JP5840124B2 - How to detect schizophrenia - Google Patents

Description

  The present invention relates to a method for detecting schizophrenia and the like.

    Schizophrenia is a major psychiatric disorder that represents psychiatry alongside mood disorders. Lifetime morbidity is as high as 1%, and it belongs to "common disease" like hypertension and diabetes. According to the 2008 patient survey by the Ministry of Health, Labor and Welfare, 22% of hospitalized patients by injury and illness category fall into mental and behavioral disorders, of which 187,400 are schizophrenia, schizophrenic type disorder and paranoid disorder Go up. In addition, schizophrenia, schizophrenia-type disorder, and delusional disorder have been reported as 66,500 in the breakdown of the number of outpatients, which is a very frequent disease. Therefore, the labor and productivity losses associated with the onset are greater than expected, and medical costs are said to be the same as for all respiratory diseases. Including the burden of the family members involved, a wide range of social and economic problems have occurred. It has been shown that schizophrenia can be found early and can return to social life with a better course as treatment is started from an early stage. Therefore, identification of biological indicators useful for early diagnosis of schizophrenia, elucidation of the cause, and development of effective treatment / prevention methods are the most important issues in psychiatry.

  The Maillard reaction reported by L.C. Maillard is initiated by a non-enzymatic reaction between the amino group of the protein and the carbonyl group of the reducing sugar. As a result, a reversible Schiff base is formed, and the Schiff base forms a stable Amadori compound by Amadori rearrangement. Furthermore, advanced glycation end products (AGEs), which are irreversible end products, are formed through a plurality of reaction processes such as dehydration, oxidation, and rearrangement. Such a state in which AGEs accumulate in a living body is proposed as “carbonyl stress” (Patent Document 1: JP 2009-39088, Non-Patent Document 1: Miyata et al., Kidney Int. 55). : 389-399, 1999). So far, many AGEs structures such as pentosidine and carboxymethyllysine (CML) have been identified, and their production processes and pharmacokinetics in various diseases and their physiological significance have been studied focusing on internal diseases. (Non-patent Document 1).

  Vitamin B6 is one of the molecules that function in the carbonyl stress elimination system in vivo (Non-Patent Document 2: Bohlender et al., Am J Physiol Renal Physiol 289: F645-59, 2005). In addition to vitamin B6, the carbonyl stress elimination system has a systemic mechanism called GLO metabolism (Non-patent Document 3: Thornalley PJ. Mol Aspects Med. 14: 287-371, 1993). In recent years, it has been reported that GLO1 dysfunction is involved in multiple pathological conditions such as mood disorders, autism, anxiety disorders, and chronic alcoholism. However, sufficient research has been conducted on the relationship with AGEs accumulation. Not.

JP 2009-39088

Miyata et al., Kidney Int. 55: 389-399, 1999 Bohlender et al., Am J Physiol Renal Physiol 289: F645-59, 2005 Thornalley PJ. Mol Aspects Med. 14: 287-371, 1993

  An object of this invention is to provide the detection method of schizophrenia.

The present inventor has intensively studied to solve the above problems. As a result, they found that the secreted glycated end product receptor is related to schizophrenia, and completed the present invention.
That is, the present invention measures the amount of a glycation end product receptor [for example, membrane-bound (mRAGE) or soluble (sRAGE), etc.] in a biological sample and correlates the obtained measurement result with schizophrenia. This is a method for detecting schizophrenia.
Further, the present invention measures the amount of a glycation end product receptor [for example, membrane-bound (mRAGE) or soluble (sRAGE)] in a biological sample, and correlates the obtained measurement result with schizophrenia. It is the evaluation method of the state of schizophrenia characterized by these.

  In the above method, at least one selected from the group consisting of a genetic abnormality of the glyoxylase I gene, the amount of a protein modification of a carbonyl compound, and the amount of pyridoxal is combined with the amount of the receptor to associate schizophrenia Can do.

Examples of the schizophrenia condition include at least one selected from the group consisting of symptoms, progress and severity of schizophrenia. An example of the protein modification product of the carbonyl compound is pentosidine.
Furthermore, the present invention is a pharmaceutical composition for treating schizophrenia comprising a glycation end product receptor or a gene encoding the receptor.
Furthermore, the present invention conducts a binding test between a glycation end product receptor and a glycation end product in the presence of a test substance (candidate substance), and selects a substance that inhibits binding as a substance that can be used for the treatment of schizophrenia. And a screening method for a substance for treating schizophrenia.
Furthermore, the present invention is a pharmaceutical composition for treating schizophrenia, comprising a substance obtained by the above screening method.
Furthermore, the present invention is a pharmaceutical composition for treating schizophrenia comprising an inhibitor of a glycation end product receptor. Examples of the inhibitor of a glycation end product receptor include a compound that promotes down-regulation of the receptor, a substance that inhibits the action of the receptor blocker, or a glycation end product.

  According to the present invention, a method for detecting schizophrenia can be provided. According to the present invention, schizophrenia can be detected or examined in more detail, and early diagnosis and early prevention methods can be established. In addition, clinical application is possible for intractable cases, and tailor-made medical care can be provided according to individual pathological conditions.

It is a figure which shows the base sequence and primer design of the area | region containing the exon 9 and exon 10 which encode RAGE. It is a figure which shows the fall of serum esRGAE in a schizophrenia patient. It is a figure which shows the fall of esRGAE in the schizophrenia patient group in which pentosidine shows a high value. It is a figure which shows that esRGAE falls more notably in the schizophrenia patient (GLO1 Glu / Glu) group in which pentosidine shows a high value. It is a figure which shows the remarkable esRAGE fall in the individual | organism | solid which has the GA genotype of RGAE c.992-6G> A by a heterozygote. It is a figure which shows the younger onset age, the increase in hospitalization period, and the increase in the dosage of an antipsychotic drug in the case with pentosidine accumulation, esRAGE decrease, and vitamin B6 decrease. It is a figure which shows the fall of esRAGE in a schizophrenia patient. It is a figure which shows the base sequence and primer design of the area | region containing the exons 6-8 which code RAGE. It is a figure which shows the fall of esRAGE in the test substance which has the variant of AGER variants. It is a figure which shows eight classification | category of the case by pentosidine, vitamin B6, and esRAGE.

  Hereinafter, the present invention will be described in detail. The scope of the present invention is not limited to these descriptions, and other than the following examples, the scope of the present invention can be appropriately changed and implemented without departing from the spirit of the present invention. It should be noted that all publications cited in the present specification, for example, prior art documents, publications, patent publications and other patent documents are incorporated herein by reference. In addition, this specification includes the contents described in the specification and drawings of the Japanese patent application (Japanese Patent Application No. 2010-112545), which is the basis of the priority claim of the present application filed on May 14, 2010.

1. SUMMARY OF THE INVENTION The present invention is a soluble glycation end product receptor or membrane-bound glycation end product that functions in the direction of reducing advanced glycation end products (AGEs) (functions as an elimination system). The present invention relates to a method for detecting schizophrenia using a product receptor as an index.

(1) Relationship of carbonyl stress in schizophrenic patients The present inventor has found that carbonyl stress may be related to some schizophrenia. In other words, as a result of quantifying the level of pentosidine (a representative molecule of AGEs) in the plasma components of 45 schizophrenia patients, 55.2 ng / ml or more in 21 cases (46.7%) (average of healthy subjects + 2SD was cut- off value) pentosidine accumulation was observed.

  Pentosidine levels (mean value: 68.4 ng / ml) in patients with schizophrenia reached about 1.7 times that of healthy subjects (mean value: 39.6 ng / ml). In these cases showing carbonyl stress, none of the three major causes of pentosidine elevation, diabetes, rheumatism and renal dysfunction were observed. Thus, pentosidine accumulation in cases has been shown to be associated with schizophrenia.

  In addition, some cases are genetically related to the glyoxalase I (GLO1) gene, which is the rate-limiting enzyme in the AGEs elimination system (Kikuchi et al., Brain Res Brain Res Rev 41: 306-323, 2003). It was suggested that carbonyl stress cases with GLO1 gene mutations may have persistent carbonyl stress before onset, since functional decline was identified.

