JP5660537B2 - Kit for generating double-stranded RNA by lactic acid bacteria and use thereof - Google Patents

Description

  The present invention relates to a kit for producing double-stranded RNA by lactic acid bacteria and use thereof. More specifically, the present invention relates to a kit for producing double-stranded RNA by lactic acid bacteria and a technology using the same for producing double-stranded RNA by lactic acid bacteria capable of expressing DNA encoding the double-stranded RNA.

  RNAi is a technique for suppressing the expression of a specific gene by RNA interference (RNA interference). For example, RNAi can be caused by introducing double-stranded RNA into a cell, tissue, organ, individual or the like. When double-stranded RNA hybridizes to mRNA of the target gene, degradation of the mRNA is promoted. Thereby, the expression of the target gene is suppressed.

  Conventionally, antisense methods and ribozyme methods have been known as gene expression suppression methods, but it has been found that RNAi has a long-lasting effect of suppressing gene expression compared to these methods.

  Therefore, in recent years, RNAi is rapidly spreading in molecular biology / cell biology research. Furthermore, since it has been clarified that it can be applied to humans and animals, it is attracting attention as a new method of mammal research in molecular biology, and is expected to be applied to pharmaceuticals and foods.

  Application of RNAi to pharmaceuticals and foods is as follows: (1) Use for treatment of diseases caused by excessive activity of specific genes such as cancer, hyperlipidemia, diabetes, etc. (for example, Patent Document 1) (2) It has been proposed to eliminate parasites such as nematodes and roundworms parasitizing human and animal bodies by suppressing the expression of genes necessary for their survival. For example, a method for suppressing the expression of a specific gene possessed by a nematode Caenorhabditis elegans by feeding Escherichia coli into which an expression vector for a gene encoding dsRNA has been introduced (Caenorhabditis elegans) is proposed ( Non-patent document 1).

  In addition, as a method for performing RNAi, a method of introducing a synthetic polymer or virus into a cell or the like as a carrier of a double-stranded RNA expression vector, a method of introducing a double-stranded RNA expression gene into a fertilized egg of an animal, etc. are reported. Has been. Patent Document 2 proposes a method using bacterial minicells as a carrier.

Japanese Patent Publication “JP-A-2006-246787 (published on September 21, 2006)” Japanese Patent Publication “Special Table 2005-505296 (published on February 24, 2005)”

Lisa Timmons and Andrew Fire, Specific interference by ingested dsRNA, NATURE, 1998, vol. 395, 29 OCTOBER, p. 854

  However, the conventional method has a problem that it is difficult to cause RNAi easily and stably in the intestines of humans and animals.

  For example, when using E. coli capable of expressing a gene encoding a double-stranded RNA disclosed in Non-Patent Document 1, when the E. coli is orally administered to cause RNAi in human and animal intestines, There is a high probability of being killed by stomach acid or the like without reaching the intestines. In addition, oral administration of E. coli is problematic in terms of safety. In particular, since large-scale administration is difficult, it is difficult to efficiently cause RNAi in the intestine. On the other hand, it is not convenient to introduce the E. coli into the intestine by a method other than oral administration. Therefore, the effect of RNAi cannot be obtained easily and stably in the intestine.

  In addition, the methods disclosed in Patent Documents 1 and 2 using viruses, synthetic polymers, or bacterial minicells as carriers are difficult to reach the intestines due to the effects of gastric acid and the like. Can not cause RNAi stably.

  In addition, in the method using a virus or a synthetic polymer as a carrier, since the safety of the carrier itself is also a problem, it is not preferable to administer it to humans and animals. Bacterial minicells are obtained by removing nuclei from bacterial cells and are completely different from bacterial cells. Therefore, in the method using bacterial minicells as a carrier, the carrier itself is not amplified and the effect of RNAi cannot be obtained stably for a long time.

  In the first place, reports on conventional RNAi such as Non-Patent Document 1, Patent Documents 1 and 2 cannot conceive even the problem of causing RNAi in human and animal intestines. For example, the nematode applied in Non-Patent Document 1 has soil habitat, and the soil has a completely different environment from the intestines of humans and animals. Therefore, it is difficult to even come up with the problem of causing RNAi in the intestine from Non-Patent Document 1.

  In view of the above problems, the present invention has been made in order to solve a completely new problem as described above. The object of the present invention is to provide RNAi easily and stably in the intestines of humans and animals. Kits for generating double-stranded RNA (especially, short double-stranded RNA that exerts an RNAi effect on mammalian cells called siRNA or shRNA) in human and animal intestinal cells in order to wake up To provide technology using

  In order to solve the above-mentioned problems, a kit for producing double-stranded RNA by lactic acid bacteria according to the present invention is characterized by comprising a vector containing a promoter that functions in mammals.

  In the kit according to the present invention, the promoter that functions in the mammal is more preferably a promoter transcribed by PolIII.

  In the kit according to the present invention, the promoter transcribed by PolIII is more preferably a U6 promoter.

  The lactic acid bacterium according to the present invention is characterized by containing a vector in which a DNA encoding a double-stranded RNA is operably linked to a promoter that functions in a mammal.

  In the lactic acid bacterium according to the present invention, the promoter functioning in the mammal is more preferably a promoter transcribed by PolIII.

  The therapeutic composition for enteric diseases according to the present invention is characterized by containing the lactic acid bacterium according to the present invention.

