JP5830465B2 - Epidermal differentiation microRNA signature and its use - Google Patents

Description

The present invention relates to the field of cosmetics and relates to the skin. More generally, it relates to the characterization of the state of epidermal differentiation of the skin and the treatment of diseases, illnesses or pathologies associated with epidermal differentiation.

The epidermis is a multilayered epithelium that functions as a protective barrier against the environment and load. It consists mainly of keratinocytes that grow in the deepest layer of the epidermis , then initiate differentiation and migrate from the deep part of the epidermis to the surface. On the surface of the epidermis, the most differentiated keratinocytes known as keratinocytes constitute a highly protective stratum corneum. Thus, the epidermis is both a sheet of cell proliferation that is placed in the basal layer and also a cell differentiation sheet in the intermediate layer that results in the formation of a stratum corneum that is a well-differentiated protective structure. The complete cycle is about 20 days. The program addresses the expression of a number of specific genes that are sequentially activated and then inhibited in a sequential, coordinated manner. The program includes a number of transcription factors, enzymes, lipids and structural proteins. A number of growth factors, calcium, vitamin A and D3 derivatives are important regulators of keratinocyte proliferation and differentiation. Certain physiological or pathological conditions and even certain loads on the surface of the skin or via blood circulation lead to deregulation of the process of epidermal differentiation that is temporarily spatially regulated.

In skin diseases related to modification of epidermal differentiation program, psoriasis, atopic dermatitis, acne, ichthyosis, Netherton syndrome, erythematous erythematosus, keratosis, Darier's disease, palmokeratoderma and sweat horn Many diseases have been observed that may or may not be genetic, such as keratosis [14-15].

Examples of further physiological situations related to the modification of epidermal differentiation are age with exceptions in terminal differentiation, and reduction of barrier function [17], scarring (hyperproliferation) characterized by stages of epithelial homeostasis correction Migration, re-epithelialization and restoration of terminal differentiation), and aging or winter drying (dry skin, flat accumulation process) [18].

[19] Examples of perturbations due to external factors that cause impairment of the epidermal differentiation process may be mentioned are exposure to solar UV radiation, heat, stripping agents, desquamating agents, degreasing agents, or mechanical loads.

  For minor disorders, emollients and keratolytic agents are preferred. Such treatments do not affect the proliferation / differentiation balance, but are intended to normalize the patient's lesions and they usually have only unstable effects.

  For more serious disorders, retinoic acid and its derivative vitamin D3, which can control the proliferation and differentiation of keratinocytes, have been used for several years. In some cases, methotrexate and cyclosporine are also preferred. All such treatments have major side effects and are very burdensome for the patient.

The following technical tools are currently available to characterize the epidermal differentiation of the skin or the state of the cultured epithelium of “reconstructed skin” or to allow evaluation of molecules that can regulate the epidermal differentiation process:
Morphological analysis of the stage of epidermal differentiation and biochemical markers (immunohistochemistry). This technique can be used only to analyze known protein dominant muscles in differentiation, very generally (local histology), or by marker markers (immunohistochemistry). It can produce a signature of the skin condition. It is cumbersome and requires, but not necessarily, to have specific tools available such as antibodies specific for the marker in the investigation. Furthermore, it is not an immediate quantitative technique;
Transcriptome analysis: This method is widely used to obtain a molecular signature of healthy or diseased crude skies. This technique is based on expression analysis of sample mRNA transcripts. It uses a DNA chip that can contain up to 12000 genes and can be very common. However, it requires particularly expensive equipment (Affymetrix ™ system) and has some drawbacks, but above all is often very difficult to handle and must be handled by high performance bioinformatics services Produces a significant amount of data;
Proteome analysis: This provides a comprehensive image of the general location of all proteins present in the tissue. It uses multiple two-dimensional electrophoresis gel techniques and is therefore very difficult to perform. Furthermore, accurate identification of proteins requires additional steps and requires very expensive equipment that requires specialized techniques and operational expertise.

Thus, there is a need for a method that can quickly and simply characterize the epidermal differentiation of the skin and the state of the cultured epithelium.

The present invention not only can be used to characterize the state of epidermal differentiation, but also of microRNA signatures of epidermal differentiation that can be used to envision various treatments for diseases associated with deregulation of said differentiation state. It makes the existence completely unexpected.

  Discovered in 1993, microRNAs (miRNAs) are short endogenous RNAs involved in RNA interference: they can target messenger RNA (mRNA), degrade them and inhibit their translation. Such microRNAs are therefore responsible for very important regulatory functions in the cell. In addition, they form one of the most abundant classes of regulatory molecules. Their origin is endogenous and derived from the pri-miRNA encoded in the genome. To date, approximately 700 human microRNAs have been identified. Their function and target are not all known and reported.

  They play a critical role in the regulation of various cell type pathways and can be involved in human pathology. MicroRNAs play an essential role in development, differentiation, proliferation and apoptosis (see [1] and [3] for a review). As an example, in humans, miR-17-5p and miR-20 are regulators of proliferation [4]; miR-223 is involved in downstream neoplasia [5].

  Deregulation of miRNA expression can contribute to human pathology. As a tumor suppressor, certain miRNAs function; others function as oncogenes.

  Currently, there are very few studies of miRNA in the skin, more preferably human skin.

In animal skin, the expressed miRNA has been cloned in mice. They play an important role in the epidermis and fur morphology [8]. More recently, miRAN has been shown to be involved in fur growth in goats and sheep [10]. Very recently, in mouse skin, the miRNA miR203 has been shown to play an important role in inducing epidermal differentiation by reducing cell proliferative capacity [11].

  In humans, miRNA expression has been studied in normal skin and compared to psoriatic and eczema skin. The miRNA miR203 is highly expressed in the skin (compared to other tissues) and is only by keratinocytes. It has been found as one of the miRNAs overexpressed in psoriatic skin [12].

  Finally, it has been shown in humans that certain miRNAs (miR-221 and miR-222) are involved in the regulation of melanoma progression [13].

Assuming that there are dozens of target genes for several miRNAs,
Use miRNA as a marker of differentiation. The very small number of them compared to messenger RNA means that miRNA profiles can be obtained for location or tissue more simply, quickly and cheaper than conventional common transcriptome methods ;
Use of miRNA molecular signature of epidermal differentiation for identifying therapeutic modulator purposes of benign or severe disease associated with disorders of epidermal differentiation. The term “modulator” refers not only to chemicals or natural extracts, complex preparations, substances derived from miRNA inhibitors such as siRNA, antagomir, but also to measuring systems using light, mechanical effects in the skin, or injection. means;
Use of miRNA or modulators of said miRNA for the purpose of cosmetic or therapeutic treatment of diseases of epidermal differentiation or proliferation;
Use of said miRNA signature to assess the effect of cosmetic or therapeutic treatment of epidermal differentiation;
We propose the use of miRNA molecular signatures of epidermal differentiation to perform diagnosis of normal or pathological epithelium.

  For this purpose, the inventor proposes to use an assay for the expression of specific identified miRNAs.

Surprisingly, by systematic analysis of the expression of miRNA in epithelial keratinocytes, the present inventor has miRNA-141, miR-148a of human miRNA when it results in the formation of stratum corneum due to epidermal differentiation process. , MiR-182, miR-224, miR-26a, miR-26b, miR-361-5p, miR-425, miR-455-3p, miR-92b do not express known epidermal differentiation markers and corneocytes Is overexpressed in keratinocytes of differentiated epidermis compared to proliferative, undifferentiated keratinocytes that do not form. These 10 miRNAs thus represent the molecular signature of keratinocyte differentiation.

