JP5661148B2 - Bio-optical imaging probe - Google Patents

Description

  The present invention relates to a novel biological optical imaging probe.

  Understanding the reactions and dynamic processes of biomolecules that function in living organisms at the molecular level is the most important issue in current life science research. In recent years, “biomolecule imaging” that visualizes biomolecules while living organisms are alive has been actively used. Biomolecular imaging techniques include biophotonic imaging techniques as well as PET, SPECT, MRI, and the like. This method has a high S / N ratio as compared with other molecular imaging methods and is advantageous in terms of convenience, safety, and cost, and therefore has been actively studied. In biomolecular imaging, it is very important to select the imaging probe to be used as well as the equipment used for molecular imaging. In other words, the development of useful imaging probes is a major key in the progress of biomolecular imaging.

  On the other hand, accurately diagnosing hypoxic conditions including ischemic conditions is extremely important for treating diseases such as myocardial infarction and cerebral infarction for which there is no effective treatment method only in the initial stage. In addition, if it is possible to quickly and accurately determine hypoxia due to abnormal cell growth before refractory cancer, it is very useful for early clinical diagnosis and pathological elucidation of cancer. .

  However, conventional imaging probes that use proteins or low molecular weight compounds that are chemically labeled with fluorescent dyes have low tissue penetration and intracellular reach, especially in hypoxia and ischemic tissues. The efficiency of transportation to sites with poor blood circulation was extremely poor. Therefore, it has been difficult for conventional imaging probes to image hypoxic regions and ischemic tissues.

  Further, in the conventional imaging probe, the signal-to-noise ratio is lowered due to the long residence time of the fluorescent dye in the tissue, and the accuracy of the obtained image is not high. Furthermore, the function of the probe itself may be suppressed by fluorescent labeling. Furthermore, when a conventional probe is used in biophotonic imaging, since the pigment excretion in the kidney and liver is slow, a high background continues for a long time, and it is difficult to image the trunk. Therefore, a more effective biological optical imaging probe has been desired.

Hypoxia inducible factor -1 (H ypoxia- I nducible F actor -1 complex, hereinafter HIF-1) is decomposed positively in aerobic conditions, a protein present only stable under hypoxic conditions. This is the stability of the control is required specific area across 401AA~603AA of HIF-l [alpha] protein (see Non-Patent Document 1), this region is referred to as ODD domain (O xygen D ependent D egradation domain ). The ODD domain is controlled by a cellular oxygen sensor, and the hypoxic state in which the ODD protein is stabilized is a concentration that is pathologically below the optimal oxygen concentration of the cell. It can be said that the cell in which the ODD protein is stabilized is in a hypoxic state that is abnormal for at least that cell (see Patent Document 1).

  It is known that a fusion protein obtained by fusing an ODD domain with an arbitrary protein is subject to the same enzyme-dependent stability control as the HIF-1 protein (see Non-Patent Document 2). Since a protein fused with ODD undergoes oxygen-specific degradation in normal cells, it is expected to function as an ischemic focus-specific marker as a result.

Until now, it has been difficult to deliver a drug to the ischemic lesion in the brain with a brain protective agent alone in the acute phase of cerebral infarction. The reason is alone in normal blood-brain barrier; be (B lood- B rain B arrier below BBB) impossible to transmit the drug, ischemia late (3 hours later) for BBB to collapse This is because the BBB remains maintained in the early stage of ischemia (within 3 hours) and the drug does not migrate to the brain tissue (see Non-Patent Documents 3 and 4).

For the purpose of delivering a neuroprotective agent to ischemic brain tissue, brain-derived neurotrophic factor of the brain protective effect; the (B rain- D erived N eurotrophic F actor following BDNF) to bind the antibody to the transferrin receptor, vascular endothelial There is a report that the BBB passage through the transferrin receptor of cells is realized in a rat middle cerebral artery occlusion model (see Non-Patent Document 3). However, although BBB permeates, cell-selective drug delivery in ischemic tissue cannot be performed, so that side effects cannot be expected to be suppressed.

  On the other hand, it has been reported that a protein fused with a membrane permeation domain derived from the human immunodeficiency virus TAT protein can permeate the cell membrane independently of the receptor and carry the protein into cells throughout the body. Moreover, it was shown that the fusion protein can also penetrate the BBB and be delivered to the brain (see Non-Patent Documents 5 and 6).

International Publication No. 2002/099104 Pamphlet

Huang LE et al. , Proc. Natl. Acad. Sci. USA. 95; 7987-7992 Harada et al. , Cancer Res. 62, 2013-2018, 2002 Zhang Y. et al. , Stroke, 2001 Jun; 32 (6): 1378-84. Belayev L.M. et al. Brain Res. , 1996; 739, 88-96. Schwarze S. et al. , Science, 285: 1569-1572, 1999. Ota Shigeo, J.H. Nippon Med. Sch. 2003; 70 (5)

  A high quality biological optical imaging probe is desired. Especially for biophotonic imaging where fluorescent dyes are rapidly discharged from the kidney and liver, and can rapidly penetrate and reach ischemic tissues and other tissues where blood flow is difficult A probe is desired.

  The present inventors have conducted various studies on probes suitable for biological optical imaging. As a result, surprisingly, when fluorescent dyes are indirectly labeled using protein ligand binding, reproducible preparation of high-quality biological optical imaging probes with extremely short residence times in the liver, kidney, etc. I found out for the first time.

  As a result of further intensive studies based on these findings, the present inventors have completed the present invention.

