JP5610459B2 - Aptamers against herpes simplex virus - Google Patents

Description

  The present invention relates to a stable RNA having an ability to bind to the herpes simplex virus (HSV-1) gD protein, and an antiviral agent and a test agent for the herpes simplex virus using the RNA.

  Herpess implex virus (HSV, herpes simplex virus) includes type I (HSV-1) and type II (HSV-2). Type I infections are usually characterized by blister rashes on the margin of the lips or nostrils, while type II causes such rashes on the genitals. The gene sequences of type I (HSV-1) and type II (HSV-2) are very similar and have 50-70% homology. Some epitopes (antigenic determinants) cause a cross-reaction between type I and type II. There are four glycoproteins that act upon entry into the host cell, namely gD, gB, gH, and gL. They act after gC and gB bind to cell surface proteoglycans. Of these glycoproteins, gD is required for receptor binding and entry into the cell. There are two receptors, HVEM and nectin1, which mediate HSV entry. These receptors belong to the tumor necrosis factor family and recognize the N-terminal region of gD protein (Non-patent Document 1). The amino acid sequences of type I and type II gD proteins are very similar, with 84% homology (Figure 1).

  The crystal structure of the HSV-1gD protein and the complex with the receptor HveA (also called HVEM) have been determined (Patent Documents 2 and 3). According to this, the structure from HSV-1gD protein from residue 56 to residue 184 has a V-shaped Ig-fold and is a structure common to cell surface adhesion molecules. The N-terminal 1-37 residue has a hairpin structure, mediates binding to HVEM, and is involved in HSV entry as well as (260-316) at the C-terminal of gD ectodomain (FIG. 2). In the insertion / deletion experiment of 275-300 residues, it has been reported to prevent HSV invasion (Non-patent Documents 4, 5, and 6). In addition, ectodomain of gD has a variable structure and is easy to match with the receptor. In particular, Trp294 appears to play a role that is largely involved in binding to the receptor. As described above, the N-terminus and C-terminus of the gD protein play an important role in binding to the receptor.

  Aptamers, on the other hand, are functional nucleic acids. Aptamers that specifically bind to target compounds from a myriad of nucleic acid libraries by a method called “SELEX”, that is, a method of repeating selection and amplification processes. (Nucleic acid) can be obtained. Due to the high discrimination ability of aptamers, it has been used as a diagnostic compound. Although it has a function similar to that of an antibody, it can be used as a target compound from a small compound such as an ion to a large complex such as a virus. ). Some of these aptamers have been obtained targeting viral surface proteins.

  These include HIV (Tat, Rev, reverse transcriptase, nucleocapsid protein, gp120, Gag, and integrase), human T-cell leukemia virus type-1 (Rex and Tax), hepatitis B and C virus (lRES, NS3 , And RNA polymerase), and cat immunodeficiency virus (reverse transcriptase). Moreover, there are aptamers such as human influenza virus, Cytomegalovirus, Rous sarcoma virus, etc. that target the whole virus. These have been confirmed to have antiviral effects in vitro and in vivo (Non-Patent Documents 10 and 11). The inventor obtained aptamers to HA of influenza A (H3N2) and B and reported that it has the effect of preventing influenza from binding to the cell surface, and this aptamer also identifies other types of HA (Non-Patent Document 10).

