JP5939641B2 - Glucose dehydrogenase - Google Patents

Description

  The present invention relates to a glucose dehydrogenase and a production method thereof, a glucose measurement method using glucose dehydrogenase, a glucose measurement reagent composition, and a glucose measurement biosensor.

  Rapid and accurate measurement of glucose concentration in the blood is important in diagnosing diabetes. There are two methods for measuring glucose, the chemical method and the enzymatic method. The enzymatic method is superior in terms of specificity and safety. Among the enzyme methods, electrochemical biosensors are advantageous from the viewpoints of reducing the amount of specimen, reducing the measurement time, and reducing the size of the apparatus.

  Glucose oxidase is known as an enzyme that can be used in such a biosensor. However, since glucose oxidase has a problem that measurement errors occur due to dissolved oxygen in blood, several glucose dehydrogenases have been developed. Among glucose dehydrogenases, flavin-binding glucose dehydrogenase does not require the addition of coenzymes, is not affected by dissolved oxygen, and has excellent substrate specificity. It has attracted attention (Patent Documents 1 to 4).

International Publication No. 2004/058958 Pamphlet International Publication No. 2006/101239 Pamphlet International Publication 2008/001903 Pamphlet International Publication 2010/140431 Pamphlet

Mol. Plant Pathol. 5 (1), p17-27, 2004

  An object of the present invention is to provide a glucose dehydrogenase useful as an enzyme for a glucose biosensor, a glucose biosensor using the same, a method for identifying and isolating the glucose dehydrogenase gene, and producing a recombinant enzyme efficiently. Is to provide.

  Therefore, the present inventor focused on the filamentous fungus-derived glucose dehydrogenase, isolated the glucose dehydrogenase gene derived from Botryotinia fukeliana, and further introduced the recombinant vector into microorganisms such as Escherichia coli, filamentous fungi, and yeast. A recombinant glucose dehydrogenase was produced, and its enzymatic activity, amino acid sequence, availability to glucose sensor, etc. were studied. As a result, the enzyme having the amino acid sequence represented by SEQ ID NO: 51 derived from Botryotinia fukeliana was supposed to be glucose oxidase (GOD) (Non-patent Document 1), but the recombinant enzyme obtained by the present invention was The present inventors have found that it is not a glucose oxidase but a flavin-binding glucose dehydrogenase, and its amino acid sequence is shown by SEQ ID NO: 5, unlike the conventionally estimated amino acid sequence. Therefore, it has been found that the flavin-binding glucose dehydrogenase obtained by the present invention is useful as an enzyme for a glucose biosensor because it is not affected by dissolved oxygen. Furthermore, among various recombinant enzymes, glycopolypeptides obtained from transformed eukaryotic cells are more useful as biosensor enzymes than polypeptides obtained from transformed E. coli without sugar chains. As a result, the present invention was completed.

That is, the present invention provides the following [1] to [12].
[1] A biosensor for glucose measurement, characterized by using a flavin-binding glucose dehydrogenase comprising the following glycopeptide of (e) or (f):
(E) a glycopolypeptide consisting of the amino acid sequence represented by SEQ ID NO: 5,
(F) A glycopolypeptide comprising an amino acid sequence in which one to several amino acids are substituted, deleted or added in the amino acid sequence represented by SEQ ID NO: 5 and having glucose dehydrogenase activity.
[2] Glucose measuring reagent composition containing a flavin-binding glucose dehydrogenase comprising the following glycopolypeptide (e) or (f):
(E) a glycopolypeptide consisting of the amino acid sequence represented by SEQ ID NO: 5,
(F) A glycopolypeptide comprising an amino acid sequence in which one to several amino acids are substituted, deleted or added in the amino acid sequence represented by SEQ ID NO: 5 and having glucose dehydrogenase activity.
[3] A method for measuring glucose comprising using a flavin-binding glucose dehydrogenase comprising the following glycopolypeptide (e) or (f):
(E) a glycopolypeptide consisting of the amino acid sequence represented by SEQ ID NO: 5,
(F) A glycopolypeptide comprising an amino acid sequence in which one to several amino acids are substituted, deleted or added in the amino acid sequence represented by SEQ ID NO: 5 and having glucose dehydrogenase activity.
[4] Flavin-binding glucose dehydrogenase comprising the following glycopolypeptide (e) or (f):
(E) a glycopolypeptide consisting of the amino acid sequence represented by SEQ ID NO: 5,
(F) A glycopolypeptide comprising an amino acid sequence in which one to several amino acids are substituted, deleted or added in the amino acid sequence represented by SEQ ID NO: 5 and having glucose dehydrogenase activity.
[5] The flavin-binding glucose dehydrogenase according to [4], which is expressed in a transformed eukaryotic cell using a recombinant glucose dehydrogenase gene derived from Botryotinia fukeliana.
[6] The following polynucleotide (a) or (b):
(A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 4 or SEQ ID NO: 6,
(B) a polynucleotide that hybridizes with a polynucleotide comprising a base sequence complementary to the polynucleotide comprising the base sequence (a) under a stringent condition and encodes a polypeptide having glucose dehydrogenase activity.
[7] A polynucleotide encoding the following polypeptide (c) or (d):
(C) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 5,
(D) A polypeptide comprising an amino acid sequence in which one to several amino acids are substituted, deleted or added in the amino acid sequence (c) and having glucose dehydrogenase activity.
[8] A polynucleotide having a base sequence encoding a signal sequence upstream of the polynucleotide according to [6] or [7].
[9] The polynucleotide according to [8], wherein the signal sequence is a signal sequence of a eukaryotic cell-derived protein.
[10] A recombinant vector comprising the polynucleotide according to any one of [6] to [9]. [11] A transformed eukaryotic cell produced by using the recombinant vector according to [10].
[12] A method for producing glucose dehydrogenase, comprising culturing the transformed eukaryotic cell according to [11], and collecting glucose dehydrogenase from the obtained culture.

  The glycopolypeptide of the present invention is a flavin-binding glucose dehydrogenase and is useful for a glucose biosensor that can accurately measure glucose without being affected by dissolved oxygen. In addition, by using the polynucleotide of the present invention, it is possible to produce a glucose dehydrogenase having excellent properties such as excellent substrate recognizability to glucose and low activity against maltose in a homogeneous and large-scale production. .

It is a figure which shows the glucose level measurement result by this invention glucose dehydrogenase.

In the present invention, “glucose dehydrogenase” refers to catalyzing the reaction of dehydrogenating (oxidizing) the hydroxyl group at the 1-position of glucose in the presence of an electron acceptor, and acting on maltose with respect to its action on glucose. It means a soluble protein having a property of 5% or less, and the enzyme is characterized by the following properties.
1) Flavin adenine dinucleotide (FAD) as a coenzyme,
2) Do not use oxygen as an electron acceptor,
3) At a substrate concentration of 333 mM, when the action on glucose is 100%, the action on maltose is 5% or less, and 4) the molecular weight of the polypeptide of the enzyme protein is 60-70 kDa.
The molecular weight of the polypeptide of the enzyme protein is the molecular weight when the glycosylated recombinant enzyme expressed in a eukaryotic cell is subjected to sugar chain cleavage treatment and subjected to SDS-polyacrylamide electrophoresis. The recombinant enzyme expressed in eukaryotic cells can have a molecular weight of about 80 to 200 kDa because the amount of glycosylation varies depending on the host, culture conditions, and the like.
In the present invention, “glycopolypeptide” refers to a polypeptide to which a sugar chain is added.

The polynucleotide of the present invention is the following polynucleotide (a) or (b).
(A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 4 or SEQ ID NO: 6,
(B) a polynucleotide that hybridizes with a polynucleotide comprising a base sequence complementary to the polynucleotide comprising the base sequence (a) under a stringent condition and encodes a polypeptide having glucose dehydrogenase activity.

Furthermore, the polynucleotide of the present invention is a polynucleotide encoding the following polypeptide (c) or (d).
(C) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 5,
(D) A polypeptide comprising an amino acid sequence in which one to several amino acids are substituted, deleted or added in the amino acid sequence (c) and having glucose dehydrogenase activity.

  Examples of the polynucleotide (b) or polypeptide (d) include those having a base sequence or amino acid sequence having at least 80% homology with the base sequence (a) or amino acid sequence (c). Here, the base sequence or amino acid sequence having at least 80% homology shows at least 80% identity over the entire length of the reference sequence to be compared, preferably at least 85%, more preferably at least 90%. %, More preferably each sequence having at least 95% identity. Such sequence identity percentage can be calculated using publicly available or commercially available software with an algorithm that compares the reference sequence as a query sequence. As an example, BLAST, FASTA, or GENETYX (manufactured by Software Development Co., Ltd.) can be used, and these can be used with default parameters.

  In the present invention, specific conditions for “hybridization under stringent conditions” for hybridization between polynucleotides include, for example, 50% formamide, 5 × SSC (150 mM sodium chloride, 15 mM trisodium citrate, After incubation at 42 ° C. with 10 mM sodium phosphate, 1 mM ethylenediaminetetraacetic acid, pH 7.2), 5 × Denhardt's solution, 0.1% SDS, 10% dextran sulfate and 100 μg / mL denatured salmon sperm DNA, the filter Can be exemplified by washing at 42 ° C. in 0.2 × SSC.