(2) Vitamin B6 reduction in patients with schizophrenia Vitamin B6 plays an important role in various physiological functions by being interconverted into pyridoxine, pyridoxal, and pyridoxamine in vivo. The inventor found a significant decrease in vitamin B6 concentration (24.4%, 11/21 cases) in addition to the finding of pentosidine accumulation in schizophrenic patients. This phenomenon was thought to be the result of pyridoxamine, which is capable of eliminating carbonyl stress, being mobilized and depleted to suppress carbonyl stress.

  The present inventor found that GLO1 metabolism interacts with various blood dynamics such as antioxidants, vitamins, and amino acids to contribute to the maintenance of homeostasis, and the functional breakdown of their molecular network is a pathology of schizophrenia (Krebs MO, et al. Trends Mol Med. 15 (12): 562-70, 2009).

  In order to explore the molecular basis of carbonyl stress in schizophrenic patients, genetic analysis of the GLO1 gene using DNA provided by 3,682 subjects including 1,761 schizophrenic patients revealed a rare frameshift. Fourteen mutations and missense mutations were identified. In patients with schizophrenia who have a heterozygous frameshift mutation and in healthy individuals, GLO1 mRNA, protein expression, and enzyme activity decreased to about 50%, and plasma pentosidine levels increased significantly, averaging 80.9 ng / ml, Vitamin B6 level was significantly reduced to 3.6 ng / ml. Furthermore, about 15-20% reduction in enzyme activity was observed in schizophrenic patients with missense mutations as homozygotes, and plasma pentosidine accumulation and vitamin B6 reduction were observed.

(3) Decrease in secreted endogenous glycation end product receptor There are three major splicing isoforms of glycation end product receptor (RAGE), including full-length type, N-terminal deletion type, and C-terminal deletion type. (Sakurai S, et al. J Am Soc Nephrol. 2003 Aug; 14 (8 Suppl 3): S259-63; Yonekura et al., Biochm. J. 370: 1097-1109, 2003 .; Ohe et al., J. Biochem. 147: 651-659, 2010).).
Of the above isoforms, the full-length type is generally referred to as membrane-bound RAGE (mRAGE).

  The C-terminal deletion type is a soluble glycation end product receptor, and the soluble type includes (i) endogenous secretary RAGE (endogenous secretary RAGE (esRAGE) and (ii) full-length RAGE. There is a cleaved RAGE (metalloproteinase cleaved RAGE) that has undergone shedding by a matrix metalloprotease, and the above esRAGE and metalloproteinase cleaved RAGE are collectively referred to as “sRAGE” (Katakami et al., Diabetes Vasc Dis Res 5, : 190-197, 2008) In particular, sRAGE has an AGEs-binding region and lacks a transmembrane region, so it is secreted outside the cell and activates intracellular signals through AGE-RAGE binding. It is known to have a function to suppress the induction of reactive oxygen species production (oxidative stress) (Katayama N. CLINICIAN No. 568 63-69, 2008), and its relation to clinical symptoms has also been suggested (Steiner J, et al. Biol Psychiatry. 65 (12): 1107-1110, 2009). Te, by clarifying the molecular basis of the AGE-RAGE system in schizophrenia, early diagnosis of new schizophrenia, treatment, progress in the development of preventive methods are expected.

  The inventor of the present invention is a secreted endogenous glycation end product receptor that functions as an elimination system for advanced glycation end products (AGEs) in carbonyl stress schizophrenia without Glyoxalase I (GLO1) gene mutation. (esRAGE)) We found that decline was related. In addition, we found that the genetic factor of the RAGE gene is related to the decrease in secretory esRAGE. Therefore, in the present invention, a new development of a method for detecting and diagnosing schizophrenia by the amount of secreted esRAGE and a membrane-bound (full-length) RAGE genotype and a therapeutic method by supplementing secreted esRAGE is expected. it can.

  In recent years, oxidative stress has been attracting attention as a pathological hypothesis of schizophrenia, but the molecular mechanism is still unclear (Ng F, et al., Int J Neuropsychopharmacol. 11 (6): 851-876, 2008.) The present inventor paid attention to the AGE-RAGE (AGE receptor) system that works as an AGEs accumulation elimination system (Bohlender JM, et al. Am J Physiol Renal Physiol. 289 (4): F645-59, 2005) and integrated it. We examined the association with ataxia.

  The present inventor identified a frameshift mutation in a gene encoding a neutralizing enzyme GLO1 of AGEs from a proband of multiple families, and AGEs (pentosidin) in the peripheral blood of cases was about 3.7 times that of the wild type. It increased (carbonyl stress) and found that vitamin B6, a scavenger of AGEs, was significantly reduced.

In addition, as a result of examining 200 patients with schizophrenia, the present inventor found pentosidine accumulation in 66 (37.5%) of 176 cases in which the GLO1 genotype was found. On the other hand, the pentosidine accumulation in healthy controls was 3 out of 76 cases (3.9%) with GLO1 genotype found, confirming that pentosidine accumulation was significantly associated with schizophrenia (χ ² = 30.05; df = 1; P <0.0001; Odds = 14.6; 95% CI = 4.421-48.21). In addition, frameshift mutations or missense mutations were identified in 12 of 176 cases (6.8%), of which 9 (5.1%) showed pentosidine accumulation and pentosidine accumulation was associated with the GLO1 mutation (χ ² = 7.727; df = 1; P = 0.0054; Odds = 5.632; 95% CI = 1.466-21.64). About 32.4% (57/176) of patients did not have the GLO1 mutation although pentosidine accumulation was observed.

Based on the above, pentosidine accumulation (carbonyl stress) occurred in about 40% of all schizophrenia, of which about 13.6% (out of 9/66 cases) had GLO1 frameshift mutations or missense mutations. ).
Therefore, glycation end product receptors (soluble RAGE, membrane-bound RAGE), GLO1 gene and vitamin B6 can be used as detection markers for schizophrenia.

(4) Treatment of schizophrenia with RAGE blocker In general, the physiological action between a ligand and a receptor is that a receptor signal is generated by the binding of the ligand to the receptor, and subsequent signal transduction is performed. is there. However, when the ligand is bound, the receptor is translocated into the cell, and a safety valve that prevents further binding of the ligand works, so that the receptor signal is not unnecessarily prolonged. When a large amount of ligand is chronically exposed for a long period of time, the receptor remains invaded into the cell for a long time, and eventually the receptor begins to degrade in the cell, resulting in a decrease in the total amount of the receptor. This phenomenon is called "down-regulation", and thanks to the down-regulation, runaway of signal transduction by a large amount of ligand is prevented (this defense is called "desensitization").

For example, dopamine receptors and acetylcholine receptors, when dopamine and acetylcholine (ligand) are bound, emit a receptor signal to cause the physiological action of excitement of dopamine neurons and acetylcholine neurons. It is regulated so that neuronal excitement does not occur more than necessary even if it increases (desensitization).
In schizophrenia, there is a hypothesis that the dopamine receptor desensitization is impaired, so that dopamine signal runaway (enhancement) occurs and auditory hallucinations are heard.

  RAGE originally has a physiological function of generating an immune response signal as a receptor when infectious bacteria enter. Therefore, RAGE, like other receptors, is considered to have a desensitizing function in order to prevent immune overresponse. It is not the original physiological action that AGE binds to RAGE to cause RAGE response, but excess AGE is present in 46.7% of schizophrenia. Therefore, even in schizophrenic patients, it is considered that RAGE is decreased (has a negative correlation) due to desensitization.

Therefore, in the present invention, focusing on AGEs as ligands and RAGE as receptors, the relationship between ligand expression and receptor expression was examined using a microarray.
As a result, it was shown that schizophrenic patients have the negative correlation (see Example 2 for the microarray test).

  The phenomenon in which RAGE decreases as described above is considered to be a physiological normal reaction that attempts to prevent excessive signals due to AGEs. However, schizophrenic patients still have excessive AGEs that cannot be prevented. Therefore, compounds that further promote down-regulation of RAGE, blockers of RAGE itself (RAGE blockers), substances that inhibit AGE action (collectively referred to as “RAGE inhibitors”) and the like are treatment drugs for schizophrenia. It is considered to be.