Connolly, SA, Landsburg, DJ, Carfi, A., Wiley, DC, Eisenberg, RJ and Cohen, GH 2002.Strcuture-based analysis of the herpes simplex virus glycoprotein D binding site present on herpesvirus entry mediator HveA (HVEM). Virol. 76, 10894-10904. Carfi, A., Willis, SH, Whitbeck, JC, Krummenacher, C., Cohen, GH, Eisenberg, RJ and Wiley, DC 2001. Herpes Simplex Virus glycoprotein D bound to the human receptor HveA. Molecular Cell 8, 169-179 . Krummenacher, C., Supekar, VM, Whitbeck, JC, Lazear, E., Connolly, SA, Eisenberg, RJ, Cohen, GH, Wiley, DC and Carfi, A. 2005. Structure of unliganded HSV gD reveals a mechanism for receptor -mediated activation of virus entry. EMBO J. 24, 4144-4153. Chiang, H-Y., Cohen, G.H. and Eisenberg, R.J. 1994. Identification of functional regions of herpes simplex virus glycoprotein gD by using linker-insertion mutagenesis. J. Virol. 68, 2529-2543. Milne, RSB, Hanna, SL, Rux, AH, Willis, SH, Cohen, GH and Eisenberg, RJ 2003.Functionof herpes simplex virus type 1gD mutants with different receptor-binding affinities in virus entry and fusion.J. Virol. 77, 8961-8972. Zhou, G., Avitabile, E, Campadelli-Fiume, G. and Roizman, B. (2003) The domains of glycoprotein D required to block apoptosis induced by herpes simplex virus 1 are largely distinct from those involved in cell-cell fusion and binding to nectin 1. J. Virol. 77, 3759-3767. Jenison, R.D., Gill, S.C., Pardi, A., and Polisky, B. 1994.High-resolution molecular discrimination by RNA.Science 263, 1425-1429. Tombelli, S., Minunni, M., and Mascini, M. 2005. Analytical applications of aptamers. Biosens. Bioelectron. 20, 2424-2434. Chu, TC, Marks, JW III., Lavery, LA, Faulkner, S., Rosenblum, MG, Ellington, AD, and Levy, M. 2006. Aptamer: Toxin conjugates that specifically target prostate tumor cells.Cancer Res.66, 5989-5992. Gopinath, SCB, Misono, T., Kawasaki, K., Mizuno, T., Imai, M., Odagiri, T., and Kumar, PKR 2006a. An RNA aptamer that distinguishes between closely related human influenza viruses and inhibits hemagglutinin- mediated membrane fusion.J. Gen. Virol. 87, 479-487. Gopinath, S.C.B., Sakamaki, Y., Kawasaki, K. and Kumar, P.K.R. 2006b.An efficient RNA aptamer against human influenza B virus hemagglutinin.J. Biochem.139, 837-846. Kumar, PKR, Machida, K., Urvil, PT, Kakiuchi, PN, Vishnuvardhan, D., Shimotohno, K., Taira, K., and Nishikawa, S. 1997. Isolation of RNA aptamers specific to the NS3 protein of hepatitis C virus from a pool of completely random RNA.Virology 237, 270-282. Kumarevel, TS, Gopinath, SCB, Nishikawa, S., Mizuno, H., and Kumar, PKR 2004. Identification of important chemical groups of the hut mRNA for HutP interactions that regulate the hut operon in Bacillus subtilis.Nucleic Acids Res. 32 , 3904-3912. Gopinath, S.C.B., Balasundaresan, D., Akitomi, J. and Mizuno, H. 2006c.An RNA aptamer that discriminates bovine factor IX from human factor IX.J. Biochem. 140, 667-676.

  The present invention obtains an aptamer targeting HSV-1 and intends to newly provide an antiviral agent that is effective against HSV-1 and has side effects, and the virus test agent.

  As a result of intensive studies to solve the above problems, the present inventor has focused on the HSV-1 ectodomain gD protein, and aptamer (hereinafter referred to as aptamer 1) that specifically binds to the gD domain with high affinity. In some cases). As a result of testing the antiviral effect of this aptamer, it has been confirmed that it has an antiviral effect against host cell invasion of HSV-1, that it binds to HSV-1 but does not bind to HSV-2, and accepts host cells. It is confirmed that it does not bind to the body, and is found to be useful as an antiviral agent for HSV-1 or a test agent for HSV-1, and further, it binds to the gD domain by shortening aptamer RNA and converting the constituent bases We succeeded in providing ribonuclease resistance by improving the activity, replacing with a modified base, and modifying the aptamer RNA 'end with in-burst deoxythymidine (idT) or polyethylene glycol (PEG), thereby completing the present invention. is there.

That is, the present invention is as follows.
(1) The nucleotide sequence shown in SEQ ID NO: 1 or 28, or a nucleotide sequence in which one or several bases are deleted, substituted or added in the nucleotide sequence, and in the gD domain of HSV-1 An aptamer RNA characterized by having binding ability.

(2) consisting of the base sequence represented by any of SEQ ID NOs: 2 to 6 and 27, or including a base sequence in which one or several bases are deleted, substituted or added, and HSV An aptamer RNA characterized by having a binding ability to the gD domain of -1.

(3) In the base sequence represented by any one of SEQ ID NOs: 2 to 5 and 27, the base sequence consists of a base sequence in which the 9th A in the following common sequence is substituted with U, or the substitution An aptamer RNA comprising a base sequence in which one or several bases are deleted, substituted or added in the base sequence and having a binding ability to the gD domain of HSV-1.

CACGAGAGAG GUCGUCCCCA GGGGAGAACU CGUGC

(4) The aptamer RNA according to any one of (1) to (3) above, wherein the aptamer RNA has a chemically modified nucleotide.