  In the present invention, the term “polynucleotide” refers to a nucleoside phosphate ester (ATP (adenosine triphosphate), GTP (guanosine triphosphate), CTP (purine or pyrimidine bonded to a sugar). Cytidine triphosphate), UTP (uridine triphosphate); or dATP (deoxyadenosine triphosphate), dGTP (deoxyguanosine triphosphate), dCTP (deoxycytidine triphosphate), dTTP (deoxythymidine triphosphate) ) Refers to a molecule in which 100 or more are bound, specifically, chromosomal DNA encoding glucose dehydrogenase, mRNA transcribed from chromosomal DNA, cDNA synthesized from mRNA, and polynucleotide amplified by PCR using these as templates including. “Oligonucleotide” refers to a molecule in which 2-99 nucleotides are linked. “Polypeptide” means a molecule composed of 30 or more amino acid residues joined together by amide bonds (peptide bonds) or unnatural residue linkages. “Glycopolypeptide” means a molecule in which a sugar chain is added to the polypeptide.

  The most specific embodiment of the polynucleotide (gene) of the present invention is a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 6. A polynucleotide which is a chromosomal DNA represented by SEQ ID NO: 6 is prepared by preparing a chromosomal DNA library from, for example, Botryotinia fukeliana strain, and the amino acid sequence of Aspergillus terreus-derived glucose dehydrogenase described in Patent Document 2 And a plurality of oligonucleotide probes prepared based on the amino acid sequence of glucose dehydrogenase derived from Aspergillus oryzae or the amino acid sequence of other glucose dehydrogenases, by the method known to those skilled in the art. It can be obtained by screening the rally.

  The labeling of the probe can be performed by any method known to those skilled in the art, for example, the radioisotope (RI) method or the non-RI method, but it is preferable to use the non-RI method. Examples of the non-RI method include a fluorescence labeling method, a biotin labeling method, a chemiluminescence method, and the like, but it is preferable to use a fluorescence labeling method. As the fluorescent substance, those capable of binding to the base moiety of the oligonucleotide can be appropriately selected and used. However, cyanine dyes (for example, Cy Dye ™ series Cy3, Cy5, etc.), rhodamine 6G reagent, N-acetoxy-N2 -Acetylaminofluorene (AAF), AAIF (iodine derivative of AAF) and the like can be used.

  Alternatively, a polynucleotide that is a cDNA represented by SEQ ID NO: 4 is obtained, for example, after obtaining a target polynucleotide containing an intron from chromosomal DNA, as specifically described in the Examples of the present specification, In addition to being obtained by deleting introns by PCR, for example, it can be obtained by various PCR methods known to those skilled in the art using a set of oligonucleotide primers (probes) prepared above using a cDNA library as a template. Alternatively, it can also be obtained by RT-PCR method using total RNA or mRNA extracted from Botryotinia fukeliana strain as a template. It should also be noted that the final concentration of primers used in PCR is from about 0.1 to about 1 μM. In the primer design, commercially available software such as Oligo ™ (National Bioscience Inc. (USA)), GENETYX (Software Development Co., Ltd.) and the like can also be used.

  Such an oligonucleotide probe or oligonucleotide primer set can also be prepared, for example, by cleaving cDNA, which is a polynucleotide of the present invention, with an appropriate restriction enzyme.

  Furthermore, the polynucleotide of the present invention is a polynucleotide having a base sequence encoding a signal sequence upstream of the polynucleotide described in [6] or [7]. The base sequence encoding the signal sequence may be any base sequence encoding a signal sequence capable of efficiently secreting a glycopolypeptide having glucose dehydrogenase activity, for example, a base sequence encoding a signal sequence of a eukaryotic cell-derived protein. The base sequence encoding the signal sequence of the protein derived from the genus Botriotinia or Aspergillus is more preferable. Further examples include a base sequence encoding a signal sequence of a protein derived from the same gene as the host transformed with the polynucleotide, and a base sequence encoding a signal sequence of glucose dehydrogenase. The signal sequence encoded by the base sequence is, for example, a comparison between the Aspergillus terreus-derived glucose dehydrogenase sequence described in Patent Document 2 and the amino acid sequence of the secreted protein, or a signal sequence prediction site (Signal p: http: / /www.cbs.dtu.dk/services/SignalP/) and can be deduced from the amino acid sequence of the secreted protein, and further may be a signal sequence in which one to several amino acids are substituted, deleted or added. As specific examples, the sequences described in SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12 and SEQ ID NO: 14 can be exemplified. These sequences or sequences obtained by deleting several sequences of these sequences may be combined as appropriate.

  Specific examples of the polynucleotide having the base sequence encoding the signal sequence include SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, and sequence. Although the polynucleotide of number 48 can be illustrated, the site | part which codes the protein which has glucose dehydrogenase activity may contain the intron.

  In addition, the polynucleotides (a) to (d) can be prepared, for example, by modifying the above-mentioned glucose dehydrogenase cDNA derived from Botryotinia fukeliana by a known mutation introduction method, mutation introduction PCR method or the like. it can. Furthermore, it can be obtained by a probe hybridization method using an oligonucleotide prepared based on the nucleotide sequence information of SEQ ID NO: 1 from a chromosomal DNA of a Botryotinia fukeliana strain other than the NBRC7185 strain or a cDNA library thereof. In the hybridization, the above-mentioned polynucleotide can be obtained by variously changing the stringent conditions. Stringent conditions are defined by the salt concentration in the hybridization and washing steps, the concentration of organic solvent (formaldehyde, etc.), temperature conditions, and the like. For example, as disclosed in US Pat. No. 6,100,037, etc. Various conditions well known to those skilled in the art can be employed.

  Furthermore, literature (for example, Carruthers (1982) Cold Spring Harbor Symp. Quant. Biol. 47: 411-418; Adams (1983) J. Am. Chem. Soc. 105: 661; Belousov (1997) Nucleic Acid Res. 25: 3440-3444; Frenkel (1995) Free Radic. Biol. Med. 19: 373-380; Blommers (1994) Biochemistry 33: 7886-7896; Narang (1979) Meth. Enzymol. 68:90; Brown (1979) Meth. Enzymol. 68: 109; Beaucage (1981) Tetra. Lett. 22: 1859; US Pat. No. 4,458,066) and synthesizing the polynucleotide of the present invention in vitro by well-known chemical synthesis techniques. Can do.

  The recombinant vector of the present invention is a cloning vector or an expression vector, and an appropriate one is used according to the type of polynucleotide as an insert, the purpose of use, and the like. For example, in the case of producing glucose dehydrogenase using cDNA or its ORF region as an insert, expression vectors for in vitro transcription, filamentous fungi such as yeast and mold, eukaryotic cells such as insect cells and mammalian cells are used. Expression vectors suitable for each can also be used.

  As transformed cells of the present invention, eukaryotic cells such as yeasts, molds, insect cells and mammalian cells can be used. These transformed cells can be prepared by introducing a recombinant vector into cells by a known method such as electroporation, calcium phosphate method, liposome method, DEAE dextran method. Specific examples of the recombinant vector and the transformed cell include the recombinant vector shown in the Examples below, the mold transformed with this vector, and the transformed yeast.

  When glucose dehydrogenase is expressed in eukaryotic cells for production, the polynucleotide is inserted into an eukaryotic expression vector having a promoter, a splicing region, a poly (A) addition site, etc. Once prepared and introduced into eukaryotic cells, glucose dehydrogenase can be produced in eukaryotic cells. It can be maintained in the cell in a state like a plasmid, or it can be maintained in a chromosome. Examples of expression vectors include pKA1, pCDM8, pSVK3, pSVL, pBK-CMV, pBK-RSV, EBV vector, pRS, and pYE82. In addition, if pIND / V5-His, pFLAG-CMV-2, pEGFP-N1, pEGFP-C1, etc. are used as expression vectors, glucose dehydrogenase poly- hydrase can be used as a fusion protein to which various tags such as His tag, FLAG tag, GFP are added. Peptides can also be expressed. As eukaryotic cells, cultured mammalian cells such as monkey kidney cell COS-7, Chinese hamster ovary cell CHO, budding yeast, fission yeast, mold, silkworm cell, Xenopus egg cell, etc. are generally used, but glucose dehydrogenase is used. Any eukaryotic cell may be used as long as it can express the expression. In order to introduce an expression vector into a eukaryotic cell, a known method such as electroporation, calcium phosphate method, liposome method, DEAE dextran method can be used. The inserted gene for production when expressed in eukaryotic cells may or may not contain introns. For example, SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, sequence A gene sequence containing the signal sequence described in SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, or SEQ ID NO: 48 is preferred, but when there is a secretory signal sequence on the vector side, the gene sequence described in SEQ ID NO: 4 or SEQ ID NO: 6 In order to produce a recombinant protein in the microbial cell, a polynucleotide in which a start codon ATG is added to the gene sequence described in SEQ ID NO: 4 or 6 may be inserted. Secretory production is preferred. In eukaryotic cells, the expression efficiency of the recombinant glucose dehydrogenase of the present invention is high, preferably at least 20 U per mL of culture medium, more preferably at least 50 U per mL of culture medium, more preferably at least 80 U per mL of culture medium, particularly preferably Is at least 100 U per mL of culture and most preferably at least 120 U per mL of culture. Furthermore, in eukaryotic cells, there is no formation of inclusion bodies that cause problems during recombinant production in prokaryotic cells, and the recombinant enzyme can be stably and highly expressed. In addition, since the specific activity of the crude enzyme obtained from the culture is high and there are few contaminating proteins, the purification process is simple, the purification cost is reduced, and the purified enzyme can be obtained in high yield.