  Since the kit for producing double-stranded RNA by lactic acid bacteria according to the present invention comprises a vector containing a promoter that functions in mammals such as a promoter transcribed by PolIII, the human and the human in the intestine of the animal and There is an effect that the effect of RNAi can be obtained stably and simply in an animal cell.

It is a figure which shows the result of having used the colony obtained by introduce | transducing pUCYIT-shLuc to colony PCR. It is a figure which shows the result of having quantified pUCYIT-shLuc in lactic acid bacteria by real-time PCR method. It is a figure which shows the result of having confirmed the effect of RNAi by pUCYIT-shLuc in a CHO cell. In Example 4, it is a figure which shows a mode that 211H-Luc was administered to the mouse | mouth. In Example 4, it is a figure which shows a mode that the lactic acid bacteria obtained in Example 1 are locally injected into a mouse | mouth. In Example 4, it is a figure which shows the result of having observed the mode of the mouse | mouth before and after administration of a sample using IVIS200. In Example 4, it is a figure which shows the result of having calculated the FLuc activity ratio before and behind administration of a sample. In Example 5, it is a figure which shows a mode that lactic acid bacteria are orally administered using the gastric sonte method. FIG. 9 is a diagram showing the results of oral administration of lactic acid bacteria to mice and observing luciferase activity in Example 5. FIG. 9 (a) shows the results of administration of pUCYIT-Luc Lactobacilli, and FIG. 9 (b) shows a comparison. FIG. 9C shows the results of administration of the pUCYIT-Luc vector solution prepared for the purpose, and FIG. 9C is an anatomical view of the mouse shown as a reference.

<1. Kit for producing double-stranded RNA by lactic acid bacteria according to the present invention>
The kit for producing double-stranded RNA by lactic acid bacteria according to the present invention (hereinafter simply referred to as “kit”) is provided with a vector containing a promoter that functions in mammals such as a promoter transcribed by PolIII. Good.

  By using the kit according to the present invention, double-stranded RNA (hereinafter referred to as “dsRNA”) can be generated in cells in the intestines of humans and animals using lactic acid bacteria. In other words, if the kit according to the present invention is used, an expression vector for producing dsRNA in human and animal cells can be held in lactic acid bacteria and transported to the intestines of humans and animals.

  Lactic acid bacteria can reach the intestines alive even when administered orally to humans and animals. Then, dsRNA can be expressed in the human and animal cells to cause RNAi. Therefore, by using the kit according to the present invention, dsRNA can be stably produced in the intestines of humans and animals simply by preparing a lactic acid bacterium capable of producing dsRNA and orally administering it. Thus, for example, if dsRNA that suppresses the expression of a gene encoding a protein that causes intestinal diseases (short RNA dsRNA that exhibits RNAi effect on mammalian cells) is used as dsRNA. It is also possible to treat internal diseases.

  Conventionally, there has been no report on lactic acid bacteria capable of expressing DNA encoding dsRNA. One reason for this is that, as compared to E. coli and the like, there is very little knowledge regarding genetic manipulation and transformation techniques using lactic acid bacteria as host cells.

  In the present specification, the term “dsRNA” intends a double-stranded RNA as described above. “DsRNA” may be used to refer to long double-stranded RNA, but in this specification, it includes “short-stranded double-stranded RNA such as siRNA and shRNA”. Further, in the present specification, “generates double-stranded RNA by lactic acid bacteria” means that dsRNA is generated by lactic acid bacteria. Specifically, the vector in the cells of lactic acid bacteria is different from the lactic acid bacteria. Then, a form in which the vector is expressed in the other cell to produce dsRNA is also included.

[1-1. (Vector structure)
The vector provided in the kit according to the present invention only needs to contain a promoter that functions in mammals. Examples of promoters that function in mammals include promoters transcribed by PolIII, SV promoters, and the like, and promoters transcribed by PolIII are more preferred. Hereinafter, for simplicity of explanation, the “promoter transcribed by PolIII” is referred to as “PolIII promoter”. Examples of the PolIII promoter included in the vector include U6 promoter and H1 promoter. Of these, the U6 promoter is preferred. If the U6 promoter is used, dsRNA-encoding DNA can be expressed with high efficiency in human and animal cells, and if the U6 promoter is used, DNA encoding a short dsRNA is suitable. Can be expressed.

  The PolIII promoter and SV promoter are promoters that work in mammals and are known to not work in lactic acid bacteria. However, as a result of intensive studies, the present inventors have come up with the idea that dsRNA is suitably expressed in vivo using lactic acid bacteria by using a vector containing such a promoter. That is, when a vector containing such a promoter is introduced into a lactic acid bacterium and administered to a mammal, the vector is released from the inside of the lactic acid bacterium to the outside of the mammal, and then the promoter and the like in the vector function. DsRNA is preferably expressed. The idea of using a promoter that does not work in lactic acid bacteria despite the use of lactic acid bacteria is not easily conceived by those skilled in the art, and the present inventors have arrived at the present invention with a unique focus.

  The type of vector provided in the kit according to the present invention is not particularly limited, as long as a promoter that functions in mammals such as a PolIII promoter introduced into the vector is operable. For example, a method using a plasmid, phage, cosmid or the like can be mentioned, but it is not particularly limited.

  The vector provided in the kit according to the present invention may be provided with a region for introducing DNA encoding dsRNA downstream of a promoter that functions in mammals such as a PolIII promoter, depending on the use of the kit, etc. DsRNA may be introduced in advance.