For example, thiazolidinedione is exemplified as a compound that promotes down-regulation of RAGE (Marx et al., Diabetes 53: 2662-2668, 2004), and low molecular weight heparin (Myint KM. Et al., Diabetes. 2006 Sep; 55 (9): 2510-22), α-lipoic acid (Bierhaus A. et al., Diabetes. 1997 Sep; 46 (9): 1481-90), phenylpyrrole derivatives and the like. Substances that inhibit AGE action include Candesartan or Olmesartan (Qiuling F. et.al., Nephrol Dial Transplant (2004) 19: 3012-3020; Fujita M. et al., Arterioscler Thromb Vasc Biol 2006; 26; e138- e139, 2006). “Inhibiting AGE action” refers to, for example, causing suppression of RAGE expression and suppression of NFkB and VCAM1, which are downstream signals of RAGE, via endothelial cells. Aminoguanidine (Thornalley PJ., Arch Biochem Biophys 419: 31-40, 2003), OPB-9195 (Miyata et al., J Am Soc Nephrol 11: 1719-1725, 2000; Nakamura et al., Am J Kidney Dis 41: S68-S71, 2003), ALT-946 (Forbes et al., Diabetologia 44: 108-114, 2001), Alagebrium (Susic et al., Curr Opin Cardiol 19: 336-340, 2004), N-phenacylthiazolium bromide (Cooper et al., Diabetologia 43: 660-664, 2000) also inhibits AGE action by suppressing AGE formation.
In addition, sRAGE has an AGE binding region but lacks a transmembrane region, so it is secreted extracellularly and inhibits AGE action. Therefore, sRAGE, preferably esRAGE, can be a therapeutic drug for schizophrenia.

2. In the present invention, RAGE and sRAGE can be used as clinical markers of schizophrenia, and by measuring the amount of RAGE or sRAGE in a biological sample, the measurement result is used as an index. Schizophrenia can be detected.

(1) Biological sample The biological sample is not particularly limited. For example, biological components such as blood and blood components (serum, plasma, blood cells, etc.), urine, spinal fluid, saliva, tears, sweat, etc. A solid component derived from a living body such as a part of tissue excised by hair, biopsy or the like. Blood or blood components are preferable, and serum or plasma is particularly preferable. In addition, even if it uses directly the sample extract | collected from the biological body, the sample adjusted by adding a certain process can also be used as the object of the biological sample of this invention.

(2) Measurement of the amount of glycation end product receptor (mRAGE or sRAGE) The amount of glycation end product receptor (mRAGE or sRAGE) can be measured if the method has sufficient detection sensitivity and measurement accuracy for the receptor. There is no particular limitation, and a known analysis method or immunological method can be employed. For example, HPLC method etc. are mentioned as an analytical method, ELISA method, RIA method, Sandwich ELISA method etc. are mentioned as an immunological measuring method. Further, the measurement target may be either mRAGE or sRAGE, preferably sRAGE, and more preferably esRAGE.

  The average level of esRAGE in patients with schizophrenia is about 0.23 ng / mL, which is about 0.72 times higher than the average level of normal subjects, which is about 0.32 ng / mL (P <0.01. The difference is more than 99.9%). The level of esRAGE in patients with schizophrenia is less than or equal to 0.19 ng / ml (average of healthy individuals-1 SD), more preferably 0.06 ng / mL (average of healthy individuals-2 SD) Can be associated with schizophrenia.

  In another embodiment of the present invention, the ratio (Test / Control) between the esRAGE amount (Test) in the test sample derived from a schizophrenia patient and the esRAGE amount (Control) in the test sample derived from a healthy person is 0.72 or less (for example, Test average value: 0.2308 / Control average value: 0.3199), preferably 0.48 or less (for example, Test average value -0.5SD: 0.1551 / Control average: 0.3199), more preferably 0.25 or less (for example, Test average value -1SD: 0.2308 / Control average value: 0.3199) is judged positive for detection of schizophrenia, and 0.72 or more (for example, Test average value: 0.2308 / Control average value: 0.3199) If so, it can be determined as a false positive.

  In another embodiment of the present invention, schizophrenia can be detected using the amount of mRNA of a glycation end product receptor (such as mRAGE or sRAGE) as an index. Measurement of mRNA can be performed by, for example, RT-PCR, Real-time PCR, microarray, and the like. And the judgment whether it is schizophrenia should just compare with the mRNA expression level derived from a healthy subject. Typical RAGE mRNA analysis by microarray method is, for example, NM_001136 (Homo sapiens, advanced glycosylation end product-specific receptor, transcript variant 1, mRNA), NM_172197 (Homo sapiens, advanced glycosylation end product-specific receptor, transcript variant 2, mRNA), AB061669 (Homo sapiens, mRNA for N-terminal truncated form of receptor for advanced glycation endproducts) can be comprehensively detected.

  Integration by comparing the ratio (Test / Control) of mRNA expression level (Test) in test samples from patients with schizophrenia and mRNA expression level (Control) in test samples from healthy subjects Determine ataxia. For example, detection of schizophrenia is 0.8 to 0.7 or less (20 to 30% decrease), preferably 0.7 to 0.6 or less (30 to 40% decrease), more preferably 0.6 to 0.5 or less (40 to 50% decrease). Can be determined as positive.

The mRAGE level of a schizophrenic patient can be set by statistical processing in the same manner as the schizophrenia determination criterion setting method using the esRAGE concentration as an index.
By the way, in the method of the present invention, mRAGE or sRAGE levels may be measured using biological tissue samples derived from a plurality of patients. Therefore, the mRAGE or sRAGE amount is measured in a predetermined number of schizophrenic patients (primary population), and the obtained measurement values are used as basic data, and the basic data and individual detection targets. The amount of mRAGE or sRAGE derived from a biological sample derived from a subject can be compared.

  Furthermore, when the measured data of the subject patient is greater than or equal to a predetermined concentration, the mRAGE or sRAGE level is included in the population value and data processing is performed again (eg, averaging), and the target patient (population) The number of examples can also be increased. By increasing the number of cases, the accuracy of the critical value of RAGE or sRAGE can be increased, and the detection or diagnosis accuracy of schizophrenia can be increased by appropriately correcting the critical value as occasion demands.

  The detection result can be, for example, main data or auxiliary data when performing a definitive diagnosis of schizophrenia. For more detailed examination or definitive diagnosis of schizophrenia, in addition to the above detection results, other test results such as carbonyl compound modification levels, pyridoxal (vitamin B6) levels, and GLO gene abnormalities It may be determined comprehensively in combination with at least one selected from the following (described later).

(3) Mutation of RAGE gene or sRAGE gene In the present invention, mutation of membrane-bound mRAGE gene (NM_001136) (SEQ ID NO: 1) or its corresponding amino acid sequence (SEQ ID NO: 2) is used as a glycation end product receptor gene. NP_001127), esRAGE gene (AY755620) (SEQ ID NO: 3) mutation or its corresponding amino acid sequence (SEQ ID NO: 4) (AAX07273) mutation, and the like can be used to detect schizophrenia. These mutations and the like can be used as main data or auxiliary data when performing a definitive diagnosis of schizophrenia. In addition, the detection or diagnosis accuracy of schizophrenia can be improved by taking into account mutations other than those described above.

For example, the following mutations can be used in the present invention.
c.964 + 141 G> A
Polymorphism from G to A of the 141st base intron 3 'from the 964th base from the translation start point
c.965-163 C> T
C-to-T polymorphism in the 163rd base of the intron 5 'from the 965th base from the translation start point
* 196 G> A
Polymorphism from G to A of the 196th base from the translation termination point
c.992-6G> A
Polymorphism from G to A in the 6th base of the intron 5 'from the 992nd base from the translation start point

3. Evaluation method of schizophrenia state Similar to the detection method shown in the above item 2, the measurement result of the obtained mRAGE or sRAGE amount is associated with the schizophrenia state to evaluate or diagnose the schizophrenia state. be able to. When it is determined as positive, it is determined that schizophrenia has occurred or is likely to occur, and the state of schizophrenia can be evaluated.

  The state of schizophrenia means the presence or absence of positive or negative symptoms, progress, or generalized life scale (GAF) among schizophrenia. In the above evaluation, one of these schizophrenia states may be selected, or a plurality thereof may be selected in appropriate combination. To evaluate the symptoms of schizophrenia, determine whether the patient is resistant to treatment or a PANSS severity rating scale.

Positive symptoms include delusions, conceptual integration disorders, hallucinatory behaviors, excitement, hype, suspicion, and hostility. Judgment is based on whether or not one of these is true. Negative symptoms include flattened emotions, emotional withdrawal, communicative disability, social withdrawal due to passive / motivated, difficulty in abstract thinking, lack of spontaneous and fluent speech, regularity Thinking, etc. are listed, and judgment is made based on whether or not at least one of them is applicable.
The progression of schizophrenia is judged as mild when the GAF is 70 or more, and severe when the GAF is less than 30.
The symptom evaluation of schizophrenia is judged as severe when the total of PANSS P score + N score is 72 points or more, and is judged as mild when the total of PANSS P score + N score is less than 24 points.

