JP6041685B2 - Solid phase carrier for nucleic acid synthesis and nucleic acid synthesis method - Google Patents

Description

  The present invention relates to a porous resin bead. More specifically, a nucleic acid carrying a cleavable linker on a porous resin bead comprising a monovinyl monomer unit and a divinyl monomer unit, having a group capable of binding to a carboxy group by a dehydration condensation reaction on the surface and a sulfo group. The present invention relates to a solid phase carrier for synthesis.

  A solid phase synthesis method using a phosphoramidite method is widely used for chemical synthesis of nucleic acids such as DNA oligonucleotides or RNA oligonucleotides. In this method, for example, a nucleoside that becomes the 3 ′ end of a nucleic acid to be synthesized is first supported on a solid phase synthesis carrier via a cleavable linker such as a succinyl group, and this carrier is placed in a reaction column to automatically synthesize nucleic acid. Set in the device.

Thereafter, according to the synthesis program of the automatic nucleic acid synthesizer, for example, the reagent for synthesis flows in the reaction column as follows.
(1) Deprotection of nucleoside 5′-OH group with trichloroacetic acid / dichloromethane solution or dichloroacetic acid / toluene solution, etc.
(2) coupling reaction of amidite to 5′-OH group by nucleoside phosphoramidite (nucleic acid monomer) / acetonitrile solution and activator (tetrazole etc.) / Acetonitrile solution,
(3) Capping of unreacted 5′-OH group with acetic anhydride / pyridine / methylimidazole / THF and the like, and (4) oxidation of phosphite with iodine / water / pyridine and the like.

  By repeating this synthesis cycle, a nucleic acid having a target sequence is synthesized. The finally synthesized nucleic acid is excised from the carrier for solid phase synthesis by hydrolyzing the cleavable linker with ammonia, methylamine or the like (see Non-Patent Document 1).

  In the past, inorganic particles such as CPG (Controlled Pore Glass) and silica gel have been used as carriers for solid-phase synthesis used in nucleic acid synthesis. Resin beads capable of increasing the amount of nucleic acid synthesis per weight of the solid phase synthesis support have come to be used. Examples of such resin beads include highly crosslinked / non-swellable porous polystyrene beads (see Patent Document 1), low crosslinked / swellable porous polystyrene beads (see Patent Documents 2 and 3), and the like.

  Generally, the longer the chain length of the oligonucleotide to be synthesized, the lower the synthesis ability (synthesis purity and synthesis amount). To solve this problem, the nucleoside linker that is the starting point for the synthesis of the solid-phase synthesis carrier It is necessary to reduce the loading amount. For example, in order to synthesize a 20 nucleotide sequence DNA oligonucleotide with high purity, a commercially available porous resin bead carrier for solid phase synthesis has a nucleoside linker loading of about 200 μmol / g, but a 40 nucleotide sequence DNA oligonucleotide. In this case, it is necessary to make it 80 μmol / g or less. In addition, when synthesizing RNA and modified oligonucleotides, amidites containing bulky protecting groups or modifying groups are coupled, so it is possible to synthesize with a small amount of nucleoside linker supported so as not to reduce the synthesis ability. Has been done.

JP 3-68593 JP 2005-325272 A JP2008-74979

Current Protocols in Nucleic Acid Chemistry (2000), UNIT 3.6 Synthesis of Unmodified Oligonucleotides

  However, when porous resin beads were used as a solid phase synthesis carrier and oligonucleotides were synthesized with a small amount of nucleoside linker supported, there was a problem that the synthesis ability was lower than expected. . An object of the present invention is to provide a solid phase carrier for nucleic acid synthesis for synthesizing a nucleic acid with a high synthesis amount and high purity. In particular, an object is to provide a solid phase carrier for nucleic acid synthesis for synthesizing long oligonucleotides, RNA oligonucleotides, and modified oligonucleotides with a low linker loading.

As a result of intensive studies in view of the above-mentioned problems, the present inventors have found that high synthesis ability (high synthesis) can be achieved even with a low linker loading by incorporating a sulfo group into a porous resin bead for solid phase carrier for nucleic acid synthesis. The inventors have found that long-chain oligonucleotides, RNA oligonucleotides, and modified oligonucleotides can be synthesized with high purity and synthesis amount), and have completed the present invention.
That is, the gist of the present invention is as follows.

[1] Porous resin beads comprising a copolymer containing a monovinyl monomer unit and a crosslinkable vinyl monomer unit and having a group that can be bonded to a carboxy group by dehydration condensation on the surface; A solid phase carrier for nucleic acid synthesis formed by covalently bonding to a cleavable linker having a carboxy group via a group capable of binding, wherein the porous resin beads have a sulfo group. Solid support.
[2] The solid phase carrier for nucleic acid synthesis according to [1], wherein the monovinyl monomer unit includes a styrene monomer unit.
[3] The solid phase carrier for nucleic acid synthesis according to [1] or [2], wherein the content of the sulfo group with respect to the weight of the porous resin beads is 0.5 to 40 μmol / g.
[4] The solid phase carrier for nucleic acid synthesis according to any one of [1] to [3] above, wherein the cleavable linker is supported in an amount of 1 to 60 μmol / g relative to the weight of the porous resin beads. .
[5] The solid phase carrier for nucleic acid synthesis according to any one of [1] to [4], wherein the group capable of binding to a carboxy group includes a hydroxy group or an amino group.
[6] Nucleic acid synthesis comprising using the solid phase carrier for nucleic acid synthesis according to any one of [1] to [5] above to obtain an oligonucleotide by sequentially binding nucleosides or nucleotides via a cleavable linker Method.
[7] A porous resin comprising a copolymer containing a monovinyl monomer unit and a crosslinkable vinyl monomer unit, having a group capable of binding to a carboxy group by a dehydration condensation reaction on the surface, and further having a sulfo group A carrier kit for solid phase synthesis of nucleic acid, comprising beads and a cleavable linker having a carboxy group.