That is, the present invention
[1] A biological optical imaging probe comprising (i) a target recognition unit and (ii) a complex of a ligand-binding protein and a fluorescently labeled ligand;
[2] The probe according to [1], wherein the target recognition unit comprises a polypeptide represented by the same or substantially the same amino acid sequence as the amino acid sequence of SEQ ID NO: 1;
[3] The target recognition unit includes a polypeptide having a cell membrane permeation function and a polypeptide represented by the same or substantially the same amino acid sequence as the amino acid sequence of SEQ ID NO: 1. [1] ] The probe according to
[4] The probe according to [3], wherein cysteine is further added to the polypeptide having a cell membrane permeation function;
[5] The complex of a ligand binding protein and a fluorescently labeled ligand is a complex of a HaloTag® protein and a fluorescently labeled HaloTag® ligand, [1] to [ 4] The probe according to any one of
[6] A method for performing biological optical imaging of a hypoxic region, characterized by using the probe according to any one of [2] to [5];
[7] A method for determining whether or not a subject suffers from ischemic disease or refractory cancer using the probe according to any one of [2] to [5], wherein ischemia A method of performing biological optical imaging of a site;
[8] The method according to [7], wherein the ischemic disease is ischemic cerebrovascular injury, ischemic heart disease and obstructive peripheral arteriosclerosis;
[9] A kit for diagnosing ischemic disease or refractory cancer, comprising the probe according to any one of [2] to [5];
[10] A method for screening for a substance that affects ischemic disease or refractory cancer, comprising using the probe according to any one of [2] to [5];
About.

  In the biophotonic imaging probe of the present invention, the excretion of the fluorescent dye in the liver, kidney and the like is remarkably promoted in biophotonic imaging, so that a high background does not last for a long time. Therefore, it is possible to perform biological optical imaging of the trunk, which was difficult with a conventional probe.

  In addition, since the probe of the present invention labels the target recognition unit using protein ligand binding, the labeling efficiency can be easily controlled and the fluorescent dye can be efficiently introduced into a specific position. . Therefore, it is possible to stably prepare a high-quality biological optical imaging probe.

  Furthermore, since the probe of the present invention has high tissue permeability, it can also be used to image tissues with poor blood circulation or brain tissues.

It is the figure which showed the probe of this invention typically. It is the figure which compared the uptake | capture to the cell of PTD at the time of adding a different amino acid residue to the N terminal of PTD. It is a figure which shows the comparison of the biological tumor imaging of the probe labeled with various fluorescent dyes. Arrows and arrowheads indicate tumor tissue. It is a figure which shows the difference in the discharge time of the probe from which the labeling method of a fluorescent dye differs. Arrows and arrowheads indicate tumor tissue. It is a figure which shows the comparison of the biological tumor imaging of the probe labeled with ICG. Arrows and arrowheads indicate tumor tissue. It is the figure which imaged the biological cerebral ischemic part of the mouse | mouth.

  Hereinafter, the present invention will be described in detail.

1. Probe for biological optical imaging The present invention provides a probe for biological optical imaging , comprising (i) a target recognition unit, and (ii) a complex of a ligand-binding protein and a fluorescently labeled ligand.

  That is, the probe of the present invention has the structure shown in FIG. A detailed description of each part will be given below.

(I) Target recognition unit In the present specification, the “target recognition unit” refers to a target tissue / cell or the like when performing biological optical imaging in a target living body (hereinafter sometimes referred to as “target tissue”). It is a part that acts directly on, and is an important site that determines the specificity of the probe. A “target recognition unit” refers to a molecule that functions specifically in a target tissue.

  Here, the “target” refers to all living organisms that can be targets for imaging biological tissues using the probe of the present invention, and is not particularly limited in this specification. Examples of such organisms include vertebrates such as mammals, birds, reptiles, amphibians and fish. Of these, mammals are preferable, and humans or experimental animals (mouse, rat, hamster, rabbit, etc.) are more preferable.

  The target recognition unit exists in a target tissue-specific manner, such as a protein / gene that is specifically expressed in the target tissue, a protein / gene that is specifically stabilized in the target tissue, or a protein / gene that functions in the target tissue-specific manner. Includes proteins, genes, and other substances that are recognized as “specific” in the target tissue in terms of expression processes and functional mechanisms, such as proteins and genes that specifically bind to biological materials (hereinafter referred to as “target tissue”). It may be described as “a substance that functions specifically”).

  In the present specification, the “specific function” in “functioning specifically in the target tissue” refers to the overall functions of the above-mentioned substances that are recognized as specific in the target tissue (eg, target tissue-specific expression, target tissue). Specific functions, specific binding in the target tissue, etc.).

  Therefore, the “target recognition unit” may be any known substance such as a protein or gene that is known per se in the target tissue, and may be used in a living tissue by various methods such as microarray. It may be a protein or gene that has been newly confirmed for specific expression or tissue-specific function.

  The “target tissue” in the present invention includes all tissues in the target living body, and is particularly preferably a tissue under hypoxic conditions such as cancer tissue and ischemic tissue. That is, the “target recognition unit” of the probe of the present invention preferably contains a substance that specifically functions under hypoxic conditions.

  Examples of such a substance that specifically functions under hypoxic conditions include, for example, a polypeptide represented by an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1 (hereinafter referred to as “ODD”). Sometimes referred to as “derived polypeptide”).

  Even when the polypeptide is fused with another protein, it gives stability depending on the oxygen concentration in the cell to the other fused protein in the cell holding the fusion protein. And the said fusion protein is hold | maintained stably compared with an aerobic condition, when the cell holding the said fusion protein is under a hypoxic condition. On the other hand, in cells under aerobic conditions, it is rapidly degraded as compared to hypoxic conditions.

  Examples of the “other proteins” include other proteins and polypeptides that can constitute the probe of the present invention. Specifically, polypeptides and ligand-binding proteins having a cell membrane permeation function, which will be described later, and labels For example. Various other low molecular weight compounds (drugs) and genes may be bound to these other proteins.

  In the present specification, the “hypoxic condition” specifically refers to a condition where the HIF-1α protein is expressed and can stably exist. Cells expressing HIF-1α are in an abnormally hypoxic state, which is an indicator of cell malignancy (for example, enhanced angiogenesis, glycolytic enzyme expression, translocation / invasion-related molecule induction, etc.) Can be. On the other hand, the “aerobic condition” refers to a condition where the HIF-1α protein cannot exist stably.

  The causes of this hypoxia include an imbalance between cell proliferation and angiogenesis, and decreased blood circulation due to vascular infarction and necrosis. A large number of cells under hypoxic conditions are expected to lead to injury such as refractory cancer and ischemic disease.

  The target recognition unit of the present invention preferably comprises a polypeptide (ODD-derived polypeptide) represented by the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1.