  In order to isolate and purify the target protein from the culture (bacteria or culture solution containing the enzyme secreted outside the cell, medium composition, etc.) after expressing glucose dehydrogenase in eukaryotic cells A known separation operation can be performed in combination. For example, treatment with denaturing agents and surfactants such as urea, heat treatment, pH treatment, ultrasonic treatment, enzyme digestion, salting out and solvent precipitation, dialysis, centrifugation, ultrafiltration, gel filtration, SDS-PAGE, etc. Electrophoresis, ion exchange chromatography, hydrophobic chromatography, reverse phase chromatography, affinity chromatography (including methods using tag sequences, polyclonal antibodies specific to glucose dehydrogenase, and methods using monoclonal antibodies) , Etc.

  In addition, glucose dehydrogenase can be obtained by a recombinant DNA technique using the polynucleotide (cDNA or its translation region) of the present invention. For example, it is possible to prepare glucose dehydrogenase in vitro by preparing RNA from a vector having the polynucleotide by in vitro transcription, and performing in vitro translation using this as a template. In addition, if a polynucleotide is recombined into an appropriate expression vector by a known method, a large amount of glucose dehydrogenase encoded by the polynucleotide can be expressed in eukaryotic cells such as yeast, mold, insect cells, and mammalian cells. I can do things. Further, a polynucleotide having the same amino acid sequence corresponding to the host but having optimized codon usage may be introduced.

  In the case of producing glucose dehydrogenase by in vitro expression, a recombinant vector is prepared by inserting the polynucleotide into a vector having a promoter to which RNA polymerase can bind, and this vector is converted into RNA corresponding to the promoter. When added to an in vitro translation system such as a rabbit reticulocyte lysate containing a polymerase or a wheat germ extract, glucose dehydrogenase can be produced in vitro. Examples of promoters to which RNA polymerase can bind include T3, T7, SP6 and the like. Examples of vectors containing these promoters include pKA1, pCDM8, pT3 / T718, pT7 / 319, and pBluescript II.

The glucose dehydrogenase of the present invention is a glucose dehydrogenase comprising the following sugar polypeptide (e) or (f).
(E) a glycopolypeptide consisting of the amino acid sequence represented by SEQ ID NO: 5,
(F) A glycopolypeptide comprising an amino acid sequence in which one to several amino acids are substituted, deleted or added in the amino acid sequence (e) and having glucose dehydrogenase activity.

The most specific embodiment of the glucose dehydrogenase of the present invention is a glycopolypeptide consisting of the amino acid sequence represented by SEQ ID NO: 5. As long as it has glucose dehydrogenase activity, it may be a glycopolypeptide consisting of an amino acid sequence in which one to several amino acids are substituted, deleted or added in the amino acid sequence shown in SEQ ID NO: 5, Preferably at most 100, more preferably at most 80, even more preferably at most 60, particularly preferably at most 40.
As an example, glucose dehydrogenase having a glycopolypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47 or SEQ ID NO: 49 Can be illustrated.
Further, the glucose dehydrogenase of the present invention has at least 80% homology with the amino acid sequence of SEQ ID NO: 5, more preferably 85% or more homology, more preferably 90% or more homology, more preferably 95 A glycopolypeptide comprising an amino acid sequence having a homology of at least% and having glucose dehydrogenase activity is included.

  Since the glucose dehydrogenase of the present invention is an enzyme that catalyzes the reaction of dehydrogenating glucose in the presence of an electron acceptor, it is not particularly limited as long as the change due to this reaction can be used. For example, it can be used in the medical field and clinical field such as measuring and measuring reagents in glucose-containing samples, and used as a reagent for erasing, and is capable of producing substances using flavin-binding glucose dehydrogenase. Can also be used.

  The glucose dehydrogenase of the present invention can be used in a glucose measurement reagent composition. The measurement reagent composition of the present invention comprises a glucose dehydrogenase comprising the glycopolypeptide of the present invention, bovine serum albumin (BSA) or ovalbumin, a saccharide or sugar alcohol having no activity with the enzyme, a carboxyl group-containing compound Other appropriate components known to those skilled in the art, such as a heat stabilizer selected from the group consisting of alkaline earth metal compounds, ammonium salts, sulfates or proteins, or buffers, etc. The thermal stability and storage stability of can be improved. Furthermore, the measurement reagent composition can contain a known substance that suppresses the influence of a contaminant substance that affects the measurement present in the test sample. In addition, the composition may contain a buffer so that the enzyme has a pH at which the enzyme is likely to act when dissolved.

  The glucose dehydrogenase of the present invention can be used in a biosensor as a glucose sensor for measuring the glucose concentration in a sample solution. The biosensor of the present invention may be any sensor that uses glucose dehydrogenase comprising the glycopolypeptide of the present invention as an enzyme in the reaction layer. For example, the biosensor is manufactured by forming an electrode system on an insulating substrate using a method such as screen printing or vapor deposition, and further including a measurement reagent containing an oxidoreductase and an electron acceptor. When a sample solution containing a substrate is brought into contact with the measurement reagent of this biosensor, the measurement reagent is dissolved and the enzyme reacts with the substrate, and the electron acceptor is reduced accordingly. After completion of the enzymatic reaction, the reduced electron acceptor is oxidized electrochemically. At this time, the biosensor can measure the substrate concentration in the sample solution from the obtained oxidation current value. In addition, it is possible to construct a biosensor that detects color intensity or pH change. With these biosensors, various substances can be measured by selecting an enzyme that uses the substance to be measured as a substrate.

  As the electron acceptor of the biosensor, a substance excellent in electron transfer capability can be used. Substances that excel in electron transfer are chemical substances generally called “electron mediators,” “mediators,” or “redox mediators,” and protein-type electron mediators. For example, an electron carrier or a redox mediator listed in JP-T-2002-526759 may be used.

  Furthermore, the glucose dehydrogenase of the present invention can be used in a biobattery. The biobattery according to the present invention includes an anode electrode that performs an oxidation reaction and a cathode electrode that performs a reduction reaction, and includes an electrolyte layer that separates the anode and the cathode as necessary. An enzyme electrode containing the above-described electron mediator and the enzyme of the present invention is used as an anode electrode, and electrons generated by oxidizing the substrate are taken out to the electrode and protons are generated. On the other hand, an enzyme generally used for the cathode electrode may be used on the cathode side, for example, by using laccase, ascorbate oxidase or bilirubin oxidase, and reacting protons generated on the anode side with oxygen. Generate water. As the electrode, an electrode generally used for a bio battery such as carbon, gold, or platinum can be used.

[Enzyme activity measurement method]
Each solution was mixed according to the following procedure, the absorbance was measured, and the GLD activity was examined.
1.00 mL of 100 mM potassium phosphate buffer (pH 6.0), 1.00 mL of 1M D-glucose solution, 0.61 mL of ultrapure water, 0.14 mL of 3 mM 2,6-dichlorophenolindophenol (hereinafter referred to as DCIP) and 3 mM 0.20 mL of 1-methoxy-5-methylphenadium methyl sulfate (hereinafter referred to as 1-m-PMS) was mixed and incubated at 37 ° C. for 10 minutes, and then 0.05 mL of an enzyme sample was added to start the reaction. The amount of decrease per minute (ΔA600) in absorbance at 600 nm accompanying the progress of the enzyme reaction was measured for 5 minutes from the start of the reaction, and the GLD activity was calculated from the linear portion according to Equation 1. At this time, the GLD activity was defined as 1 U for the amount of enzyme that reduces 1 μmol of DCIP per minute at 37 ° C. and pH 6.0. In the formula, 3.0 is the volume of the reaction reagent + enzyme solution (mL), 10.8 is the molar extinction coefficient (mM ⁻¹ cm ⁻¹ ) of DCIP at pH 6.0, 1.0 is the optical path of the cell Length (cm), 0.05 is the volume of the enzyme solution (mL), ΔA600 blank is the decrease in absorbance per minute at 600 nm when the reaction is started by adding the solution used for enzyme dilution instead of the enzyme solution. The amount, df, represents the dilution factor.

  In measuring the protein concentration of the enzyme, the enzyme is preferably diluted as appropriate so that the final concentration is preferably 0.2 to 0.9 mg / mL. The protein concentration in the present invention is determined by using bovine serum albumin (BSA, manufactured by Wako Pure Chemical Industries, Ltd.) according to the instruction manual using Bio-Rad Protein Assay, which is a protein concentration measurement kit that can be purchased from Nippon Bio-Rad Co., Ltd. , For biochemistry) can be calculated from a calibration curve created as a standard substance.