  According to the present invention, it can be confirmed that esRAGE clearly shows a low value for schizophrenia compared to healthy individuals. That is, in one embodiment of the method of the present invention, it is possible to determine whether or not the patient has schizophrenia with esRAGE as an index with extremely high accuracy.

4). Combination of schizophrenia markers In the present invention, in addition to detection of schizophrenia using the amount of glycation end product receptor (mRAGE or sRAGE) as an index, protein modifications of carbonyl compounds such as pentosidine, pyridoxal and GLO1 gene mutation Can be combined as a marker of schizophrenia. In this case, the order of combination is not limited. For example, pentosidine in plasma is first measured, and subjects are classified into a high pentosidine group and a normal pentosidine group with a predetermined critical value as a boundary. Next, the amount of sRAGE (for example, esRAGE) is measured, and subjects are classified into a low value group and a normal group with a predetermined critical value as a boundary. In addition, pyridoxal levels are measured and classified into low and normal groups. Thus, when the amount of pentosidine, esRAGE and pyridoxal is used as an index, it can be classified into a total of 8 types of schizophrenia by dividing into a high or low value group and a normal group, and each disease state can be evaluated. (Table 1).

In the said Table 1, the disease states 1-8 show the severity of schizophrenia, and can be classified as follows.

Pathology 1: PANSS P score + N score is 84 points or more Pathology 2: PANSS P score + N score is 72 points or more and less than 84 points Pathology 3: PANSS P score + N score is 60 points More than 72 points Pathology 4: PANSS P score + N score is 48 points or more and less than 60 points Pathology 5: PANSS P score + N score is 36 points or more and less than 48 points Pathology 6: PANSS P score + N score is 24 or more and less than 36. Pathology 7: PANSS P score + N score is 14 or more and less than 24. Pathology 8: PANSS P score + N score is 14 points.

  According to the present invention, by using the amount of mRAGE or esRAGE of the glycation end product receptor as an index, schizophrenia that could not be classified finely so far can be classified into, for example, eight groups, The treatment policy can be determined accordingly. For example, since pathological conditions 1 to 4 belong to the treatment resistance group, conventional schizophrenia ameliorating drugs are often not effective, and it is necessary to examine another treatment method, whereas in pathological conditions 5 to 8, It is more likely that treatment will be effective, reducing the burden on the patient.

Hereinafter, markers that can be used in combination with mRAGE or sRAGE in the present invention will be described.
(1) Modified product of carbonyl compound Examples of the target carbonyl compound include arabinose, GO, MGO, 3-DG, glycolaldehyde, dehydroascorbic acid, hydroxynonenal, malondialdehyde, acrolein, 5-hydroxymethylfurfural, formaldehyde, Acetaldehyde, repric acid, furfural, etc. can be mentioned. These amounts can usually be measured by performing instrumental analysis such as high performance liquid chromatography (HPLC) or gas chromatography / mass spectrometry (GC / MS) using standard products of known concentrations.

  Similarly, protein modifications (for example, “AGEs”) (hereinafter referred to simply as “AGEs”) produced by the reaction of these carbonyl compounds with biological proteins are also analyzed using standard products of known concentrations. And can be measured by instrumental analysis such as GC / MS. AGEs are an aggregate of a plurality of structures (AGEs structures). Therefore, AGEs can be measured by measuring the AGEs structure. AGEs structures include pentosidine, croslin, pyropyridine, vesperlidine A, B, C, glyoxal-lysine dimmer (GOLD), methylglyoxal-lysine dimmer (MOLD) (above, fluorescent substance), Nε- (carboxymethyl) lysine ( CML), Nε- (carboxyethyl) lysine (CEL), argpyrimidine, pyralin, imidazolone, GA-pyridine (non-fluorescent substance), and the like. Pentosidine is preferable.

  Pentosidine has a structure in which pentose, equimolar lysine and arginine are cross-linked, and is a fluorescent substance stable to acid hydrolysis. It is known to accumulate in human skin in correlation with aging and the onset of diabetes, and it has been reported to increase especially in the onset of diabetes and end-stage nephropathy. Pentosidine contained in proteins such as blood can be quantified by HPLC after acid hydrolysis using the fluorescence (Ex: 335 nm, Em: 385 nm) as an index. Pentosidine can be quantified using an immunochemical method using a monoclonal antibody against pentosidine (for example, ELISA, particularly sandwich ELISA or competitive ELISA). In addition, although the monoclonal antibody and polyclonal antibody with respect to pentosidine can be prepared in accordance with a conventional method, they can also be obtained commercially easily (for example, (transgenic), Fushimi Pharmaceutical, etc.). In addition, carboxymethyl lysine, which is an AGEs structure, and antibodies against protein modifications of malondialdehyde and hydroxynonenal are also commercially available.

  In the competitive ELISA method, a specimen (plasma) pretreated with proteolytic enzyme and a standard AGEs structure are added to a microplate on which an AGEs structure such as pentosidine is immobilized, and an antibody against the AGEs structure is added and reacted. Then, after washing, the enzyme solution can be added and washed again, and a color former can be added to measure the absorbance. This method is a method defined as a blood chemistry test for pentosidine, and can be carried out simply by using a quantitative kit such as “FSK Pentosidine” (product name) (Fushimi Pharmaceutical Co., Ltd.). In addition, the amount of AGEs such as pentosidine accumulated in the skin can be easily measured using a commercially available AGE-Reader device (Diagn Optics).

(2) Pyridoxal (vitamin B6)
More specifically, the test method of the present invention measures the amount of pyridoxal in a biological sample of a subject by the above method, and then compares the measured value with the corresponding amount (control amount) in a healthy person. This can be done by evaluating. In this case, the judgment that the subject is suffering from schizophrenia or has a high risk of developing it in the future can be used as an indicator that the subject's pyridoxal amount is lower than the control amount. The serum concentration of pyridoxal in healthy individuals is 6.0-40.0 ng / ml for men and 4.0-19.0 ng / ml for women.

  The pyridoxal value is linked to the homocysteine value, and when the pyridoxal value becomes low, the homocysteine value tends to become high. For this reason, when measuring the amount of pyridoxal, the amount of homocysteine may be measured together to confirm the accuracy and accuracy of the measured value of the amount of pyridoxal. In this case, if the subject's pyridoxal level is lower than the control level and the subject's homocysteine level is higher than the healthy person's homocysteine level (control level), then the subject is suffering from schizophrenia, or There is a high probability that there is a high risk of developing it in the future. The amount of homocysteine can be measured according to a conventional method. For example, it can usually be measured by performing instrumental analysis such as HPLC or GC / MS using a standard product having a known concentration. The serum concentration of homocysteine in healthy individuals is 3.7-13.5 nmol / ml.

(3) Glyoxylase gene abnormality A glyoxylase I gene (also referred to as GLO-I gene) gene abnormality may be present, and a test for measuring a glyoxylase I gene abnormality in advance may be performed. You may be a person. The target glyoxylase I gene abnormality means a gene abnormality that results in a decrease in glyoxylase I activity, such as a deficiency in glyoxylase I or a poor expression of glyoxylase I. Specifically, at least one allele of the glyoxylase I gene is point-mutated (glyoxylase I gene coding region base sequence (NM_006708) (SEQ ID NO: 5) between positions 79 and 80. Adenine insertion), a case where the frame is shifted due to this, or a case where the mutation (Glu → Ala) of the 111st amino acid of the amino acid sequence of glyoxylase I (NP_006699) (SEQ ID NO: 6) is homozygous. be able to. In the case of the former gene abnormality, the glyoxylase I activity in the blood is about 50% lower than that in the healthy subject. In the latter gene abnormality, the glyoxylase I activity in the blood is reduced. It has been confirmed that it is about 20% lower than that of healthy individuals. In addition, not only these gene abnormalities but gene abnormalities that cause a decrease in glyoxylase I activity may be used.

  It should be noted that the amount of carbonyl compound protein modifications (AGEs) and pyridoxal used as indicators for examination in the present invention varies depending on the presence or absence of renal dysfunction, diabetes or inflammation. Therefore, the subject is preferably a person who does not have at least renal dysfunction, diabetes and inflammation.