  Here, the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, for example, about 40% or more, preferably about 60% or more, with the amino acid sequence represented by SEQ ID NO: 1, More preferred is an amino acid sequence having a homology of about 80% or more, more preferably about 90% or more.

  The “polypeptide represented by an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1” has an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1. And a target recognition unit that has substantially the same activity as the polypeptide represented by the amino acid sequence represented by SEQ ID NO: 1.

  Examples of “substantially the same activity” include the above-described activity of imparting stability to other fused proteins depending on the intracellular oxygen concentration. “Substantially homogeneous” indicates that their activities are homogeneous in nature.

  In addition, the “polypeptide represented by the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1” is a fusion protein containing the polypeptide, and the oxygen concentration in the cell as described above. An amino acid sequence in which one or two or more (preferably 1 to 9, more preferably several) amino acids in the amino acid sequence have been deleted, as long as the dependent stability can be imparted. An amino acid sequence to which one or more (preferably 1 to 9, more preferably several) amino acids in the amino acid sequence represented are added, 1 or 2 in the amino acid sequence represented by SEQ ID NO: 1 A polypeptide represented by an amino acid sequence in which the above (preferably 1 to 9, more preferably several) amino acids are substituted with other amino acids may be used.

  When the amino acid sequence is deleted, added, or substituted as described above, the position of the deletion, addition, or substitution is not particularly limited, but in the amino acid sequence represented by SEQ ID NO: 1, amino acid number 9 These tyrosine residues are preferably conserved. For those skilled in the art, substitution, addition, and deletion can be appropriately performed by a method known per se as appropriate. For example, when a peptide synthesizer is used, it can be easily performed by changing the type of protected amino acid. it can.

  Furthermore, the “polypeptide represented by the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1” in the present invention refers to the intracellular oxygen as described above in the fusion protein containing the polypeptide. A part of the polypeptide represented by the amino acid sequence may be used as long as stability depending on the concentration can be imparted.

  Specifically, a polypeptide having an amino acid sequence consisting of at least 16 consecutive amino acid residues, preferably 17 or more amino acid residues, among the amino acid sequences is mentioned. More specifically, a polypeptide having an amino acid sequence consisting of amino acid numbers 1 to 16 of SEQ ID NO: 1 or an amino acid sequence consisting of amino acid numbers 3 to 18 of SEQ ID NO: 1 is mentioned.

  A method for producing an ODD-derived polypeptide is not particularly limited. For example, when the polypeptide of SEQ ID NO: 1 is prepared, it can be produced by chemically synthesizing by a method known per se, or a gene is obtained from a cell expressing a naturally occurring HIF-1α protein. In addition, it can be produced using a genetic technique known per se. Examples of the chemical synthesis method include a method of synthesis by a solid phase synthesis method using a peptide synthesizer.

  In addition, an ODD-derived polypeptide can be produced by applying a phosphoramidite method or triester method, or a DNA encoding the polypeptide obtained by using a commercially available oligonucleotide synthesizer. It can also be produced by incorporating it into an appropriate expression vector. Thus, by obtaining the DNA encoding the polypeptide, the ODD-derived polypeptide is a component of the probe of the present invention such as “polypeptide having cell membrane permeation function” and “ligand binding protein” described later. Together, they can be manufactured using genetic techniques.

  The ODD-derived polypeptide imparts stability depending on the intracellular oxygen concentration as described above to a fusion protein containing the polypeptide by being introduced into a target tissue, particularly a cell.

  Therefore, from the viewpoint of introducing the probe of the present invention into a cell and detecting cells under hypoxic conditions, the target recognition unit in the probe of the present invention has a cell membrane permeation function in addition to the ODD-derived polypeptide. Preferably it comprises a polypeptide. The probe of the present invention comprising such a target recognition unit, when administered into a subject, rapidly penetrates into the cell and stably exists in the cell under hypoxic conditions. Useful for biological optical imaging.

  The “polypeptide having a cell membrane permeation function” gives the fusion protein the ability to permeate the cell membrane when fused with other proteins constituting the probe of the present invention including the ODD-derived polypeptide. The polypeptide is not particularly limited as long as it is a polypeptide, and any polypeptide having a known permeation function of a cell membrane may be used. Such polypeptides include, for example, a TAT protein-derived membrane permeation domain, a polypeptide derived from the domain (hereinafter referred to as “TAT-derived polypeptide”), the third alpha-helix of Antenna homeodomain-derived polypeptide. Peptide, polypeptide derived from VP22 protein from herpes simplex virus and the like.

  Moreover, those skilled in the art can produce a new polypeptide having a cell membrane permeation function by adjusting the ratio of basic sequence and hydrophobic sequence and examining the three-dimensional structure of each polypeptide. It is. The “polypeptide having a cell membrane permeation function” of the present invention may be a synthetic polypeptide produced as described above.

  In the following description of the present specification, as described above, the term “PTD (Protein Transduction Domain)” refers to polypeptides that have a cell membrane permeation function and impart a membrane permeation function to a fused protein. May be described.

  TAT is a protein having a cell membrane permeation function derived from human immunodeficiency virus (HIV). Since a protein fused with a TAT-derived polypeptide is delivered into systemic tissue cells while retaining the function of the fused protein itself, application of the TAT-derived polypeptide can be an effective method for in vivo delivery. Examples of the TAT-derived polypeptide include a polypeptide represented by the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2. Here, the amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 2 is, for example, about 40% or more, preferably about 60% or more, more than the amino acid sequence represented by SEQ ID NO: 2. An amino acid sequence having a homology of preferably about 80% or more, more preferably about 90% or more is mentioned.

  The polypeptide derived from TAT has an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 2, and an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 2. It is preferable to have substantially the same activity. Examples of substantially the same activity include cell membrane permeation activity as described above and activity for imparting a cell membrane permeation function to a fusion protein. “Substantially homogeneous” means that their activities are homogeneous in nature.