  Various techniques used for carrying out the present invention can be easily and surely implemented by those skilled in the art based on known literatures and the like, except for the technique that clearly shows the source. For example, genetic engineering and molecular biology techniques are described in Sambrook and Maniatis, in Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1989; Ausubel, FM et al., Current Protocols in Molecular Biology, John Wiley & It can be carried out based on the method described in Sons, New York, NY, 1995 or the like, the method described in the literature cited therein, or a method or modification method substantially similar thereto. Furthermore, the terms in the present invention are basically based on the IUPAC-IUB Commission on Biochemical Nomenclature, or based on the meanings of terms conventionally used in the field.

Hereinafter, the present invention will be described in more detail with reference to examples. The technical scope of the present invention is not limited by these descriptions. Moreover, the content described in the literature referred in this specification comprises the content disclosed by this specification as a part of this specification.
[Example 1]
(Confirmation of glucose dehydrogenase (BfGLD) activity derived from Botryotinia fukeliana)
Potato dextrose broth (manufactured by Difco) 100 mL of 2.4% medium was placed in a 500 mL Sakaguchi flask, capped, and autoclaved at 121 ° C. for 20 minutes. The cooled liquid medium was inoculated with Botryotinia fukeliana strain NBRC7185, and the cells were cultured at 25 ° C. for 216 hours under aeration and agitation. As a result, 0.21 U / mL of the culture was added to the culture supernatant. / ML glucose dehydrogenase activity was confirmed. Glucose oxidase (GOD) activity was not detected.
GOD activity was measured by the following method. 1.00 mL of 100 mM potassium phosphate buffer (pH 7.0), 0.10 mL of 25 mM 4-aminoantipyrine, 0.10 mL of 420 mM phenol, 0.10 mL of peroxidase (100 units / mL), 0.65 mL of ultrapure water, D-glucose After mixing 1.00 mL and incubating at 37 ° C. for 5 minutes, 0.05 mL of enzyme sample was added to start the reaction. The amount of increase per minute (ΔA500) in absorbance at 500 nm accompanying the progress of the enzyme reaction from the start of the reaction was measured, and the GOD activity was calculated according to Equation 2. At this time, the GOD activity was defined as 1 U for the amount of enzyme that produces 1 μmol of hydrogen peroxide per minute at 37 ° C. and pH 7.0. In the formula, 3.0 is the amount of the reaction reagent + enzyme solution (mL), 10.66 is the molar extinction coefficient (mM ⁻¹ cm ⁻¹ ) under the present measurement conditions, and 0.5 is 1 mol of peroxide The amount of quinone dye produced relative to the amount of hydrogen produced, 1.0 is the optical path length of the cell (cm), 0.05 is the amount of the enzyme solution (mL), and ΔA500 blank is the amount of the enzyme solution diluted with the enzyme solution. Instead, the amount of increase in absorbance at 500 nm per minute when the reaction is started by addition, df represents the dilution factor.

[Example 2]
(Expression of glucose dehydrogenase (BfGLD) derived from recombinant Botryotinia fukeliana by eukaryotic cells)
(1) Cell culture Glucose (manufactured by Nacalai) 1% (W / V), defatted soybean (manufactured by Showa Sangyo Co., Ltd.) 2% (W / V), corn steep liquor (manufactured by Sanei Sugar Chemical Co., Ltd.) 0.5% ( W / V), magnesium sulfate heptahydrate (manufactured by Nacalai Co., Ltd.) 0.1% (W / V) and water were adjusted to pH 6.0, and 100 mL was placed in a 500 mL Sakaguchi flask. Autoclaved at 20 ° C. for 20 minutes. The cooled liquid medium was inoculated with Botryotinia fukeliana NBRC7185 strain and cultured with shaking at 25 ° C. for 90 hours, and then wet cells were collected by suction filtration.

(2) Extraction of chromosomal DNA Of the microbial cells obtained in (1), 0.25 g of wet microbial cells were frozen with liquid nitrogen, crushed, and chromosomal DNA was extracted by a conventional method.

(3) Acquisition of BfGLD gene The BfGLD gene was PCR amplified using the DNA acquired in (2) as a template. Primers analyze a common sequence from a plurality of GLD gene sequences that have already been elucidated by the present inventors, design a degenerate primer based on the common sequence, obtain a gene fragment, and finally the following primers : Using the primer1F (SEQ ID NO: 15) and primer2R (SEQ ID NO: 16), a DNA fragment of about 1.8 kbp containing the entire length of the target GLD gene (including intron) was obtained. primer1F: (TGACCAATTCCGCAGCTCGTCAAA) ATGTATCGTTTACTCTCTACATTTG (SEQ ID NO: 15)
(In parentheses: transcription enhancer)
primer2R: ((GCTATCCTGTTACGCTTCTAGA)) GCATGC CTAAATGTCCTCCTTGATCAAATCT (SEQ ID NO: 16)
(In parentheses: pSENS vector sequence, underlined: restriction enzyme site (SphI))
primer3F: ((CCGTCCTCCAAGTTA)) GTCGAC (TGACCAATTCCGCAGCTCGTCAAA) (SEQ ID NO: 17)
(In parentheses: pSENS vector sequence, underlined: restriction enzyme site (SalI), parentheses: transcription enhancing factor)

(4) Preparation of vector containing BfGLD gene Aspergillus oryzae derived from known literature 1 (Aspergillus heterologous gene expression system, Toshiki Mineki, Chemistry and Biology, 38, 12, 831-838, 2000) Using an improved amylase promoter, the GLD gene amplified using the above primer: primer3F (SEQ ID NO: 17) and the above primer: primer2R is bound downstream of the DNA fragment obtained in (3) as a template. Thus, a plasmid vector capable of expressing the gene was prepared. This expression plasmid vector is introduced into E. coli strain JM109 for transformation, and the resulting transformant is cultured. From the collected cells, Illustra plasmid-prep MINI Flow Kit (manufactured by GE Healthcare) is obtained. Used to extract the plasmid. As a result of sequence analysis of the insert in the plasmid, a BfGLD gene (SEQ ID NO: 3) containing an intron could be confirmed.

(5) Acquisition of transformant Using the plasmid extracted in (4), known documents 2 (Biosci. Biotech. Biochem., 61 (8), 1367-1369, 1997) and 3 (gene manipulation of koji mold for sake) Recombinant mold (Aspergillus oryzae) producing BfGLD was prepared according to the method described in Technology, Katsuya Gomi, Brewery, 494-502, 2000), and the obtained recombinant strain was purified with Czapek-Dox solid medium . As a host to be used, Aspergillus oryzae NS4 strain was used. This strain is bred at a brewery laboratory in 1997 as disclosed in known document 2, and is used for analysis of transcription factors, breeding of high-producing strains of various enzymes, etc. Is available.

(6) Confirmation of recombinant mold-derived BfGLD Paindex 2% (manufactured by Matsutani Chemical Co., Ltd.) (w / v), tryptone 1% (manufactured by BD) (w / v), 0.5% potassium dihydrogen phosphate ( 10 mL of a liquid culture medium consisting of Nacalai Tesque) (w / v), magnesium sulfate heptahydrate 0.05% (w / v) (Nacalai Tesque) and water is placed in a thick test tube (22 mm × 200 mm). And autoclaving at 121 ° C. for 20 minutes. Into this cooled liquid medium, the transformant obtained in (5) was inoculated, and cultured with shaking at 30 ° C. for 3 to 4 days. After completion of the culture, the supernatant was collected by centrifugation and used as a sample with recombinant BfGLD sugar chains (Sc (+) BfGLD).

  When the glucose dehydrogenase activity (U / mL) of recombinant Sc (+) BfGLD was measured according to the enzyme activity measurement method described above, it was 133 U / mL on the third day and 98 U / mL on the fourth day per 1 mL of the culture solution. The glucose dehydrogenase activity was confirmed. Glucose oxidase activity could not be confirmed. In addition, the recombinant BfGLD of the present invention had a reactivity with respect to maltose of 1.3% when the activity against D-glucose was 100% at a substrate concentration of 333 mM.

(6) Enzyme purification D-glucose 1% (w / v), soy flour 2% (w / v), corn steep liquor 0.5% (w / v), magnesium sulfate heptahydrate 0.1% 50 mL of a liquid medium (pH 7.0) composed of (w / v) and water was placed in a 200 mL Erlenmeyer flask and autoclaved at 121 ° C. for 20 minutes. Into this cooled liquid medium, the transformant obtained in (5) was inoculated, and cultured with shaking at 25 ° C. for 3 days to obtain a seed culture solution. 3.5 L of a medium having the same medium composition as above and added with an antifoaming agent was placed in a 5 L jar fermenter and autoclaved at 121 ° C. for 20 minutes. 50 mL of the seed culture solution was inoculated into this cooled liquid medium, and cultured at 30 ° C., 300 rpm, 1 v / v / m for 7 days. After completion of the culture, the culture solution is filtered through a filter cloth, and the collected filtrate is centrifuged to collect the supernatant, and further filtered through a membrane filter (10 μm, manufactured by Advantech) to collect the culture supernatant, and the molecular weight cutoff The resultant was concentrated with an 8,000 ultrafiltration membrane (Millipore) to obtain a crude enzyme solution. The specific activity of the crude enzyme solution was 1,170 U / mg.

