was digested with the restriction enzyme DnpI after amplification by the PCR method. DpnI recognizes and cleaves GATC sequences containing methylated G, so that plasmids prepared from transformants hosting E. coli XL10-Gold and JM109 are degraded, but amplified in vitro such as PCR. The digested DNA fragment does not contain methylated G and therefore does not degrade.

Using 1 μl of the DNA fragments MK07 and MK09 thus prepared, Rhodococcus erythropolis NBRC10087 was transformed by the same method as in Example 2. As a result, the transformation efficiency was about 1 × 10 ⁴ colonies / μg DNA, respectively.

On the other hand, E. coli XL10-Gold was transformed according to the method described in Example 1 using 1 μl of DNA fragments MK07 and MK09. The E. coli competent cell used should have a high transformation ability since a transformant can be obtained at a frequency of 1 × 10 ⁹ / μg DNA or more when using plasmid pK4, but DNA fragment MK07 When MK09 was used, no transformant was obtained.

  The transformant of the present invention is useful for gene function analysis and microorganism improvement.

SEQ ID NOs: 1 to 40: synthetic DNA

Claims (10)

A bacterium belonging to the genus Rhodococcus is transformed with a linear DNA fragment having an arbitrary sequence and having no transposase recognition sequence at its end {where the linear DNA is 500 to 10,000 bases long}. A method for inserting the linear DNA into the bacterial genome. The method according to claim 1, wherein the linear DNA is a PCR amplified fragment having a length of 500 to 10,000 bases. A bacterium belonging to the genus Rhodococcus is transformed with a linear DNA fragment having an arbitrary sequence {where the linear DNA fragment is 500 to 10,000 bases in length}, and the linear DNA is A method of inserting into the bacterial genome (except for a method in which transformation is performed using transposase). The method according to claim 3, wherein the linear DNA is a PCR amplified fragment having a length of 500 to 10,000 bases . Furthermore, the method of any one of Claims 1-4 which can lose the function of the genomic DNA of the bacteria at random. The method according to any one of claims 1 to 4, wherein the linear DNA fragment contains a gene encoding a desired protein and / or one or more selectable marker genes. The method according to any one of claims 1 to 4, wherein the linear DNA fragment contains a plasmid replication origin in E. coli. The method according to claim 7 , wherein the origin of plasmid replication is derived from plasmid pMB1 and its derivatives. The method according to any one of claims 6 to 8 , wherein the selectable marker gene is a drug resistance gene or a combination of a drug resistance gene and a conditionally lethal gene. {Where linear DNA contains a combination of a drug resistance gene and the conditional lethal gene} to prepare a transformant by a method according to claim 1 or 2, the transformant obtained, lethal conditions A method for producing a strain in which a part of the inserted fragment has been removed by transformation.