  Moreover, as a synthetic polypeptide illustrated above, the polypeptide represented by the amino acid sequence represented by SEQ ID NO: 3 can be mentioned. The polypeptide also has a cell membrane permeation function and can impart a cell membrane permeation function to the fusion protein fused therewith. A person skilled in the art can synthesize a polypeptide having an appropriate cell membrane permeation function by appropriately selecting the type of basic amino acid or hydrophobic amino acid. For example, a polypeptide consisting of 7 consecutive basic amino acids, 8 consecutive polypeptides, or 9 consecutive lysines is also a polypeptide having a cell membrane permeation function of the present invention. included. In addition, Ming Zhao and Ralph Weissleder, Intracellular cargo delivery using Tat peptide and derivatives. Medicinal Research Reviews, Vol. 24, no. The amino acid sequences described in Table 1 of 1-12, 2004 are also included in the polypeptide having a cell membrane permeation function of the present invention.

  In addition, the polypeptide having a cell membrane permeation function has one or more amino acids in the amino acid sequence deleted, as long as the cell membrane permeation activity as described above can be imparted to the fusion protein containing the polypeptide. It may be added, substituted or the like. When the amino acid sequence is deleted, added or substituted, the position of the deletion, addition or substitution is not particularly limited.

  Among them, the polypeptide having a cell membrane permeation function is preferably a polypeptide in which 1 to several, preferably 1 to 3 cysteines are further added to the polypeptide. Addition of cysteine further improves the cell membrane permeation function of the polypeptide, so that the cell membrane permeation activity of the probe of the present invention can be further improved. The position at which cysteine is added is not particularly limited, but is preferably the N-terminus of the polypeptide. By adding cysteine to the N-terminus, the cell membrane permeability function of a polypeptide having a cell membrane permeability function can be significantly improved.

  For those skilled in the art, substitution, addition, and deletion can be appropriately performed by a method known per se as appropriate. For example, when a peptide synthesizer is used, it can be easily performed by changing the type of protected amino acid. it can.

  Furthermore, the polypeptide having a cell membrane permeation function may be a part of the polypeptide represented by the amino acid sequence as long as it can impart the cell membrane permeation activity to the fusion protein containing the polypeptide. Specifically, for example, in the case of a polypeptide derived from TAT, an amino acid sequence consisting of amino acid numbers 3 to 11 of SEQ ID NO: 2 and the like can be mentioned.

  A method for producing a polypeptide having a cell membrane permeation function is not particularly limited. For example, when the polypeptide of SEQ ID NO: 2 is prepared, it can be produced by chemically synthesizing by a method known per se, or a gene can be obtained from a cell expressing a polypeptide that can be a PTD existing in nature. And can be produced using a genetic technique known per se. These polypeptides may be chemically synthesized by a method known per se. Examples of the chemical synthesis method include a method of synthesizing by a solid phase synthesis method using a peptide synthesizer.

  Alternatively, a polypeptide having a cell membrane permeation function appropriately expresses a DNA encoding a target amino acid sequence obtained by applying a phosphoramidite method or triester method, or by using a commercially available oligonucleotide synthesizer. It can also be produced by incorporating it into a vector. Thus, by obtaining DNA encoding the target amino acid sequence, a polypeptide having a cell membrane permeation function can be obtained by using the probe of the present invention such as the above-mentioned “ODD-derived polypeptide” or the “ligand binding protein” described later. Along with the components, it can also be manufactured using genetic techniques.

  The probe of the present invention is preferably a probe comprising an ODD-derived polypeptide and a polypeptide having a cell membrane permeation function in the “target recognition unit”. Such a probe has a cell membrane permeation function and has an oxygen concentration. Stability that depends on Specifically, the probe of the present invention is a probe that is more stably maintained under aerobic conditions than in aerobic conditions and is rapidly degraded in cells under aerobic conditions.

  Further, the probe of the present invention has a function of permeating the blood brain barrier (BBB) in addition to having a cell membrane permeation function. Therefore, by applying the probe of the present invention, it is possible to perform biophotonic imaging even at a site that is difficult to deliver via blood, such as a cerebral ischemic site that has been difficult until now.

(Ii) Complex of ligand binding protein and fluorescently labeled ligand In the present specification, “complex of ligand binding protein and fluorescently labeled ligand (hereinafter simply referred to as“ ligand complex ”or“ fluorescently labeled ligand complex ”) Is a complex of a “ligand binding protein moiety” and a “ligand moiety”, wherein the ligand moiety is fluorescently labeled. This complex is an important site for visualizing the above-described “target recognition unit” in the probe of the present invention.

  In particular, the probe of the present invention is characterized in that the target recognition unit is not directly fluorescently labeled, but the target recognition unit is indirectly fluorescently labeled using a ligand complex. By applying the probe of the present invention, it is possible to perform high-quality biological optical imaging in which the retention of fluorescent dyes in the liver, kidney, etc. is extremely short.

  The “ligand binding protein” is not particularly limited as long as it is a protein capable of forming a ligand complex by specifically interacting with a specific “ligand”. Conversely, the “ligand” is not particularly limited as long as it is a substance capable of forming a ligand conjugate by specifically interacting with a specific “ligand binding protein” and capable of fluorescent labeling.

  The ligand may be a protein, a polypeptide or a gene, or a low molecular compound.

  The ligand complex in the probe of the present invention is preferably a complex of HaloTag (registered trademark, Promega) protein and HaloTag (registered trademark) ligand.

  HaloTag® protein can be prepared using genetic techniques as a complex with a target recognition unit. Specifically, it can be prepared by the method described in the instructions attached to the HaloTag (registered trademark) kit.

  The fluorescent dye labeled in the ligand complex is not particularly limited, and a fluorescent dye known per se can be applied. In particular, from the viewpoint of selecting a fluorescent dye most suitable for biological optical imaging, there is a fluorescent dye applicable in near infrared fluorescent imaging in a wavelength range of about 650 to about 900 nm, which is excellent in convenience and high in tissue permeability. Preferably used. Such a fluorescent dye can be appropriately selected by those skilled in the art.

  Specific examples of fluorescent dyes preferably include Alexa Fluor (registered trademark) 660, Alexa Fluor (registered trademark) 750, and the like. It is also possible to use indocyanine green (ICG), a fluorescent dye that has already been used in clinical practice. Since ICG has already been used clinically, it can be rapidly clinically applied. By appropriately selecting these fluorescent dyes, it is possible to produce a probe with a short residence time in the tissue and a low background.