The crude enzyme solution was adjusted to a 50% saturated ammonium sulfate solution (pH 5.0), allowed to stand overnight at 4 ° C., and then centrifuged to collect the supernatant.
The supernatant was passed through a TOYOPEARL Butyl-650C (manufactured by Tosoh Corp.) column (φ7.5 cm × 17.7 cm) pre-equilibrated with 50 mM sodium acetate buffer (pH 5.0) containing 50% saturated ammonium sulfate. Enzyme was adsorbed. The column was washed with the same buffer, and then the enzyme was eluted by a gradient elution method from the buffer to 50 mM sodium acetate buffer (pH 5.0) to collect the active fraction. The collected active fraction is concentrated with an ultrafiltration membrane, desalted, equilibrated with 1 mM sodium acetate buffer (pH 5.0), and DEAE Cellufine A-500m (Chisso) pre-equilibrated with the same buffer. The enzyme was adsorbed by passing through a column (φ6.0 cm × 21.9 cm). After washing the column with the same buffer, the enzyme was eluted by a gradient elution method from the buffer to a 200 mM sodium acetate buffer (pH 5.0) to collect the active fraction. The collected active fraction was concentrated with an ultrafiltration membrane having a fractional molecular weight of 8,000, and then replaced with water to obtain a purified enzyme of a sample with a recombinant BfGLD sugar chain (Sc (+) BfGLD). The specific activity of the purified enzyme was 2,100 U / mg.
Furthermore, the recombinant BfGLD before and after the sugar chain cleavage was subjected to SDS-polyacrylamide electrophoresis for confirmation. Specifically, 5 μL of recombinant Sc (+) BfGLD and 5 μL of 0.4 M potassium phosphate buffer (pH 6.0) containing 1% SDS and 2% β-mercaptoethanol were mixed and heat-treated at 100 ° C. for 3 minutes. . As the sugar chain cleavage treatment, 10 μL (50 mU) of endoglycosidase H (Roche) was added to the heat-treated sample and reacted at 37 ° C. for 18 hours. Samples before and after sugar chain cleavage treatment were subjected to SDS-polyacrylamide electrophoresis, and molecular weight was determined from molecular weight markers. Recombinant BfGLD with 90-100 kDa enzyme before sugar chain cleavage and 60-70 kDa enzyme after sugar chain cleavage. Was confirmed.

[Reference Example 1]
(Expression of Recombinant Botryotinia fukeliana-derived glucose dehydrogenase (BfGLD) by prokaryotic cells)
(1) Cloning of BfGLD gene The BfGLD gene was PCR amplified using the plasmid extracted in (2) of Example 2 as a template. In order to obtain a BfGLD (16AA (−) BfGLD) gene that does not include a gene sequence encoding a predicted signal sequence, a gene encoding the C-terminus from the predicted N-terminus of wild-type BfGLD can be amplified as follows: primer4F_BfGLD_Sig (−) / Sac PCR was performed using a primer set of (SEQ ID NO: 18) and primer5R_BfGLD / Hind (SEQ ID NO: 19). Obtaining a polynucleotide that does not contain the gene sequence that encodes the expected signal sequence can be obtained when the recombinant protein is expressed in E. coli using a foreign gene that includes the gene sequence that encodes the secretory signal sequence. This is because productivity is poor, and it is generally known to use a sequence in which a gene sequence encoding a signal sequence is deleted when it is desired to efficiently recover a recombinant protein. For PCR, DNA polymerase, ExTaq (manufactured by Takara Bio Inc.) was used, and the reaction conditions were [94 ° C./30 seconds → 50 ° C./1 minute → 72 ° C./2 minutes] × 30 cycles. The predicted N-terminus of wild-type BfGLD is the sequence identity between the full-length amino acid sequence of BfGLD (SEQ ID NO: 2) and Aspergillus terreus-derived glucose dehydrogenase (AtGLD) described in SEQ ID NO: 2 of WO 2006/101239 pamphlet. From the 20th and subsequent amino acid sequences of SEQ ID NO: 2 of WO 2006/101239, which is the N terminus of wild-type AtGLD, the N-terminal of wild-type BfGLD is the 17th and subsequent amino acid sequences described in SEQ ID NO: 1. Predicted.
primer4F_BfGLD_Sig (-) / Sac: AAA GAGCTC GAGCACCGACTCTACCTTAAA (SEQ ID NO: 18)
(Underlined: restriction enzyme site (SacI))
primer5R_BfGLD / Hind: CCC AAGCTT CTAAATGTCCTCCTTGATC (SEQ ID NO: 19)
(Underlined part: restriction enzyme site (HindIII))
By PCR, a DNA fragment having a primer addition sequence added to a sequence containing a 46 bp intron and not including a 48 bp base sequence encoding the expected signal sequence was obtained.

Next, in order to delete introns, the primer set of primer4F_BfGLD_Sig (-) / Sac (SEQ ID NO: 18) and the following primer6R_Bf_up (int) (SEQ ID NO: 20) or the following primer7F_Bf_ ( Int) down (SEQ ID NO: 21) and primer5R_BfGLD / Hind (SEQ ID NO: 19) were used for PCR amplification under the PCR conditions.
primer6R_Bf_up (int): GGGTGTATGCCATTCCATTGATAGTACTAGTCCCT (SEQ ID NO: 20)
primer7F_Bf_ (int) down: GAATGGCATACACCCGAGCCGAAGAT (SEQ ID NO: 21)
The obtained two amplified sequences were put into one PCR amplification tube, and PCR-amplified using the primer set of primer4F_BfGLD_Sig (-) / Sac (SEQ ID NO: 18) and primer5R_BfGLD / Hind (SEQ ID NO: 19) under the PCR conditions, A DNA fragment in which a primer addition sequence was added to the 16AA (−) BfGLD gene not containing an intron and not containing a 48 bp base sequence encoding the expected signal sequence was obtained.

(2) Preparation of vector containing BfGLD gene and acquisition of transformant pUC18 vector (manufactured by Takara Bio Inc.) was cleaved with restriction enzymes SacI and HindIII, and the PCR-amplified DNA fragment treated with the restriction enzymes was ligated to the vector, and E. coli It was introduced into the JM109 strain and transformed. Plasmid DNA was prepared from 6 clones of the obtained transformants and treated with SacI and HindIII, and fragments of the desired size could be confirmed in all clones. When a plasmid was prepared for one clone and the insert was sequenced, the 16AA (-) BfGLD gene described in SEQ ID NO: 50, which does not contain an intron and does not contain a 48 bp base sequence encoding the expected signal sequence, was found. confirmed.

(3) Confirmation of recombinant Escherichia coli-derived BfGLD 10 mL of LB liquid medium was placed in a thick test tube, capped, and autoclaved at 121 ° C. for 20 minutes. 50 μg / mL ampicillin was added to the cooled liquid medium, the transformant prepared in (4) was inoculated, and cultured with shaking at 37 ° C. When the OD600 of the culture solution reached about 0.4 to 0.5, 1 mM of IPTG was added and further cultured with shaking for 18 hours. After completion of the culture, the cells were collected by centrifugation and suspended in 20 mM potassium phosphate buffer (pH 7.0). Cell bodies were crushed using an ultrasonic crushing apparatus, and centrifuged to prepare a cell-free extract. When the glucose dehydrogenase activity (U / mL) of the recombinant BfGLD sugar chain-free sample (Sc (−) BfGLD) was measured according to the enzyme activity measurement method described above, 0.703 U / mL glucose dehydrogenation per 1 mL of the culture solution was measured. Enzyme activity was confirmed. Glucose oxidase activity could not be confirmed.

(4) Purification of recombinant Sc (−) BfGLD The transformant prepared in (2) is inoculated into 10 mL of LB liquid medium containing 50 μg / mL ampicillin and cultured with shaking at 37 ° C. for 7 hours, and then 50 μg / mL. Inoculated into a 250 mL Meyer flask containing 50 mL of LB liquid medium containing mL ampicillin and cultured with shaking at 37 ° C. for 17.5 hours to obtain a preculture solution. 50 mL of the preculture solution is inoculated into a 2 L jar fermenter containing 1.5 L of LB liquid medium containing 50 μg / mL ampicillin and cultured at 37 ° C., and the OD600 of the culture solution is about 0.4 to 0.5. At that time, 1 mM of IPTG was added and cultured for 25.5 hours under aeration and stirring conditions. After completion of the culture, the cells collected by centrifugation were suspended in 20 mM potassium phosphate buffer (pH 6.0), and the cells were disrupted using an ultrasonic crusher and then centrifuged to prepare a cell-free extract. The specific activity of the cell-free extract was 0.0182 U / mg. The cell-free extract was dialyzed in 20 mM potassium phosphate buffer (pH 7.5), passed through a DEAE-Cellulofine A-500 column equilibrated with the same buffer, and the eluate was collected. The eluate was dialyzed in 5 mM potassium phosphate buffer (pH 7.5) and passed through a DEAE-Cellulofine A-500 column equilibrated with the same buffer to adsorb the enzyme. After washing the column with the same buffer, the active fraction was collected by eluting the enzyme by the gradient elution method from the buffer to the same buffer containing 0.3 M potassium chloride. The active fraction was concentrated with an ultrafiltration membrane having a molecular weight cut off of 10,000, desalted and then replaced with 20 mM potassium phosphate buffer (pH 6.0) to obtain a purified enzyme of Sc (−) BfGLD.
Furthermore, when recombinant Sc (-) BfGLD was subjected to SDS-polyacrylamide electrophoresis and the molecular weight was determined from the molecular weight marker, recombinant Sc (-) BfGLD of about 60 kDa could be confirmed.