(5) Characteristic in that the 2 ′ position of the ribose moiety in the nucleotide is modified with a fluoro group (2′-F) or a methoxy group (2′-OMe) or substituted with hydrogen (2′-deoxy) The aptamer RNA according to (4) above.

(6) The aptamer RNA according to any one of (1) to (5) above is modified at its 3 ′ and / or 5 ′ end with inburst deoxythymidine (idT) or polyethylene glycol (PEG). An aptamer RNA characterized by

(7) contains the base sequence shown in SEQ ID NO: 7, or contains a base sequence in which one or several bases are deleted, substituted or added, and binds to the gD domain of HSV-1 DNA that can be converted into a functional aptamer.

(8) It consists of the base sequence represented by any of SEQ ID NOs: 8 to 12 and 29, or includes a base sequence in which one or several bases are deleted, substituted or added, and HSV A DNA that can be converted into an aptamer having binding ability to the gD domain of -1.

(9) In the base sequence represented by any one of SEQ ID NOs: 8 to 12 and 29, the base sequence consists of a base sequence in which the 9th A in the following common sequence is replaced with T, or the substitution A DNA that includes a base sequence in which one or several bases are deleted, substituted, or added in the base sequence, and that can be converted into an aptamer capable of binding to the gD domain of HSV-1.

CACGAGAGAG GTCGTCCCCA GGGGAGAACT CGTGC

(10) DNA having a base sequence complementary to the DNA of any one of (7) to (9) above.

(11) Double-stranded DNA obtained by hybridizing the DNA according to any one of (7) to (9) above and its complementary DNA.

(12) RNA having a base sequence complementary to the aptamer RNA according to any one of (1) to (3) above.

(13) An HSV-1 test agent comprising the aptamer RNA according to any one of (1) to (6) as an active ingredient.

(14) An antiviral agent against HSV-1 comprising the aptamer RNA according to any one of (1) to (6) as an active ingredient.

  The aptamer of the present invention has an anti-HSV-1 action. This action is caused by specifically binding to the gD domain involved in intracellular entry that occurs through membrane fusion with HSV-1 host cells and preventing HSV-1 entry into the cell, It does not affect cellular receptors. Therefore, the adapter of the present invention has no side effects and the aptamer is extremely useful as an anti-HSV-1 agent. In addition, HSV-1 and HSV-2 have similar gene sequences, and conventional antibody test drugs often cause cross-reactions and cannot accurately detect only HSV-1. On the other hand, the aptamer of the present invention recognizes only HSV-1, does not bind to HSV-2, and can identify both, and is excellent in this respect as an HSV-1 test agent.

Furthermore, according to the present invention, the ability to bind to the gD domain is improved by converting the base of aptamer RNA, and substitution with chemically modified nucleotides, or in-burst deoxythymidine (idT) or polyethylene glycol ( Modification by PEG) imparts ribonuclease resistance and can further increase its potency, and shortening the aptamer can improve its production efficiency.
In view of the above, the aptamer of the present invention can be a lead compound, particularly as an anti-HSV-1 agent, and greatly contributes to the development of pharmaceuticals.

It is a figure which shows the homology of the amino acid sequence of each gD protein of HSV-1 and HSV-2. It is a crystal structure ribbon diagram of gD-HveA complex (a) and gD protein (b) in the absence of the HveA receptor. It is a figure which shows the secondary structure model of the aptamer 1 and the aptamer 5. It is a figure which shows the result of having tested the HSV-1 binding ability when the aptamers 1 and 5 are 2'fluorinated. It is an electrophoretic diagram which shows the result of having performed the interference analysis by phosphate group modification in order to identify which site | part of the aptamer 1 is a gD binding site. It is a figure which shows the phosphate group interference site | part in the aptamer 1 estimated from the result of FIG. It is a figure which shows the secondary structure model of mini-1 aptamer. It is a figure which shows the secondary structure model of mini-2 aptamer. It is a graph which shows the result of having tested the binding ability with respect to gD protein of a mini-1 aptamer and a mini-2 aptamer. It is an electrophoretic diagram which shows the result of having analyzed the cleavage pattern of mini-2 aptamer-gD complex by In-line probing method. It is a figure which shows the cleavage position on the secondary structure of mini-2 aptamer. It is an electrophoretic diagram which shows the result of having performed boundary analysis about aptamer 1. FIG. It is a figure which shows the secondary structure model of mini-3 aptamer, and its pseudoknot-like structure. It is an electrophoretic diagram which shows the result of having analyzed the hydrolysis site | part by a ribonuclease about the aptamer 1. FIG. It is a graph which shows the result of having tested the binding ability with respect to gD protein of a mini-3 aptamer. It is a graph which shows the result of having tested the anti- HSV-1 activity and intracellular toxicity of each aptamer of this invention. It is a figure which shows the secondary structure model of HV1-41, HV1-41-II, HV1-41-Va, HV1-41-Va1 aptamer. Among them, HV1-41 is a diagram in which a substitution site and binding ability are added, and the underlined residues of HV1-41 and HV1-41-II are substituted residues. The bold residues in HV1-41-Va and HV1-41-Va1 are 2'-OMe derivatives. It is a filter binding analysis figure regarding the coupling | bonding with the gD protein of HV1-41-II and HV1-41-Va1 aptamer. It is a gel shift analysis electrophoretic diagram which shows the comparison result of stability of HV1-41-II and HV1-41-Va1 aptamer in 2% serum. It is a gel shift analysis electrophoretic diagram which shows the comparison result of stability of HV1-41-Va1 and HV1-41-Va1-idT aptamer in 2% serum. It is a figure which shows the secondary structure model of HV1-41-Va1-idT aptamer.