  A person skilled in the art can label a fluorescent dye with a ligand by applying a method known per se. When the fluorescent dye is labeled on the HaloTag® ligand, for example, it can be labeled by the method described in the instructions attached to the HaloTag® kit.

  The probe of the present invention is characterized in that the ligand moiety is fluorescently labeled and is used for biophotonic imaging. However, by labeling with a labeling substance other than a fluorescent dye, the probe can be used for other than biophotonic imaging. It can also be used as a probe suitable for other imaging methods.

For example the ligand moiety by labeling with various radioactive isotopes (such as ^{18 O, 15 O, 13 N} ), the probe of the present invention can also be used as probes for PET diagnosis. Similarly, the present invention can also be applied as a diagnostic probe using SPECT, MRI, near infrared light, or the like. Those skilled in the art can appropriately determine a labeling method suitable for each technique.

  That is, according to the present invention, it is possible to provide a probe that is applicable not only to biological optical imaging applications but also to general biological imaging applications. Since the probe of the present invention indirectly labels the target recognition unit using a ligand complex, a high-quality imaging probe with less tissue retention can be obtained.

  Furthermore, the probe of the present invention is characterized in that it contains a target recognition unit and a ligand complex. By substituting the ligand complex with another substance, the target recognition unit transports the substance to the target. It can also be used as a delivery protein.

  For example, a fusion protein in which a peptide having a caspase inhibitory function that induces cell death is added to a target recognition unit for a hypoxic region consisting of a polypeptide having a cell membrane permeation function and an ODD-derived polypeptide is transient Delivered to the ischemic brain in the cerebral ischemia / reperfusion model mouse, and the ischemic region can be reduced. In addition, a fusion protein obtained by adding a precursor Caspase-3 of Caspase-3 to the target recognition unit can be applied as an anticancer agent having hypoxic cell specificity.

2. Biophotonic Imaging Method The present invention provides a biophotonic imaging method for a hypoxic region, characterized by using the probe of the present invention.

  In the present specification, the “hypoxic region” refers to a region where cells under hypoxic conditions gather in the living body of the subject, and more specifically, HIF-1α protein is expressed and HIF- It refers to the area where cells that can stably contain 1α protein are gathered. Cells expressing HIF-1α protein are in abnormal hypoxia, which is an indicator of cell malignancy (for example, enhanced angiogenesis, glycolytic enzyme expression, translocation / invasion related molecule induction, etc.) )

  Possible causes of the hypoxic region include imbalance between cell proliferation and angiogenesis in the region, decreased blood circulation due to vascular infarction or necrosis, and the like. The occurrence of a hypoxic region is expected to lead to injury such as refractory cancer and ischemic disease.

  According to the biophotonic imaging method of the present invention, the hypoxic region can be noninvasively biophotometrically imaged using the activity of ODD, so that hypoxic cancer cells that can lead to refractory cancer can be discovered, It is possible to discover ischemic sites. That is, the present invention can provide a method for determining whether or not a subject suffers from ischemic disease or refractory cancer, characterized by performing biological optical imaging of the diseased part. .

  In the present specification, “ischemic disease” refers to a disease caused by ischemia, specifically, ischemic cerebrovascular disorder (eg, cerebral embolism, cerebral thrombosis, cerebral infarction), imaginary It refers to diseases such as blood heart disease (eg, angina pectoris, myocardial infarction) and obstructive peripheral arteriosclerosis. The ischemic diseases include not only clogged blood vessels but also peripheral circulation disorders due to diabetic complications, diabetic nephropathy, diseases related to arteriosclerosis, ligation of blood vessels or tissue compression. This includes all pathological conditions that cause systemic or local ischemia, such as ischemia, decreased blood flow due to thickening of vascular endothelial cells, and the like.

  The present invention also relates to a method for determining whether or not a disease associated with increased expression of HIF-1α protein is involved using the probe of the present invention, characterized in that the diseased part is imaged in vivo. To provide a method.

  Here, examples of the “disease associated with increased expression of HIF-1α protein” include, for example, ischemic diseases such as angina pectoris, myocardial infarction, cerebral infarction, peripheral circulatory disorder or diabetic complications other than cancer. Pathological conditions related to ischemia such as nephropathy, diseases related to arteriosclerosis, artificial ischemia due to blood vessel ligation or tissue compression, or decreased blood flow (gastric ulcer, duodenal ulcer, chronic respiratory system) A wide range of conditions such as inflammation models (for example, can be caused by forced inhalation of tobacco or diesel, gasoline exhaust), or inflammatory conditions or trauma caused by the administration of inflammatory substances to various organs or tissues Is mentioned.

  Furthermore, the present invention provides a method for determining whether or not a disease in which a hypoxic region occurs (for example, refractory cancer), wherein the diseased part is subjected to biophotonic imaging. Can be provided.

  In addition, the present invention is useful as an evaluation system for physical treatment methods (for example, surgery, radiation therapy, thermotherapy) of the above-mentioned diseases, and is also useful as an experimental system applied to the following screening method.

  Specifically, the biological optical imaging method of the present invention can be performed through the following steps, for example.

(1) Step of preparing a probe This step is a step of preparing a probe to be applied to biological optical imaging. The probe in the present invention can be prepared by applying the same method as the above production method.

  As a fluorescent dye to be labeled on the probe, a fluorescent dye suitable for an optical imaging apparatus used in a later step can be selected. Examples of such a fluorescent dye include the fluorescent dyes listed above.

(2) Process of administering a probe to a subject This process is a process of administering a probe to a test subject. Examples of the test subject include a region that is hypoxic, for example, a subject that is presumed to have a tumor or a hypoxic region, or a subject that is presumed to suffer from an ischemic disease. Specific animal species of interest are not particularly limited, and include vertebrates such as mammals, birds, reptiles, amphibians and fish, preferably mammals, more preferably humans or laboratory animals (mouse, Rat, hamster, rabbit, etc.).

  The method for administering the probe to the subject is also not particularly limited, and may be either oral or parenteral.

(3) Step of observing pharmacokinetics of probe This step is a step of observing the kinetics after administration of a probe administered into a living body and imaging a hypoxic region by living body optical imaging. Arranged in a dark room equipped with a cooling ultra-high sensitivity CCD camera that can detect sensitive light even with a light source that excites fluorescence, a filter that passes light of a specific wavelength, and even weak light. Place the object to be observed and observe the fluorescence.