  In the case where a region for introducing DNA encoding dsRNA is provided downstream of a promoter that functions in mammals such as a PolIII promoter, if the region is formed by providing a conventionally known restriction enzyme site, etc. Good. When DNA encoding dsRNA is introduced in advance, examples of the dsRNA include dsRNA that inhibits expression of a DNA encoding a protein that causes a disease in the intestine, which will be described later, but is not limited thereto. It is not something.

  The vector provided in the kit according to the present invention may include a terminator downstream of the DNA encoding dsRNA or downstream of the region for introducing the DNA. The terminator is not particularly limited, and may be appropriately selected according to the type of promoter. For example, when the U6 promoter is employed as the PolIII promoter, it is preferable to employ the U6 terminator, but it is not limited thereto.

  The form of DNA encoding RNA polymerase contained in the kit according to the present invention is not particularly limited, and can be included in various forms. For example, a DNA containing an RNA polymerase may be further introduced into a vector containing a PolIII promoter, or a vector containing a DNA encoding an RNA polymerase may be separately provided.

  Such a vector provided in the kit according to the present invention can be prepared by a conventional method using a conventionally known restriction enzyme and / or ligase.

  The configuration of the kit according to the present invention is not particularly limited as long as it includes a vector containing a promoter that functions in mammals, and may include other reagents and instruments. For example, a reagent for stably holding the vector, a buffer, or the like may be included, or a reagent such as a restriction enzyme or ligase for introducing dsRNA into the vector may be included. In addition, a lactic acid bacterium which is a host cell of the vector may be included, or a reagent such as calcium phosphate or liposome for introducing the vector into the lactic acid bacterium may be included. In the kit according to the present invention, a plurality of different reagents may be mixed in an appropriate volume and / or form, or may be provided in separate containers.

  In addition, the kit according to the present invention may include instructions describing a procedure for introducing dsRNA into a vector and / or a procedure for introducing a vector after introduction of dsRNA into lactic acid bacteria. It may be written or printed on paper or other media, or it may be affixed to electronic media such as magnetic tape, computer readable discs or CD-ROMs.

[1-2. Method of using kit according to the present invention]
The kit according to the present invention may be used by introducing appropriately selected dsRNA into a vector provided in the kit. That is, DNAs encoding various dsRNAs can be inserted into the vector provided in the kit according to the present invention according to the purpose of the user. In addition, what is necessary is just to introduce | transduce into lactic acid bacteria as it is, when dsRNA is previously inserted in the vector.

  When dsRNA is inserted into the vector provided in the kit according to the present invention, the type of dsRNA is not particularly limited.

  In order to suppress the expression of a protein gene in cells such as mammals, dsRNA designed to hybridize to mRNA derived from DNA encoding the protein may be expressed. By targeting the causal protein of the intestinal disease and inhibiting the expression of the gene of the causative protein, it becomes possible to treat the intestinal disease.

  In order to suppress the expression of a protein gene in a cell such as a mammal, a short dsRNA in which the length of the double-stranded region of RNA in the dsRNA is 20 to 30 bp is often employed. As described above, although the size of the double-stranded region in dsRNA varies depending on the use, according to the kit of the present invention, as described above, short-chain dsRNA can be suitably produced in lactic acid bacteria.

  The method for inserting the DNA encoding dsRNA into the vector provided in the kit according to the present invention is not limited, and may be carried out by a conventional method using a conventionally known restriction enzyme and / or ligase or the like.

  A vector into which a DNA encoding dsRNA has been introduced (hereinafter referred to as “dsRNA expression vector”) may be introduced into lactic acid bacteria. The type of lactic acid bacteria used as a host cell for the dsRNA expression vector is not particularly limited, and Lactobacillus casei, L. et al. rhamnosus, L .; plantarum, L .; delbrueckii, L .; Conventionally known lactic acid bacteria such as acidophilus and Lactococcus lactis can be exemplified. Among these, L. Casei is preferable because it has a strong resistance to gastric acid and has a high probability of reaching the intestine alive.

  The method of introducing the dsRNA expression vector into lactic acid bacteria, that is, the transformation method is not particularly limited, and a conventionally known method such as electroporation, calcium phosphate method, liposome method, DEAE dextran method or the like is preferably used. it can.

  In order to cause the lactic acid bacterium according to the present invention to generate dsRNA in the intestinal cells of subjects such as humans and animals, the lactic acid bacterium according to the present invention into which the dsRNA expression vector has been introduced is orally administered to the subject. Good. Since lactic acid bacteria have strong resistance to gastric acid, they reach the intestines alive. Lactic acid bacteria that have reached the intestine, for example, are taken up by cells that cause disease in the intestine, cause RNAi in the cell, and inhibit the expression of protein genes that cause the disease. Can be treated.

  In addition, the utilization method of the lactic acid bacteria produced with the kit based on this invention is not limited to the oral administration to a test subject. In addition, since lactic acid bacteria can be safely delivered in the intestine to various organisms, they can be used for RNAi studies in various organisms.

  As shown in the above description, a method for transforming lactic acid bacteria with a vector containing a promoter transcribed by PolIII and causing RNAi in the intestines of humans and / or animals is also within the scope of the present invention.

<2. Lactic acid bacteria according to the present invention>
The lactic acid bacterium according to the present invention only needs to contain a vector in which a DNA encoding dsRNA is operably linked to a promoter that functions in mammals. Examples of promoters that function in mammals include Pol III promoters and SV promoters, with Pol III promoters being more preferred. In other words, the lactic acid bacterium according to the present invention contains a vector in which the DNA and the promoter are linked so that the DNA encoding the dsRNA can be expressed by a promoter that functions in a mammal such as a PolIII promoter. It only has to be.