  Even when synthesizing long oligonucleotides, RNA oligonucleotides, etc. with a low linker loading, the solid phase carrier for nucleic acid synthesis of the present invention has a high nucleic acid synthesis amount and high synthesis purity. By using it, nucleic acid synthesis can be performed more efficiently than in the case of a solid phase carrier for nucleic acid synthesis using conventional porous resin beads.

  In the present specification, the “nucleic acid” means a chain compound (oligonucleotide) in which nucleotides are linked by a phosphodiester bond, and includes DNA, RNA, and the like. The nucleic acid may be either single-stranded or double-stranded, but is preferably single-stranded because efficient synthesis by a nucleic acid synthesizer is possible. As used herein, the term “nucleic acid” includes not only oligonucleotides containing purine bases such as adenine (A) and guanine (G) and pyrimidine bases such as thymine (T), cytosine (C) and uracil (U). Also included are modified oligonucleotides containing other modified heterocyclic bases.

  The nucleotide length of the nucleic acid is not particularly limited, but is preferably 2 to 200 nucleotides. In general, when the nucleotide length is too long, the yield and purity of the nucleic acid obtained are lowered, but in the present invention, the yield and purity are hardly lowered even in the synthesis of a nucleic acid having a length of 20 nucleotides or more.

  As used herein, “linker” refers to a molecule that connects two substances through a covalent bond. In the present invention, the linker connects the porous resin beads and the nucleic acid.

  In this specification, “porous resin beads” refers to a solid phase carrier that functions as a field for proceeding a nucleic acid synthesis reaction, and refers to a granular resin having a large number of pores. Here, the term “granular” is preferably spherical, but it means that it may have a certain shape (for example, a substantially spherical shape such as an elliptical sphere, a polyhedron shape, a columnar shape, or a deformed shape such as a confetti shape).

(Porous resin beads)
The monovinyl monomer unit, which is one of the structural units of the porous resin beads in the present invention, is roughly classified into an aromatic vinyl monomer and an aliphatic vinyl monomer.

  Examples of the aromatic vinyl monomer include an aromatic ring having 5 to 6 ring members which has one vinyl group in the molecule and may contain a hetero atom such as a nitrogen atom in addition to carbon as a ring constituent atom. It is done. The aromatic ring is a carbon atom such as a halogen atom such as a fluorine atom, a chlorine atom, a bromine atom or an iodine atom, a linear or branched alkoxy group having 1 to 10 carbon atoms such as a methoxy group or an ethoxy group, a methyl group or an ethyl group. A linear or branched alkyl group having 1 to 10 carbon atoms (the alkyl group may be substituted with a halogen atom, an alkoxy group or the like), an acetoxy group, or a linear or branched chain group having 2 to 10 carbon atoms It may have a substituent such as a linear or branched acylamino group having 2 to 10 carbon atoms such as an acyloxy group, an amino group or an acetylamino group, a cyano group or a nitro group. Specifically, for example, alkyl styrene such as styrene, ethyl styrene, methyl styrene, dimethyl styrene, trimethyl styrene, butyl styrene, halogenated styrene such as chlorostyrene, dichlorostyrene, fluorostyrene, pentafluorostyrene, bromostyrene, chloromethyl Examples thereof include halogenated alkyl styrene such as styrene and fluoromethyl styrene, amino styrene, cyano styrene, methoxy styrene, ethoxy styrene, butoxy styrene, acetoxy styrene, nitro styrene and the like.

  A specific example of the aliphatic vinyl monomer is (meth) acrylic acid alkyl ester. Examples thereof include esters obtained from a linear or branched monohydric alcohol having 1 to 20 carbon atoms in an alkyl group and acrylic acid or methacrylic acid. The alcohol may be substituted with a halogen atom, a hydroxy group, an alkoxy group, an epoxy group, a phenyl group, or the like. Also included are esters obtained from polyethylene glycol monoalkyl ethers such as polyethylene glycol and polyethylene glycol monomethyl ether and acrylic acid or methacrylic acid. For example, methyl acrylate, butyl acrylate, 2-ethylhexyl acrylate, 2-hydroxyethyl acrylate, methoxyethylene glycol acrylate, methoxypolyethylene glycol acrylate, methyl methacrylate, ethyl methacrylate, butyl methacrylate, hexyl methacrylate , 2-ethylhexyl methacrylate, glycidyl methacrylate, stearyl methacrylate, 2-hydroxyethyl methacrylate, methoxyethylene glycol methacrylate, methoxypolyethylene glycol methacrylate, polyethylene glycol methacrylate, benzyl methacrylate, trifluoroethyl methacrylate, methacryl Acid octafluoropentyl etc. are mentioned.

Another specific example of the aliphatic monovinyl monomer is a vinyl cyanide monomer represented by acrylonitrile, methacrylonitrile, ethacrylonitrile and the like.
Other specific examples of the aliphatic monovinyl monomer include N-isopropylacrylamide, Nt-butylacrylamide, N, N-dimethylacrylamide, N- (methoxymethyl) methacrylamide, and N- (butoxymethyl). (Meth) acrylamide monomers such as acrylamide and diacetone acrylamide.

  Monovinyl monomers can be used alone or in combination with different ones.

  The monovinyl monomer is preferably a styrenic monomer or a mixture of a styrene monomer and other monovinyl monomers.

  The crosslinkable vinyl monomer, which is one of the structural units of the porous resin beads of the present invention, is used as a crosslinking agent and has 2 or more, preferably 2 to 3 vinyl groups in the molecule. In addition, a crosslinked network structure can be formed with the aforementioned monovinyl monomer. For example, divinylbenzene, trivinylbenzene, trivinylcyclohexane, ethylene glycol di (meth) acrylate, diethylene glycol di (meth) acrylate, triethylene glycol di (meth) acrylate, higher polyvalent ethylene glycol di ( (Meth) acrylate, propylene glycol di (meth) acrylate, dipropylene glycol di (meth) acrylate, tripropylene glycol di (meth) acrylate, higher polypropylene glycol di (meth) acrylate, di ( Examples thereof include but are not limited to butanediol (meth) acrylate, hexanediol di (meth) acrylate, and nonanediol di (meth) acrylate.