The aptamer of the present invention has an ability to bind to the gD domain of herpes simplex virus (HSV-1).
The aptamer of the present invention is derived from 24 clones obtained by the SELEX method, and one of them includes RNA containing at least the base sequence shown in SEQ ID NO: 1 or 28. More specific aptamer RNA molecules include, for example, RNA having the base sequence shown in SEQ ID NOs: 2 to 5 or 27. These RNAs shown in SEQ ID NOs: 2 to 5 have the base sequence of SEQ ID NO: 1 in common, and further include the RNA consisting of the base sequence shown in SEQ ID NO: 27. Common in that it has a base sequence. The other aptamer is RNA consisting of the base sequence shown in SEQ ID NO: 6.
Further, the aptamer of the present invention includes RNA in which the 9th adenine base (A) in the common sequence (SEQ ID NO: 28) portion in the RNA molecule of SEQ ID NO: 2-5 or 27 is changed to uracil base (U). . Thereby, the binding activity to the gD domain is increased.

  On the other hand, in the present invention, not only the RNAs represented by the above SEQ ID NOs, but also DNAs having the sequences corresponding to these RNAs, including the base sequence represented by SEQ ID NO: 7, more specifically, for example, SEQ ID NOs: 8 to 12 Alternatively, a DNA comprising the nucleotide sequence shown in 29 and a DNA obtained by converting the 9th adenine base into a thymine base in the common sequence (SEQ ID NO: 28), a DNA complementary to these DNAs, or complementary DNA strands are Includes dsDNA comprising double strands. Furthermore, RNA having a base sequence complementary to the above RNA is also included. These can be easily converted into the aptamer RNA of the present invention by conventional genetic manipulation means, and are the intermediates for producing the aptamer of the present invention. Further, in the present invention, even if the base sequence of the aptamer of the present invention is modified by deleting, substituting, or adding one or several nucleotide residues, it can be used as long as it binds to the gD protein. Includes this.

The aptamer of the present invention has a well-known SELEX (systematic evolution of ligands by
obtained by the exponential enrichment method.
The SELEX method starts with the creation of a random-sequence nucleic acid library, selects the binding to the target protein as an index, and repeats the PCR amplification cycle multiple times. Only nucleic acids having high binding ability can be selected. The above selection and PCR amplification correspond to “spider” and “growth” in nature, respectively, and reproduce the evolution in nature in a short time in a test tube.
In the present invention, a DNA library (SEQ ID NO: 13) having 74 bases in the middle of the sequence as a random region is synthesized, amplified by PCR, reverse transcribed to form an RNA pool, and the RNA pool binds to the gD protein. The aptamers shown in SEQ ID NOs: 5 and 6 having high specificity and binding to the gD protein were obtained by selecting and amplifying the RNA to be amplified and repeating this cycle a plurality of times. Has further shortened the aptamer shown in SEQ ID NO: 5 (aptamer 1) to obtain the mini aptamer RNAs shown in SEQ ID NOs: 2 to 4, all of which have the ability to bind to the gD protein. Miniptamer 3 has a particularly high binding ability to gD protein. On the other hand, although these were obtained by in vitro transcription method, a shorter 41-mer aptamer HV1-41 (SEQ ID NO: 27) obtained by chemical synthesis method also has a binding ability to gD protein, and is further shown in SEQ ID NO: 27. The aptamer HV1-41-II (SEQ ID NO: 25) in which the 9th adenine base in the base sequence is converted to a uracil base has a significant increase in binding activity to the gD domain of HSV-1. From this result, the 9th adenine base in the common sequence portion of the aptamer of SEQ ID NO: 2 to 5 corresponding to the adenine base in SEQ ID NO: 27 is replaced with a uracil base, thereby similarly binding activity to the gD domain. Will increase.