  Since the DNA encoding dsRNA is operably linked to a promoter that functions in mammals such as a PolIII promoter, the lactic acid bacterium according to the present invention can express the DNA encoding dsRNA. Further, since the host cell is a lactic acid bacterium, it has excellent resistance to gastric acid. Therefore, even when the lactic acid bacterium according to the present invention is orally administered to humans and animals, it passes through the stomach and reaches the intestine alive. And dsRNA is expressed in an enteric cell. Therefore, according to the lactic acid bacterium according to the present invention, it can be easily introduced into the intestines of humans and animals, and the RNAi effect can be obtained stably in the enteric cells.

  The description of the vector provided for the lactic acid bacterium according to the present invention and the lactic acid bacterium as a host cell is based on the above description of the kit according to the present invention.

  The lactic acid bacteria according to the present invention can be produced by a conventionally known method. For example, a dsRNA expression vector is constructed by first introducing a DNA encoding a PolIII promoter and dsRNA into a vector using a restriction enzyme and / or ligase so that the DNA is operably linked by the promoter. To do. And even if the dsRNA expression vector is introduced into lactic acid bacteria by electroporation or the like, the lactic acid bacteria according to the present invention can be produced.

<3. Use of Lactic Acid Bacteria According to the Present Invention>
The present invention provides a therapeutic composition for enteric diseases for treating diseases such as cancer in the intestine.

  The therapeutic composition for intestinal diseases according to the present invention only needs to contain the lactic acid bacterium according to the present invention.

  In the present specification, “therapeutic composition for enteric disease” is a therapeutic composition containing the lactic acid bacterium according to the present invention, and intended for a therapeutic composition using intestinal diseases of human beings and animals as a treatment target.

  The lactic acid bacterium contained in the composition for controlling intestinal parasites according to the present invention may be the lactic acid bacterium according to the present invention described above. For example, a lactic acid bacterium according to the present invention, which is prepared so as to generate dsRNA that inhibits the expression of a protein gene that causes intestinal diseases, may be included.

  What is necessary is just to use what was set suitably according to the target disease as dsRNA which inhibits the expression of the protein gene which causes the disease in an intestine. For example, when colorectal cancer is targeted as a disease, what is designed to hybridize to mRNA of K-Ras mutant protein may be used. The K-Ras mutant protein is, for example, a protein that is highly expressed in human colon cancer cells SW480, and is a K-Ras protein mutant that is expressed in normal human cells. Specifically, the 12th codon is mutated from GGT (glycine) to GTT (valine). A person skilled in the art can easily obtain the sequence of K-Ras mutant mRNA. For example, as an example of K-Ras mutant mRNA sequence, GenBank accession no. M54968. Matilde E. Lleonart, Santiago Ramon y Cajal, John D. Groopman and Marlin D. Friesen, Sensitive and specific detection of K-ras mutations in colon tumors by short oligonucleotide mass analysis, Nucleic Acids Research, 2004, vol.32, No. 5 e53 also discloses a mutation of the K-Ras gene.

  Moreover, the intestinal disease which the therapeutic composition which concerns on this invention makes the object of treatment is not limited to this, For example, the intestinal disease in which a virus is concerned is mentioned. That is, the intestinal disease can be treated by suppressing the gene expression of the virus. The length of the double-stranded region in dsRNA is not limited as long as the dsRNA can cause RNAi. For example, in order to cause RNAi in mammalian cells, the length of the double-stranded region is generally about 20 to 30 bp. Short dsRNA is often used.

  Furthermore, in the present invention, cancer or cell proliferation disorder can be treated or prevented in mammals by regulating gene expression by introducing lactic acid bacteria into the living body. The proliferating cells to be treated or prevented may be, for example, colon cancer as described above, colon cancer cells, or pancreatic cancer cells. In the case of colorectal cancer, RNAi targets are mutant K-Ras gene, EGFR gene, β-catenin gene and the like. In one embodiment, the colon cancer cell is a SW480 cell. In another embodiment, the pancreatic cancer cell is a CAPAN-1 cell. Treatment and prevention of various inflammatory bowel diseases is also possible with the present invention. In this case, the target of RNAi is, for example, the TNF-α gene.

  The form of lactic acid bacteria contained in the therapeutic composition for enteric diseases according to the present invention is not limited as long as dsRNA can be produced in the intestine. For example, the therapeutic composition for intestinal diseases according to the present invention may include a culture solution containing the lactic acid bacteria according to the present invention, a crude product obtained by recovering cells from the culture solution, or a purified product. Such lactic acid bacteria may be put into a dormant state by freeze-drying or the like.

  The therapeutic composition for enteric diseases according to the present invention may contain a composition other than the lactic acid bacteria according to the present invention. The composition other than the lactic acid bacterium according to the present invention is not limited as long as it is less harmful to a subject to be administered such as humans and animals and does not impair the function of the lactic acid bacterium.

  For example, the therapeutic composition for enteric diseases according to the present invention may contain auxiliary substances such as water, physiological saline, wetting or emulsifying agents, pH buffering substances, stabilizers, antioxidants and the like.

  In addition, even if the lactic acid bacterium according to the present invention is orally administered, it reaches the intestine alive, expresses dsRNA in the intestinal cell, and can control the diseased cell. The therapeutic composition for enteric diseases is preferably prepared for oral administration.