  The crosslinkable vinyl monomer can be used alone or in combination with different ones. The crosslinkable vinyl monomer is particularly preferably p-divinylbenzene, m-divinylbenzene, or a mixture thereof.

  In the present invention, the crosslinkable vinyl monomer unit of the porous resin beads is 100 to 5000 μmol / g, preferably 300 to 3000 μmol / g, as the amount occupying the weight of the porous resin beads. When the crosslinkable vinyl monomer unit is less than 100 μmol / g, the resulting particles have insufficient solvent resistance, thermal stability, and porosity, and it is difficult to expect a desired effect when used as a solid phase carrier for nucleic acid synthesis. . On the other hand, when it exceeds 5000 μmol / g, the degree of swelling in an organic solvent is lowered, and thus the synthesis purity and synthesis amount of nucleic acid obtained when used as a solid phase carrier for nucleic acid synthesis tend to be lowered.

The “group capable of binding to a carboxy group by a dehydration condensation reaction” present on the surface of the porous resin beads is not particularly limited as long as it can form a bond by a dehydration condensation reaction with a carboxy group. Group or an amino group-containing group, specifically, a hydroxy-C _1-20 alkyl group such as a hydroxy group, an amino group, or a hydroxymethyl group, and an amino-C _1-20 alkyl group such as aminomethyl. It is done.

A group capable of binding to a carboxy group by a dehydration condensation reaction is
(1) A vinyl monomer containing a group capable of bonding to a carboxy group by a dehydration condensation reaction is copolymerized with the monovinyl monomer and the crosslinkable vinyl monomer, or (2) a reaction such as hydrolysis. The vinyl monomer containing a group that can be converted into a group that can be bonded to a carboxy group by dehydration condensation reaction is copolymerized with the monovinyl monomer and the crosslinkable vinyl monomer, and then subjected to a reaction such as hydrolysis. By attaching, it can introduce | transduce into the surface of a porous resin bead. The manufacturing method will be described later.

  In order to make the porous resin beads contain a sulfo group, a vinyl monomer having a sulfo group, such as sodium p-styrenesulfonate, sodium vinylsulfonate, sodium (meth) allylsulfonate, 2-acrylamide-2- A method of copolymerizing methylpropanesulfonic acid can be mentioned.

  The sulfo group contained in the porous resin beads may be produced by synthesizing and then introducing the porous resin beads by suspension copolymerization or the like. For example, a sulfo group can be introduced into the benzene ring by heat-treating polystyrene-based porous resin beads at room temperature to 150 ° C. for several hours using concentrated sulfuric acid, fuming sulfuric acid, chlorosulfonic acid, or the like.

  The amount of the sulfo group contained in the porous resin beads per weight of the porous resin beads is 0.5 to 40 μmol / g, preferably 0.7 to 30 μmol / g. When the amount of the sulfo group is less than 0.5 μmol / g, the synthesis reagent such as nucleoside phosphoramidite is adsorbed to the porous resin beads when used as a carrier for solid phase synthesis, so the nucleic acid synthesis ability is low. Become. When the amount of the sulfo group exceeds 40 μmol / g, when used as a carrier for solid phase synthesis, the reason for this is unknown, but the nucleic acid synthesis ability is lowered.

  The amount of sulfo groups contained in the porous resin beads is determined by collecting the gas generated by completely burning the porous resin beads in an absorbing solution, and quantifying the amount of S (sulfur) in this solution using an ion chromatograph. Is required.

  Preferred copolymers include styrene-hydroxystyrene-divinylbenzene copolymer, styrene-hydroxymethylstyrene-divinylbenzene copolymer, styrene-aminostyrene-divinylbenzene copolymer, styrene-aminomethylstyrene- Divinylbenzene copolymer, styrene-hydroxystyrene-acrylonitrile-divinylbenzene copolymer, styrene-hydroxystyrene-methacrylonitrile-divinylbenzene copolymer, styrene-hydroxystyrene-N-isopropylacrylamide-divinylbenzene Examples thereof include a copolymer and a styrene-hydroxystyrene-diacetone acrylamide-divinylbenzene copolymer.

  The shape of the porous resin beads does not necessarily have to be a strict spherical shape, and may be a certain shape. However, the porous resin beads are preferably spherical from the viewpoint that the efficiency of filling the reaction column for solid phase synthesis can be increased and that they are not easily damaged.

  The median particle diameter of the porous resin beads measured by the laser diffraction scattering method is usually 1 to 1000 μm, preferably 10 to 500 μm, more preferably 20 to 300 μm.

  Specifically, the median particle diameter determined by the laser diffraction scattering method is determined by using porous resin beads using a laser diffraction scattering type particle size distribution analyzer LA-950 (manufactured by Horiba, Ltd.) using a 50 v / v% aqueous ethanol solution as a dispersion medium. The particle diameter is measured to determine the median particle diameter.

  The median particle size depends on the stirring conditions before the start of polymerization when the porous resin beads are produced by suspension polymerization, and the type and concentration of the dispersion stabilizer. Therefore, by adjusting these, it is possible to adjust the median particle diameter to a desired range.

  The median pore diameter of the porous resin beads measured by mercury porosimetry is usually 1-1000 nm, preferably 5-500 nm, more preferably 10-300 nm.

  The median pore diameter of the porous resin beads is measured by a mercury intrusion method. Specifically, 0.2 g of porous resin beads were put into a mercury porosimeter PoreMaster60-GT (manufactured by Quanta Chrome Co.), and the mercury intrusion method was performed at a mercury contact angle of 140 ° and a mercury surface tension of 480 dyn / cm. taking measurement.

  The median pore diameter depends on the stirring conditions before the start of polymerization when the porous resin beads are produced by suspension polymerization, and the kind and concentration of the porous agent. Therefore, by adjusting these, it is possible to adjust the median pore diameter to a desired range.