In contrast, in highly undifferentiated proliferating keratinocytes, human miRNAs let-7i, miR-22, miR-221, miR-222, miR-29a, miR-29b, miR-663, miR-30a, miR-30c is overexpressed in undifferentiated keratinocytes compared to differentiated epidermis . These nine miRNAs, in contrast, represent the state of epidermal differentiation associated with significant proliferation.

Thus, the present invention is particularly for evaluating or determine the status of the epidermal differentiation, as a new diagnostic tool physiological or pathological differentiation disorder, or epithelial differentiation as a target for correcting defects in epidermal differentiation It relates to the miRNA signature of epidermal differentiation and various uses of the signature as biomarkers and screening tools to evaluate modulators. The present invention also relates to the use of the miRNA of the signature, or modulator of the miRNA, in the form of a composition, especially in therapeutic and cosmetic applications.

More specifically, in the context of the present invention, the following terms have the following meanings:
MicroRNA (or microRnA or miRNA): A microRNA is a single difference RNA of about 20 to 25 nucleotides in length, more commonly 21 to 24 nucleotides. miRNAs are repressors that act after transcription of mRNA from a gene: in fact, paired with messenger RNA to inhibit or suppress translation into proteins.

The production of miRNA is under strict control of transcription and post-transcriptional regulation. The miRNA gene is transcribed by RNA polymerase II in the form of a long first transcript or precursor known as “primiRNA”. The precursor miRNA is enzymatically cleaved in the cell nucleus by class 2 RNAase II (Drosha) to form a “pre-miRNA”. A “pre-miRNA” is an RNA of about 70 nucleotides in length that folds into an incomplete stem loop with base pairs between the first and second half of the sequence. The pre-miRNA is then transported to the cytoplasm that binds to a RISC complex (RNA-induced silencing complex) containing another nuclease (Dicer), TRBP (transactivation response RNA binding protein) and Ago2 (Argonaut 2). Upon binding, the protein Ago2 cleaves the 3 ′ end of the miRnA precursor, thereby generating a mature miRNA duplex. Only a specific strand of the miRNA target mRNA is maintained in the complex (thermokinetic reaction); the other strand is removed and degraded.
The target miRNA is then loaded into the RISC complex and degraded.

  Translational suppression is the most observed silencing pathway in animal cells, and recent studies indicate that miRNA also affects the amount of target RNA.

hsa-miRxx: This is the nomenclature for miRNAs identified in humans (hsa means homosapiens). The sequences for all of the known miRNAs are recorded in a base such as miRBase or microRNAdb, which is identified by its unique access number (xx). In the list below, the hsa-miRxx number is used to refer to the mature miRNA sequence.

In particular, the lower miRNA has the following sequence:
hsa-miR-141: mature miRNA: UAACACUGUGUGGUAAGAUGGG (SEQ ID NO: N ° 1)
hsa-miR-148a: mature miRNA: UCAGUGCACACACAGAACUUUGU (SEQ ID NO: 2)
hsa-miR-182: mature miRNA: UUUGGCAAUGGUAGAACUCACUCU (SEQ ID NO: N ° 3)
hsa-miR-224: mature miRNA: CAAGUCACUAGUGGUUCCCGUU (SEQ ID NO: N ° 4)
hsa-miR-26a (hsa-miR-26a-1 and hsa-miR-26a-2): mature miRNA: UUCAAGUAAUCCAGGAUAGGCU (SEQ ID NO: 5 °)
hsa-miR-26b: mature miRNA: UUCAAGUAAUUCAGGAUAGGU (SEQ ID NO: N ° 6)
hsa-miR-361-5p: mature miRNA: UUAUCAGAAUCUCCAGGGGAC (SEQ ID NO: 7)
hsa-miR-425: mature miRNA: AAUGACACGAUCACUCCCGUUGA (SEQ ID NO: 8)
hsa-miR-455-3p: mature miRNA: GCAGUCCCAUGGGCAUAUACAC (SEQ ID NO: N ° 9)
hsa-miR-92b: mature miRNA: UAUUGCACUUCGUCCGCGCUCC (SEQ ID NO: N ° 10)
hsa-let-7i: mature miRNA: UGAGGUAGUAGUUUGUGCUGUU (SEQ ID NO: N11)
hsa-miR-22: mature miRNA: AAGCUGCCAGUUGAAGAACUGU (SEQ ID NO: N ° 12)
hsa-miR-221: mature miRNA: AGCUACAUUGUCUGCUGUGUUC (SEQ ID NO: N 13)
hsa-miR-222: mature miRNA: AGCUACAUCUGGCUACUGGGU (SEQ ID NO: N ° 14)
hsa-miR-29a: mature miRNA: UAGCACCAUCUGAAAACGGUUA (SEQ ID NO: N ° 15)
hsa-miR-29b: mature miRNA: UAGCACCAUUUGAAAACAGUGUU (SEQ ID NO: N ° 16)
hsa-miR-663: mature miRNA: AGGCGGGGCGCCGCGGGACCGC (SEQ ID NO: 17)
hsa-miR-30a: mature miRNA: UGUAAAACAUCCUCGACGUGGAAG (SEQ ID NO: N18)
hsa-miR-30c: mature miRNA: UGUAAAAUCUCCUACUCUCCAGC (SEQ ID NO: 19)

  The prefix “hsa” is sometimes omitted in the context of this specification. However, the 19 identical miRNAs described above are designated.

Epidermal differentiation (keratinization or keratinization): A phenomenon of the epidermis that provides continuous regeneration of human skin. Epidermal differentiation deals with all molecular, biochemical and morphological phenomena that provide for the transformation of epidermal stem cells into anucleated corneal cells or corneocytes that go through various stages of epidermal differentiation.

The terminal differentiation allows the construction of special structures such as stratum corneum that provide tissue with an effective barrier to the environment. During epidermal differentiation, the deepest keratinocytes of the epithelium divide into two identical daughter cells, while undergoing morphological and biochemical modifications, one into the differentiated layer where the other is the upper layer Remain in place while moving.

  Non-differentiated keratinocytes (or undifferentiated keratinocytes) or basal keratinocytes (or basal layer): keratinocytes expressing keratins K5 and K14 with mitotic activity

  Differentiated keratinocytes: keratinocytes that no longer have mitotic activity and in particular have started terminal differentiation by induction of keratins K1 and K10.

  Antagomir: This is a new class of chemically synthesized oligonucleotides. They are used to inactivate the action of endogenous miRNA. antagomir is a short synthetic RNA that is fully complementary to the target miRNA with one or more base modifications to inhibit cleavage by Ago2 (because antagomir is more resistant to degradation, another modification was also introduced. )

  Antagomir is frequently used to structurally inhibit the activity of specific miRNAs. A number of antagomirs have been reported. All miRNAs can be specifically inhibited by antagomir.

  The only information required is the sequence of the sequence of the target miRNA to produce an antagomir capable of inhibiting the activity of the miRNA.

  Examples of other miRNA inhibitors are miRCURY LNA ™ microRNA knockdown probe (Exiqon) or Qiagen's miScirpt miRNA inhibitor.

  The present invention relates to miRNA signatures of epithelial differentiation and thus signatures that represent a balance between proliferation and differentiation.

In a first aspect, more specifically, the present invention relates to a method for determining the state of epidermal differentiation of human keratinocytes in a sample of human epithelium. Such a method preferably comprises a step for determining the expression level of at least one miRNA in said keratinocytes.