  And when preparing the therapeutic composition for enteric diseases based on this invention for oral administration, starch, lactose, sucrose, mannitol, carboxymethylcellulose, and corn starch may be included, for example. Further, a binder, a disintegrant, a surfactant, a lubricant, a fluidity promoter, a corrigent, a colorant, a fragrance and the like may be further blended.

  As described above, since the therapeutic composition for enteric diseases according to the present invention is preferably prepared for oral administration, the form is preferably a tablet, capsule or the like, but is not limited thereto. .

  The dosage of the therapeutic composition for enteric diseases according to the present invention is appropriately set according to the formulation form, administration method, purpose of use, and age, weight, and symptom of the patient to whom the pharmaceutical is administered, and is not constant. Administration may be carried out in a single dose or divided into several doses within a desired dose range. In addition, the therapeutic composition for intestinal diseases according to the present invention can be administered orally as it is, or can be added to any food or drink and consumed daily.

  As shown in the above description, a method of treating an intestinal disease by administering the lactic acid bacterium according to the present invention is also within the scope of the present invention.

  Examples will be shown below, and the embodiments of the present invention will be described in more detail. Of course, the present invention is not limited to the following examples, and it goes without saying that various aspects are possible in detail. Further, the present invention is not limited to the above-described embodiments, and various modifications can be made within the scope shown in the claims, and the present invention is also applied to the embodiments obtained by appropriately combining the disclosed technical means. It is included in the technical scope of the invention. Moreover, all the patent documents and nonpatent literatures described in this specification are used as reference in this specification.

<Example 1: Preparation of experimental material>
[Plasmid]
In this example, pUCYIT-shLuc was used as a plasmid to be introduced into lactic acid bacteria.

  Vector pUCYIT356N (Genbank accession No. AB119527) (provided by Yakult Central Research Institute) into which the erythromycin resistance gene and the repB gene necessary for replication in lactic acid bacteria have been introduced (shown in SEQ ID NO: 1). DNA encoding U6 promoter and shRNA was introduced into the EcoRI-SalI site of ACCESSION No. AB119527). The shRNA targets mRNA of firefly luciferase (Genbank ACCESSION No. ABO769905.1) and has a sequence complementary to positions 1188-1206 of the firefly luciferase coding region.

  The sequence of the prepared pUCYIT-shLuc is shown in SEQ ID NO: 2. This vector is kept stable in lactic acid bacteria, but in which shRNA gene transcription does not occur, and when this vector is transferred into mammalian cells, transcription of the shRNA gene occurs by the U6 promoter.

  The nucleotide sequences of the DNA encoding the U6 promoter and shRNA are the 1339th to 1596th positions and the 1603 to 1654th positions of the nucleotide sequence shown in SEQ ID NO: 2. The 1333th to 1338th positions are EcoRI sites, and the 1658th to 1663th positions are SalI sites. The nucleotide sequence of shRNA obtained by expression of pUCYIT-shLuc is shown in SEQ ID NO: 3.

[Lactic acid bacteria]
Lactobacillus casei was used as a lactic acid bacterium (purchased from American Type Culture Collection (ATCC 27139)).

[Introduction of plasmid by electroporation]
In this embodiment, L.P. The vector was introduced into casei by electroporation.

  First, in 2 ml of MRS liquid medium, L. Casei glycerol stock (20 μl) was added and statically cultured at 37 ° C. overnight. Next, 100 μl was taken from the MRS liquid medium, added to 10 ml of fresh MRS liquid medium, and cultured. Next, L. In the logarithmic growth phase of casei, 4 ml was collected from the MRS liquid medium and centrifuged at 2000 g × 5 min to remove the supernatant. To the resulting precipitate, 40 μl of 10% glycerol solution was added and suspended. To this glycerol solution, 1 μl of the vector to be introduced (500 ng / μl) was added and stirred by pipetting.

  Next, the solution was transferred to a cuvette (0.2 cm manufactured by BIORAD), allowed to stand on ice for 5 minutes, and then electroporated at 1.5 kV, 200Ω, and 25 μF using Gene Pulser (manufactured by BioRad). Immediately after that, 0.9 ml of MRS medium (+ Em 20 μg / ml) was added and cultured at 37 ° C. for 2 hours. Next, the cultured MRS medium was seeded on an MRS plate (+ Em 20 μg / ml), placed in a tapper so that the MRS plate did not dry, and cultured at 37 ° C. When cultured for 2 to 3 days, colonies grew. In this way, the L. elegans introduced with the vector was introduced. casei was obtained.

  The introduction of the vector was confirmed by colony PCR. First, 10 μl of 2 × TET (20 mM Tris-HCl, pH 8.0, 2 mM EDTA, 1% Triton X-100) was put in an 8-strip tube, and then the cells were collected by lightly pitting the colony with a toothpick. And suspended in the above 2 × TET. Next, after incubating at 95 ° C. for 5 minutes, the mixture was centrifuged for 5 minutes in a tabletop centrifuge, and 1 μl of the supernatant was recovered. This was used as a template for colony PCR.

  Next, 0.1 μl of Vent DNA polymerase (manufactured by New England Biolabs), 1 μl of 10 × Vent Buffer (attached to Vent DNA polymerase), 2 μm of dNTPs 1 μl, positive primer (GCAAGTCGGATGGATGGATGGATGGATGAGTGTAGG sequence; No. 4) 0.2 μl, reverse primer (AGGTCCACCAAAATAGTCG; SEQ ID NO: 5) 0.2 μl and ultrapure water 6.5 μl were mixed to make a total volume of 10 μl. Moreover, the said ultrapure water is the ultrapure water refine | purified using the Milli-Q system (made by a Millipore company).