[Example 3]
(Comparison with known sequence of recombinant BfGLD)
The amino acid sequence of BfGLD including the signal sequence portion was as shown in SEQ ID NO: 2, but when BLAST search was performed using this sequence, it surprisingly matched the amino acid sequence of glucose oxidase derived from Botriotinia fukeliana . However, BfGLD obtained in the present invention had glucose dehydrogenase activity as described in Example 2, (6), and no glucose oxidase activity was observed. The amino acid sequence of glucose oxidase derived from Botryotinia fukeliana is described in publicly known document 4 (Molecular Plant Pathology (2004) 5 (1), 17-27), and is self-cloned by Botrytis cinerea (= Botryotinia fuckliana). It is described. Furthermore, the properties of the glucose oxidase in which the wild-type Botrytis cinerea (= Botryotinia fuchelia) is described in publicly known document 5 (Physiological and Molecular Plant Pathology (1998) 53, 123-132) described in the document is described. The enzyme is described as a tetrameric enzyme having a subunit molecular weight of 35 kDa and a gel filtration molecular weight of about 160 kDa. In contrast, when the recombinant BfGLD of the present invention has a molecular weight in SDS-polyacrylamide electrophoresis that is recombined in a eukaryotic cell, the enzyme before sugar chain cleavage is 90-100 kDa, and the enzyme after sugar chain cleavage is 60-70 kDa. Glucose dehydrogenase. For example, publicly known document 6 (Protein Nucleic Acid Enzyme (2004) 49 (5), 625-633, Review) describes that xanthine dehydrogenase is converted to xanthine oxidase by partial degradation with a protease. . That is, after the three-dimensional structure is taken, it is decomposed by protease, and xanthine dehydrogenase and xanthine oxidase are derived from the same gene. From these facts, the Botryotinia fukeliana-derived glucose dehydrogenase and the Botryotinia fukeliana-derived glucose dehydrogenase of the present invention are the same as the amino acid sequence deduced from the gene sequence. Has a subunit molecular weight of 90-100 kDa for the enzyme before glycosylation, 60-70 kDa for the enzyme after glycosylation, and has glucose dehydrogenase activity, while it is derived from Botryotinia fukeliana described in the paper Glucose oxidase has a subunit molecular weight of 35 kDa and has glucose oxidase activity, and is completely different in structure and function. The difference between the two is that after taking a three-dimensional structure, some modification such as degradation by protease is performed. I guess it depends on whether or not . In particular, in the enzyme recombined with Aspergillus, activity conversion due to protease modification was not observed. Therefore, recombinant production with Aspergillus seems to be a meaningful method for efficiently producing recombinant BfGLD.

[Example 4]
(Measurement of glucose by electrode)
Using a sample with a recombinant BfGLD sugar chain (Sc (+) BfGLD), D-glucose was measured with an electrode. Using a glassy carbon (GC) electrode equipped with the enzyme 0.16U, the response current value with respect to the glucose concentration was measured. In the electrolytic cell, 1.8 mL of 50 mM sodium phosphate buffer (pH 6.0 or pH 7.0) and 0.2 mL of 1M potassium hexacyanoferrate (III) aqueous solution (potassium ferricyanide) were added. The GC electrode was connected to potentiostat BAS100B / W (manufactured by BAS), the solution was stirred at 37 ° C., and +500 mV was applied to the silver-silver chloride reference electrode. 5 μl of 1M D-glucose solution was added to these systems so that the final concentration was 10 mM, and the steady-state current value was measured. Furthermore, the operation of adding a 1M D-glucose solution to each final concentration and measuring the current value was repeated, and finally the current value of each glucose concentration (5, 10, 20, 30, 40 mM) was measured. . When this was plotted, a calibration curve was created (FIG. 1). In addition, as a result of measuring the electric current value similarly about the sample without recombinant BfGLD sugar chain (Sc (−) BfGLD) using 50 mM sodium phosphate buffer (pH 7.0), Sc (+) BfGLD is more suitable for Sc ( -) The sensor sensitivity was about twice that of BfGLD.

[Example 5]
(N-terminal analysis)
Analysis of the N-terminus of the sample with recombinant BfGLD sugar chain (Sc (+) BfGLD) revealed that it was STLNY. That is, it was found that 19 amino acids of MYRLLLSTFAVASLAAASTD are signal sequences, and the enzyme is present in a form in which the 19 amino acids are deleted by modification with a signal peptidase from the translated peptide.

[Example 6]
(Signal sequence mutation)
In the production of recombinant BfGLD by recombinant mold, the secretion signal was mutated.
The primers described below were synthesized, and the BfGLD gene with the signal sequence substituted was amplified by the PCR method using the plasmid vector obtained in (2) of Example 2 as a template.
primer8_Bf-Atsignal1-7AA-F: ((CCCTGTCCCTGGCAGTGGCGGCACCTTTG)) TTTGCTGTAGCCTCTTTGGCTGCAG (SEQ ID NO: 22)
primer9_Bf-Atsignal2-F: ((ATGTTGGGAAAGCTCTCCTTCCTCAGTGCCCTGTCCCTGGCAGTGGCGGCACCTTTG)) (SEQ ID NO: 23)
primer10_Bf-eno-Atsignal-F: (TGACCAATTCCGCAGCTCGTCAAA) ((ATGTTGGGAAAGCTCTCCTTCCTCA)) (SEQ ID NO: 24)
primer11_Bf-infusion-F: CTCCAAGTTA GTCGAC (TGACCAATTCCGCAGCTCGTCAAA) (SEQ ID NO: 25)
primer12_Bf-infusion-R: CGCTTCTAGA GCATGC CTAAATGTCCTCCTTGATCAAATC (SEQ ID NO: 26)
primer13_Bf-Aosig-short1-7AA-F: ((AGTGCCCTGTCGCTGGCCACGGCA)) TTTGCTGTAGCCTCTTTGGCTGCA (SEQ ID NO: 27)
primer14_Bf-Aosig-short2-F: ((ATGCTCTTCTCACTGGCATTCCTGAGTGCCCTGTCGCTGGCCACGGCA)) (SEQ ID NO: 28)
primer15_Bf-Aosignal1-7AA-F: ((TCGCTGGCCACGGCATCACCGGCTGGACGGGCC)) TTTGCTGTAGCCTCTTTGGCTGCAGCTAGCACC (SEQ ID NO: 29)
primer16_Bf-Aosignal2-F: ((ATGCTCTTCTCACTGGCATTCCTGAGTGCCCTGTCGCTGGCCACGGCATCACCGGCTGGACGGGCC)) (SEQ ID NO: 30)
primer17_Bf-eno-Aosignal-F: (TGACCAATTCCGCAGCTCGTCAAA) ((ATGCTCTTCTCACTGGCATTCCTGA)) (SEQ ID NO: 31)
primer18_Bf-Atsignal1-16AA-F: ((CCCTGTCCCTGGCAGTGGCGGCACCTTTG)) AGCACCGACTCTACCTTAAACTATG (SEQ ID NO: 32)
primer19_Bf-Aosig1-short1-16AA-F: ((AGTGCCCTGTCGCTGGCCACGGCA)) AGCACCGACTCTACCTTAAACTATG (SEQ ID NO: 33)
primer20_Bf-Atsignal1-19AA-F: ((CCCTGTCCCTGGCAGTGGCGGCACCTTTG)) TCTACCTTAAACTATGATTATATCATCG (SEQ ID NO: 34)
primer21_Bf-Aosig1-short1-19AA-F: ((AGTGCCCTGTCGCTGGCCACGGCA)) TCTACCTTAAACTATGATTATATCATCG (SEQ ID NO: 35)
(F is Forward, R is Reverse, underlined: restriction enzyme cleavage site, double brackets: each signal sequence, brackets: enoA 5'-UTR, others: ORF)
The primer is signal sequence information of Aspergillus terreus-derived glucose dehydrogenase (AtGLD) described in SEQ ID NO: 2 of International Publication No. 2006/101239 pamphlet (amino acids 1 to 19 of SEQ ID NO: 2 described in the publication) Sequence: SEQ ID NO: 10) and signal sequence prediction site (Signal p: http://www.cbs.dtu.dk/services/SignalP/) signal of Aspergillus oryzae-derived glucose dehydrogenase (AoGLD) Designed based on the sequence. In addition, the signal sequence of AoGLD was expected to have two types (short: SEQ ID NO: 12 and long: SEQ ID NO: 14).

