JP5654808B2 - Method for evaluating or selecting hair growth regulator - Google Patents

Description

  The present invention relates to a method for evaluating or selecting a hair growth regulator.

  Biologically, hair or body hair protects important organs such as the head, chest, and limbs. However, in recent years, there is an increasing tendency that hair on limbs and the like is preferably not in terms of aesthetic appearance.

  Examples of the method for removing body hair include a mechanical removal method using a shaver, a hair removal device, and the like, and a removal method by chemical action using a hair removal agent or a hair removal agent. However, these hair removal methods may be accompanied by physical or chemical irritation to the skin and are still insufficient in terms of hair suppression action, so that the hair removal treatment is performed again after a certain period of time. There must be. Reduction of body hair removal processing is desired.

  Conventionally, when evaluating or selecting a hair restorer or a hair suppressant, it is applied to the skin of a living body (Patent Documents 1 to 3), or an in vitro human, mouse, rat, or pig hair follicle organ After administering the candidate substance to the culture, the degree of hair elongation and hair follicle growth was measured, and the hair growth or hair-loss action of the candidate substance was evaluated based on the measurement results (Patent Documents 4 to 7, Non-patent documents 1 to 3). Considering the efficiency and accuracy of evaluation, in vitro tests are more preferable. However, organ culture of hair follicles in vitro may be difficult to obtain sample hair follicles, it takes time to cultivate, and several days before hair growth and hair follicle growth are observed Therefore, there is a problem that it takes time to evaluate. There is a need to develop an in vitro screening system for evaluating or selecting hair restorers or hair suppressants more efficiently.

  Patent Document 7 observes that heat shock proteins HSP-27, HSP-70 and HSP-90 are present in human hair follicles, and that hair fiber growth is significantly reduced by administration of HSP-27 antibody to hair follicles. It has been described that the growth of human hair follicles was reduced in a dose-dependent manner by the administration of the HSP-90-specific inhibitor geldanamycin or the HSP synthesis inhibitor KNK437. However, since there are many types of heat shock proteins and their functions are diverse, the molecular mechanism by which the above heat shock proteins are involved in hair growth is not clear, and whether other heat shock proteins can be involved in hair growth. Could not be predicted.

International Publication No. 03/086331 Pamphlet JP-A-2005-206536 JP 2006-008657 A International Publication No. 2010/016606 Pamphlet JP 11-49647 A JP 2002-62289 A Japanese Patent No. 4189024

Jindo et al., The Journal of Dermatology, Vol, 20: 756-762, 1993. Makoto Utsuka and Sou Chika Sawa, Nikko Journal, 104 (8): 979-987, 1994. Philpott et al., Journal of Cell Science, 97: 463-471, 1990.

  The present invention relates to a method for evaluating or selecting a hair growth regulator using gene expression as an index.

  The present inventors have found that a substance that controls hair growth can be efficiently evaluated or selected by using the expression of DnaJC6 as an indicator, and have completed the present invention.

That is, the present invention provides the following.
1) A method for evaluating or selecting a hair growth regulator, comprising:
Administering a test substance to a cell capable of expressing DnaJC6;
Measuring the expression of DnaJC6 in the cell; and evaluating the hair growth control effect of the test substance based on the expression;
Including the method.

  According to the present invention, a hair growth regulator can be evaluated or selected in vitro, simply, quickly and efficiently.

The effect of Aurelia extract and Beech rose extract on human DnaJC6 promoter activity. n = 3, mean ± SD. *: P <0.05, ***: P <0.001 (non-paired t-test, vs Vehicle). The effect of auren extract and beech rose extract on human DnaJC6 mRNA expression. n = 3, mean ± SD. *: P <0.05, **: P <0.01 (non-paired t-test, vs Vehicle). Effect of Auren extract and Beech rose extract on human DnaJC6 protein expression. Effect of Aureen extract on hair growth. A: Observation results of hair growth over time (n = 5 or 6, mean ± SD. *: P <0.05, **: P <0.01, ***: P <0.001 (non-paired t-test, vs Vehicle) B: Cultured hair follicle image after 10 days. Effect of beech extract on hair growth. A: Observation results of hair growth over time (n = 10-14, mean ± SD. ***: P <0.001 (non-paired t-test, vs Vehicle) B: Cultured follicle image after 9 days.

  The present invention provides a method for evaluating or selecting a hair growth regulator. The method includes the following steps: administering a test substance to a cell capable of expressing DnaJC6; measuring the expression of DnaJC6 in the cell; and evaluating a hair growth control effect of the test substance based on the expression .