  As temperature conditions, after incubation at 95 ° C. for 3 minutes, 30 cycles of 95 ° C. for 30 seconds, 54 ° C. for 30 seconds, and 72 ° C. for 30 seconds were performed. After performing colony PCR, 5 μl of the solution after the reaction was subjected to electrophoresis on a 3% agarose gel and stained with ethidium bromide to confirm the result of colony PCR.

  As an example of the result of colony PCR, the result of colony PCR when pUCYIT-shLuc is introduced is shown in FIG. FIG. 1 is a diagram showing the results of subjecting colonies obtained by introducing pUCYIT-shLuc to colony PCR, and lane 1 shows the results of colonies introduced with a vector. Lane 2 shows a double-stranded DNA size marker (New England Biolabs 2-Log DNA Ladder). Lane 3 is an L. elegans that introduced pUCYIT356N. Casei colony PCR results, lane 4 shows the results of PCR under the same conditions without using a template. In the colony PCR, if a 420 bp PCR fragment is obtained, it indicates a colony into which a plasmid has been introduced. As shown in FIG. 1, a 420-bp PCR fragment was confirmed from the colony subjected to lane 1 (cannot be confirmed in lanes 3 and 4). Therefore, L. It was confirmed that pUCYIT-shLuc was introduced into casei.

<Example 2: Quantification of pUCYIT-shLuc in lactic acid bacteria by real-time PCR>
In this example, L. pylori transformed with pUCYIT-shLuc prepared in Example 1 was used. The amount of plasmid present in casei was measured using a real-time PCR instrument.

First, L. pylori transformed with pUCYIT-shLuc. casei was statically cultured in MRS medium (+ Em 20 μg / ml). The cultured cells were counted to make a suspension of 2 × 10 ⁷ cells / μL, and 1 μL (that is, 2 × 10 ⁷ cells / μL) was added to the 2 × TET to make a total volume of 20 μL. . Next, after incubating at 95 degrees for 5 minutes, the supernatant was collected by centrifuging for 5 minutes in a tabletop centrifuge. This was used as a template for PCR.

Next, 1 μl of a solution obtained by diluting the supernatant 10 times (template: DNA contained in 1 × 10 ⁵ cells), Fast SYBR green Mix (2 ×) 5 μl (manufactured by Applied Biosystems), 2 μM 5U6-2 primer ( CCGAGCTCGAATTCAAGGTCGGGCAGG; SEQ ID NO: 6) 1 μl, 2 μM 3U6 primer (GGTGTTTCGTCCCTTTCCAC; SEQ ID NO: 7) 1 μl, ultrapure water 2 μl were mixed to make a total volume of 10 μl PCR reaction solution. For the calibration curve, a PCR reaction solution was prepared in the same manner as the PCR reaction solution using 1 μl solution containing 30 pg, 300 pg, 3 ng, and 30 ng of pUCYIT-shLuc instead of 1 μl of the cell extract. For these PCR reaction solutions, the target plasmid was quantified using a real-time PCR system (Step One manufactured by Applied Biosystems). PCR conditions were 95 ° C. for 5 seconds, then (95 ° C. for 18 seconds, 60 ° C. for 30 seconds) for 40 cycles, 60 ° C. for 1 minute, and 95 ° C. for 15 seconds. Three sets of samples were prepared for each measurement point and measured. When the target plasmid is detected by this real-time PCR, the length of the amplified DNA is 278 bp. The results are shown in FIG. FIG. 2 is a diagram showing the results of quantifying pUCYIT-shLuc in lactic acid bacteria by a real-time PCR method, and the vertical axis CT (threshold cycle) indicates that the PCR amplification curve is represented by the threshold line (threshold set in the exponential amplification period). The number of cycles crossed is shown, and the horizontal axis shows the amount of pUCYIT-shLuc subjected to real-time PCR.

As shown in FIG. 2, the measurement by real-time PCR showed that 1.2 ng of plasmid was contained in 1.0 × 10 ⁵ cells.

<Example 3: Confirmation of RNAi by shRNA expression vector>
In this example, RNAi by pUCYIT-shLuc constructed in Example 1 was confirmed.

  pUCYIT-shLuc 70 ng, firefly luciferase (FLuc) expression vector (ProGL pGL3-control) 70 ng, and Renilla luciferase (RLuc) expression vector (Promega pRL-SV40) 70 ng were introduced into CHO cells. pGL3-control and the Fluc sequence encoded thereby are shown in SEQ ID NOs: 8 and 9, respectively. Note that SEQ ID NO: 8 is GenBank with ACCESSION No. It is registered as U47296. The peptide consisting of the amino acid sequence shown in SEQ ID NO: 9 is encoded at positions 280 to 1932 of pGL3-Control shown in SEQ ID NO: 8. In addition, SEQ ID NO: 9 is ACCESSION No. It is registered as AAA89084. pRL-SV40 and the RLuc sequence encoded thereby are shown in SEQ ID NOs: 10 and 11. In addition, SEQ ID NO: 10 is GenBank with ACCESSION No. It is registered as AF025845. The peptide consisting of the amino acid sequence shown in SEQ ID NO: 11 is encoded at positions 694 to 1629 of pRL-SV40 shown in SEQ ID NO: 10. In addition, SEQ ID NO: 11 is GenBank with ACCESSION No. It is registered as AAB82577. The CHO cells were obtained from Invitrogen (product name: Flp-In-CHO cells). In addition, RNA was introduced into cells using Effectene (registered trademark) transfection reagent (manufactured by QIAGEN) according to the instruction manual attached thereto.