The production method of the porous resin beads is not particularly limited, for example,
(1) a monovinyl monomer, a crosslinkable vinyl monomer, a vinyl monomer containing a group capable of binding to a carboxy group by a dehydration condensation reaction, and a monomer containing a sulfo group, A method for producing porous resin beads by mixing and dissolving with a polymerization initiator and suspension copolymerization in water in which a dispersion stabilizer is dispersed or dissolved,
(2) Mixing and dissolving a monovinyl monomer, a crosslinkable vinyl monomer, and a vinyl monomer containing a group capable of binding to a carboxy group by a dehydration condensation reaction with a porosifying agent and a polymerization initiator, A method of producing a porous resin bead by suspending copolymerization in water in which a dispersion stabilizer is dissolved to synthesize a porous resin bead and then introducing a sulfo group;
(3) a monovinyl monomer, a crosslinkable vinyl monomer, a vinyl monomer containing a group that can be converted to a group that can be bonded to a carboxy group by a dehydration condensation reaction by a reaction such as hydrolysis, and a sulfo group Porous resin beads are synthesized by mixing and dissolving a monomer having a porosifying agent and a polymerization initiator, suspending copolymerization in water in which the dispersion stabilizer is dispersed or dissolved, and then hydrolyzing it. A method for producing a porous resin bead by converting it into a group capable of binding to a carboxy group by a dehydration condensation reaction,
(4) Vinyl containing a vinyl monomer containing a monovinyl monomer, a crosslinkable vinyl monomer, and a group that can be converted to a group that can be bonded to a carboxy group by a dehydration condensation reaction by a reaction such as hydrolysis. Porous resin beads are synthesized by mixing and dissolving the monomer with the porosifying agent and the polymerization initiation ratio, and by suspension copolymerization in water in which the dispersion stabilizer is dispersed or dissolved, and then reaction such as hydrolysis. A method for producing a porous resin bead by converting to a group capable of binding to a carboxy group by a dehydration condensation reaction, and further introducing a sulfo group with sulfuric acid or the like,
Etc.

  The amount of the crosslinkable vinyl monomer charged in the suspension copolymerization with respect to the total weight of the monomer is preferably 0.1 to 5 mmol / g, more preferably 0.3 to 3 mmol / g. .

  At the time of suspension copolymerization, the vinyl monomer containing a group capable of binding to a carboxy group by a dehydration condensation reaction with respect to the total weight of the monomer, or by a dehydration condensation reaction by a reaction such as hydrolysis. The amount of the vinyl monomer containing a group that can be converted into a group to be obtained is preferably 0.001 to 1 mmol / g, and more preferably 0.005 to 0.5 mmol / g.

  Suspension copolymerization is performed by stirring and emulsifying a mixed solution of the above-described monomers, a porosifying agent, and a polymerization initiator in water in which a dispersion stabilizer is dispersed or dissolved.

  The porosifying agent in the present invention means a solvent other than water in the suspension copolymerization system, and hydrocarbons and alcohols are preferably used. Specifically, aliphatic saturated or unsaturated hydrocarbon or aromatic hydrocarbon can be used as the hydrocarbon, preferably an aliphatic hydrocarbon having 5 to 12 carbon atoms, and more preferably n- Examples include hexane, n-heptane, n-octane, isooctane, undecane, and dodecane. In order to increase the porosity of the beads obtained at this time, it is desirable to coexist alcohol. As alcohol in this invention, an aliphatic alcohol can be mentioned, for example, The carbon number becomes like this. Preferably it is 5-9. Specific examples of such an alcohol include 2-ethylhexanol, t-amyl alcohol, nonyl alcohol, 2-octanol, and cyclohexanol.

  The weight ratio of hydrocarbon to alcohol used for the porosification agent in suspension copolymerization is appropriately changed depending on the specific combination of hydrocarbon and alcohol, and the specific surface area of the resulting solid phase synthesis carrier is thereby changed. Can be bigger. A preferable blending ratio of hydrocarbon and alcohol is 1: 9 to 6: 4 by weight.

  The weight of the porosifying agent in the suspension copolymerization is preferably 0.5 to 2.5 times, more preferably 0.8 to 2.2 times the total weight of each monomer. More preferably, it is 1.0 to 2.0 times. Regardless of whether this value is large or small, the specific surface area of the obtained porous resin beads becomes small, and the amount of synthetic reaction product due to chemical reaction decreases.

  In the present invention, conventionally known methods may be used as the method for suspension copolymerization.

  The dispersion stabilizer for suspension copolymerization is not particularly limited, and conventionally known hydrophilic protective colloid agents such as polyvinyl alcohol, polyacrylic acid, gelatin, starch, carboxymethylcellulose, calcium carbonate, magnesium carbonate, calcium phosphate, sulfuric acid Insoluble powders such as barium, calcium sulfate and bentonite are used. The amount of the dispersion stabilizer added is not particularly limited, but is preferably 0.01 to 10% by weight with respect to the weight of the water in the suspension polymerization system. When this value is small, the dispersion stability of suspension polymerization is impaired and a large amount of aggregates are formed. When this value is large, a large number of microbeads are generated.

  The polymerization initiator used in the suspension copolymerization is not particularly limited, and conventionally known dibenzoyl peroxide, dilauroyl peroxide, distearoyl peroxide, 1,1-di (t-butylperoxy) -2-methyl Cyclohexane, 1,1-di (t-hexylperoxy) -3,3,5-trimethylcyclohexane, 1,1-di (t-hexylperoxy) cyclohexane, 1,1-di (t-butylperoxy) cyclohexane, di -T-hexyl peroxide, t-butylcumyl peroxide, di-t-butyl peroxide, 1,1,3,3-tetramethylbutylperoxy-2-ethylhexanoate, t-hexylperoxy-2-ethyl Hexanoate, t-butylperoxy-2-ethylhexanoate, t-butylpero Peroxides such as xylisopropyl monocarbonate, 2,2′-azobisisobutyronitrile, 2,2′-azobis-2-methylbutyronitrile, 2,2′-azobis-2,4-dimethylvalero An azo compound such as nitrile is used. The addition amount of the polymerization initiator is not particularly limited, and those skilled in the art can select an appropriate amount.