  In the present specification, “hair growth control” means an action of promoting or suppressing the elongation of hair or hair follicles, or an action of increasing or decreasing hair diameter. That is, “hair growth control” in the present specification is a concept including promotion and suppression of hair growth.

  In this specification, “DnaJC6” is registered in the NCBI database (OMIM) [http://www.ncbi.nlm.nih.gov/sites/entrez?db=omim] as MIM ID * 608375. Refers to protein. DnaJC6 is a protein classified as a heat shock protein. There are many families of heat shock proteins, for example, broadly divided into HSP11O, HSP90, HSP70, HSP60, HSP40, HSP27, and HSP1O families. Of these, DnaJC6 is presumed to be a molecular chaperone belonging to the DNAJ / HSP40 family.

  In the present specification, “cells capable of expressing DnaJC6” include cells that inherently have the DnaJC6 gene and have the ability to express it, and cells that have been introduced exogenously to express the DnaJC6 gene. It is done. The cell may be a cell collected from a living body, a cell contained in a tissue or organ collected from a living body, or a cultured cell. Preferably, the cell is derived from a mammal. Cells that naturally have the DnaJC6 gene and are capable of expressing it include cells derived from any tissue of the organism, but preferably cells derived from skin collected from mammals, such as hair Examples include tissue-derived cells, epidermal tissue-derived cells, dermal tissue-derived cells (fibroblasts, etc.), brain-derived cells, and the like, and cell cultures, organ cultures, and the like derived from these cells. A cell in which the DnaJC6 gene can be expressed exogenously can be obtained by introducing an expression vector incorporating the DnaJC6 gene into any mammalian cell and transforming the cell. Methods for producing an expression vector incorporating the DnaJC6 gene and methods for introducing the expression vector into mammalian cells are well known to those skilled in the art.

  The test substance to be administered to the cells is not particularly limited as long as it is a substance desired to be used as a hair growth regulator, for example, animals and plants, marine organisms, microorganisms and extracts thereof; Natural ingredients; synthetic compounds; and mixtures and compositions thereof.

  The expression of DnaJC6 in the cells can be measured using the expression of DnaJC6 protein, the expression of DnaJC6 gene encoding the protein or its mRNA, the activation of the promoter of DnaJC6 gene, etc. as an index. The measurement may be performed according to a method known in the art as a method for measuring parameters used as indicators (for example, protein expression, gene or mRNA expression, DnaJC6 gene promoter activation, etc.). As a measuring method, for example, RT-PCR, agarose gel electrophoresis, Real-time RT-PCR, SDS-PAGE, chromatography method, immunoassay (for example, immunohistochemistry, ELISA, Western blot, immunoprecipitation) Etc.), colorimetric determination method, fluorescence / optical measurement method, mass spectrometry, electron microscope observation, etc., and combinations thereof, but are not limited thereto.

  When measuring DnaJC6 expression using the activation of the DnaJC6 gene promoter as an index, the promoter used for the measurement is preferably the human DnaJC6 promoter. The human DnaJC6 promoter has one to several (preferably 1 to 10, more preferably 1 to 5) promoters having the base sequence represented by SEQ ID NO: 1 and the base sequence represented by SEQ ID NO: 1. ) Are substituted, deleted, inserted, added, and controlled by a transcription factor similar to the promoter having the base sequence shown in SEQ ID NO: 1 to control the expression of downstream genes. The activation of the DnaJC6 gene promoter may be measured by, for example, operably linking a marker gene such as a luciferase gene downstream of the promoter and measuring the expression of the marker gene (for example, luciferase activity).

  Based on the measurement results, the hair growth control effect of the test substance is evaluated. The evaluation is performed, for example, before and after administration of the test substance, or by comparing the test substance addition group with the test substance non-addition group or the control substance addition group. Alternatively, the evaluation can be performed by comparing the measurement results between different concentrations of the test substance. A substance that affects the expression of DnaJC6 can be selected as a hair growth regulator. For example, a test substance that decreases or inhibits the expression of DnaJC6 or suppresses the increase in expression of DnaJC6 is selected as a hair growth inhibitor. A test substance that increases or promotes the expression of DnaJC6 or suppresses the decrease in the expression of DnaJC6 is selected as a hair growth promoter.

  The hair growth control agent thus obtained can be used for hair growth, hair growth, hair removal, hair removal, hair growth suppression, or the like, or hair growth agents, hair growth agents, hair removal agents, hair removal agents, hair growth inhibition. It can be an active ingredient such as an agent. Alternatively, by administering the hair growth regulator to a subject in need of promoting or suppressing hair growth such as hair growth, hair growth, hair removal, hair removal, hair growth inhibition, etc. Hair growth, hair growth, hair removal, hair removal, hair growth inhibition, etc. can be realized by promoting or suppressing. Alternatively, the hair growth regulator may be used as a composition for hair growth, hair growth, hair removal, hair removal, hair growth suppression, etc., as a medicine, quasi-drug, cosmetic or food and drink, or for their production. Can be used for

  EXAMPLES Hereinafter, an Example is shown and this invention is demonstrated more concretely.