  In accordance with the present invention, miRNAs are the following miRNAs identified by the inventors: hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR- 224, hsa-miR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425, hsa-miR-92b, hsa-let-7i, hsa-miR-22, hsa-miR- 221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c. These 19 miRANs are referred to as microRNA or miRNA in the present invention.

The expression level of the selected miRNA is compared with the average expression level of the miRNA in undifferentiated keratinocytes, preferably undifferentiated keratinocytes in culture, or differentiated epidermal keratinocytes.

  There are numerous methods for detecting and quantifying miRNA and are well known to those skilled in the art. Example 3 details the most used technology.

Preferably, the method comprises hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425, hsa-miR-92b, hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, determining the level of at least two different miRNAs selected from hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c, and determining the two levels as undifferentiated keratinocytes , particularly undifferentiated keratinocytes in culture, or two corresponding selected m the differentiated epidermal keratinocytes in Comprising comparing the average level of RNA.

  Instead, the method determines the expression level of some of the 19 miRNAs of the invention, eg, at least 3 or 5, or even 8, 10, 15 or 19 of the invention including determining the expression level of the miRNA and comparing the level so determined to, for example, the average level of corresponding miRNA expression in undifferentiated keratinocytes in culture or in differentiated keratinocytes. obtain.

The term “average expression level of miRNA in undifferentiated keratinocytes, especially in undifferentiated keratinocytes in culture or in differentiated epidermal keratinocytes” preferably represents the number of undifferentiated keratinocytes in culture. Or an expression level commonly observed in cells of this type, corresponding to an average expression level determined in at least 5 different keratinocytes, representative of the number of differentiated epidermal keratinocytes . Preferably it is an average of at least 10 measurements, or even 20 or 100 different measurements.

Preferably, the undifferentiated keratinocytes in culture or the differentiated epidermal keratinocytes in question are keratinocytes derived from the same strain or the same population as the keratinocytes under investigation.

  In the context of performing the above method, the keratinocytes under investigation are hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa. An expression level of at least one miRNA selected from miR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425 and hsa-miR-92b is an undifferentiated keratinocyte, For example, if it is greater than the mean level of expression of the miRNA in cultured undifferentiated keratinocytes, it is considered differentiated or undergoing differentiation.

  The term “statistically greater” means that the observed difference is significant from a statistical point of view, in particular greater than the standard deviation. A value is considered statistically greater than the other if the difference between the two points is greater than the uncertainty present in the measurement.

  Preferably, the upper level is at least 20%, preferably at least 50% greater than the average level. According to a particularly preferred embodiment, the expression level of the selected miRNA is at least equal to 1.5 times the average level of said miRNA, preferably more than 2 times the average level of the selected miRNA.

  Preferably, hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa-miR The expression level of at least one of the miRNAs selected from -361-5p, hsa-miR-425 and hsa-miR-92b is statistically determined under the culture used to obtain the average expression level of the miRNA. Greater than any of the miRNA expression levels in all undifferentiated keratinocytes.

  According to a preferred embodiment of the method of the present invention, hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa- The average level of at least two miRNAs selected from miR-26b, hsa-miR-361-5p, hsa-miR-425 and hsa-miR-92b is the average expression level of said miRNA in undifferentiated keratinocytes Bigger than. Preferably this is hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa-miR-361-5p, This is the case for at least 3, or even 5 or 8, or even all of the miRNA from the list consisting of hsa-miR-425, hsa-miR-455-3p and hsa-miR-92b.

Instead, hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR- If the expression level of at least one miRNA selected from 30a and hsa-miR-30c is substantially the same as the expression level of said miRNA in a differentiated epidermal keratinocyte, the keratinocyte being investigated is It may also be concluded that it is differentiated or undergoing differentiation. Preferably, this is hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa- This is the case for at least two miRNAs selected from miR-30a and hsa-miR-30c, or even 3, 5, 8 or all.

  The term “substantially the same level” means that the observed level difference is not statistically significant, eg, less than the uncertainty in measuring the expression level of the miRNA.

In contrast, in the context of practicing the method of the invention, hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, The expression level of at least one miRNA selected from hsa-miR-663, hsa-miR-30a and hsa-miR-30c is statistically greater than the average expression level of said miRNA in differentiated epidermal keratinocytes In some cases, the keratinocytes under investigation are considered to be undifferentiated or slightly differentiated keratinocytes.

In a preferred embodiment, hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR The average level of at least two miRNAs selected from -30a and hsa-miR-30c is greater than the average expression level of the miRNA in differentiated epidermal keratinocytes. Preferably, this is hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa- This is the case for at least 3, or even 5 or 8, and in all cases of miRNA from the list consisting of miR-30a and hsa-miR-30c.

Instead, hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa- When the expression level of at least one miRNA selected from miR-361-5p, hsa-miR-425 and hsa-miR-92b is the same as the expression level of the miRNA in undifferentiated epidermal keratinocytes, It may be concluded that the keratinocytes under investigation are in a non-differentiated state, also called undifferentiated, or in a slightly differentiated state. Preferably, this is hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, This is the case for at least two, or even three, five, eight or all miRNAs selected from hsa-miR-361-5p, hsa-miR-425 and hsa-miR-92b.

The invention also relates to a method for assessing differences in epidermal differentiation present in human epithelial samples. The method can be used to characterize the differentiation state of the sample and thus determine, for example, whether normal human epithelium is normal differentiation or exhibits pathological characteristics.

According to the method of the present invention, it is possible to determine the difference in epidermal differentiation present between the two layers of the epithelial keratinocytes, i.e. the differences present in these two layers with respect to epidermal differentiation, It is possible to define whether the state is more differentiated than another layer of epithelium, or vice versa.

The inventive method for assessing the difference in epidermal differentiation is as follows: hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR- between the two layers of keratinocytes in the epithelium. 182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425, hsa-miR-92b, hsa-let-7i, hsa-miR- 22, at least one selected from hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c A step for comparing the expression levels of the miRNAs.

Indeed, as defined above, the inventors have shown that the expression present in these 19 miRNAs, referred to as miRNAs of the invention in highly differentiated keratinocytes, and in undifferentiated keratinocytes. It reveals the major differences in levels. Studies of differences in the expression levels of these miRNAs therefore mean that there is a difference between the level of epidermal differentiation of the layer compared to another layer of epithelial keratinocytes being investigated.

Although a difference in the expression level of several miRNAs between the two layers can be established, as soon as there is a significant difference in expression level in one layer for at least one of the miRNAs of the invention compared to the other The difference in epidermal differentiation becomes clear.

In accordance with the present invention, in particular hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa-miR in one layer compared to the other. Difference in epidermal differentiation between two layers due to at least one greater expression of miRNA selected from -26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425 and hsa-miR-92b Is characterized. The difference in expression of the selected miRNA must be on the order of magnitude such that this difference is significant from a statistical point of view.

  Preferably, the difference in the expression level of the selected miRNA is 1.3 times or more preferably 1.5 times or more, or even 2 times or more.

In a preferred embodiment of the invention, the difference in epidermal differentiation between the two layers of epithelium is greater in one layer compared to the other in hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa. Selected from a list consisting of -miR-182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425 and hsa-miR-92b Preferably at least 3 times, or even at least 5 or 8 times greater expression of at least 2 different miRNAs, or greater expression of 10 miRNAs on this list. The difference in the expression level of miRNA in one layer compared to the other layer is not necessarily the same multiple for all miRNAs in the list.

According to this method, the difference in epidermal differentiation between the two layers is the difference between hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a in one layer compared to the other. , Hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c may also be characterized by greater expression of at least one miRNA. Again, the expression levels referred to mean differences that are significant from a statistical point of view.