  The gene abnormality of the GLO-I gene targeted by the present invention is a gene abnormality that results in a decrease in GLO-I activity, such as a deficiency of glyoxylase I (GLO-I) or poor expression of GLO-I. Although not particularly limited, specifically, at least one allele of the nucleotide sequence of the coding region of the GLO-I gene (SEQ ID NO: 5) is point-mutated (between adenine at position 79 and cytosine at position 80). Adenine insertion), resulting in a frame-shifted gene abnormality, and a nucleotide substitution mutation that causes a homozygous mutation (Glu → Ala) of the 111th amino acid in the amino acid sequence of GLO-I (SEQ ID NO: 6) Can be mentioned. In the case of the former gene abnormality, the blood GLO-I activity is about 50% lower than that in a healthy person. In the latter case, the blood GLO-I activity is in a healthy person. It has been confirmed that it is about 15 to 20% lower than that of JP-A-2009-39088 (see Examples).

  Specifically, the gene abnormality is detected by (i) a method in which PCR is performed in a region containing a gene abnormality and detected by the SSCP method, (ii) PCR is performed in a region containing the gene abnormality, and a restriction enzyme for the PCR product is detected. (Iii) a method of directly sequencing the PCR product and determining the sequence; (iv) using an oligonucleotide that hybridizes to a region having a genetic abnormality as a probe, By using known methods such as ASO (allele specific oligonucleotide) method to hybridize with, and (v) a method using a oligonucleotide that hybridizes to a region having a gene abnormality as a probe and detecting with a mass spectrometer etc. It can be carried out.

5. Pharmaceutical composition The pharmaceutical composition of the present invention can exert an excellent effect on the treatment of schizophrenia, and a gene encoding sRAGE or sRAGE or a RAGE inhibitor is an active ingredient for the treatment of schizophrenia. Can be used. That is, the present invention provides a pharmaceutical composition for treating schizophrenia containing the aforementioned sRAGE, a gene encoding sRAGE, or a RAGE inhibitor. Therefore, the present invention provides a method for treating schizophrenia, which comprises administering sRAGE, a gene encoding sRAGE, or a RAGE inhibitor to a schizophrenic patient.

  As an active ingredient in the pharmaceutical composition of the present invention, sRAGE or a gene encoding sRAGE (hereinafter simply referred to as “sRAGE” for convenience of explanation), or a RAGE inhibitor, may be a pharmaceutically acceptable salt or It can be used in the state of a hydrate or the like, and may be used in a state that has been subjected to appropriate chemical modification in consideration of storage stability as a therapeutic agent, and is not particularly limited.

The sRAGE used as an active ingredient of the pharmaceutical composition of the present invention is as follows.
esRAGE protein: full length or partial fragment of the amino acid sequence represented by SEQ ID NO: 4. A partial fragment having the amino acid sequence shown in SEQ ID NO: 4 and having binding activity with AGEs can be used.
The metalloproteinase-cleaved RAGE has the amino acid sequence from 1 to 315 of the amino acid sequence of the esRAGE protein (SEQ ID NO: 4).
Therefore, the amino acid sequence of sRAGE refers to the amino acid sequence shown in SEQ ID NO: 4 or the amino acid sequence from 1 to 315 of the amino acid sequence shown in SEQ ID NO: 4.
The binding activity with AGEs can be measured by a reporter gene assay system, an immunological assay, or the like (details will be described later).

esRAGE gene: full length or partial fragment of the base sequence shown in SEQ ID NO: 3. The partial fragment has the base sequence shown in SEQ ID NO: 3 and has a binding activity to AGEs when translated (for example, the region of the base sequence shown in SEQ ID NO: 3 is the region from No. 11 to 1054 (coding region)) Can be used.
The metalloproteinase-cleaved RAGE gene has the 1st to 955th base sequence of the esRAGE gene base sequence (SEQ ID NO: 3) or the 11th to 955th base sequence as a coding region.

  Furthermore, in the present invention, a mutant form of the above sRAGE can also be used. “Mutant” refers to a protein having an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence of sRAGE and having sRAGE activity, or in the amino acid sequence of sRAGE. It means a protein having at least 80% homology and having sRAGE activity.

  For example, the mutant form of sRAGE is about 80% or more, preferably 90% or more, more preferably about amino acid sequence shown in SEQ ID NO: 4 or its amino acid sequence 1 to 315, or the amino acid sequence of these partial peptides. Examples thereof include an amino acid sequence having 95% or more, more preferably about 98% or more homology, and having sRAGE activity.

  Homology can be performed using a homology search site using the Internet. For example, homology searches such as FASTA, BLAST, and PSI-BLAST can be used in Japan DNA Data Bank (DDBJ). In addition to the amino acid sequence shown in SEQ ID NO: 4 or the amino acid sequence Nos. 1-315 thereof, one or more (for example, one) in the amino acid sequence shown in SEQ ID NO: 4 (or the amino acid sequence Nos. 1-315 thereof) Or an amino acid sequence in which a mutation such as deletion, insertion, substitution or addition, or a combination mutation thereof has occurred in a few amino acids, and an amino acid sequence of a protein having sRAGE activity.

  For example, (i) 1 to 10 (preferably 1 to 5) in the amino acid sequence of the above sRAGE (amino acid sequence shown in SEQ ID NO: 4, amino acids 1 to 315 of SEQ ID NO: 4, or a partial peptide thereof) (Ii) more preferably 1 to 3 amino acid sequences deleted, and (ii) 1 to 10 (preferably 1 to 5, more preferably 1 to 3) amino acids in the amino acid sequence of sRAGE Added amino acid sequence, (iii) amino acid sequence in which 1 to 10 (preferably 1 to 5, more preferably 1 to 3) amino acids are inserted into the amino acid sequence of sRAGE, (iv) in the amino acid sequence of sRAGE An amino acid sequence in which 1 to 10 (preferably 1 to 5, more preferably 1 to 3) amino acids are substituted with other amino acids, (v) an amino acid sequence combining (i) to (iv) above Etc.

  Here, “sRAGE activity” refers to the activity of capturing AGEs in vivo and suppressing AGEs-RAGE signaling, that is, sRAGE binds to AGEs that are ligands and competes with RAGE receptors on the cell membrane surface. And the activity of suppressing the cellular response by AGEs-RAGE signaling, which is substantially equivalent to the activity of the protein having the amino acid sequence shown in SEQ ID NO: 4, such as 50% or more, more preferably 90%. It means having activity of more than%.

  The sRAGE activity can be measured using, for example, an affinity chromatography method (AGE binding assay) (Yonekura et al., Biochem J. 15; 370 (Pt 3): 1097-1109, 2003) Biacore method.

  Furthermore, as a mutant DNA that can be used in the present invention, a polynucleotide encoding sRAGE, for example, the base sequence shown in SEQ ID NO: 3 or the sequence of its coding region, the base sequence encoding the metalloproteinase cleavage type or the coding region thereof Hybridizes under stringent conditions to a sequence (No. 1 to 955 or No. 11 to 955 of SEQ ID NO: 3), or a partial sequence thereof, or a sequence complementary to these sequence or partial sequence; and A polynucleotide encoding a protein having sRAGE activity is included.

  In the hybridization conditions of the present invention, stringent conditions include, for example, “2 × SSC, 0.1% SDS, 50 ° C.”, “2 × SSC, 0.1% SDS, 42 ° C.”, “1 × SSC, 0.1% For example, “2 × SSC, 0.1% SDS, 65 ° C.”, “0.5 × SSC, 0.1% SDS, 42 ° C.”, “0.2 × SSC, 0.1% SDS, The conditions such as “65 ° C.” can be mentioned. A person skilled in the art can appropriately set conditions such as DNA concentration, length of DNA, reaction time, etc. in addition to such conditions as salt concentration and temperature of the buffer.

  For the detailed procedure of the hybridization method, Sambrook et al., Molecular Cloning, A Laboratory Manual 2nd ed. (Cold Spring Harbor Laboratory Press (1989)) and the like can be referred to.

  The polynucleotide to be hybridized is at least 70%, preferably 80%, more preferably 90% (for example, 95%) with respect to the base sequence encoding sRAGE or a partial sequence thereof, or a base sequence complementary thereto. In addition, a polynucleotide containing a base sequence having the identity of 99% or more) can be mentioned.