As described above, the aptamer of the present invention is basically obtained by the SELEX method. However, in the present invention, the base sequence of the aptamer is clarified, and the base sequence is not determined by the SELEX method. The aptamer of the present invention can be synthesized. For example, the following method known per se can be used.
In vitro transcription method: The above DNA corresponding to the aptamer RNA to be synthesized is chemically synthesized, PCR amplified, and aptamer RNA is synthesized from the amplified DNA by a transcription reaction with RNA polymerase. For example, the above DNA is linked to the downstream side of the T7 promoter, PCR amplified to obtain double stranded DNA, T7 RNA polymerase and the RNA polymerase comprising ATP, GTP, CTP and UTP using the double stranded DNA as a template Aptamer RNA can be obtained by performing an RNA extension reaction in a reaction solution containing a substrate.

In this method, a plasmid containing the T7 promoter sequence linked to the above dsDNA or chemically synthesized DNA can also be used as a template. In addition, the DNA synthesis can be performed using a DNA synthesizer (eg, 334 DNA synthesizer (Applied Biosystems)).
Chemical synthesis method: RNA synthesis requires protection of the 2 'hydroxyl group of the ribose moiety, and various amidites have been developed as protecting groups. Using the recently developed 2-cyanoethoxymethyl (CEM) group The efficiency of the chain length extension reaction at the time of RNA synthesis is increased, and it becomes possible to synthesize a long chain RNA exceeding 100 mer. The aptamer RNA of the present invention can be synthesized using such a chemical synthesis method.
In addition, the aptamer RNA of the present invention can be obtained from RNA complementary to the aptamer RNA by using RNA-dependent RNA polymerase.

On the other hand, the aptamer RNA of the present invention may have a chemically modified nucleotide in its sequence in order to add ribonuclease resistance. Such aptamer RNA is, for example, a 2′-OH group of a nucleotide ribose site in aptamer RNA, a 2′-fluoro group or a methoxy group (2′-OMe) by a conventional method, or a ribose site of the same. It is obtained by replacing the 2 ′ position with hydrogen (2′-deoxy). This chemical modification is more effective for pyrimidine nucleotides because the pyrimidine nucleotide sites are susceptible to degradation by ribonucleases.
In the present invention, the 3 ′ and / or 5 ′ end of the aptamer RNA can be further modified with inburst deoxythymidine (idT) or polyethylene glycol (PEG), thereby further improving the ribonuclease resistance of the aptamer RNA. And the fall of the activity by decomposition | disassembly in a biological body is suppressed, and it becomes possible to exhibit an antiviral effect effective in the biological body.
The aptamer RNA of the present invention is used as a test or detection agent for HSV-1 virus. For example, the aptamer RNA of the present invention is labeled with a fluorescent dye such as fluorescein, rhodamine, Texas red, etc., contacted with a test sample, subjected to a binding reaction, removed unbound, and then detected fluorescence or its intensity, By measuring, it is possible to detect HSV-1 virus or its amount. In this case, for example, it can be performed using a substrate on which either the labeled aptamer RNA or the test sample is immobilized.

  It is also possible to use a substance that fluoresces when bound to label either the aptamer of the present invention or the test sample, and detect and measure the fluorescence upon binding or its intensity. Examples of such fluorescent dyes include fluorescein, rhodamine, and Texas red.

  In the present invention, it is also possible to detect HSV-1 virus without labeling the fluorescent dye. This includes, for example, surface plasmon resonance (SPR). That is, the intermolecular binding reaction can be measured by adopting an optical phenomenon called surface plasmon resonance, which is a fine mass change upon intermolecular binding occurring on the sensor surface. Biacore BIACORE3000 is a device that uses the SPR method. The measurement is performed while immobilizing either the aptamer RNA of the present invention or the test sample on the surface of the gold thin film of the sensor chip by a well-known method, supplying the test sample or the aptamer RNA thereto, and monitoring the binding reaction in real time.

In addition, the aptamer RNA of the present invention has an action of binding to the gD domain in HIV-1 virus and preventing the virus from entering the cell, and thus has an antiviral action. Moreover, the aptamer RNA of the present invention has extremely low intracellular toxicity and can be used as an antiviral agent against HIV-1 virus. In order to use the aptamer RNA of the present invention as an antiviral agent, for example, the aptamer RNA is applied and pasted to the affected area in the form of a solution, cream, or poultice containing the aptamer RNA.
Examples of the present invention are shown below, but the present invention is not limited to the following examples.