  Preferably, the difference in the expression level of the selected miRNA is 1.3 times or more, preferably 1.5 times or more, more preferably 2 times or more.

In a preferred embodiment of the invention, the difference in epidermal differentiation between the two layers of the epithelium is greater in one layer compared to the other in hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR. Preferably at least two different miRNAs selected from the list consisting of -222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c, Is characterized by at least 3-fold, or even at least 5-, or 8-fold greater expression, or greater expression of 9 miRNAs in this list. The difference in the expression level of miRNA in one layer compared to the other layer is not necessarily the same multiple for all miRNAs in the list.

In the context of the present invention, the epidermis sample of the skin or epidermis in question can be from different sources; for example, from an epithelium in culture such as a “reconstructed skin” type of reconstructed epithelium, Or, for example, from a sample obtained from an individual, such as from a biopsy. Said sample can therefore be derived from human skin.

  Comparison of the expression level of at least one miRNA of the invention can be performed between two layers of the epithelial sample under investigation. In the case of human skin samples, it is preferably performed between two opposing layers of keratinocytes, for example between the keratinocytes of the basal layer and the keratinocytes of the epithelial stratum corneum. In this regard, recent studies indicate that keratinocytes produce or contain miRNA.

  Comparison of expression levels can also be performed between two layers of samples in close proximity, for example to also highlight different stages of differentiation.

The present invention also relates to various applications of the above-described characterization methods, and thus, particularly as a diagnostic tool for physiological or pathological differentiation disorders, as a target to correct epidermal differentiation defects or to test epidermal differentiation modulator agents Relates to various uses of the miRNA signature highlighted by the inventor as a screening tool.

In a second aspect, the present invention relates to a method for determining a therapeutic effect performed on the epithelium. Such methods include comparison of miRNA signatures of epithelial epidermal differentiation before and after treatment. Thus, hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa- in the epithelial keratinocytes before and after treatment. miR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425, hsa-miR-92b, hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa- Comparing the expression level of at least one miRNA selected from miR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c.

The present inventor has actually found a change in the expression levels of these 19 pieces of miRNA in the process of epidermal differentiation occurring in the epidermis. Correction of at least one level of the miRNA is thus representative of correction of the differentiation state in response to the test treatment. Once again, correction of the expression level is significant from a statistical point of view, and thus is sufficient and reproducible, meaning that it is observed in a significant number of representative keratinocytes of the epithelium under investigation .

Instead, the method of determining the therapeutic effect applied to the epithelium in the context of the present invention may also include a comparison of the epidermal differentiation differences before and after the test treatment. Therefore, according to the method change, the difference in epidermal differentiation existing between the two layers of epithelium before treatment and the obtained results are compared with the difference in epidermal differentiation existing between the same two layers after treatment. Thus, this test treatment is, for example, by reducing the difference in the differentiation state between the two layers, i.e. by reducing the level of expression of the miRNA of the invention between the two layers or by the difference in epidermal differentiation. By reducing, it is decided whether or not to correct the difference existing between the two layers.

  The test treatment by this method can consist of any treatment. Preferably, it relates to topical application of the molecule by application or preferably subcutaneous injection. The molecules applied can be simple chemical components or combinations or associations of different components, active ingredients, natural molecules, proteins, RNA, DNA, essential oils, chemical components from natural extracts, complex formulations, DNA molecules, miRNA , SiRNA, miRNA inhibitors, especially antagomir and the like.

  Particular molecules that are particularly preferred in the context of the test treatment of the present invention are molecules that modify the expression of RNA, in particular miRNA, or miRNA, or in particular natural miRNA such as antagomir.

  It also relates to the application of electromagnetic radiation independent of wavelength such as, for example, visible, UV, IR or X-ray. The treatment of the present invention also includes the application of various mechanical effects.

  The methods of the invention are considered effective if they cause a modification of the expression level of at least one miRNA of the invention in the epithelium under investigation. Preferably, the treatment is considered effective if it causes a modification of the expression level of at least 2 or even at least 5 of the miRNA in the epithelium. Said treatment may cause a modification of the expression level of at least 10, 15 or even 19 miRNAs of the invention. The correction of the expression level of the miRNA of the present invention is not necessarily the same for all miRNAs.

  Preferably, in the context of the present invention, the test treatment comprises hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa-miR-26a. Modification of the expression level of at least one miRNA selected from hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425 and hsa-miR-92b, hsa-let-7i, hsa- at least selected from miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c When triggered with a modification of the expression level in the opposite direction to that of a single miRNA It may be considered to be effective. Thus, effective treatment in the context of the present invention includes, for example, hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa An increase in the expression level of at least one miRNA selected from miR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425 and hsa-miR-92b, and simultaneously hsa-let -7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c May also cause a decrease in the expression level of at least one miRNA selected from .

With the method for determining the therapeutic effect of the present application, it is also possible to quantify beneficial effects with respect to the effect of drugs, in particular cosmetic products, for example cosmetic compositions, on the state of epidermal differentiation of the skin . The above in vitro determination method can be used in a test protocol to determine a product that can be quantified as an agent that actually has an effect on the state of proliferation or differentiation of cutaneous keratinocytes.

In addition, this test can be used to promote the product to the consumer by providing the full results obtained with the product using the determination method described in the present invention. Evaluation of the effect on the state of epidermal differentiation will be based on the study of the expression of miRNA of the present invention. Thus, the present invention also provides a method that can be used to recommend a product by demonstrating the effect in a test protocol constructed by the determination method described above. Thus, the present invention also relates to a method for the promotion of a beauty product that consists of a determination of the effect, action or properties of said product as indicated by at least one test carried out as described above.

  Such products can be facilitated using any transmission pathway. It can be implemented directly by the sales clerk by the point of sale or by radio and television, especially in the context of advertising. It can also be done via print media or by any other document (sample), especially for public relations purposes. It can also be facilitated via the Internet or via any other suitable computer network. It can also be made directly on the product, especially the container or any other instructions that may accompany it.

In a third aspect, the invention also relates to various methods for screening molecules for effects in the epidermal differentiation process.

In particular, the invention relates to a method for screening for modulators of the epidermal differentiation process in the epithelium comprising assessing the state of epidermal differentiation of keratinocytes in said epithelium before and after application of the modulator to be screened.

  Such screening processes can be performed in vivo, ex vivo, or in vitro, for example, on a sample in culture or on an epithelial sample.

Evaluation of the state of epidermal differentiation of keratinocytes in the epithelium is performed using one of the methods described in the first aspect of the invention.

  As noted above, the epithelium referred to herein can be an epithelium in culture, eg, a “reconstructed skin” type of reconstructed epithelium, or a sample obtained from a human, eg, during a biopsy.

Instead, the present invention also relates to a method for screening for a modulator of the epithelial epidermal differentiation process, comprising evaluating the difference in epithelial epidermal differentiation before and after application of the modulator to be screened.

Evaluation of the difference in epidermal keratinocyte differentiation is performed using one of the methods according to the first aspect of the invention.

  The modulator in question can be, for example, any chemical component derived from or synthesized from a natural extract, which is a complex formulation, a DNA molecule, a miRNA, a siRNA or a miRNA inhibitor such as, for example, antagomir It can be an agent. Obviously, this list is not comprehensive.

  Alternatively, the modulator may be a measurement system using electromagnetic radiation, preferably visible, UV, IR or X irradiation, or a system using mechanical effects.