  These proteins and genes can be obtained by ordinary genetic engineering techniques or from known databases using, for example, nucleic acid synthesis, peptide synthesis, and gene expression techniques using microorganisms (Molecular Cloning, A Laboratory Manual 2nd ed. (Cold Spring Harbor Laboratory Press (1989) etc.).

In addition to the genetic engineering protein synthesis system using the transformant, the target protein can also be produced using a cell-free protein synthesis system that does not use any living cells. Such cell-free protein synthesis can be performed using a commercially available kit. Examples include reagent kits PROTEIOS ^™ (Toyobo), TNT ^™ System (Promega), synthesizer PG-Mate ^™ (Toyobo), RTS (Roche Diagnostics) and the like.

  The target protein can be purified by appropriately selecting means such as chromatography.

The RAGE inhibitor used as an active ingredient of the pharmaceutical composition of the present invention includes a compound that promotes down-regulation of RAGE, a RAGE blocker, a substance that inhibits AGE action, and the like.
Examples of compounds that promote RAGE down-regulation include thiazolidinediones (Marx et al., Diabetes 53: 2662-2668, 2004), and RAGE blockers such as low molecular weight heparin (Myint KM. Et al., Diabetes. 2006). Sep; 55 (9): 2510-22), α-lipoic acid (Bierhaus A. et al., Diabetes. 1997 Sep; 46 (9): 1481-90), phenylpyrrole derivatives and the like. Examples of the phenylpyrrole derivative include 2-phenylpyrrole, 3-phenylpyrrole, and the like, but the phenylpyrrole derivative described in JP-A-2009-46403 can also be used. Candesartan or Olmesartan (Qiuling F. et.al., Nephrol Dial Transplant (2004) 19: 3012-3020; Fujita M. et al., Arterioscler Thromb Vasc Biol 2006; 26; e138-e139 , 2006), Aminoguanidine (Thornalley PJ., Arch Biochem Biophys 419: 31-40, 2003), OPB-9195 (Miyata et al., J Am Soc Nephrol 11: 1719-1725, 2000; Nakamura et al., Am J Kidney Dis 41: S68-S71, 2003), ALT-946 (Forbes et al., Diabetologia 44: 108-114, 2001), Alagebrium (Susic et al., Curr Opin Cardiol 19: 336-340, 2004), N -phenacylthiazolium bromide (Cooper et al., Diabetologia 43: 660-664, 2000) and the like can be used.

  In the present invention, the pharmaceutically acceptable salt is not particularly limited as long as it has a therapeutic or ameliorating effect on schizophrenia and is pharmaceutically acceptable. Specifically, for example, hydrohalide (eg, hydrofluoride, hydrochloride, hydrobromide, hydroiodide), inorganic acid salt (eg, sulfate, nitrate, perchlorate) , Phosphates, carbonates, bicarbonates, etc.), organic carboxylates (eg acetate, oxalate, maleate, tartrate, fumarate, citrate, etc.), organic sulfonates (eg Methanesulfonate, trifluoromethanesulfonate, ethanesulfonate, benzenesulfonate, etc.), amino acid salts (eg aspartate, glutamate, etc.), quaternary amine salts, alkali metal salts (eg sodium salt, potassium) Salts), and alkaline earth metal salts (eg, magnesium salts, calcium salts, etc.).

  The pharmaceutical composition of the present invention can contain other components in addition to sRAGE and RAGE inhibitor. Examples of the other components include various pharmaceutically acceptable components (such as various pharmaceutically acceptable carriers) required depending on the usage (form of use) of the pharmaceutical composition. Other components can be appropriately contained within a range in which the effect exhibited by sRAGE is not impaired.

  When the pharmaceutical composition is used as a therapeutic agent for schizophrenia, the blending ratio of sRAGE and the types and blending ratios of other components can be appropriately set according to known methods for preparing a therapeutic drug for schizophrenia. .

  The administration method of the pharmaceutical composition of the present invention is not limited, but oral administration or parenteral administration is usually employed. Formulations that can be used for various usages are carriers generally used in drug production, such as excipients, fillers, extenders, diluents, binders, wetting agents, disintegrants, lubricants, surfactants, dispersants, buffers. Agents, preservatives, solubilizers, preservatives, flavoring agents, soothing agents, stabilizers, tonicity agents, emulsifiers, fragrances, colorants, sweeteners, thickeners or other additives. It can be appropriately selected and used, and can be prepared by a conventional method.

  By using one or more of such carriers, pharmaceuticals in the form of tablets, pills, powders, granules, injections, solutions, capsules, troches, elixirs, suspensions, emulsions or syrups, etc. A composition can be prepared. These pharmaceutical compositions can be administered orally or parenterally.

In the case of oral administration, various excipients such as microcrystalline cellulose, sodium citrate, calcium carbonate, dipotassium phosphate and glycine can be used together with a disintegrant, a binder and the like. Examples of the disintegrant include starch, alginic acid, and certain types of silicate double salts. Examples of the binder include polyvinylpyrrolidone, sucrose, gelatin, and gum arabic. Further, lubricants such as magnesium stearate, sodium lauryl sulfate, and talc are very effective for tablet formation. When an aqueous suspension or elixir is used for oral administration, an emulsifier and a suspending agent may be used in combination, if necessary, and used together with water, ethanol, propylene glycol, glycerin, etc., and diluents that combine them. .
Other forms for parenteral administration include injections that contain one or more active substances and are prescribed by conventional methods.

  In the case of an injection, it can be produced by dissolving or suspending sRAGE at a predetermined concentration in a pharmaceutically acceptable carrier such as physiological saline or commercially available distilled water for injection. The injection thus prepared can be administered once to several times per day for schizophrenic patients requiring treatment. However, the dose can be appropriately set depending on the weight and symptoms of the patient and the individual administration route. The dose may vary depending on the sensitivity of the patient to be treated, the way the drug is prescribed, the period of administration, and the interval between administrations. In some cases, the dose may be higher or lower than the set range (described later). The amount may be appropriate.

  Examples of parenteral administration include intravenous injection, subcutaneous injection, and intradermal injection, and intravenous injection is preferred. In addition, injections can be prepared as non-aqueous diluents (for example, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, alcohols such as ethanol), suspensions, or emulsions. Such sterilization of the injection can be performed by filtration sterilization through a bacteria-retaining filter, blending of a bactericidal agent, or irradiation. The injection is made into a sterile solid composition by freeze-drying method or the like, and can be used as a form of preparation for use by dissolving in sterile distilled water for injection or other solvent before use.

  sRAGE can exert various excellent effects on the treatment of schizophrenia, and can be used as an active ingredient of a gene therapy preparation for schizophrenia. That is, the present invention provides a pharmaceutical composition for treating schizophrenia containing the sRAGE gene.

  When the pharmaceutical composition of the present invention is used as a gene therapy agent, in addition to a method of direct administration by injection, a method of administering a vector in which a nucleic acid is incorporated may be mentioned. Examples of the vector include adenovirus vectors, adeno-associated virus vectors, herpes virus vectors, vaccinia virus vectors, retrovirus vectors, and lentivirus vectors. It can administer efficiently by using these viral vectors. A commercially available gene transfer kit (for example, product name: Adeno Express, manufactured by Clontech) can also be used.

  When the pharmaceutical composition of the present invention is used as a gene therapy agent, the composition can be introduced into a phospholipid vesicle such as a liposome, and the vesicle can be administered. For example, an endoplasmic reticulum holding the sRAGE gene is introduced into a predetermined cell by the lipofection method. Then, the obtained cells are administered, for example, intravenously or intraarterially.

  In the present invention, the dosage for oral administration is 1 mg to 1000 mg per person per day, preferably 10 mg to 500 mg. For parenteral administration (including gene therapy agent), 100 μg / day per person is used. ml to 1000 mg / ml, preferably 1 mg / ml to 500 mg / ml. This can be administered for 1 person or more per person (for example, 1 to 14 days).

6). Screening method The screening method of the present invention comprises a step of detecting a binding between AGE and RAGE in the presence of a test substance and selecting a substance that inhibits the binding between AGE and RAGE.

  “In the presence of a test substance” means that the test compound can be in contact with AGE or RAGE, adding a test substance to a reaction system containing AGE and RAGE, and AGE and RAGE. It means both culturing with cells containing (including cells into which these genes have been incorporated so that they can be expressed).