3. Kit for diagnosing ischemic disease or refractory cancer The present invention relates to an ischemic disease or refractory cancer comprising the probe of the present invention characterized in that the target recognition unit contains an ODD-derived polypeptide. Provide a diagnostic kit. Examples of the ischemic disease in the present invention include diseases similar to those described above.

  The kit of the present invention includes reagents necessary for carrying out the present invention, such as reagents necessary for the steps of preparing the probe, administering the probe to the subject, and observing the pharmacokinetics of the probe. May be included. Examples of such reagents include RNA purification reagents such as ISOGEN, reverse transcription enzymes, reverse transcription reaction reagents such as RNase-free water, gene amplification primers, gene purification reagents such as ethanol, phenol and trichloromethane, DNA polymerase, dNTPs A reagent for gene amplification reaction such as magnesium chloride aqueous solution and Tris buffer, proteolytic enzyme, fluorescent dye, gene expression vector and the like. Further, one or more different kits may be included in the kit, and the kit may be an existing kit or a kit to be sold in the future. For example, by combining with a conventionally known MRI examination kit, a PET diagnostic kit, or the like, it can be determined whether or not the subject suffers from ischemic disease or refractory cancer.

  Various operations that can be employed in the present invention, for example, RNA extraction, DNA or DNA fragment synthesis, cleavage, deletion, addition or binding enzyme treatment, RNA or DNA isolation, purification, replication, selection Any operation not specifically described in this specification, such as amplification, can be performed according to a conventional method (Molecular Genetics Experimental Method, published by Kyoritsu Publishing Co., Ltd. 1983; PCR Technology, published by Takara Shuzo Co., Ltd. 1990) Etc.) In addition, these DNAs and the like can be appropriately modified according to conventional methods as necessary.

  In this specification, the abbreviations relating to amino acids, peptides, base sequences, nucleic acids, restriction enzymes, etc. are indicated by the nomenclature by IUPAC and IUPAC-IUB or the definition thereof, and the “specifications including base sequences or amino acid sequences etc. "Guidelines for the preparation of" (Japan Patent Office Coordination Division Examination Standards Office, March 1997).

4). A method for screening a substance affecting an ischemic disease or refractory cancer The present invention uses a probe of the present invention characterized in that the target recognition unit contains an ODD-derived polypeptide. Provided is a method for screening a substance that affects a blood disease or refractory cancer. Examples of the ischemic disease in the present invention include diseases similar to those described above.

  The probe of the present invention, which comprises an ODD-derived polypeptide in the target recognition unit, can exist stably under hypoxic conditions. Therefore, the effectiveness of the candidate substance against ischemic disease or refractory cancer can be determined by simultaneously administering the probe and the candidate substance to the subject and observing tissues and cells under hypoxic conditions. Using this, it is possible to screen for substances that affect ischemic disease or refractory cancer.

  The present invention will be described more specifically with reference to the following examples.

Example 1 Preparation of Probe A fusion protein in which a ligand binding protein was linked to PTD-ODD was prepared by the following method.
(1) Preparation of PTD-ODD-HaloTag fusion protein First, a PTD-ODD-HaloTag fusion protein was prepared using a GST affinity tag. The gene encoding the PTD-ODD-HaloTag fusion protein was first constructed so that the cDNA encoding the polypeptide of each domain had a restriction enzyme site so that the cDNA ends could be bound to each other.

  PTD (SEQ ID NO: 3) of the cDNA, two gene sequences below: PTD sense oligomer (EieititishijitijishieieijieieijieieijieieijieieijieieijieieijieieijieieijijieieieishijitijijiTGGGAAACGTGGTGGACGGAATGGA: SEQ ID NO: 4) and PTD antisense oligomer (JieitishitishishieititishishijitishishieishishieishijitititishishishieishishieishijitititishishititishititishiTTCTTCTTCTTCTTCTTCTTGCACG: SEQ ID NO: 5) were respectively synthesized, these complementary Created by fusing (annealing). The cDNA has an EcoRI restriction enzyme site and a BglII restriction enzyme site on the 5 'side and 3' side, respectively.

The cDNA of ODD (SEQ ID NO: 1 ) is a primer for amplifying ODD from a gene encoding human HIF-1α [(1) BglII sense primer: GGAGATCTAACCCATTTCTACTCAGGGACACA: SEQ ID NO: 6 and (2) SalI antisense primer: GCTTGTTCGCACCTGCTTGGAATACTGTAC: 7] was used for PCR. The cDNA has a BglII restriction enzyme site and a SalI restriction enzyme cleavage site on the 5 ′ side and 3 ′ side, respectively.

  HaloTag protein cDNA is obtained by using pFC14K CMV Flexi vector (Promega product) holding HaloTag protein 7 gene as a template, HaloTag sense primer: GCAAGTCGACGGATCTGAATCGGTACTGGCTGTCTCA (SEQ ID NO: 8) and AGAG PCR was performed using 9). The cDNA has SalI and NotI restriction enzyme cleavage sites on the 5 'side and 3' side, respectively.

  These gene fragments were converted into a single cDNA using a gene-binding enzyme (ligase) and inserted into the EcoRI and NotI sites of the pGEX6P3 vector (GE Healthcare) to prepare a plasmid pGEX / PTD-ODD-HaloTag.