In a fourth aspect, the present invention also relates to a method of diagnosing the state of the epidermis by using the miRNA signature discovered by the present invention. Such a diagnostic method determines the difference in epithelial differentiation present in the epidermis between the basal and stratum corneum and averages the epidermal differentiation present in the same type of normal epidermis between the basal and stratum corneum. Includes comparison of differences.

The determination of the difference in epidermal differentiation is preferably carried out using the various methods described in the first aspect of the invention. Preferably it is performed on a sample of the skin epidermis to be diagnosed.

The average difference in epidermal differentiation between the basal and stratum corneum present in the same type of normal epidermis is that of normal and diagnosed epidermis , several epidermis samples from specimens with the same type of skin In accordance with the average value of the various measurements carried out. The term “same type” means equivalent age, ethnicity and color. It is an average value corresponding to a “normal” or “healthy” state without epidermal lesions or disorders.

  This diagnostic method creates and compares miRNA profiles of the skin to be diagnosed, thereby comparing premature aging, damage caused by UV aging or solar radiation, aging or damage caused by stress, acne or any other physiology Or pathological disease.

In another aspect, the present application provides hsa-miR-455-3p, hsa-miR-141, hsa-miR- in keratinocytes in a sample of human epithelium for determining the state of epidermal differentiation of keratinocytes. 148a, hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425, hsa-miR-92b, hsa-let- From 7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c It also relates to the use of an assay of at least one expression of the selected miRNA.

The inventor actually provides access to the miRNA signature of epidermal differentiation.

In a particularly preferred use, at least 2, preferably at least 5, 8, 10, 12, or 15 of the 19 miRNAs of the invention are assayed. For example, the 19 miRNA assay of the present invention can be used for the determination of the state of epidermal differentiation of the keratinocytes being tested.

  In yet another aspect, the present application provides hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa-miR. -26b, hsa-miR-361-5p, hsa-miR-425, hsa-miR-92b, hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR At least one miRNA selected from -29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c, and / or at least one modulator of the expression of said miRNA, And more specifically a variety of inhibitors of miRNA such as antagomir Description and relates to the therapeutic use.

In fact, because of the importance of the miRNA in the skin epidermal differentiation process, regulation of their levels in keratinocytes is by slowing it down, for example, to slow down or accelerate the stratum corneum renewal process Or, conversely, acceleration can affect epidermal differentiation. Modulating the level of miRNA of the invention in keratinocytes is more preferably to increase the amount in keratinocytes, particularly by using miRNA to calibrate the endogenous dysregulation of miRNA. This is done by introducing one or another of the miRNAs of the invention. Modulation also preferably targets at least one modulator of the miRNA, such as antagomir, that targets one of the miRNAs of the invention to reduce levels in keratinocytes. Of miRNA inhibitors. Other miRNA inhibitors that may be envisaged, particularly in the context of the present invention, are miRCURY LNA ™ microRNA knockdown probe (Exiqon) and Qiagen's miScript miRNA inhibitor.

In a preferred embodiment, the invention targets a miRNA selected from the 19 miRNAs of the invention, or the miRNA targeting the miRNA for therapeutic use to treat an epidermis differentiation program skin disease. It relates to modulators, particularly related to miRNA inhibitors such as antagomir. The associated pathology is preferably a pathology that causes an abnormality in epidermal differentiation.

  More specifically, the pathologies considered in the context of the present invention are psoriasis, atopic dermatitis, acne, ichthyosis, Netherton syndrome, pore erythema, keratosis, Darier's disease, palm It is keratoderma and sweat keratosis.

  Preferably, the present invention provides at least 2, further 3, preferably at least 5, 10, 15 or equally 19 miRNAs, or inhibitors of miRNAs, in particular of these, for the therapeutic applications described above. It relates to a composition comprising at least some antagomir of miRNA.

With regard to the therapeutic application of the present invention, if the desired therapeutic effect consists of an increase in the state of epidermal differentiation of the skin to be treated, in a preferred embodiment, the present invention is an epidermal differentiation program for use in therapy, preferably For the treatment of dermatoses associated with, in particular, psoriasis, atopic dermatitis, acne, ichthyosis, Netherton's syndrome, pore erythema, keratosis, Darier's disease, palmokeratoderma and Hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa for treating pneumokeratosis A composition comprising at least one miRNA selected from miR-26b, hsa-miR-361-5p, hsa-miR-425 and hsa-miR-92b About. The present invention also provides hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa- in addition to or instead of the miRNA described above for use in the treatment of the pathology. Inhibitors of at least one miRNA, such as antagomir, that targets a miRNA selected from miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c It relates to the composition containing this. Other inhibitors of miRNA that are more specifically expected in the context of the present invention are the miRCURY LNA ™ microRNA knockdown probe (Exiqon) and Qiagen's miScript miRNA inhibitor.

  hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa-miR-361- At least 2 miRNAs from the list consisting of 5p, hsa-miR-425 and hsa-miR-92b, preferably at least 5, 8 or equally 10 miRNAs may be selected.

For situations that require stimulation of terminal differentiation, the composition or product for the therapeutic application mentioned is therefore:
At least one, preferably at least 2, 3, 5 or all miRNAs hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa- miR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425 and hsa-miR-92b, or modulators of these miRNAs that cause increased expression thereof; and / or in some cases,
miRNA hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa -Including miR-30c targeting, for example, inhibitors of miRNAs such as antagomir, or modulators of these miRNAs that cause suppression of their expression.

  More specific inhibitors of miRNA envisaged in the context of the present invention are antagomir, miRCURY LNA ™ microRNA knockdown probe (Exiqon) and Qiagen's miScript miRNA inhibitor.

In contrast, if the desired therapeutic effect is in another implementation, for example, to delay epidermal differentiation or to promote the proliferation ability of keratinocytes in the treated skin, the present invention is preferably epidermis. To treat dermatoses associated with the differentiation program, in particular, psoriasis, atopic dermatitis, acne, ichthyosis, Netherton syndrome, pore erythema, keratosis, Darier's disease, palmokeratoderma And hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa- for therapeutic use to treat pneumokeratosis It relates to a composition comprising at least one miRNA selected from miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c. The present invention also includes, in addition to or instead of the cited miRNA, hsa-miR-455-3p, hsa-miR-141, hsa-miR, for use in the treatment of said pathologies, such as, for example, antagomir. -148a, hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425 and hsa-miR-92b It relates to a composition comprising at least one inhibitor of miRNA that targets the miRNA.

  hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa- At least 2 miRNAs from the list consisting of miR-30c may be selected, preferably at least 4, 7 or equally 9 miRNAs.

For situations that require a decrease in terminal differentiation, the composition or product for the therapeutic application mentioned is therefore:
At least one, preferably at least 2, 3, 5 or all miRNA hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR- 29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c, or modulators of these miRNAs that cause increased expression thereof; and / or
miRNA hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa-miR-361 Including inhibitors of miRNAs that target one of -5p, hsa-miR-425 and hsa-miR-92b, eg, antagomir, or cause the suppression of their expression.

  Inhibitors of miRNA that are more specifically envisaged in the context of the present invention are antagomir, miRCURY LNA ™ microRNA knockdown probe (Exiqon) and Qiagen's miScript miRNA inhibitor.

  Preferably, the composition according to the invention for therapeutic use is formulated with a pharmaceutically acceptable carrier for topical application or ingestion.

  The present invention also includes hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa- miR-361-5p, hsa-miR-425, hsa-miR-92b, hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa- a miRNA selected from miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c, or a modulator of said miRNA, preferably for cosmetic application to non-pathological human skin, Inhibition of miRNAs such as antagomir targeting one of the miRNAs It contemplates the use of.