  The reaction conditions for suspension copolymerization can be appropriately set, and examples include stirring at 60 to 90 ° C. for 30 minutes to 48 hours. The stirring speed is, for example, 100 rpm to 1000 rpm, preferably 200 rpm to 800 rpm.

  The copolymer obtained by suspension copolymerization may be appropriately subjected to treatments such as washing, drying and classification. Further, after the porous resin beads are synthesized by suspension copolymerization or the like, a group capable of binding to a carboxyl group or / and a sulfo group may be introduced by a dehydration condensation reaction, and the introduction method is as described above. .

(Solid phase carrier for nucleic acid synthesis)
In the solid phase carrier for nucleic acid synthesis of the present invention, the porous resin beads and the cleavable linker having a carboxy group are covalently bonded via a group capable of binding to the carboxy group by a dehydration condensation reaction on the surface of the porous resin bead. Become. That is, the solid phase carrier for nucleic acid synthesis of the present invention carries a cleavable linker having a carboxy group on a porous resin bead.

  A cleavable linker is a compound that serves as a starting point for a nucleic acid synthesis reaction, and is cleaved under conditions such as heating and alkalinity in order to separate the synthesized nucleic acid from a solid phase carrier for nucleic acid synthesis.

  Examples of the cleavable linker having a carboxy group of the solid phase carrier for nucleic acid synthesis of the present invention include, but are not limited to, a nucleoside succinyl linker represented by the following formula, and various modifying groups are bonded. As well as universal nucleoside linkers (for example, described in US 5681945, US 6653468, WO 2005/049621, US 2005/0182241, US 2011/0092690) Linkers that do not contain a nucleoside, such as

In the formula, the base represented by B ₁ is a nucleobase such as adenine, guanine, cytosine, thymine, uracil, and the amino group of these nucleobases is protected with a protecting group such as an acetyl group, an isobutyryl group, or a benzoyl group. May be.
DMT represents a dimethoxytrityl group, and may be a trityl group (Tr) or a monomethoxytrityl group (MMTr).
X represents a hydrogen atom, a hydroxy group which may be substituted with a protecting group, a halogen atom (eg, a fluorine atom, a chlorine atom, a bromine atom or an iodine atom).
Examples of the protective group for the hydroxy group include linear or branched alkyl groups having 1 to 6 carbon atoms, —O-methylpyrimidine group, —O-propargyl group, —O-methoxyethyl group, —O- (methylthio) ethyl. Group, -O- [2- (N-methylamino) -2-oxoethyl] group, -O-cyanoethyl group and the like.
Examples of the protective group for the hydroxy group that can be eliminated by the fluorine compound include tert-butyldimethylsilyl group (TBDMS), triisopropylsilyloxymethyl group (TOM), and 2-cyanoethoxymethyl group (CEM).

  The load of the cleavable linker of the solid phase carrier for nucleic acid synthesis of the present invention is 1 to 60 μmol / g, preferably 3 to 50 μmol / g, more preferably 5 to 45 μmol / g. When the amount of the linker supported is less than 1 μmol / g, the amount of nucleic acid that can be synthesized is too small. When the amount of the linker supported exceeds 60 μmol / g, there is no difference between the nucleic acid synthesis ability and the solid phase carrier for nucleic acid synthesis that does not contain a sulfo group.

  The amount of the cleavable linker supported on the solid phase carrier for nucleic acid synthesis can be appropriately set by adjusting the amount of the cleavable linker used for the porous resin beads.

  The method for supporting the cleavable linker of the solid phase carrier for nucleic acid synthesis of the present invention is not particularly limited. For example, the cleavable linker is bound to the carboxy group by a dehydration condensation reaction of the porous resin beads. A method of covalently bonding the obtained group by dehydration condensation reaction in the presence of a condensing agent is mentioned.

  In order to introduce a group capable of binding to a carboxy group by such a dehydration condensation reaction into the porous resin beads of the solid phase carrier for nucleic acid synthesis of the present invention, in the case of a hydroxy group, a vinyl monomer containing a hydroxy group Such as 2-hydroxyethyl acrylate, 2-hydroxyethyl methacrylate, 2-hydroxypropyl acrylate, 2-hydroxypropyl methacrylate, 4-hydroxybutyl acrylate, 4-hydroxybutyl methacrylate, hydroxystyrene, and the like. In the case of an amino group, a vinyl monomer containing an amino group, for example, aminostyrene, aminomethylstyrene, etc., is copolymerized into a monovinyl monomer and a crosslinkable vinyl monomer. Is mentioned.

  When the vinyl monomer containing a group that can be bonded to a carboxy group by a dehydration condensation reaction is a styrene monomer, the group that can be bonded to a carboxy group by a dehydration condensation reaction is placed in the para position relative to the vinyl group. Preferably, it may be in the ortho position or the meta position.

  The group that can be bonded to a carboxy group by a dehydration condensation reaction contained in the solid phase carrier for nucleic acid synthesis of the present invention is a group that can be bonded to a carboxy group by a dehydration condensation reaction by a reaction such as hydrolysis once by suspension copolymerization or the like. It may be produced by synthesizing a porous resin bead having a group that can be converted into a group, and then converting it into a group that can be bonded to a carboxy group by a dehydration condensation reaction by hydrolysis or the like.

Examples of the “group that can be converted to a group that can be bonded to a carboxy group by a dehydration condensation reaction by a reaction such as hydrolysis” include a linear, branched, or cyclic acyloxy group having 2 to 10 carbon atoms such as an acetoxy group or a benzoyloxy group. Straight chain, branched chain or cyclic acyloxy-C having 2 to 10 carbon atoms such as a straight chain, branched chain or cyclic acylamino group such as a group, acetylamino group or benzoylamino group, or acetoxymethyl group _1-20 alkyl group, straight chain, branched chain or cyclic acylamino-C _1-20 alkyl group such as acetylaminomethyl group, halo-C _1-20 alkyl group such as chloromethyl group, etc. Can be mentioned.