  This plasmid was transformed into E. coli strain BL21 (DE3) codonplus (Strategene product). Next, the transformed strain was cultured on an agar medium to form colonies, inoculated into 500 mL of TB medium, and cultured with shaking at 37 ° C. After culturing for 8 hours, the temperature was changed to 20 ° C., and IPTG was added to a final concentration of 0.5 mM to induce expression of the fusion protein. After culturing for 18 hours in total, centrifugation was performed. The cells were suspended in 20 mL of a solution (hereinafter referred to as Lysis buffer) having a composition comprising 50 mM Tris-HCl (pH 8.0), 0.1 M NaCl, 1 mM EDTA, 1 mM PMSF, 1% (v / v) Triton X-100. It became cloudy and freeze-thawed at -80 ° C. The cells were then sonicated to disrupt the cells and centrifuged again to recover the soluble fraction. 2 mL of Glutation Sepharose (product of GE Healthcare) equilibrated with Lysis buffer was added thereto, and the mixture was gently shaken on ice for 1 hour to be adsorbed on the gel. After shaking, Glutatione Sepharose was washed with 15 mL of Lysis buffer, and further washed with 15 mL of a solution obtained by removing Triton X-100 from the Lysis buffer. Thereafter, 2 mL each of an eluate (reduced glutathione was added to Lysis buffer to 30 mM and adjusted to pH 8.0) was added to the column to elute the PTD-ODD-HaloTag fusion protein as a GST fusion protein. To this solution, 10 μL of Precision Protease was added and mixed. Further, the solution was transferred to a 10 kDa dialysis membrane and dialyzed against PBS (pH 8.0) (overnight, 4 ° C., 1 L × 3, gently stirring). After the completion of dialysis, GST released by digestion with Precision Protease was removed by passing again through Gluteation Sepharose (GE Healthcare) equilibrated with PBS (pH 8.0). The passing liquid was concentrated to 2 mL by ultrafiltration, and the protein concentration was quantified. Moreover, purity was evaluated by SDS-PAGE.

(2) Preparation of fluorescent dye-labeled ligand Next, the fluorescent dye was chemically labeled on the ligand. Labeling was performed using the following method.

  1 mg of HaloTag® ligand was dissolved in 100 μL of DMF. Further, Alexa Fluor 660 (1 mg) was dissolved in 1 mL (DMF: 0.1 M borate buffer (pH 8.5) = 9: 1). Both were mixed and allowed to react overnight at room temperature in the dark. At that time, it was gently mixed with a rotator. After the reaction, 50 μL of 1M Tris-HCl pH 8.0 was added, and the mixture was further reacted for 1 hour to block unreacted fluorescent dye. The reaction solution was equally divided and each was applied to a Sep-Pak C18 column to separate the labeled ligand.

  A water-acetonitrile-trifluoroacetic acid solution was used for a Sep-Pak C18 column (Waters product). A Sep-Pak C18 column, which had been collimated in advance with a 0% acetonitrile solution, was applied with half of the ligand solution (above) after the labeling reaction, which was also made up to 5 mL with 0% acetonitrile solution, and 10 mL with 0% acetonitrile solution. The column was washed. Subsequently, it was washed with 10 mL of acetonitrile 10% solution and 10 mL of acetonitrile 20% solution. Contaminant components were removed during this process. Thereafter, the labeled HaloTag ligand was eluted with a 40% acetonitrile solution. The obtained eluate was stored at −80 ° C. in a dry state after removing the solvent under reduced pressure.

(3) Preparation of probe Subsequently, a HaloTag ligand chemically labeled with a fluorescent dye was added to a solution of the PTD-ODD-HaloTag fusion protein and bound to prepare a probe. The reaction was carried out by the following method.

  Dispense 1 mg of PTD-ODD-HaloTag fusion protein solution equilibrated with PBS (pH 8.0), 500 μL of 1 M Tris-HCl (pH 8.0) and 1 mL of 50% (w / v) aqueous ammonium sulfate solution. And made up to 5 mL with distilled water. This was mixed with 25 μL of a fluorescently labeled ligand solution, and allowed to react at room temperature for 1 hour or more in the dark. After the reaction, the solution was concentrated to 1 mL by ultrafiltration, the unreacted fluorescently labeled ligand was removed with a desalting column, and the solvent was exchanged with PBS (pH 8.0). Thereafter, the absorption of A280 and A668 was measured, and the protein concentration, the fluorescent dye concentration, and the labeling efficiency were calculated according to the instruction manual of Alexa Fluor 660. In some cases, ultrafiltration was performed again to prepare an arbitrary concentration. EDTA was added to the prepared sample so that it might be set to 1 mM, and it stored on ice on light shielding.

Example 2: Improvement of tissue permeability by modification of amino acid sequence of PTD Cysteine and other amino acids (serine, methionine, glycine, phenylalanine) are genetically engineered at the N-terminus of PTD to form a fusion protein with EGFP Prepared.

  Each was prepared as a fusion protein with EGFP in the same manner as the PTD-ODD-HaloTag fusion protein described in Example 1, using a pGEX6P3 vector (product of GE Healthcare) as a vector. The fluorescence intensity of EGFP per mol concentration showed no difference between samples.

  Subsequently, each PTD-EGFP was taken into the cultured cells, and the fluorescence intensity of EGFP was measured using flow cytometry, thereby examining the amount taken up into the cells. HeLa cells were cultured in DMEM medium in a 24-well plate to 70% confluence, and after changing the medium, 1.25 nmol of each PTD-EGFP was added. After incubating for 30 minutes, the cells were washed three times with PBS-EDTA, treated with trypsin, and the cells were collected. PTD-EGFP that was not taken up into cells but remained on the cell surface was removed by this treatment. These cells were suspended in 300 μL of PBS and then subjected to flow cytometry (CELLQuest, product of Becton-Dickinson) to measure the fluorescence of EGFP and observe the distribution of the number of cells for each fluorescence intensity. The ability to take in additional PTD was evaluated. As a result, it was found that the amount of cellular uptake of PTD-EGFP in which cysteine was arranged was significantly increased as compared with the case of incorporating other amino acids (FIG. 2).

  By arranging cysteine, it is considered that the adsorptivity to cells increased, and more PTD-ODD fusion protein was taken up.

Example 3 Selection of Fluorescent Dye with Low Tissue Retention Property In order to perform imaging with a PTD-ODD fusion protein with higher sensitivity, an attempt was made to select an optimum dye. When the tissue retention of the fluorescent dye is high (the residence time is long), the background is increased, the time for obtaining a tumor image is delayed, and an image with a poor signal to noise ratio is obtained (FIG. 3). Therefore, various commercially available fluorescent dyes were examined.