Example 1
(1) Viral protein Recombinant HSV-1 gD protein was prepared from Pichia pastoris expressing 319 amino acid sequence purchased from CORTEX BIOCHEM (CA, USA). On the other hand, HSV-2 gD was provided by Drs. Jerry P. Weir and Clement Meseda from DVP, OVRR / CBER / FDA, Rockville, MD, USA. These sequences were subcloned into pET20b (Novagen) and expressed in E. coli.s. The expressed protein was further purified with a nickel resin following a Mono-Q column.

(2) Creation of RNA random pool A single-stranded DNA (ssDNA) library with the central 74 bases as a random region is synthesized using an automatic DNA synthesizer as a template. Similarly, an automatic DNA synthesizer is used. DNAs having the following sequences were synthesized and used as 5 ′ and 3 ′ primers and PCR amplified.

〔template〕
TCTAATACGACTCACTATAGG AGCTCAGCCTTCACTGC--N74 --- GGCACCACGGTCGGATCCTG, (SEQ ID NO: 13)
The underlined portion in the above sequence is the T7 promoter region.
[5'end primer]
5'-TCTAATACGACTCACTATAGGAGCTCAGCCTTCACTGC-3 '(SEQ ID NO: 14)
[3 'end primer]
5'-CAGGATCCGACCGTGGTGCC-3 '(SEQ ID NO: 15)

PCR was performed using the above single-stranded DNA random library (1 × 10 ¹⁴ molecules), 0.25 μM each of 5 ′ primer and 3 ′ primer. PCR was limited to 8 cycles to maintain and amplify the DNA composition of the initial library.
Next, in vitro transcription was performed using T7 Ampliscribe kit (Epicentre Technologies), and the amplified DNA library was converted into an RNA library.

(3) Selection in vitro Using the RNA library (15 μg (˜10 ¹⁴ RNA molecules) obtained in (2) above, the RNA library and each purified protein obtained in (1) above are used for selection. It was carried out in an RNA binding buffer (50 mM Tris-HCl, 50 mM KCl, pH 7.5) containing a ratio of 2: 1. During the sorting cycle, the protein concentration decreased later after the cycle to sort RNA with high affinity. After the selection cycle, the RNA was heated to 95 ° C. and then cooled to room temperature to form a stable structure. In the selection cycle, tRNA (total tRNA from E. coli, Boehringer-Mannheim) was used as a competitor in order to remove non-specifically bound RNA.

After incubating the RNA with the target protein for 10 minutes at room temperature, the protein-RNA complexes are pre-wetted nitrocellulose acetate filters (HAWP filters) immobilized in “Pop-top” filter holders (Nucleopore). , 0.45 μm, 13.0-mm, Millipore) and then washed with 1 ml of the RNA binding buffer. The RNA remaining on the filter was eluted and recovered according to conventional methods (Non-Patent Documents 10 and 11). The recovered RNA is reversed in 20 μl of a reaction mixture containing 50 mM Tris-HCl (pH 8.0), 40 mM KCl, 6 mM MgCl ₂ , 0.4 mM dNTPs, primer 2.5 μM and AMV reverse transcriptase (Seikagaku) 5 U. It was copied. Nucleotides and enzymes were added after the denaturation and annealing steps (10 minutes incubation at room temperature followed by 2 minutes at 90 ° C.). Reverse transcription was performed at 42 ° C. for 1 hour.

The obtained cDNA was amplified by PCR and used as a template for obtaining RNA in the next selection round. For amplification by PCR, 20 μl of the reverse transcription mixture (cDNA reaction product) was mixed with the PCR mixture (10 mM Tris-HCl (pH 8.8), 50 mM KCl, 1.5 mM MgCl ₂ , 0.1% Triton X- 100, Taq DNA polymerase (Takara) 5U, and each primer 0.4 μM) was diluted with 80 μl. The reaction mixture was attempted to be detected by electrophoresis after each cycle of 94 ° C. for 70 seconds, 55 ° C. for 50 seconds, and 72 ° C. for 70 seconds to obtain a product that binds with the correct molecular size.

  The PCR product was precipitated with ethanol and used for transcription. In vitro transcription was performed at 37 ° C. for 3 hours using T7Ampliscribe kit (Epicentre Technologies). After treatment with DNase I, fractionation was performed on an 8% denaturing polyacrylamide gel. RNA was extracted from the gel and purified by ethanol precipitation, then quantified and used in the next selection and amplification cycle.