Example 1 Evaluation of Test Substance Based on DnaJC6 Expression (1) Procedure
Preparation of Ouren Extract Solution 400 mL of 50% ethanol aqueous solution was added to 40 g of Ouren root (Shinwa Bussan) and immersed for 13 days at room temperature. This was filtered to obtain an aurene extract. When this auren extract was concentrated, the solid content was 5.46 g. The solid concentration of the extract was 1.73 wt%.
Preparation of Beech Grassroot Extract 400 ml of 50% ethanol aqueous solution was added to 40 g of beech grassroot (Shinwa product) and immersed at room temperature for 27 days. This was filtered to obtain a beech extract. When this beech rose extract was concentrated, the solid content was 4.39 g. The solid content concentration of the extract was 1.33 wt%.

Cultured human cultured cells (293A, ATCC or MeWo, Human Science Foundation) with DnaJC6 expression in DMEM (Invitrogen, High glucose, 10% heat-inactivated FBS) at 37 ° C, 5% CO ₂ did. The test substance was adjusted to a concentration of 1 mg / ml with 50% ethanol and added to the medium so that the concentration was 0.1 vol% (final concentration 1 μg / ml). For the control group, the same amount of 50% ethanol solution (Vehicle) was added to the medium.

Measurement of human DnaJC6 promoter activity hDnaJC6opP / pGL4.10 [luc2] plasmid in which a firefly luciferase gene is inserted downstream of the human DnaJC6 promoter (SEQ ID NO: 1979 bp [−771 to +208 from the transcription start site]), and transfection efficiency In order to correct the above, a plasmid (pRL-CMV, Promega) in which Renilla luciferase was introduced downstream of the CMV promoter was transfected into 293A cells using LipofectAMINE 2000 reagent (Invitrogen). After 8 hours, the medium was changed and the test substance was added. Further, after 24 hours, each luciferase activity was measured.
The luciferase assay was performed using Dual-Glo Luciferase Assay System (Promega). After removing the medium, Dual-Glo luciferase reagent diluted 2-fold with PBS was added and stirred, and then firefly luciferase activity was measured about 20 minutes later. Thereafter, an equal amount of Dual-Glo Stop & Glo reagent was added and stirred, and then Renilla luciferase activity was measured. In both cases, the measurement time for luciferase activity was 2 seconds.
All DnaJC6 promoter activities (firefly luciferase activities) were corrected by dividing by the Renilla luciferase activity introduced for transfection efficiency correction. Thereafter, the inhibition rate of DnaJC6 promoter activity was determined by the following formula, and the percentage of the test substance inhibiting DnaJC6 promoter activity was calculated.
DnaJC6 promoter activity inhibition rate (%)
= {(Solvent control addition group-test substance addition group) / solvent control addition group} × 100

Real-time RT-PCR
After adding the test substance, total RNA was extracted from MeWo cells cultured for 24 hours using RNeasy Mini Kit (QIAGEN). Total RNA was prepared according to the attached instruction manual. The total RNA was heat-treated at 65 ° C. for 5 minutes after adjusting the concentration, and used after quenching. For the reverse transcription reaction, a certain amount of total RNA and Oligo (dT) ₂₀ were used, and ThermoScript RT-PCR System (Invitrogen) was used. The reaction was performed according to the attached instruction manual. RT samples were stored at −20 ° C. until use.
Quantification of mRNA expression by Real-time RT-PCR was performed using POWER SYBR-green PCR Master Mix (ABI) and PCR product automatic detection / quantification system PRISM7500 (ABI). In 50 μl of the reaction solution, amplification conditions were 95 ° C., 15 seconds denaturation reaction, 60 ° C., 1 minute annealing and extension reaction. The DnaJC6 mRNA gene expression level was corrected by the control gene RPLP0 mRNA expression level. Primers used for RT-PCR were designed using Primer Express ver. 2.0 (ABI). The primers used are shown below.
DnaJC6 Forward: CAGGAAAGTGAGCAATCAGATGA (SEQ ID NO: 2)
DnaJC6 Reverse: GGCTTGTCACCATTGGCATT (NM_014787: 53bp, SEQ ID NO: 3)
RPLP0 Forward: TCCTGAGTGATGTGCAGCTGAT (SEQ ID NO: 4)
RPLP0 Reverse: AGCACTTCAGGGTTGTAGATGCT (NM_053275: 151bp, SEQ ID NO: 5)