The various uses mentioned for therapeutic or cosmetic use preferably comprise topical application of a composition comprising a miRNA or a composition comprising said miRNA or an inhibitor of said miRNA, eg antagomir. Because of its small size, miRNA and its inhibitors can cross the keratinocyte membrane and modify the quantity of the miRNA in the keratinocytes being treated. Furthermore, because of their physicochemical properties, they can reach the deep layers of the skin and therefore cannot limit their action on the epidermis .

  The stability of miRNA and its inhibitors, particularly antagomir, indicates that its action is temporary, and therefore the present invention contemplates use in treatments or cosmetics, including updated applications on the skin being treated.

For this reason, the present invention particularly relates to hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa-miR- 26b, hsa-miR-361-5p, hsa-miR-425, hsa-miR-92b, hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR- A modulator of miRNA selected from 29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c and / or one expression of these miRNAs, preferably, for example, Of miRNAs like antagomir targeting one of the miRNAs Physiological including topical application to the skin of an individual harm agents, assume a method for treating diseases associated with epidermal differentiation in non-pathological cosmetic conditions.

According to a preferred embodiment of said method, the miRNA is used to increase the state of epidermal differentiation of the keratinocytes of the skin to be treated, hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa. -MiR-182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425 and hsa-miR-92b.

  At least 2 miRNAs, preferably at least 5, 8 or equally 10 miRNAs are hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR- 224, hsa-miR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425, hsa-miR-923, and hsa-miR-92b.

  Alternatively or additionally, at least one or even some one or more of hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa Inhibitors of miRNA targeting miRNAs selected from miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c may be selected. Inhibitors of miRNA that are more specifically envisaged in the context of the present invention are antagomir, miRCURY LNA ™ microRNA knockdown probe (Exiqon) and Qiagen's miScript miRNA inhibitor.

In contrast, if the desired effect is described in another embodiment, for example to delay epidermal differentiation or to promote the proliferative capacity of the keratinocytes of the skin to be treated, the present invention Hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa -It relates to a therapeutic method selected from miR-30c.

  At least 2 miRNAs, preferably at least 4, 7 or equally 9 miRNAs, hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, It can be selected from the list consisting of hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c.

  Alternatively or additionally, at least one, or even some of one or more hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224 Inhibition of miRNA targeting miRNAs selected from hsa-miR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425, hsa-miR-923 and hsa-miR-92b Agents can be selected. Inhibitors of miRNA that are more specifically envisaged in the context of the present invention are antagomir, miRCURY LNA ™ microRNA knockdown probe (Exiqon) and Qiagen's miScript miRNA inhibitor.

Diseases of epidermal differentiation in the cosmetic context are related to physiological conditions including age, skin sunstroke, scarring, skin dryness or hardening, or chemical loading, especially due to exfoliants, desquamating agents, or degreasing agents, or mechanical loading To do. These diseases are not pathological and their treatment is considered not a therapeutic treatment, but merely a treatment for cosmetic purposes, and the treatment of such diseases improves the appearance of the skin and the convenience of the individual The basic purpose is to do.

More specifically, age related diseases consist of a modification of epidermal differentiation related to life age. Indeed, during the aging process, the epidermis undergoes many changes that affect the epidermal differentiation process and the formation of a functional stratum corneum. A particular observation is a more limited number of basal epidermis thinning and cloneable cells, and thus a reduction in the growth compartment with a decrease in the number of epidermis rotations. With the expression of keratins 16 and 17 that are not observed in young, normal skin, conventional differentiation markers such as keratin expression profiles are corrected. The amount of keratin K1 and K15 as well as the major components of the retinal nucleus layer is reduced. The amount of transglutaminase 1 also decreases with age. Barrier function changes with increasing permeability.

Diseases associated with cutaneous sunstroke, or “photoaging,” extend to corrections in epidermal differentiation with chronic irradiation of sunlight. Photoaged skin is characterized by a look that is particularly similar to leather and a more pronounced wrinkle; this skin is also modified at the epidermal level with overexpression of keratins K6, K16, K17 and a decrease in filaggrin and transglutaminase Is done. These changes are associated with wrinkle formation. The SPRR protein involved in stratum corneum formation is also altered by UV. It is also known that acute irradiation of the sun results in epidermal modifications that affect barrier function and epithelial homeostasis.

Diseases associated with scarring extend to the modification of epidermal differentiation with the process of scarring and repair. During re-epithelialization that occurs after injury, all expression patterns of epithelial proteins are corrected. Complete repair occurs in three phases, an initial migration phase, then a proliferation phase and finally a differentiation phase. The proliferative phase involves wounds and thus follows the process of new morphogenesis of the epithelium, including players of keratinocyte stratification and differentiation, which can be used to regenerate a functional stratum corneum under normal conditions.

The diseases associated with dryness or dryness are in principle due to the fact that dry skin is basically characterized by a decrease in the oil content of the epidermis and a change in the stratum corneum. Keratins 1 and 10 decrease and keratinocytes K6 and K14 increase. The expression level of filaggrin is unstable, like involucrin.

In particular, chemical loading and mechanical loading due to exfoliants, desquamating agents or degreasing agents are factors for correction to epidermal homeostasis and induce changes in the barrier function provided by the stratum corneum. The process of normal epidermal differentiation can reconstruct epidermal homeostasis and normal barrier function.

  Upon application of preferably at least one, preferably at least two miRNAs of the present invention, or specific inhibitors of said miRNAs, treatment of various above-mentioned non-pathological diseases for cosmetic applications is possible. Is possible.

  Thus, the present invention also provides at least one miRNA of the present invention for expression of one of the miRNAs of the present invention to correct or ameliorate the appearance of the skin, its particles, its brightness, its defects or its micro undulations. Relates to a cosmetic composition or product comprising at least one modulator for the expression of, or indeed for the expression of one miRNA of the invention. A modulator of one expression of the miRNA of the present invention is an active ingredient that causes an increase or suppression of the expression of one of the miRNAs. Said active ingredient that modulates the expression of one of the miRNAs is identified, for example, by the screening method described above, or it is an mitag antagonist of the present invention.

  The cosmetic product or composition in question may be in any herbal form, for example formulated into milk, cream, gel, spray or soap for topical administration or orally digested. It can be a form to obtain.

  In particular, it may be a combination of various active ingredients, for example at least two miRNAs of the invention, or a modulator of a miRNA of the invention and a miRNA of the invention, or a combination of two miRNA modulators of the invention. It can also be a combination of active ingredients and equipment, in particular mechanical, optical or electrical or electromagnetic processing type machines.

  The present invention specifically contemplates beauty products known as “anti-aging” products to reduce surface defects associated with impaired differentiation and the leather-like appearance of aging skin. Certain cosmetic products for aging skin exposed to the sun are also envisaged to restore some quality by modifying the balance between proliferation and epithelial differentiation by the miRNAs of the invention or modulators of said miRNAs.

It also relates to a cosmetic aftersun product to offset the modification of differentiation induced by acute exposure to sunlight. Products capable of controlling coloring disorders by stimulating epidermal differentiation and keratinocyte desquamation are also envisioned to more quickly remove excess melanin that causes coloring disorders.

Other beauty products are also products made specifically for dry skin that have a moisturizing effect and regulate the final process of epidermal differentiation. Repair products for improving the skin repair process of scars are also envisaged in the context of the present invention. It is also possible to formulate products for evoked skin on a daily basis, such as in the context of specific procedures (after peeling, after laser, etc.) or contamination, household items, etc.