(4) Selection and amplification cycle In the following, each selection cycle was performed in order to obtain RNA having high specificity and specificity for RNA HSV-1gD protein. These cycles include corrections for RNA: protein ratio, competitor concentration and buffer volume.
In order to avoid enrichment of non-specifically binding RNA, xenobind plates (xenopore) were used instead of filters for the third, fifth, seventh and eighth generation sorting. For Xenobind selection, each well was first coated with 5 μg of the above gD protein per ml of RNA binding buffer, and the remaining part was blocked with BSA (3% stock solution). Each well was then washed and used for sorting. In the selection, the RNA pool obtained in the second cycle was denatured at 90 ° C. for 2 minutes and then cooled at room temperature for 10 minutes to promote equilibration of the different structures.

  The RNA pool (0.25 μM) and competitor tRNA (40 μM) are mixed in 100 μl of the above binding buffer, filled twice into wells coated with BSA, and incubated at room temperature (25 ° C.) for 10 minutes. did. Unbound RNA was collected and loaded into wells coated with HSV1-gD. The reaction mixture was incubated for an additional 10 minutes. Unbound RNA molecules were discarded and each well was washed 5 times with 300 μl of the RNA binding buffer. The bound RNA was recovered by adding a 7M urea solution and heating. After purification by precipitation with ethanol, the RNA was regenerated by reverse transcription, PCR and in vitro transcription. This cycle was repeated 8 times and 29% of the RNA pool was concentrated to bind to gD protein. Table 1 shows the results of a binding test for the HSV-gD protein of the RNA pool obtained after each cycle.

(5) Analysis of aptamer In order to obtain individual aptamers, the PCR product obtained in cycle 8 was directly ligated to the vector pCRII (Invitrogen) according to the manufacturer's protocol. DNA was isolated from individual clones by the alkaline miniprep method, and its nucleotide sequence was examined with a DNA sequencer (Model 373A, ABI) using a dye terminator sequencing kit (Applied Biosystems Inc. (ABI)). The secondary structure of the aptamer was predicted by the BayesFold program (version 1.01). Similar to the individual aptamers above, radiolabeled RNA was prepared using [γ- ³² P] ATP to assess the binding activity of RNA pools obtained from different selection cycles and was reported previously. (Non-Patent Documents 11, 12, and 13) The same filter binding analysis as the method was used.

Binding conditions and in vitro transcription conditions were similar to these conditions in selection except for the molar ratio of RNA to gD protein (RNA 20 nM, target molecule 200 nM).
The filter was washed with 1 ml of the above binding buffer, dried in air, and the radiation intensity was quantified with an image analyzer (BAS2500, FUJIFILM). To confirm that the binding was specific, a 10-fold molar excess of RNA was added in the binding reaction as a non-specific competitor. Furthermore, the binding and the discriminant analysis were also performed by a surface plasmon resonance apparatus (SPR) according to the previous description (Non-patent Document 14).
Aptamers were divided into two classes, aptamer-1 and aptamer-5, by sequence analysis of the clones obtained above.
Aptamer 1 and aptamer 5 are shown below.

However, the underlined portion indicates a primer region, and the region with a small character size indicates a randomized nucleic acid corresponding region. These areas are continuous.

The abundance ratio of aptamer 1 and aptamer 5 in the pool is 30% and 23%, and the secondary structure model of these aptamers calculated by BayesFold is shown in FIG. 3. Is shown in FIG.
Although the amino acid sequences of HSV-1gD and HSV-2-gD ectodomain are 84% homologous, no binding to HSV-2-gD was found by filter binding analysis. In addition, no binding was observed in Surface Plasmon Resonance (SPR) using BIACORE. Therefore, the binding ability of aptamers 1 and 5 is specific for HSV-1gD.

(Example 2)
(1) Production of stable aptamers The first pool used for sorting was prepared to have RNA containing 2'-OH groups. That is, in order to produce stable RNA, the selected clone was prepared to be modified with a 2′-fluoro group in the transcription step. Chemical modification of pyrimidine positions with 2'-fluoro groups was done by modification of cytidine and uridine to extend their lifetime. The sorted aptamers were amplified with the same primers used in the sorting process. The base sequence of the primer is shown below.

5'-end primer; 5'-TCTAATACGACTCACTATAGGAGCTCAGCCTTCACTGC-3 (SEQ ID NO: 16)
3 'terminal primer; 5'-CAGGATCCGACCGTGGTGCC-3' (SEQ ID NO: 17)
The obtained dsDNA was converted to stable RNA by in vitro transcription after overnight incubation at 37 ° C. using T7 Durascribe kit (Epicentre Technologies). The transcribed RNA was purified by the same method as in the above [0029].