  First, the tissue retention of each fluorescent dye itself was observed. An artificial tumor was made subcutaneously in the left thigh of a nude mouse and used as an experimental model. When a fluorescent dye is administered from the tail vein and the transition of the whole body fluorescent signal is observed over time, some fluorescent dyes may stay in the tumor for a long time (~ several days) by themselves. In some cases, a strong signal systemically persisted for a long time (~ 1 day). Among these, Alexa Fluor 660 and Alexa Fluor 750 were judged to be fluorescent dyes suitable for biophotonic imaging because they did not have tumor accumulation and rapid elimination was observed.

Example 4: Reduction of evacuation time by application of protein ligand binding Probes were prepared by labeling Alexa Fluor 660 with PTD-ODD-HaloTag fusion protein using ligand binding. A nude mouse with an artificially created tumor in the left thigh was used as an experimental model, the probe was administered from the tail vein, and changes in the whole body fluorescence signal were observed over time. At the same time, the probe of the present invention labeled with Alexa Fluor 660 by chemical labeling (introduced into the thiol group) was also tested.

  When 1 nmol of each was administered, when the probe of the present invention fluorescently labeled by protein ligand binding was applied, the fluorescent dye was released 3 hours after administration from kidney tissue or liver tissue (circled portion in FIG. 4). The signal was rapidly cleared and the signal was rapidly accumulated in the tumor tissue (indicated by arrows and ridges in FIG. 4) (FIG. 4, upper panel). On the other hand, when chemically labeled, not only a high signal was observed systemically, but also the fluorescence signal in the liver remained high at 12 hours after administration, and no reduction in retention was observed (Fig. 4, bottom). This is considered to be because the release of the pigment is facilitated by ligating the ligand, and the excretion from the organ is promoted. By using the probe of the present invention, biological optical imaging of the trunk, which has been difficult in the past, becomes possible.

Example 5: Imaging using indocyanine green (ICG) ICG is a fluorescent dye that has been used clinically as a fundus test and has been recognized for safety for over 40 years. Therefore, a probe was prepared by labeling ICG on a PTD-ODD-HaloTag fusion protein using ligand binding. A nude mouse with an artificially created tumor in the left thigh was used as an experimental model, the probe was administered from the tail vein, and changes in the whole body fluorescence signal were observed over time.

  When 1 nmol was administered, the fluorescence signal in the kidney tissue and liver tissue (in the circled portion in 5) was relatively high compared to Example 4, but the tumor tissue (arrow in FIG. 5) Rapid signal accumulation was confirmed (in FIG. 5, the part marked with 鏃).

Example 6: Imaging of cerebral ischemic site Experimental model mice (hairs) were artificially infarcted only in the right hemisphere by inserting a silicon-coated filament into the right middle cerebral artery. After middle cerebral artery occlusion for 30 minutes, the filament was removed and reperfused. Immediately after reperfusion, the probe was administered from the tail vein for 3 hours, and observed over time using an IVIS (r) Imaging System (Xenogen). In the observation 3 to 4 days after the administration of the probe, signal accumulation was confirmed in the right hemisphere corresponding to the ischemic site (FIG. 6). As a result, it was found that the probe of the present invention can depict not only tumor hypoxic cells but also ischemic tissue.

  While the invention has been described with emphasis on preferred embodiments, it will be apparent to those skilled in the art that the preferred embodiments can be modified. The present invention contemplates that the present invention may be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications encompassed within the spirit and scope of the appended claims.

  The contents of all publications, including the patents and patent application specifications mentioned herein, are hereby incorporated by reference herein to the same extent as if all were expressly cited. .

  Since the biophotonic imaging probe of the present invention applies protein ligand binding to a fluorescent label, the discharge of fluorescent dyes in the kidney and liver is remarkably promoted. Is possible.

  In addition, the biological optical imaging probe of the present invention is not only excellent in cell membrane permeability, but can also transmit BBB. In addition, since the signal-to-noise ratio is high, detection is possible with high sensitivity. Therefore, by using the probe of the present invention, it is possible to perform biological imaging of ischemic tissue, brain tissue, and the like that have been difficult until now.

  Furthermore, since the imaging probe of the present invention applies protein ligand binding to a fluorescent label, it is possible to link various functional molecules to the same protein probe by binding any functional molecule to the ligand. For example, it is possible to divert to an imaging probe for a different detection device by connecting PET or MR contrast agent instead of the fluorescent dye. Furthermore, it can be easily applied as a carrier for drugs and the like to the low oxygen region.

[SEQ ID NO: 1] description of artificial sequence: polypeptide encoded by synthetic DNA [SEQ ID NO: 2] description of artificial sequence: polypeptide encoded by synthetic DNA [SEQ ID NO: 3] description of artificial sequence: encoded by synthetic DNA Polypeptide

Claims (7)

A biological optical imaging probe comprising (i) a target recognition unit and (ii) a complex of a ligand-binding protein and a fluorescently labeled ligand, wherein the target recognition unit is a polyhedron having a cell membrane permeation function. seen containing a peptide, following the polypeptide of (a) or (b), a polypeptide having the cell membrane permeability function grants cell membrane permeability function protein fused, further to a polypeptide having the cell membrane permeability function Biological optical imaging probe with cysteine added :
(a) a polypeptide represented by the amino acid sequence of SEQ ID NO: 1,
(b) The amino acid sequence represented by SEQ ID NO: 1, consisting of an amino acid sequence in which several amino acids are deleted, added, or substituted, and stable against other fused proteins depending on intracellular oxygen concentration A polypeptide having the activity of imparting sex . The probe according to claim 1, wherein the complex of the ligand binding protein and the fluorescently labeled ligand is a complex of the HaloTag® protein and the fluorescently labeled HaloTag® ligand. A method for performing biological optical imaging of a hypoxic region in a non-human animal , wherein the probe according to claim 1 or 2 is used. A method is a non-human animal with a probe according to claim 1 or 2 subject to determine whether or not suffering ischemic diseases or refractory cancer, biological optical imaging an ischemic site A method, characterized by: The method according to claim 4 , wherein the ischemic disease is ischemic cerebrovascular injury, ischemic heart disease and obstructive peripheral arteriosclerosis. A kit for diagnosing ischemic disease or refractory cancer, comprising the probe according to claim 1 or 2 . A method for screening for a substance that affects ischemic disease or refractory cancer, comprising using the probe according to claim 1 or 2 .

Images