In situations requiring stimulation of terminal differentiation to increase barrier function and stratum corneum, a cosmetic composition or product in the sense of the present invention:
At least one, preferably at least 2, 3, 5 or all miRNAs hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa- miR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425 and hsa-miR-92b, or modulators of these miRNAs that cause increased expression thereof; and / or in some cases,
miRNA sa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa -Inhibitors of miR-30c, or modulators of these miRNAs that cause suppression of their expression. Inhibitors of miRNA that are more specifically envisaged in the context of the present invention are antagomir, miRCURY LNA ™ microRNA knockdown probe (Exiqon) and Qiagen's miScript miRNA inhibitor.

In situations requiring reduced terminal differentiation and reduced stratum corneum formation, a cosmetic composition or product in the sense of the present invention:
At least one, preferably at least 2, 3, 5 or all miRNA hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR- 29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c, or modulators of these miRNAs that cause increased expression thereof; and / or
miRNA hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa-miR-361 Inhibitors of -5p, hsa-miR-425 and hsa-miR-92b, or modulators of these miRNAs that cause suppression of their expression. Inhibitors of miRNA that are more specifically envisaged in the context of the present invention are antagomir, miRCURY LNA ™ microRNA knockdown probe (Exiqon) and Qiagen's miScript miRNA inhibitor.

  The present invention also includes hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa- miR-361-5p, hsa-miR-425, hsa-miR-92b, hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa- including means for assaying the expression of at least one miRNA selected from miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c and information providing a reference level of said miRNA The invention relates to a kit for determining the differentiation state of human keratinocytes.

  A particularly preferred kit in the context of the present invention is the mean level of expression of said miRNA in non-differentiated keratinocytes in culture, the reference level.

Instead, the kit according to the invention can be used at a reference level corresponding to the average level of expression of the miRNA in differentiated epidermal keratinocytes.

  The various preferred implementations described more specifically for one or other aspects of the invention also apply to other aspects of the invention. In particular, as described by the methods, processes, kits, compositions and uses of the present invention, it is always at least two miRNAs selected from the list of 19 miRNAs of the present invention, preferably at least 3, 5, 9, 10, 15 or even 19 miRNAs of the present invention: hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa -MiR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425, hsa-miR-92b, hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa -MiR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, It is preferable to determine the expression levels of sa-miR-30a and hsa-miR-30c.

Materials and Methods Monolayer cultures of human keratinocytes Normal human epidermal keratinocytes are derived from mast formation and are cultivated routinely using Rheinwald and Green's method in mitomycin-treated Swiss 3T3 fibroblast trophoblasts. .

Reconstructed skin In vitro reconstructed skin containing stratum corneum and stratified differentiated epidermis with living equivalent dermis was produced with normal human keratinocytes and normal human dermal fibroblasts.

Briefly, equivalent dermis was produced with bovine collagen I and 1 million human skin fibroblasts. Normal keratinocytes were seeded after reduction of the lattice in an amount of 500,000 keratinocytes and cultured in conventional medium for 7 days. The culture was then loaded onto an emerging phase screen (gas phase liquid phase interface, 7 days).

  At the end of this period, the skin morphology was very similar to normal human skin. It can then be used for various experiments while maintaining the subdermal medium cultured by capillary rise.

Extraction of total RNA from keratinocytes Cell degradation:
Keratinocytes in monolayer cultures were degraded in culture dishes in TriReagent buffer.
Reconstructed epidermis from reconstructed skin was separated from equivalent epithelium using tweezers. The epidermis was manually crushed in a glass homogenizer in TriReagent degradation buffer.

Extraction of total RNA Total RNA was extracted using conventional techniques of extraction with a guanidine isothiocyanate solution followed by a phenol / chloroform mixture.

miRNA Hybridization on μParaflo ™ “MiRHuman 10.0” Chip Short RNA was extracted from total RNA (Microcon filter, Millipore) and extended at the 3 ′ end with poly A ends. A fluorescently labeled oligonucleotide was attached to the poly A terminus. The short labeled RNA was then hybridized on a μParaflo ™ “MiRHuman 10.0” chip (Atomic Technologies, LC Sciences). They contained all the complementary sequences of human miRNA recorded in miRBase 10.0 (711 mature miRNAs). The array was deposited 5 times on the chip. Fluorescence was quantified and signal normalized. The amount of fluorescence reflected the expression level of each miRNA in the sample.

Statistical Analysis expression of each miRNA, using Student's t-test for (p <0.05), were statistically compared between "cultured keratinocytes" samples and "rebuilding epidermal keratinocytes".

Example 1: List of 10 miRNAs overexpressed in differentiated reconstructed epidermal keratinocytes compared to non-differentiated monolayer cultured keratinocytes

Three lines of mammogenic human primary normal human keratinocytes were used in the study (PH202, PH64 and PH63). The expression of all known human miRNAs in monolayer cultured keratinocytes, ie non-differentiated keratinocytes (2D), reconstructed epidermal samples with 3 keratinocytes (3D) at the same time was quantified.

The expression of each miRNA was statistically compared between “keratinocytes” and “reconstructed epidermal keratinocytes” samples in culture using Student's t-test providing an established p. Each miRNA quoted in Table 1 had a statistically greater level (p <0.05) in the epidermis compared to undifferentiated keratinocytes for each cell line tested. An expression ratio of 3D / 2D was obtained for each strain. For example, miR-141 on average was 2.3 times more abundant in reconstructed epidermal keratinocytes than monolayer cultured keratinocytes.

表１：単層培養（２Ｄ）、すなわち、非分化の角化細胞と比較した再構築表皮（３Ｄ）、すなわち、分化した角化細胞中で過剰発現したｍｉＲＮＡ。

Table 1: Monolayer culture (2D), ie reconstructed epidermis (3D) compared to undifferentiated keratinocytes, ie miRNA overexpressed in differentiated keratinocytes.

Example 2: List of 9 miRNAs overexpressed in undifferentiated keratinocytes in monolayer culture compared to differentiated reconstructed epidermal keratinocytes.

Three lines of primary normal human keratinocytes of mammogenesis were used in this study (PH202, PH64 and PH63). The expression of all known miRNAs was quantified in keratinocytes cultured as monolayers, ie in reconstructed epidermis with these identical keratinocytes and at the same time. The expression of each miRNA was statistically compared between the “cultured keratinocyte” and “reconstructed epidermal keratinocyte” samples using a Student's t-test that produced a probability p. Each miRNA cited in this table had a statistically greater level in undifferentiated keratinocytes compared to reconstructed epidermal keratinocytes (p <0.05) for each cell line investigated. An expression ratio of 2D / 3D was obtained for each strain. As an example, miR-29b, on average, was 6.7 times more abundant in monolayer cultured keratinocytes than in reconstituted epidermal keratinocytes.

表２：再構築表皮（３Ｄ）、即ち、分化角化細胞と比較した単層培養（２Ｄ）、即ち、非分化において過剰発現しているｍｉＲＮＡ。

Table 2: Reconstructed epidermis (3D), ie monolayer culture (2D) compared to differentiated keratinocytes, ie miRNAs that are overexpressed in non-differentiated.

Example 3: Method for detecting miRNA.
Northern Blot This conventional technique is qualitative and quantitative. It can analyze several miRNAs during one experiment. This method requires the use of 5 to 50 μg of total RNA.

RT Q-PCR
This method can investigate miRNA precursors and has been applied to investigate mature miRNAs. It is a commercial method (Applied Biosystems Tackman MicroRNA Assay) and has been described in several references [23].

miRNA Microassay This method uses a fluorescent label for the cDNA complementary to the sample miRNA, such as that of a conventional mRNA microarray, and the labeled cDNA on the slide where the known miRNA sequence is located. Based on hybridization [25].