  The CHO cells into which the plasmid vector was introduced were cultured at room temperature for 24 hours, and then the luciferase activity was measured on the next day using a Dual-Luciferase Reporter System System (Promega). As negative controls, (1) CHO cells into which only FLuc expression vector and RLuc expression vector were introduced, and (2) CHO cells into which pUCYIT356N was introduced in addition to FLuc expression vector and RLuc expression vector were used. In the negative control, the same method as that described in this example was performed except that pUCYIT-shLuc was not used. The results are shown in FIG. FIG. 3 is a diagram showing the results of confirming the effect of RNAi by pUCYIT-shLuc in CHO cells.

  As shown in FIG. 3, it was confirmed that expression of FLuc was specifically suppressed in CHO cells into which pUCYIT-shLuc was introduced, as compared with the negative control. That is, it was confirmed that pUCYIT-shLuc has an RNAi effect in mammalian cells.

<Example 4: Confirmation of RNAi in mouse malignant tumor cells by lactic acid bacteria carrying shRNA expression vector>
As an index for verifying the RNAi effect in the intestine, the following model experiment was conducted for the purpose of confirming the RNAi effect in vivo on human tumor cells.

To 20 nude mice (male, 6 weeks old), 10 ⁷ cells of human malignant mesothelioma cell line FLuc expression strain (211H-Luc) were subcutaneously administered to the right foot. This is shown in FIG. FIG. 4 shows how 211H-Luc was administered to mice in this example. In addition, when ingesting, cells were suspended in 100 μL of Matrigel (BD biosciences, BD Matrigel Basement Matrix) so that 211H-Luc was easily engrafted. The mice were bred for about 3 weeks until the tumor of 211H-Luc cells grew to a sufficient size. Thereafter, lactic acid bacteria for delivering the RNAi effect (transformed with pUCYIT-shLuc obtained in Example 1) were locally injected into the site where the tumor was engrafted. This is shown in FIG. FIG. 5 is a diagram showing a state in which the lactic acid bacteria obtained in Example 1 are locally injected into a mouse. FLuc activity was measured 2 days after local injection. For FLuc activity measurement, after anesthesia using isoflurane, 50 μL of luciferin (30 mg / ml in PBS buffer) (Promega, Betle Luciferin) was administered to the abdominal cavity of the mouse, and IVIS 200 Imaging System after 5 to 10 minutes. (Measured in 0.02 seconds). As a negative control experiment, FLuc activity was also measured in the case of local injection of lactic acid bacteria transformed with an empty vector (pUCYIT356N) and local injection of physiological saline without administration of lactic acid bacteria. The lactic acid bacterium transformed with pUCYIT-shLuc and the lactic acid bacterium transformed with the above empty vector were each administered with 200 μl of suspension in physiological saline at a concentration of 2 × 10 ⁸ cells / 200 μl.

  The results are shown in FIGS. FIG. 6 is a diagram showing the results of observation of mice using IVIS 200 before and after sample administration, and FIG. 7 is a diagram showing the results of calculating the FLuc activity ratio before and after sample administration. In addition, the vertical axis | shaft of FIG. 7 is the value computed as follows. That is, in the mouse FLuc image, the vicinity of the tumor site is surrounded by a circle, and the FLuc activity of that part is measured. Next, before and after sample administration and in the negative control experiment, the FLuc activity in the region surrounded by a circle of the same size is also measured. The value on the vertical axis is obtained by dividing the Fluc activity after sample administration by the FLuc activity before sample administration.

As shown in FIGS. 6 and 7, in the group of mice administered with lactic acid bacteria retaining pUCYIT-shLuc as compared to the negative control, a significant decrease in FLuc activity was confirmed, and the RNAi effect was confirmed. When this experiment was repeated, reproducibility was confirmed. In addition, even when pUCYIT-shLuc in an amount equal to the amount of plasmid (2.4 μg) contained in lactic acid bacteria (2 × 10 ⁸ cells) administered in FIG. 6 is dissolved in 200 μl of physiological saline and administered to mice, RNAi is completely removed. The effect was not seen. From these results, it was confirmed that lactic acid bacteria carried the shRNA expression vector into human tumor cells, and that the RNAi effect by the shRNA was exhibited in the human tumor cells.

  The specific embodiments or examples made in the detailed description section of the invention are merely to clarify the technical contents of the present invention, and are limited to such specific examples and are interpreted in a narrow sense. It should be understood that various modifications may be made within the spirit of the invention and the scope of the following claims.

<Example 5: Confirmation of luciferase expression>
In this example, a lactic acid bacterium having a vector derived from pUCYIT356N having an SV promoter which is a promoter that functions in mammals in the same manner as a promoter transcribed by PolIII is orally administered to a mouse, so that the vector becomes a mouse. It was confirmed that it was transmitted to intestinal cells.

[5-1: Preparation of luciferase expression vector]
pGL3-control vector (Promega) was cleaved with KpnI and SalI, and a 2440 bp fragment was purified by agarose gel electrophoresis. This fragment is a sequence in which a firefly luciferase gene follows downstream of the SV promoter that works in mammalian cells. The sequence is shown in SEQ ID NO: 12. In SEQ ID NO: 12, positions 1 to 6 are KpnI sequences, positions 2448 to 2453 are SalI sequences, positions 48 to 250 are promoters, and positions 280 to 1932 are luciferase genes. Next, this fragment was incorporated into the KpnI-SalI site of pUCYIT356N (SEQ ID NO: 1), which is the same vector as used in Example 1. This produced a vector [pUCYIT-Luc] that expresses the luciferase gene when entering mammalian cells. Although pUCYIT-Luc is stably retained in lactic acid bacteria, expression of the luciferase gene does not occur in lactic acid bacteria.