  In such a production process, examples of the monovinyl monomer containing a group that can be converted into a group that can be bonded to a carboxy group by the dehydration condensation reaction of the present invention include acylaminostyrene such as acetylaminostyrene; And acyloxystyrene such as ethanoyloxystyrene and benzoyloxystyrene; and haloalkylstyrene such as chloromethylstyrene.

  When the monovinyl monomer containing a group that can be converted into a group that can be bonded to a carboxy group by a dehydration condensation reaction is a styrene monomer, it is converted to a group that can be bonded to a carboxyl group by a dehydration condensation reaction. The acyloxy group, acylamino group, haloalkyl group and the like are preferably arranged in the para position with respect to the vinyl group, but may be in the ortho position or the meta position.

  Acyloxy groups and acylamino groups in porous resin beads synthesized by suspension copolymerization are usually hydrolyzed, for example, in aqueous alcohol (aqueous ethanol, aqueous methanol), reaction with inorganic bases such as sodium hydroxide. By the dehydration condensation reaction, it can be converted into a group capable of binding to a carboxy group, specifically, a hydroxy group or an amino group. A haloalkyl group can be converted into a group capable of binding to a carboxy group by a dehydration condensation reaction, specifically an aminoalkyl group or a hydroxyalkyl group, by reaction with phthalimide and hydrazine, ammonia or sodium hydroxide. .

  The dehydration condensation reaction between the porous resin beads and the linker can be performed in a solvent inert to the reaction. Such a solvent is not particularly limited as long as the reaction proceeds, but halogenated hydrocarbon solvents such as dichloromethane, 1,2-dichloroethane and chloroform, aromatic hydrocarbon solvents such as benzene, toluene and xylene, pentane, Examples thereof include aliphatic hydrocarbon solvents such as hexane, heptane, and octane, and nitrile solvents such as acetonitrile. Among them, acetonitrile is preferable.

  Examples of the condensing agent include dicyclohexylcarbodiimide (DCC), diisopropylcarbodiimide (DIC), N-ethyl-N′-3-dimethylaminopropylcarbodiimide or its hydrochloride (EDC · HCl), hexafluorophosphoric acid (benzotriazole-1- Yloxy) tripyrrolidinophosphonium (PyBop), o- (benzotriazol-1-yl) -N, N, N ′, N′-tetramethyluronium tetrafluoroborate (TBTU), 1- [bis (dimethylamino) Methylene] -5-chloro-1H-benzotriazolium-3-oxide hexafluorophosphate (HCTU), o- (benzotriazol-1-yl) -N, N, N ′, N′-tetramethyluronium hexa Examples thereof include fluorophosphate (HBTU). Of these, HBTU, HCTU, and dicyclohexylcarbodiimide (DCC) are preferable.

  The reaction temperature is not particularly limited as long as the reaction proceeds, but it is preferably -10 ° C to 50 ° C. The reaction time is 30 minutes to 70 hours.

  After the dehydration condensation reaction, capping is preferably performed on a group that can be bonded to the carboxy group by an unreacted dehydration condensation reaction. The capping can be performed by a conventionally known method, for example, preferably by acetylating a group capable of binding to a carboxy group by the unreacted dehydration condensation reaction. The acetylation reaction is not limited. For example, a solution containing acetic anhydride is added to a solid support together with a solution containing a basic catalyst (eg, 1-methylimidazole, pyridine, dimethylaminopyridine, etc.). Is preferred.

  Through the above treatment, the solid phase carrier for nucleic acid synthesis of the present invention can be obtained.

  A conventionally known method can be applied to nucleic acid synthesis using the solid phase carrier for nucleic acid synthesis of the present invention.

  For example, in the case of a solid phase carrier for nucleic acid synthesis carrying a nucleoside linker, nucleoside phosphoramidites are linked step by step so as to have a predetermined base sequence from the 5 'end of the nucleoside. This synthesis reaction can be performed using an automatic synthesizer. For example, a reaction column packed with a solid phase carrier for nucleic acid synthesis, 5′-OH deprotecting agent solution, nucleoside phosphoramidite solution, amidite activator solution, oxidizing agent solution, capping agent solution, acetonitrile as a washing solution, etc. Are sent in sequence and the reaction is repeated. Finally, the target nucleic acid can be obtained by cleaving the cleavable linker moiety by hydrolysis with an alkaline solution.

  In the nucleic acid synthesis using the solid phase carrier for nucleic acid synthesis of the present invention, in particular, a long-chain oligonucleotide, DNA or RNA having a length of 20 bases or more is reduced in the amount of the cleavable linker (1 to 60 μmol / g). Useful in synthesis.

  Hereinafter, the present invention will be described more specifically with reference to examples. The present invention is not limited by these.

Production of porous resin beads A 500 mL separable flask equipped with a cooler, a stirrer and a nitrogen introduction tube was placed in a constant temperature water bath, 2.6 g of polyvinyl alcohol (manufactured by Kuraray), sodium p-styrenesulfonate (Wako Pure Chemical Industries, Ltd.) 2.7 g and distilled water 260 g were added and stirred at 300 rpm to dissolve the polyvinyl alcohol. Styrene (made by Wako Pure Chemical) 26.4g, p-acetoxystyrene (made by Aldrich) 3.2g, divinylbenzene (content 55%, Wako Pure Chemical) 21.5g, 2-ethylhexanol (Wako Pure Chemical) Product) 60.3 g, isooctane (manufactured by Wako Pure Chemical Industries, Ltd.) 25.9 g, and benzoyl peroxide (25% water content, NOF Corporation) 1.1 g were mixed and dissolved. After stirring (500 rpm), the temperature was raised to 80 ° C. and suspension copolymerization was performed for 10 hours.

  The polymerization product was filtered and washed with distilled water and acetone (manufactured by Wako Pure Chemical Industries, Ltd.) and dispersed in acetone so that the total amount was about 1 L. The dispersion was allowed to stand until the precipitate was not disturbed even when the liquid was tilted, and then the supernatant acetone was discarded. Acetone was again added to the precipitate to make the total volume about 1 L, and the mixture was classified by repeating the operation of standing and discarding acetone. The dispersion was filtered and dried under reduced pressure to obtain porous resin beads comprising a styrene-divinylbenzene-p-acetoxystyrene-p-sodium styrenesulfonate copolymer.