  According to some authors, this miRNA microarray technology should be an option for analysis of the overall expression profile of miRNA when regularly integrating new sequences of miRNA from miRBase .

  Furthermore, in some situations as the present invention, the miRNA expression profile is more beneficial than the messenger RNA expression profile.

In situ hybridization of miRNA This technique uses conventional binding methods to allow short RNA to diffuse out of long RNA and be lost during the hybridization and washing process. It is also difficult. Techniques have been developed to overcome this problem; in addition, miRNA probes are commercially available (Exiqon, Denmark) [27].

miRNA reporter transgene In this technique, the GFP or LacZ reporter gene was placed under the control of a promoter containing the complementary 3'UTR portion of the miRNA.

References
1. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function.Cell 2004; 116: 281-97.
3. Alvarez-Garcia I, Miska EA. MicroRNA functions in animal development and human disease.Development 2005; 132: 4653-62.
4. O'Donnell KA, Wentzel EA, Zeller KI, etc. c-Myc-regulated microRNAs modulate E2F1 expression. Nature 2005; 435: 839-43.
5. Fazi F, Rosa A, Fatica A, etc. A minicircuitry comprised of microRNA-223 and transcription factors NFI-A and C / EBPalpha regulates human granulopoiesis. Cell 2005; 123: 819-31.
8. Yi R, O'Carroll D, Pasolli HA etc. Morphogenesis in skin is governed by discrete sets of differentially expressed microRNAs. Nat Genet. 2006; 38: 356-62.
10. Wenguang Z, Jianghong W, Jinquan L et al. A subset of skin-expressed microRNAs with possible roles in goat and sheep hair growth based on expression profiling of mammalian microRNAs. OMICS. 2007; 11: 385-96.
11. Yi R, Poy MN, Stoffel M et al. A skin microRNA promotes differentiation by repressing 'stemness'. Nature 2008; 452: 225-9.
12. Sonkoly E, Wei T, Janson PC, etc. MicroRNAs: Novel Regulators Involved in the Pathogenesis of Psoriasis? PLoS.ONE. 2007; 2: e610.
13. Felicetti F, Errico MC, Bottero L et al. The promyelocytic leukemia zinc finger-microRNA-221 / -222 pathway controls melanoma progression through multiple oncogenic mechanisms. Cancer Res 2008; 68: 2745-54.
14. Ishida-Yamamoto A, Tanaka H, Nakane H et al. Inherited disorders of epidermal keratinization. J Dermatol Sci 1998; 18: 139-54.
15. Hoffjan S, Stemmler S. On the role of the epidermal differentiation complex in ichthyosis vulgaris, atopic dermatitis and psoriasis. Br J Dermatol 2007; 157: 441-9.
17. Ghadially R, Brown BE, Sequeira-Martin SM, etc. The aged epidermal permeability barrier. Structural, functional, and lipid biochemical abnormalities in humans and a senescent murine model. J. Clin. Invest 1995; 95: 2281-90.
18. Harding CR. The stratum corneum: structure and function in health and disease.Dermatol Ther 2004; 17 Suppl 1: 6-15.
19. Marionnet C, Bernerd F, Dumas A et al. Modulation of gene expression induced in human epidermis by environmental stress in vivo. J Invest Dermatol 2003; 121: 1447-58.
23. Chen C, Ridzon DA, etc. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res 2005; 33: e179.
25. Vagin VV etc. A distinct small RNA pathway silences selfish genetic elements in the germline. Science 2006; 313: 320-324.
27. Takada S et al. Mouse microRNA profiles determined with a new and sensitive cloning method. Nucleic Acids Res 2006; 34: e115.

Claims (16)

A method for determining the state of epidermal differentiation of human keratinocytes in a sample of human epithelium, comprising hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a in said keratinocytes. Hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425, hsa-miR-92b, hsa-let-7i , Hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c Determining the expression level of at least one miRNA that is selected, and favoring the expression level of the selected miRNA. The method comprises comparing the same strain or obtained from the same population, the average level of expression of a miRNA selected in the undifferentiated keratinocytes or differentiated epidermal keratinocytes in culture are.   hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa-miR-361- The level of expression of at least one miRNA selected from 5p, hsa-miR-425 and hsa-miR-92b is statistically greater than the mean level of expression of said miRNA in undifferentiated keratinocytes in culture 2. The method of claim 1, wherein said keratinocytes are considered differentiated.   hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa- If the level of expression of at least one miRNA selected from miR-30c is statistically greater than the mean level of expression of the miRNA in differentiated epidermal keratinocytes, the keratinocytes are undifferentiated The method of claim 1, which is considered. A method for evaluating the difference in epidermal differentiation present in a sample of human epithelium, comprising: hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a between two layers of epithelial keratinocytes Hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425, hsa-miR-92b, hsa-let-7i , Hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c is the comprising comparing the level of expression of at least one miRNA, methods. The difference between the two layers of the epidermis differentiation, the size has factors than 1.3, hsa-miR-455-3p in one layer, hsa-miR-141, hsa -miR-148a, hsa-miR-182, Expression of at least one miRNA selected from hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425 and hsa-miR-92b The method of claim 4, further comprising: 2 The difference between the layers of the epidermis differentiation, the size has factors than 1.3, hsa-let-7i in one layer, hsa-miR-22, hsa -miR-221, hsa-miR-222, hsa- The expression of at least one miRNA selected from miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c is greater than the other. 4. The method according to 4. 7. A method according to any one of claims 1 to 6, wherein the sample is obtained from "reconstructed skin" type cultured epithelium. A method for determining the efficacy of epithelial treatment, comprising: hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR in the keratinocytes of the epithelium before and after the treatment. -182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425, hsa-miR-92b, hsa-let-7i, hsa-miR -22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c the method comprising comparing One expression levels.   9. A method according to claim 8, wherein the treatment consists of topical application or injection of molecules by application of radiation or by application of mechanical effects. 10. A method according to claim 8 or claim 9, wherein the treatment is considered effective if it causes a modification of the expression level of at least one of the miRNAs in the epithelium. A method for screening for a modulator of the epidermal differentiation process in the epithelium using the method according to any one of claims 1 to 3 before and after application of the modulator to be screened. and evaluating the state of the epidermal cell differentiation methods. It said modulator, natural extracts, complex concentrates, DNA molecules, miRNA, siRNA, miRNA inhibitor is a chemical component obtained from the measurement system using a morphism antagomir or irradiation method according to claim 11. 13. The method of claim 11 or claim 12, wherein a modulator is identified if it causes a modification of at least two expression levels of the miRNA in the epithelium. Using the method according to any one of claims 4 to 7 to determine the difference in epidermal differentiation present in the epidermis between the basal layer and the stratum corneum;
A method for assessing the state of the epidermis comprising comparing it to the average difference in epidermal differentiation present in the same type of normal epidermis between the basal and stratum corneum.   Hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182 in keratinocytes in human epithelial samples to determine the state of epidermal differentiation of keratinocytes hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425, hsa-miR-92b, hsa-let-7i, hsa-miR-22, at least one miRNA selected from hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c Use of an expression assay. hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa-miR-361- 5p, hsa-miR-425, hsa-miR-92b, hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, A human horn comprising means for assaying the expression of at least one miRNA selected from hsa-miR-663, hsa-miR-30a and hsa-miR-30c and information providing a reference level of expression of said miRNA A kit for determining the differentiation state of a cell.