[5-2: Production of lactic acid bacteria expressing luciferase in mammalian cells]
In the same manner as in Example 1 [Introduction of Plasmid by Electroporation], pUCYIT-Luc was prepared by L. Casei was introduced into cells.

[5-3 Lactic Acid Bacteria Administration to Mice by Forced Feeding Method (3 times a Day x 3 Days) and Observation]
Transfer of the pUCYIT-Luc vector in vivo was observed by administering lactic acid bacteria to mice using the forced feeding method. Specifically, it was examined whether or not the pUCYIT-Luc vector was transferred into cells in the intestine of mice by observing luminescence of luciferase using IVIS 200 Imaging System manufactured by Xenogen.

(1) Collection of lactic acid bacteria Lactic acid bacteria (pUCYIT-Luc Lactobacilli) into which pUCYIT-Luc was introduced into 2 mL MRS medium (+ Em 20 μg / mL) were added, and preculture was performed. The culture solution 2 mL pre-cultured the next day was added to 800 mL MRS medium (+ Em 20 μg / mL). Static culture was performed at 37 ° C. until OD = 1.0 (A600). Thereafter, the whole culture broth was centrifuged (2000 × G 4 ° C., 4 min). The supernatant was removed, suspended in 200 mL of physiological saline, and then centrifuged (2000 × G 4 ° C., 4 min). The supernatant was removed again, physiological saline was added, and the mixture was centrifuged (2000 × G 4 ° C., 4 min). After removing the supernatant, physiological saline was added to a total volume of 8 mL to obtain 5 mL of lactic acid bacteria solution (2 × 10 ⁹ cells / mL).

For comparison, a pUCYIT-Luc vector solution containing the same amount as that contained in 2 × 10 ⁹ cells / μL of lactic acid bacteria was also prepared in physiological saline (24 μg / mL).

(2) Administration of lactic acid bacteria Lactic acid bacteria were forcibly fed using the gastric sonte method (a method in which a solution to be administered is placed in a syringe and a tube connected to the syringe is injected to reach the stomach). A state of feeding is shown in FIG. FIG. 8 is a diagram showing a state in which lactic acid bacteria are orally administered using the gastric sonte method in this example. 400 μL (8 × 10 ⁸ cells) was administered per animal at a time. Three times a day (10:00, 13:00, 16:00) were carried out continuously for 3 days (the administered lactic acid bacteria were cultured and collected on the day before the administration day). The day after the last day of administration, mice were examined for luciferase luminescence using an IVIS 200 Imaging System. Luciferin was administered intraperitoneally at 50 μL. Luciferin diluted to 30 mg / ml was used.

(3) Observation in the intestine First, mice were dislocated from the cervical vertebrae and euthanized. Thereafter, the mouse abdomen was cut and the duodenum to rectum were removed. This was washed with PBS, transferred to a petri dish containing fresh PBS, and then luciferase luminescence was examined using an IVIS 200 Imaging System. 50 μL of luciferin was added to the petri dish. Luciferin diluted to 30 mg / ml was used.

(4) Results The results are shown in FIG. FIG. 9 is a diagram showing the results of observation of luciferase activity by orally administering lactic acid bacteria to mice in this example. FIG. 9 (a) shows the results of administering pUCYIT-Luc Lactobacilli, and FIG. ) Shows the result of administration of the pUCYIT-Luc vector solution prepared for comparison, and FIG. 9C is an anatomical view of the mouse shown as a reference. As shown in FIG. 9, by administering pUCYIT-Luc Lactobacilli, luciferase activity could be confirmed in the vicinity of the intestinal location.

  As described above, it was confirmed by confirming the luminescence of luciferase that the pUCYIT356N-derived luciferase expression vector was transmitted and functioned.

  The kit according to the present invention can produce dsRNA in human and animal cells using lactic acid bacteria. For this reason, RNAi can be stably generated in the intestines of humans and animals. Therefore, the present invention can be used in the pharmaceutical industry, food industry and related industries.

Claims (6)

A kit for generating a double-stranded RNA by lactic acid bacteria, characterized in that it comprises a vector comprising a promoter transcribed by P OlIII that acts in a mammal, produces a double-stranded RNA by lactic acid bacteria Kit to do.   The lactic acid bacterium is Lactobacillus casei, Lactobacillus rhamnosus, Lactobacillus plantarum, Lactobacillus delbrueckii, Lactobacillus acidophilus or Lactococcus.   The kit according to claim 1, wherein the promoter transcribed by PolIII is a U6 promoter.   It contains a vector in which a DNA encoding a double-stranded RNA is operably linked to a promoter that functions in mammals, and the promoter that functions in mammals is a promoter transcribed by PolIII. Lactic acid bacteria characterized by.   Lactobacillus casei, Lactobacillus rhhamnosus, Lactobacillus plantarum, Lactobacillus delbrueckii, Lactobacillus acidophilus or Lactococcus lactis characterized by claim 4.   A therapeutic composition for intestinal diseases, comprising the lactic acid bacterium according to claim 4 or 5.