Examples of the test substance to be screened are not particularly limited, but are preferably compounds having affinity for AGE or RAGE.
“Having affinity” means that a test substance binds to AGE or RAGE with a specific dissociation constant.

  Examples of the test substance include compounds derived from natural or synthetic low molecular compound libraries, gene library expression products (peptides, proteins, etc.), natural or synthetic oligonucleic acids, natural or synthetic peptide libraries. Derived from peptides, antibodies, bacteria-derived substances (substances released by metabolism from bacteria, etc.), microorganisms, plant cell extracts, animal cell extracts, culture solutions (culture supernatants of microorganisms, plant cells, animal cells, etc.) Examples include compounds, compounds in soil, compounds included in random phage peptide display libraries, and the like. These compounds may be novel compounds or known compounds. Furthermore, as the test substance, a compound that has been appropriately modified or mutated by chemical, physical, or biochemical means can be used. Further, the test substance may be a compound identified by a pharmacophore search or a structure comparison program using a computer. Furthermore, candidate substances, especially compounds, may form salts and hydrates.

  The screening method of the present invention can be carried out using cells that produce AGE or RAGE, or cell preparations of these cells, and AGE or RAGE can also be used in a purified form. is there. Examples of the “cell preparation” include cell cultures, cultured cell disruptions, cytoplasm fractionated from cultured cells, organelles such as nuclei, and the like. Examples of cells that produce AGE or RAGE include endothelial cells, pericytes, A549 cell lines, etc., and these cells are expressed by introduction of at least one of AGE gene or RAGE gene. May be. Gene transfer methods are well known in the art and can be easily performed (Sambrook et al., Molecular Cloning, A Laboratory Manual 2nd ed., (Cold Spring Harbor Laboratory Press (1989)).

  The step of detecting the binding between AGE and RAGE or the signal transduction activity of RAGE can be measured using a reporter gene assay system as an index. A reporter gene is a marker gene that is incorporated into DNA to examine the transcriptional activity of promoters and enhancers, and is not particularly limited as long as it can measure the expression level thereof. Those that can be quantified are preferred. Examples of the reporter gene include luciferase gene, CAT (chloramphenicol acetyltransferase) gene, β-Gal (β-galactosidase) gene, GFP (green fluorescent protein) gene, and GUS (β-glucuronidase) gene. It is done.

  As a reagent for detecting the reporter gene product, necessary reagents are selected from a substrate for detecting the reporter product, a cell fixing solution, a cell lysate, and a buffer for diluting the sample. The If the reporter gene expression product is a protein, it can also be measured by immunological measurements such as EIA and ELISA, and reagents for this purpose can be appropriately selected and included by those skilled in the art. Is possible.

  The substance obtained by the screening method of the present invention can be used as a pharmaceutical composition for treating schizophrenia. For the pharmaceutical composition, the above-mentioned section “5. Pharmaceutical composition” can be referred to.

  Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these examples.

(1) Subjects and methods The amount of esRAGE was quantified by ELISA kit (Human esRAGE ELISA Kit, B-Bridge International, Inc) in the serum samples of 45 patients with schizophrenia and 61 healthy controls.

  The structure of the RAGE gene (Official symbol, AGER; Official full name, advanced glycosylation end product-specific receptor) is NCBI (http://www.ncbi.nlm.nih.gov/gene/177?ordinalpos=1&itool=EntrezSystem2. PEntrez.Gene.Gene_ResultsPanel.Gene_RVDocSum) and UCSC (http://genome.ucsc.edu/cgi-bin/hgc?hgsid=155267731&o=32148745&t=32152023&g=refGene&i=NM_001136) (FIG. 1, SEQ ID NO: 9) .

In FIG. 1, the underlined portion indicates the primer design location, the capital letter notation indicates the exon region, and “g” surrounded by a frame indicates the polymorphism.
The primer for gene analysis was designed after optimizing PCR conditions based on the NM_001136 sequence [Homo sapiens advanced glycosylation end product-specific receptor (AGER), transcript variant 1, mRNA] (Fig. 1). .

Primer sequences and PCR conditions are as follows.
Forward primer (RAGEex9,10-F1v2): tcacctgaggtagggagttc (SEQ ID NO: 7)
Reverse primer (RAGEex9,10-R1): gaacgacaacgtgccgcatt (SEQ ID NO: 8)

PCR was performed using a reaction solution having the following composition and cycle conditions (Table 2).

(4) Results Serum esRAGE significantly decreased in schizophrenic patients compared to healthy controls (Schizophrenia, 0.2308 ± 0.1514 ng / mL vs. Control, 0.3199 ± 0.1305 ng / mL; P = 0.0016) (FIG. 2). In addition, esRAGE decline (when the average value of healthy subjects-1SD was taken as the cut-off value, <0.1894) was 22 out of 45 schizophrenic patients (48.9%) and 8 out of 61 healthy controls (13.1%) ) (Table 3). A χ ² test in schizophrenia and controls revealed that low esRAGE was significantly associated with schizophrenia (χ ² = 16.33, P <0.0001, Odds ratio = 6.34, 95% CI = 2.46-16.32). Schizophrenia with pentosidine accumulation and decreased esRAGE was observed in 11/45 cases (24.4%).

Among schizophrenia, esRAGE was lower in the high PEN group than in the normal PEN group (Fig. 3).
The esRAGE of schizophrenia without pentosidine accumulation (Fig. 4, "Norm PEN GLO1 Glu / Glu") was not significantly different from that of healthy controls, but schizophrenic patients with pentosidine accumulation (Fig. 4). , “High PEN GLO1 Glu / Glu”), a case with no GLO1 mutation (Glu / Glu type) showed a more significant decrease in esRAGE (P <0.05). Furthermore, the decrease in esRAGE was more prominent in the case of heterozygotes with a GA genotype of RGAEc.992-6G> A (P <0.01).

Furthermore, in c.992-6G> A, esRAGE was significantly lower in A allele holders than in non-A allele holders (G / G) (FIG. 5).
Furthermore, in CSR-Sch, the onset age was lower than in the general patient group, the length of hospital stay was longer, and the dose of atypical antipsychotics was higher (FIG. 6).

(5) Discussion It has been clarified that esRAGE decrease contributes to one of the causes of pentosidine accumulation in schizophrenia in which approximately 86% of GLO1 genotypes are wild type (FIG. 2, Table 3). esRAGE is produced by splicing full length RAGE, but c.992-6G> A (located 6 bases upstream of exon 10) near the exon / intron junction of RAGE has no case with A allele Since esRAGE was significantly lower than the case (Fig. 5), it was suggested that genetic factors are involved in the decrease in esRAGE. Previous studies have revealed that about 46.7% of schizophrenia has pentosidine accumulation and 24.4% have cases with reduced esRAGE (Figure 2). In 17.8% of schizophrenia, pentosidine accumulation, esRAGE decrease, and vitamin B6 decrease were observed (Table 1), and it was revealed that genetic mutations of GLO1 and RAGE contributed as genetic factors (Figure). 5). Although it is a preliminary study, cases with pentosidine accumulation, esRAGE decline, and vitamin B6 decline showed a younger onset age, increased hospitalization, and increased antipsychotics compared to cases without these (Figure 6), suggesting an association between three factors and clinical outcomes.
The above results mean that schizophrenia can be detected using the amount of esRAGE as an index. In addition to using esRAGE alone as an index, combining esRAGE with other schizophrenia markers makes it possible to detect schizophrenia in more detail.

Microarray analysis Total RNA was prepared from two different samples to be compared. Next, total RNA was concentrated and purified, followed by reverse transcription (cDNA synthesis), and the cDNA was labeled with a fluorescent dye (for example, using Cy3 and Cy5). The fluorescently labeled cDNA sequence was hybridized to the target gene sequence (complementary sequences were immobilized on the base for array analysis), and the level of expression of the target gene was detected as the intensity of the fluorescent dye. .

  In the present invention, as a result of analysis using microarray data in lymphoblastoid cells of schizophrenia patients and healthy individuals, Accession No. MN_172197 (Homo sapiens advanced glycosylation end product-specific receptor (AGER), transcript variant 2, By measuring the gene expression level of mRNA, it was possible to predict the correlation between pentosidine and esRAGE (diagnosis using the RAGE gene as a gene expression marker) (Tables 4 and 5).