1. Cloning to delete 7 amino acids from the signal sequence of BfGLD and add another signal 1- (1) Cloning to add 19 amino acids of the signal sequence of AtGLD Amino acids from methionine to 7th of the signal sequence of BfGLD In order to delete (MYRLLLST) and add the signal sequence 19 amino acids of AtGLD, the base sequence encoding the signal sequence portion of the full-length BfGLD gene including the intron, up to the 21st base is represented by SEQ ID NO: 9. In order to replace the nucleotide sequence 57 bp encoding the signal sequence of Aspergillus terreus-derived glucose dehydrogenase, PCR was performed. PCR was performed in four stages. First, as the first step, PCR using primer8_Bf-Atsignal1-7AA-F and primer12_Bf-infusion-R was performed using the plasmid extracted in (2) of Example 2 as a template. Next, as the second step, PCR was performed using primer9_Bf-Atsignal2-F and primer12_Bf-infusion-R using the PCR product of the first step as a template. Subsequently, PCR was performed using primer10_Bf-eno-Atsignal-F and primer12_Bf-infusion-R as the third step, using the PCR product of the second step as a template. Finally, PCR was performed using primer11_Bf-infusion-F and primer12_Bf-infusion-R using the PCR product of the third step as a template as the fourth step. The obtained PCR product contains an intron that encodes a sequence in which 7 amino acids (MYRLLLST) of the signal sequence portion of the full-length amino acid sequence of BfGLD (SEQ ID NO: 2) are substituted with the AtGLD signal sequence (SEQ ID NO: 10). It is a polynucleotide. The sequence containing no intron of the sequence is shown as SEQ ID NO: 36 as the Atsig-7AA (−) BfGLD gene, and the amino acid sequence encoded by the sequence is shown in SEQ ID NO: 37.

1- (2) S. Cloning to add 16 amino acids of the expected short signal sequence of AoGLD To delete the amino acids from methionine to 7th amino acid (MYRLLLST) in the signal sequence of BfGLD and add 16 amino acids of the expected short signal sequence of AoGLD, an intron was added. The base sequence encoding the signal sequence portion of the full-length BfGLD gene is replaced by the base sequence 48 bp encoding the predicted short signal sequence of Aspergillus oryzae-derived glucose dehydrogenase described in SEQ ID NO: 11 In order to do this, PCR was performed. PCR was performed in four stages. First, as the first step, PCR was performed using primer13_Bf-Aosig-short1-7AA-F and primer12_Bf-infusion-R using the plasmid extracted in (2) of Example 2 as a template. Next, as the second step, PCR was performed using primer14_Bf-Aosig-short2-F and primer12_Bf-infusion-R using the PCR product of the first step as a template. Subsequently, PCR was performed using primer17_Bf-eno-Aosignal-F and primer12_Bf-infusion-R as the third step, using the PCR product of the second step as a template. Finally, PCR was performed using primer11_Bf-infusion-F and primer12_Bf-infusion-R using the PCR product of the third step as a template as the fourth step. The obtained PCR product encodes a sequence in which 7 amino acids (MYRLLLST) in the signal sequence part of the full-length amino acid sequence of BfGLD (SEQ ID NO: 2) are replaced with a predicted signal sequence (SEQ ID NO: 12) of AoGLD. A polynucleotide comprising The sequence containing no intron of the sequence is shown as SEQ ID NO: 38 as the AosigS-7AA (−) BfGLD gene, and the amino acid sequence encoded by the sequence is shown in SEQ ID NO: 39.

1- (2) L. Cloning to add 22 amino acids of the expected signal sequence of AoGLD To delete the amino acids from methionine to the 7th amino acid (MYRLLLST) in the signal sequence of BfGLD and add 22 amino acids of the expected signal sequence of AoGLD, an intron was added. The base sequence encoding the signal sequence portion of the full-length BfGLD gene containing the base sequence up to the 21st base is replaced with the base sequence 66 bp encoding the expected longer signal sequence of Aspergillus oryzae-derived glucose dehydrogenase described in SEQ ID NO: 13 In order to do this, PCR was performed. PCR was performed in four stages. First, as the first step, PCR using primer15_Bf-Aosignal1-7AA-F and primer12_Bf-infusion-R was performed using the plasmid extracted in (2) of Example 2 as a template. Next, as the second step, PCR was performed using primer16_Bf-Aosignal2-F and primer12_Bf-infusion-R using the PCR product of the first step as a template. Subsequently, PCR was performed using primer17_Bf-eno-Aosignal-F and primer12_Bf-infusion-R as the third step, using the PCR product of the second step as a template. Finally, PCR was performed using primer11_Bf-infusion-F and primer12_Bf-infusion-R using the PCR product of the third step as a template as the fourth step. The obtained PCR product encodes a sequence in which 7 amino acids (MYRLLLST) of the signal sequence portion of the full-length amino acid sequence of BfGLD (SEQ ID NO: 2) are replaced with the expected signal sequence (SEQ ID NO: 14) of AoGLD. A polynucleotide comprising The sequence not containing an intron of this sequence is shown as SEQ ID NO: 40 as the AosigL-7AA (−) BfGLD gene, and the amino acid sequence encoded by the sequence is shown in SEQ ID NO: 41.

2. Cloning to remove 16 amino acids from the signal sequence of BfGLD and add another signal 2- (1) Cloning to add 19 amino acids of the signal sequence of AtGLD Amino acids from methionine to 16th of the signal sequence of BfGLD In order to delete (MYRLLLSTFAVASLAA) and add 19 amino acids of the AtGLD signal sequence, the base sequence encoding the signal sequence part of the full-length BfGLD gene including the intron is represented by SEQ ID NO: 9, In order to replace the nucleotide sequence 57 bp encoding the signal sequence of Aspergillus terreus-derived glucose dehydrogenase, PCR was performed. PCR was performed in four stages. First, as the first step, PCR was performed using primer18_Bf-Atsignal1-16AA-F and primer12_Bf-infusion-R using the plasmid extracted in (2) of Example 2 as a template. Next, as the second step, PCR was performed using primer9_Bf-Atsignal2-F and primer12_Bf-infusion-R using the PCR product of the first step as a template. Subsequently, PCR was performed using primer10_Bf-eno-Atsignal-F and primer12_Bf-infusion-R as the third step, using the PCR product of the second step as a template. Finally, PCR was performed using primer11_Bf-infusion-F and primer12_Bf-infusion-R using the PCR product of the third step as a template as the fourth step. The obtained PCR product contains an intron that encodes a sequence in which 16 amino acids (MYRLLSTFASVAAA) of the signal sequence portion of the full-length amino acid sequence of BfGLD (SEQ ID NO: 2) are replaced with the AtGLD signal sequence (SEQ ID NO: 10). It is a polynucleotide. The sequence containing no intron of this sequence is shown as SEQ ID NO: 42 as the Atsig-16AA (−) BfGLD gene, and the amino acid sequence encoded by the sequence is shown in SEQ ID NO: 43.

2- (2) S. Cloning to add 16 amino acids of the expected short signal sequence of AoGLD To delete 16 amino acids from methionine (MYRLLLSTFAVASLAA) in the signal sequence of BfGLD and add 16 amino acids of the expected short signal sequence of AoGLD, an intron was added. Of the base sequence encoding the signal sequence portion of the full-length BfGLD gene, the 48th base is replaced with the base sequence 48 bp encoding the expected short signal sequence of Aspergillus oryzae-derived glucose dehydrogenase described in SEQ ID NO: 11 In order to do this, PCR was performed. PCR was performed in four stages. First, as the first step, PCR was performed using primer19_Bf-Aosig-short1-16AA-F and primer12_Bf-infusion-R using the plasmid extracted in (2) of Example 2 as a template. Next, as the second step, PCR was performed using primer14_Bf-Aosig-short2-F and primer12_Bf-infusion-R using the PCR product of the first step as a template. Subsequently, PCR was performed using primer17_Bf-eno-Aosignal-F and primer12_Bf-infusion-R as the third step, using the PCR product of the second step as a template. Finally, PCR was performed using primer11_Bf-infusion-F and primer12_Bf-infusion-R using the PCR product of the third step as a template as the fourth step. The obtained PCR product encodes a sequence in which 16 amino acids (MYRLLLSTAVASLAAA) in the signal sequence portion of the full-length amino acid sequence of BfGLD (SEQ ID NO: 2) are replaced with a predicted signal sequence (SEQ ID NO: 12) of AoGLD. A polynucleotide comprising The sequence containing no intron of the sequence is shown as SEQ ID NO: 44 as the AosigS-16AA (−) BfGLD gene, and the amino acid sequence encoded by the sequence is shown in SEQ ID NO: 45.