  Next, in a 500 mL flask equipped with a cooler, a stirrer, and a nitrogen introduction tube, 20 g of porous resin bead powder made of the above copolymer, 80 g of ethanol, 50 g of distilled water and 2 g of sodium hydroxide were charged and stirred while stirring. The reaction was carried out at 5 ° C for 5 hours. The dispersion was neutralized with hydrochloric acid, filtered and washed with distilled water and acetone, and dried under reduced pressure to obtain a porous styrene-divinylbenzene-p-hydroxystyrene-p-sodium styrenesulfonate copolymer. Resin beads were obtained. The amount of sulfo group of the obtained beads by ion chromatography (IC) -combustion method was 0.7 μmol / g.

Loading of DMT-dT-3′-succinate on porous resin beads According to the formulation of Example 1 in Table 1, porous resin beads, DMT-dT-3′-succinate (manufactured by Beijing OM Chemicals), o- ( Benzotriazol-1-yl) -N, N, N ′, N′-tetramethyluronium hexafluorophosphate (HBTU, Novabiochem), N, N-diisopropylethylamine (DIPEA, Aldrich), acetonitrile (Wako Pure) The product was mixed, reacted at room temperature for 12 hours with stirring, filtered and washed with acetonitrile, and then dried under reduced pressure.

  To these porous resin beads, 12.5 ml of CapA (20% acetic anhydride / 80% acetonitrile), 12.5 ml of CapB (20% N-methylimidazole / 30% pyridine / 50% acetonitrile), 4-dimethylaminopyridine ( (Made by Aldrich) 125 mg and 25 ml of acetonitrile were mixed, reacted at room temperature for 12 hours with stirring, filtered and washed with acetonitrile, and then dried under reduced pressure to obtain porous resin beads carrying DMT-dT-3'-succinate. Obtained. The amount of DMT-dT-3'-succinate supported was determined by measuring the absorbance (412 nm) of the DMT group deprotected using a p-toluenesulfonic acid / acetonitrile solution. The obtained porous resin beads had a DMT-dT-3′-succinate loading of 15 μmol / g.

Evaluation of synthesis of 20mer RNA + 1mer DNA Place the porous resin beads carrying DMT-dT-3'-succinate obtained above in a synthesis column to a synthesis scale of 1μmol, and then use ABI3400 DNA / RNA synthesizer (Applied Biosystems) And a mixed sequence of 20mer RNA + 1mer DNA (5'-r (CGAGAAGCGCGAUACCAUGU) dT-3 ': SEQ ID NO: 1) was synthesized under the conditions of nucleoside phosphoramidite concentration 2 eq / synthesis scale and DMT-Off. After drying the synthesized column, the synthesized nucleic acid was cut out from the porous resin beads and the base amino group was deprotected, and the UV absorbance measurement (260 nm) of the filtrate from which the porous resin beads were separated by filter filtration was used. The OD yield of nucleic acid (equivalent to the amount of nucleic acid synthesis including abnormal sequences) was determined. The OD yield was expressed as a value per linker supported amount (OD / μmol) by dividing the absorbance by the linker supported amount (μmol). The same applies to the following examples and comparative examples. Next, after drying the filtrate, deprotection of the 2 ′ hydroxyl group of the obtained RNA was performed, and the filtrate was subjected to HPLC measurement (manufactured by Waters) to obtain Full-length% (ratio of nucleic acids having the target sequence length). Asked. The results are shown in Table 2.

  Support of DMT-dT-3′-succinate on the sulfonated porous resin beads produced in Example 1, except that the formulation of (Example 2) in Table 1 was used, and The synthesis of 20mer RNA + 1mer DNA was evaluated. The amount of DMT-dT-3′-succinate supported on the obtained porous resin beads was 48 μmol / g. The results of OD yield and Full-length% are shown in Table 2.

  The polymerization formulation was changed to p-sodium styrenesulfonate Og, styrene 47. Styrene-divinyl as in Example 1, except that Og, p-acetoxystyrene 4.7 g, divinylbenzene (content 55%) 8.3 g, 2-ethylhexanol 55.4 g, and isooctane 23.7 g were used. Porous resin beads made of a benzene-p-hydroxystyrene copolymer were obtained.

  The flask was charged with 10 g of porous resin bead powder made of the above copolymer and 70 ml of sulfuric acid (manufactured by Wako Pure Chemicals, 95% or more) and allowed to react at 25 to 28 ° C. for 30 minutes with slow stirring. The dispersion was diluted with distilled water, neutralized with an aqueous sodium hydroxide solution, filtered and washed with distilled water, acetone and methanol, and dried under reduced pressure to obtain sulfonated porous resin beads. The amount of sulfo group of the obtained beads by IC-combustion method was 11 μmol / g.

  Next, the porous resin beads produced in Example 1 were loaded with DMT-dT-3′-succinate and 20mer in the same manner as in Example 1 except that the formulation of (Example 3) in Table 1 was used. The synthesis of RNA + 1mer DNA was evaluated. The obtained porous resin beads had a DMT-dT-3′-succinate loading amount of 10 μmol / g. The results of OD yield and Full-length% are shown in Table 2.

  Support of DMT-dT-3′-succinate on the sulfonated porous resin beads produced in Example 3 in the same manner as in Example 1 except that the formulation of (Examples 4 to 6) in Table 1 was used, and The synthesis of 20mer RNA + 1mer DNA was evaluated. The obtained porous resin beads had a DMT-dT-3′-succinate loading of 56 μmol / g. The results of OD yield and Full-length% are shown in Table 2.