  (i) Exhaustive gene expression analysis (DNA microarray analysis) was performed using lymphoblastoid cells derived from schizophrenia patients and healthy individuals. As a result, the expression of all AGER transcript variants was decreased in MZ70 cases that showed high pentosidine levels compared to healthy subjects.

  (ii) On the other hand, in the SA046K case that showed normal values of pentosidine, all AGER transcript variants were higher than in normal subjects. Therefore, the decrease in AGER transcripts expression may be a factor that promotes high pentosidine levels. It was suggested that increased expression of AGER transcripts may contribute to AGEs suppression.

  (iii) In NP50 cases, intermediate expression values observed in MZ70 and SA046K cases were observed, which was consistent with the fluctuation range of pentosidine and esRAGE values. Furthermore, in each AGER transcripts, a difference tendency between individual differences was observed in the expression ratio.

  (iv) The serum concentration of esRAGE was significantly positively correlated with Accession Nos. AY55625, AY755627, and NM_172197. The plasma concentration of pentosidine was significantly negatively correlated with Accession No. NM_172197. Therefore, by measuring MN_172197 (advanced glycosylation end product-specific receptor (AGER), transcript variant 2, mRNA), it is considered possible to predict the correlation (increase / decrease) between pentosidine and esRAGE (using the RAGE gene) Can be used as a diagnostic marker).

  As a result of microarray analysis, the blood concentration of AGEs elimination system esRAGE was positively correlated with the expression level of AGEs effect system RAGE, and the blood level of AGEs was negatively correlated with the expression level of AGEs effect system RAGE. That is, when the blood concentration of esRAGE acting in the direction of eliminating AGEs (suppressing the function of AGEs) increases, the expression level of AGEs effect system (causes the physiological function of AGEs) is increased. When the blood concentration of AGEs increased, a negative correlation (that is, that RAGE was down-regulated) was observed with the expression level of RAGE that causes AGEs physiological function.

  Therefore, when esRAGE is sufficiently high, the elimination system functions and AGE decreases, so the risk of RAGE signal runaway disappears, and RAGE is considered to be released from down-regulation and to recover its expression level.

  A negative correlation was observed between AGEs as ligands and RAGE as receptors, indicating that desensitization occurred. In patients with schizophrenia where AGEs accumulate, blocking RAGE functions The therapeutic effect of schizophrenia can be expected.

(1) Measurement of soluble RAGE in serum In addition to the study conducted in Example 1, the present inventor newly expanded the number of cases to 106 in the schizophrenia group and 80 in the healthy group. The serum concentration of type RAGE was measured by ELISA (Human esRAGE ELISA Kit, B-Bridge International, Inc).
As a result, the amount of soluble RAGE in the schizophrenia group averaged 272.8 pg / mL, which was significantly lower than the average in the healthy group 299.4 pg / mL (P = 0.0295, Mann Whitney test) (FIG. 7). In addition, as a result of comparison between groups based on the average value of healthy group minus 1 SD (185 pg / mL), soluble RAGE decreased in approximately 34% (out of 36/106) of schizophrenia group Was found in 11 healthy subjects (13.8%) (χ ² = 9.863, df = 1, P = 0.0017, Odds ratio = 3.226, 95% CI = 1.520-6.849) ).

(2) Identification of a new glycation end product receptor gene mutation associated with soluble RAGE amount The glycation end product receptor gene AGER (also referred to as “RAGE gene”) was subjected to mutation search using the PCR method.
For detection of AGER genotype (NM_001136.3, c.692-23C> T or NM_172197.1, c.650-23C> T), NM_001136.3 (Homo sapiens advanced glycosylation) was used as the reference sequence. end product-specific receptor (AGER), transcript variant 1, mRNA) was used (FIG. 8, SEQ ID NO: 10).
In FIG. 8, the underlined portion indicates the primer design location, the capital letter notation indicates the exon region, and “c” surrounded by a frame indicates the polymorphism.

The primer sequences and PCR conditions used for searching for mutations in the RAGE gene are as follows.
Forward primer (RAGEex7,8-F2): 5'-cacactgcagtcggagctaa (SEQ ID NO: 11)
Reverse primer (RAGEex7,8 read R1): 5'-tgtaggttccctggtcctga (SEQ ID NO: 12)

PCR was performed using a reaction solution having the following composition and cycle conditions (Table 6).

Table 6

As a result of searching for mutations in the RAGE gene, a total of 30 variants including 10 new variants were identified (Table 7, rs numbers are given for nucleotide substitutions registered in NCBI).
Table 7

As a result, in addition to the previously identified AGER NM_001136.3, c.992-6G> A, AGER NM_001136.3, c.692-23C> T (or AGER NM_172197.1, c.650-23C > T) was found to be significantly associated with soluble RAGE content (FIG. 9).
In both the schizophrenia group and the healthy group, samples with a CT genotype of c.692-23C> T as heterozygotes showed a significant decrease in soluble RAGE compared to CC wild-type samples (ANOVA, Tukey's Multiple Comparison Test, P <0.01). In addition, all specimens having a CT genotype of c.692-23C> T as heterozygotes had a GA genotype of c.992-6G> A as heterozygotes. It is thought that there is. That is, in addition to the conventional determination by c.992-6G> A, it was newly found that a haplotype of c.692-23C> T is also useful for diagnosis. Therefore, when c.692-23C> T, which is newer than the conventional c.992-6G> A, is easier to judge when using a kit, instead of c.992-6G> A, c.692- It is considered that determination is possible even with 23C> T alone.
In addition, the soluble RAGE of 8 cases with CT and GA genotypes of c.692-23C> T and c.992-6G> A as heterozygotes averaged 134.3 ± 63.46 pg / mL, and CC and GG wild It was reduced by approximately 53% compared to the soluble RAGE amount (average 284.4 ± 150.6 pg / mL) in 98 cases with type (FIG. 9).
This result showed that the amount of soluble RAGE can be predicted using the genotype of c.692-23C> T as an index.
Although soluble RAGE is produced as a splicing isoform, a new variant present at the exon / intron junction of AGER showed a significant association with a decrease in soluble RAGE. It was revealed that genetic factors were involved.

(3) Hierarchization with biomarkers of pentosidine, vitamin B6, and soluble RAGE Three types (pentosidin, vitamin B6, soluble RAGE) are bio-targeted for 108 schizophrenia groups and 80 healthy subjects. Each sample was hierarchized using it as a marker (FIG. 10).
As a result, in the schizophrenia group, 57 cases (53.8%) out of 108 cases showed pentosidine accumulation, and 26 cases out of 57 cases showed a decrease in vitamin B6 (equivalent to 24.5% of the total). In addition, 11 out of 26 cases (corresponding to 10.4% of the total) in which pentosidine accumulation and vitamin B6 reduction were observed were accompanied by a decrease in soluble RAGE (classified as group I: high risk group). There were no healthy individuals belonging to Group I. On the other hand, approximately 80% (77.5%) of healthy subjects were classified into Group VIII (low risk group).
In this example, by identifying a new biomarker, we succeeded in further improving the uniformity in the individual layers. Since it becomes possible to cluster more uniform individual pathologies, it can be expected to be applied to individualized medicine that corresponds to the heterogeneity of schizophrenia and has few side effects and high efficacy.

  The method of the present invention is useful for detecting or evaluating schizophrenia.

Sequence number 7: Synthetic DNA
Sequence number 8: Synthetic DNA
SEQ ID NO: 11: synthetic DNA
SEQ ID NO: 12: synthetic DNA

Claims (5)

Measure the amount of endogenous secreted glycation end product receptor (esRAGE) in the biological sample, and use the measured result as an index to show the measurement result and schizophrenia. A method for assisting in the detection of schizophrenia, characterized in that it relates.   Measure the amount of endogenous secreted glycation end product receptor (esRAGE) in the biological sample, and use the measured result as an index to show the measurement result and schizophrenia. A method for evaluating the state of schizophrenia, characterized by relating.   Further, at least one selected from the group consisting of a genetic abnormality of the glyoxylase I gene, the amount of a protein modification of a carbonyl compound, and the amount of pyridoxal is combined with the amount of esRAGE to relate schizophrenia. The method according to claim 1 or 2.   The method according to claim 2, wherein the schizophrenia condition is at least one selected from the group consisting of symptoms, progress and severity of schizophrenia.   The method according to claim 3, wherein the protein modification product of the carbonyl compound is pentosidine.