3. Cloning to delete all 19 amino acid sequences of BfGLD and add another signal 3- (1) Cloning to add 19 amino acid sequences of AtGLD BfGLD all signal sequences, that is, amino acids from methionine to 19th amino acid In order to delete (MYRLLLSTFAVASLAAASTD) and add 19 amino acids of the signal sequence of AtGLD, the base sequence encoding the signal sequence portion of the full-length BfGLD gene including the intron is represented by SEQ ID NO: 9, In order to replace the nucleotide sequence 57 bp encoding the signal sequence of Aspergillus terreus-derived glucose dehydrogenase, PCR was performed. PCR was performed in four stages. First, as the first step, PCR was performed using primer20_Bf-Atsignal1-19AA-F and primer12_Bf-infusion-R using the plasmid extracted in (4) of Example 2 as a template. Next, as the second step, PCR was performed using primer9_Bf-Atsignal2-F and primer12_Bf-infusion-R using the PCR product of the first step as a template. Subsequently, PCR was performed using primer10_Bf-eno-Atsignal-F and primer12_Bf-infusion-R as the third step, using the PCR product of the second step as a template. Finally, PCR was performed using primer11_Bf-infusion-F and primer12_Bf-infusion-R using the PCR product of the third step as a template as the fourth step. The obtained PCR product is a poly-containing intron that encodes a sequence in which the entire signal sequence 19 amino acids (MYRLLSTFASVALAASTD) of the full-length amino acid sequence of BfGLD (SEQ ID NO: 2) is replaced with the signal sequence of AtGLD (SEQ ID NO: 10). It is a nucleotide. The sequence containing no intron of this sequence is shown as SEQ ID NO: 46 as the Atsig-19AA (−) BfGLD gene, and the amino acid sequence encoded by the sequence is shown in SEQ ID NO: 47.

3- (2) S. Cloning to add AoGLD expected short signal sequence 16 amino acids In order to delete the entire BfGLD signal sequence, ie, amino acids from methionine to 19th (MYRLLLSTFAVASLAAASTD) and add AoGLD expected short signal sequence 16 amino acids Of the base sequence encoding the signal sequence portion of the full-length BfGLD gene including the base sequence of 48 bp encoding the predicted short signal sequence of Aspergillus oryzae-derived glucose dehydrogenase described in SEQ ID NO: 11 PCR was performed to replace. PCR was performed in four stages. First, as the first step, PCR was performed using primer21_Bf-Aosig-short1-19AA-F and primer12_Bf-infusion-R using the plasmid extracted in (2) of Example 2 as a template. Next, as the second step, PCR was performed using primer14_Bf-Aosig-short2-F and primer12_Bf-infusion-R using the PCR product of the first step as a template. Subsequently, PCR was performed using primer17_Bf-eno-Aosignal-F and primer12_Bf-infusion-R as the third step, using the PCR product of the second step as a template. Finally, PCR was performed using primer11_Bf-infusion-F and primer12_Bf-infusion-R using the PCR product of the third step as a template as the fourth step. The obtained PCR product encodes a sequence in which the entire signal sequence 19 amino acids (MYRLLSTFASVALAASTAST) of the full-length amino acid sequence of BfGLD (SEQ ID NO: 2) is replaced with the expected signal sequence (SEQ ID NO: 12) of AoGLD. A polynucleotide comprising. A sequence not containing an intron of the sequence is shown as SEQ ID NO: 48 as an AosigS-19AA (−) BfGLD gene, and an amino acid sequence encoded by the sequence is shown in SEQ ID NO: 49.

2. Preparation of vector Each obtained PCR product was ligated downstream of an improved amylase-derived promoter derived from Aspergillus oryzae described in known literature 1 using In-Fusion Advantage PCR cloning kit (manufactured by Takara Bio Inc.). By doing, Atsig-7AA (-) BfGLD gene, AosigS-7AA (-) BfGLD gene, AosigL-7AA (-) BfGLD gene, Atsig-16AA (-) BfGLD gene, AosigS-16AA (-) each containing an intron Vectors capable of expressing the BfGLD gene, the Atsig-19AA (-) BfGLD gene, and the AosigS-19AA (-) BfGLD gene were prepared.

  Each of these expression vectors was introduced into E. coli strain JM109 for transformation, and the resulting transformants were cultured. From the collected cells, Illustra plasmid-prep MINI Flow Kit (manufactured by GE Healthcare) ), And each of the inserts was subjected to sequence analysis. Atsig-7AA (-) BfGLD gene, AosigS-7AA (-) BfGLD gene, AosigL-7AA ( -) BfGLD gene, Atsig-16AA (-) BfGLD gene, AosigS-16AA (-) BfGLD gene, Atsig-19AA (-) BfGLD gene and AosigS-19AA (-) BfGLD gene were confirmed.

3. Acquisition of transformant In the same manner as in (2) of Example 2, Atsig-7AA (-) BfGLD gene, AosigS-7AA (-) BfGLD gene, AosigL-7AA (-) BfGLD gene, Atsig each containing an intron -16AA (-) BfGLD gene, AosigS-16AA (-) BfGLD gene, Atsig-19AA (-) BfGLD gene, and AosigS-19AA (-) BfGLD gene-introduced recombinant molds were prepared, respectively, on a Czapek-Dox solid medium Each transformant was purified. Paindex 2% (Matsuya Chemical Co., Ltd.) (W / V), Tryptone 1% (BD) (W / V), Potassium dihydrogen phosphate 0.5% (Nacalai Tesque) (W / V) ), Magnesium sulfate heptahydrate 0.05% (W / V) (manufactured by Nacalai Tesque) and water (10 mL) were placed in a thick test tube (22 mm × 200 mm) and autoclaved at 121 ° C. for 20 minutes. Several pieces of each obtained transformant were inoculated per gene into this cooled liquid medium, and cultured with shaking at 30 ° C. for 4 days. The culture supernatant sampled on the third and fourth days was centrifuged (3,000 × g, 20 minutes), and the precipitates were removed to obtain each enzyme sample.

  As a result of measuring the glucose dehydrogenase activity (U / mL) of each enzyme sample according to the enzyme activity measurement method described above, the average value of two samples having high activity for the same gene was as shown in Table 1 below.

Among the enzyme samples, the N-terminal of an enzyme sample derived from the Atsig-7AA (−) BfGLD gene was analyzed, and was found to be STLNY. That is, it was found that even when a part of the original signal sequence of the wild type was deleted and another signal sequence was added, the N-terminus of the enzyme was the same STLNY as that of the wild type.

  From the above results, when recombinantly producing BfGLD, it is clear that the same BfGLD as the wild type can be produced even if a part or all of the gene encoding the signal sequence of BfGLD is replaced with a gene encoding another signal sequence. Became.

Claims (8)

A flavin-binding glucose dehydrogenase obtained by culturing transformed eukaryotic cells prepared using a recombinant vector containing the following polynucleotide (a), (b), (c) or (d): There,
(A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 4 or SEQ ID NO: 6,
(B) a polynucleotide comprising a base sequence having at least 90% identity with the base sequence (a) and encoding a polypeptide having glucose dehydrogenase activity;
(C) a polynucleotide encoding a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 5, or (d) an amino acid sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and glucose dehydrogenase A polynucleotide encoding a polypeptide having activity,
Flavin-binding glucose dehydrogenase comprising the following glycopolypeptide (e) or (f):
(E) a glycopolypeptide consisting of the amino acid sequence represented by SEQ ID NO: 5,
(F) A glycopolypeptide not comprising SEQ ID NO: 8 (MYRLLLSTFAVASLAAASTD), comprising an amino acid sequence having at least 90% identity with the amino acid sequence represented by SEQ ID NO: 5 and having glucose dehydrogenase activity.   The flavin-binding glucose dehydrogenase according to claim 1, wherein the transformed eukaryotic cell is transformed mold or transformed yeast.   The flavin-binding glucose dehydrogenase according to claim 1 or 2, which is recombined with Aspergillus.   The flavin-binding glucose dehydrogenase according to any one of claims 1 to 3, which is a purified enzyme. Cultured transformed eukaryotic cells prepared using a recombinant vector containing the following polynucleotide (a), (b), (c) or (d), and flavin-binding glucose dehydration from the obtained culture Collecting elementary enzymes,
(A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 4 or SEQ ID NO: 6,
(B) a polynucleotide comprising a base sequence having at least 90% identity with the base sequence (a) and encoding a polypeptide having glucose dehydrogenase activity;
(C) a polynucleotide encoding a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 5, or (d) an amino acid sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 5, and glucose dehydrogenase A polynucleotide encoding a polypeptide having activity,
A method for producing a flavin-binding glucose dehydrogenase comprising the following glycopolypeptide (e) or (f):
(E) a glycopolypeptide consisting of the amino acid sequence represented by SEQ ID NO: 5,
(F) A glycopolypeptide not comprising SEQ ID NO: 8 (MYRLLLSTFAVASLAAASTD) , comprising an amino acid sequence having at least 90% identity with the amino acid sequence represented by SEQ ID NO: 5 and having glucose dehydrogenase activity.   6. The method for producing a flavin-binding glucose dehydrogenase according to claim 5, wherein the transformed eukaryotic cell is transformed mold or transformed yeast.   The method for producing a flavin-binding glucose dehydrogenase according to claim 5 or 6, wherein the flavin-binding glucose dehydrogenase is produced recombinantly in the genus Aspergillus.   The production method according to any one of claims 5 to 7, wherein at least 80 U of flavin-binding glucose dehydrogenase is collected per 1 mL of the culture.

Images