  The porous resin beads carrying DMT-dT-3′-succinate obtained in Example 4 were placed in a synthesis column to a synthesis scale of 1 μmol, and set in an ABI3400 DNA / RNA synthesizer (manufactured by Applied Biosystems). Thus, 20-mer DNA (5′-ATACCGATTAAGCGAAGTTT-3 ′: SEQ ID NO: 2) having a mixed sequence was synthesized under the conditions of nucleoside phosphoramidite concentration 2 eq / synthesis scale and DMT-on. After drying the synthesized column, the synthesized nucleic acid was cut out from the porous resin beads and the base amino group was deprotected, and the UV absorbance measurement (260 nm) of the filtrate from which the porous resin beads were separated by filter filtration was used. The OD yield of nucleic acid was determined. Further, the filtrate was subjected to HPLC measurement to determine Full-length%. The results are shown in Table 2.

Using the porous resin beads carrying DMT-dT-3′-succinate obtained in Example 4, 40-mer DNA (5′-ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGT-3 ′: SEQ ID NO: 3) in the same manner as in Example 4. ) Was evaluated. The results of OD yield and Full-length% are shown in Table 2.
[Comparative Example 1]

  The polymerization formulation was changed to p-sodium styrenesulfonate Og, styrene 47. Styrene-divinylbenzene in the same manner as in Example 1, except that Og, p-acetoxystyrene 4.7 g, divinylbenzene (content 55%) 8.3 g, 2-ethylhexanol 55.4 g, and isooctane 23.7 g were used. A porous resin bead made of -p-hydroxystyrene copolymer was obtained. The obtained beads had a sulfo group amount of 0 μmol / g by IC-combustion method, a median particle diameter of 94 μm by laser diffraction scattering method, and a median pore diameter of 66 nm by mercury porosimetry.

DMT-dT-3′-succinate was supported on the obtained porous resin beads in the same manner as in Example 1 except that the formulation of (Comparative Example 1) in Table 1 was used. The amount of the DMT-dT-3′-succinate supported on the obtained porous resin beads was 11 μmol / g.
In the same manner as in Example 1, synthesis evaluation of 20mer RNA + 1mer DNA was performed. The results of OD yield and full-length% of nucleic acids are shown in Table 2.
[Comparative Example 2]

  DMT-dT-3'-succinate was supported on the porous resin beads obtained in Comparative Example 1 in the same manner as in Example 1 except that the composition of (Comparative Example 2) in Table 1 was used. The amount of the DMT-dT-3′-succinate supported on the obtained porous resin beads was 42 μmol / g.

In the same manner as in Example 1, synthesis evaluation of 20mer RNA + 1mer DNA was performed. The results of OD yield and full-length% of nucleic acids are shown in Table 2.
[Comparative Example 3]

  DMT-dTM3'-succinate was supported on the porous resin beads obtained in Comparative Example 1 in the same manner as in Example 1 except that the composition of (Comparative Example 3) in Table 1 was used. The amount of the porous resin beads supported by DMT-dT-3'-succinate was 6 μmol / g.

In the same manner as in Example 1, synthesis evaluation of 20mer RNA + lmer DNA was performed. The results of OD yield and full-length% of nucleic acids are shown in Table 2.
[Comparative Example 4]

Synthesis of 20mer RNA + 1mer DNA was evaluated in the same manner as in Example 1 except that the porous resin beads carrying DMT-dT-3′-succinate obtained in Comparative Example 2 were used. The results of OD yield and full-length% of nucleic acids are shown in Table 2.
[Comparative Example 5]

Synthesis of 20mer DNA was evaluated in the same manner as in Example 5 except that the porous resin beads carrying DMT-dT-3′-succinate obtained in Comparative Example 2 were used. The results of OD yield and full-length% of nucleic acids are shown in Table 2.
[Comparative Example 6]

  Using the porous resin beads carrying DMT-dT-3′-succinate obtained in Comparative Example 2, synthesis evaluation of 40-mer DNA of mixed sequence was performed in the same manner as in Example 6. The results of OD yield and Full-length% are shown in Table 2.

  Plant (A) x (B) obtained by multiplying the OD yield of the obtained nucleic acid (A: equivalent to the amount of nucleic acid synthesized containing abnormal sequences) and Full-Length% (B: percentage of nucleic acid having the desired sequence length) Was used as an index for evaluation of nucleic acid synthesis.

  Example 1 and Comparative Example 1, Example 2 and Comparative Example 2, Example 3 and Comparative Example 3 and Example, in which DMT-dT-3′-succinate was supported in the same amount and nucleic acids having the same sequence were synthesized. When comparing (A) × (B) for Example 4 and Comparative Example 4, Example 5 and Comparative Example 5, Example 6 and Comparative Example 6, respectively, the porous resin beads having sulfo groups showed higher values. .

Claims (7)

  A porous resin bead comprising a copolymer containing a monovinyl monomer unit and a crosslinkable vinyl monomer unit and having a group capable of binding to a carboxy group by a dehydration condensation reaction on the surface, and capable of binding to the carboxy group A solid phase carrier for nucleic acid synthesis in which a cleavable linker having a carboxy group is covalently bonded via a group, wherein the porous resin beads have a sulfo group. .   The solid phase carrier for nucleic acid synthesis according to claim 1, wherein the monovinyl monomer unit comprises a styrene monomer unit.   The solid phase carrier for nucleic acid synthesis according to claim 1 or 2, wherein the content of the sulfo group relative to the weight of the porous resin beads is 0.5 to 40 µmol / g.   The solid phase carrier for nucleic acid synthesis according to any one of claims 1 to 3, wherein the loading amount of the cleavable linker with respect to the weight of the porous resin beads is 1 to 60 µmol / g.   The solid phase carrier for nucleic acid synthesis according to any one of claims 1 to 4, wherein the group capable of binding to a carboxy group includes a hydroxy group or an amino group.   A method for nucleic acid synthesis comprising obtaining an oligonucleotide by sequentially binding nucleosides or nucleotides via a cleavable linker using the solid phase carrier for nucleic acid synthesis according to any one of claims 1 to 5.   A porous resin bead comprising a copolymer containing a monovinyl monomer unit and a crosslinkable vinyl monomer unit and having a group capable of binding to a carboxy group by dehydration condensation reaction on the surface and further having a sulfo group; A carrier kit for solid phase synthesis of nucleic acid, comprising a cleavable linker having a carboxy group.