After adding Western blotting test substances, MeWo cells cultured for 24 hours are collected and solubilized with Lysis buffer (50 mM Tris-HCl, 125 mM NaCl, 0.5% NP40, pH = 7.6) containing 1% protease inhibitor cocktail (SIGMA) After mixing with Sample buffer, it was heat-treated at 100 ° C. for 5 minutes and then used for Western blotting. Polyacrylamide gel electrophoresis was performed by a standard method, and 4-20% gradient gel was used. Blotting was transferred to a Hybond P (Amersham) membrane by a wet method. After transfer to the membrane, blocking was performed with 5% skim milk. The primary antibody was rabbit anti-DnaJC6 antibody prepared by standard methods at 1 μg / ml in 5% skim milk, and goat anti-beta-Actin (I-19) antibody (SantaCruz) in 0.2 μg in 5% skim milk. / Ml. Secondary antibodies were anti-rabbit IgG-HRP (Amersham) or anti-goat IgG-HRP (SantaCruz), respectively, and used at a 1/2000 dilution in 5% skim milk. ECL color development was performed using LumiGLO Reagent and Peroxide (Cell Signaling) according to the instruction manual.

(2) Results The results are shown in FIGS. In the group to which the auren and beech rose extract were added to the control group (Vehicle), DnaJC6 promoter activity and DnaJC6 mRNA expression were significantly suppressed, and the expression level of DnaJC6 protein was also suppressed.

Example 2 Evaluation of Barberation of Test Substance Using Human Isolated Hair Follicle A human scalp sample was disinfected by immersing in a 0.1% Hibiten solution for 1 minute and then washed with PBS. Thereafter, hair follicles were isolated in a William E medium (Invitrogen) using tweezers and a scalpel under a stereomicroscope. The isolated hair follicle was added to William E medium so as to be 2 mM L-Glutamine (Invitrogen), 10 μg / ml Insulin (Invitrogen), 40 ng / ml Hydrocortisone (SIGMA), 1% Antibiotics-antimitotics (Invitrogen) Medium (24 well plate, 300 μl) was cultured under conditions of 37 ° C. and 5% CO ₂ . The oren extract and the beech rose extract prepared in Example 1 were adjusted to a concentration of 1 mg / ml with 50% ethanol and added to the medium so that the concentration was 0.1 vol% (final concentration 1 μg / ml). As a control, the same amount of 50% ethanol solution (Vehicle) was added to the medium.
For organ-cultured hair, photographs were taken over time under a microscope, and the length of the hair follicle was calculated by image analysis based on the scale photographed under the same conditions. Image analysis was performed with NewQube (version 4.0.3, Nexus), and the amount of increase from the initial value was defined as the amount of hair elongation.

  The results are shown in FIGS. In the control group (Vehicle), hair follicle elongation (hair growth) was observed according to the culture time, while in the group added with auren or beech rose having DnaJC6 expression inhibitory action, hair follicle elongation was significantly suppressed.

Claims (5)

The following steps (A) to (C):
(A) a step of measuring the expression level of DnaJC6 in cells capable of expressing DnaJC6 in the presence and absence of a test substance;
(B) comparing the expression level of DnaJC6 in the cell in the presence of the test substance with the expression level of DnaJC6 in the cell in the absence of the test substance; and (C) comparing with the absence of the test substance. Selecting a test substance that decreases the expression level of DnaJC6 as a hair growth inhibitor, and selecting a test substance that increases the expression level of DnaJC6 as a hair growth promoter ,
A method for evaluating or selecting a hair growth inhibitor and a hair growth promoter . The expression level of DnaJC6 is, the expression of DnaJC6 protein, expression of a gene or mRNA coding for DnaJC6 protein, or the amount of activation of the promoter of the gene encoding DnaJC6 protein, The method of claim 1, wherein. The method according to claim 2 , wherein the expression level of the gene or mRNA encoding the DnaJC6 protein is measured by a polymerase chain reaction (PCR) method, a northern blotting method, an RNase protection assay method, or a DNA array analysis. The method according to claim 2 , wherein the expression level of the DnaJC6 protein is measured by Western blotting, ELISA, or RIA using an antibody specific for the DnaJC6 protein. The expression level of the DnaJC6 is an amount of an expression product of a marker gene controlled by a promoter of a gene encoding the DnaJC6 protein, and the marker gene is previously introduced into a cell capable of expressing the DnaJC6 in (A) the method of claim 1 further comprising.