Filter-binding assay was used for the binding experiment between the purified 2′-F derivative of each aptamer and gD protein. The kDs of aptamer-1 and aptamer-5 and their 2′-F derivatives were 235, 197, 104, and 241 nm, respectively. The binding ability of each aptamer to gD protein is shown in FIG. Aptamer-1 increased its binding ability to 47% (about 2 times), but aptamer-5 decreased.
Therefore, aptamer-1 was used in subsequent experiments. For comparison, aptamer-1C having a complementary sequence to aptamer-1 was also used.

(Example 3)
(1) Phosphate group modification and interference analysis Phosphate group modification analysis was performed to identify which site of the selected aptamer was the gD binding site. The RNA (aptamer-1) obtained by in vitro transcription in Example 1 was treated with calf phosphatase for 1 hour at 37 ° C., extracted with phenol, and precipitated with ethanol. RNA was labeled with [γ-32P] ATP and T4 polynucleotide kinase, and electrophoresed on 8% polyacrylamide / 7 M urea gel. The labeled RNA was heated at 95 ° C. for 2 minutes to loosen the structure and slowly cooled to room temperature to return to the correctly folded structure. RNA labeled with 5 'end (having a count of 1100 Kcpm) was dissolved in buffer (20 mM HEPES, pH 8.0, 1 mM EDTA, 2.5 μg tRNA) and saturated with N-nitroso-N-ethyl-urea5 Mixed with μl of ethanol. The modification reaction was performed at 90 ° C for 2 minutes, and the reaction was stopped by adding 15 µg of carrier tRNA.
N-nitroso-N-ethyl-urea reacts with phosphoric acid groups to form Phosphotriester, which can be easily hydrolyzed by alkali treatment.

  The aptamer (aptamer-1) converted to Phosphotriester by the modification reaction was recovered by ethanol precipitation. To obtain the aptamer-gD complex, a 20 pM sample was denatured by treating with 25 μl of selection binding buffer at 92 ° C. for 2 minutes and slowly cooled to room temperature over 10 minutes. The complex was separated through a nitrocellulose filter and treated with a 200 μl solution of 100 mM Tris / HCl pH 9.0 at 50 ° C. for 5 minutes to elute the aptamer. The RNA product obtained by hydrolyzing the aptamer was recovered by ethanol precipitation, and then separated on an 8% polyacrylamide / 7 M urea gel. For confirmation, aptamer alkaline hydrolyzate and RNase T1 degradation product were electrophoresed simultaneously. The gel was dried and irradiated with X-rays to detect radioactive substances. The results are shown in FIG. In FIG. 5, + and − are patterns when HSV-1gD is present and absent. This suggests that the phosphate group of residues 29-41 of the aptamer is involved in binding to HSV-1-gD, as well as residues 44-53 are also involved in binding. . The predicted phosphate group interference site of aptamer-1 is shown in site 1 and site 2 in FIG.

Based on this result, a 39-mer small aptamer mini-1 containing this region (SEQ ID NO: 2 ; 3 bases of 19-54 bases of the aptamer 1 sequence “gg” and 3 ′ ends of “c”) 39mer) and 57mer mini-2 (SEQ ID NO: 3 ; 57mer with 2 bases of “gg” added to the 5 ′ end of 10-64 bases of the sequence of aptamer 1) using the following template and primers: The resulting dsDNA was prepared by in vitro transcription.

min1 aptamer
template
5'-GGGCACGAGAGAGGTCGTCCCCAGGGGAGAACTCGTGCC -3 '(SEQ ID NO: 18)
Primer
5′-AGTAATACGACTCACTATAGGGCACGAGAGAGGTCGTCCCCA -3 ′ (SEQ ID NO: 19)
5'- GGCACGAGTTCTCCCCTGGGGT -3 '(SEQ ID NO: 20)

Mini-2 aptamer

Template Clone 1 (aptamer 1) obtained in Example 1
Primer
5′-AGTAATACGACTCAC TATAGGGCCTTCACTGCACGAGAGAGG-3 ′ (SEQ ID NO: 21)
5'-GCCTCCAGGAGCACGA GTTCT -3 '(SEQ ID NO: 22)

  Subsequently, the binding between the obtained mini-1 aptamer and mini-2 aptamer and HSV-1-gD was examined. The secondary structure predictions of Mini-1 aptamer and mini-2 aptamer are shown in FIGS. 7 and 8, respectively, and the results of the gD protein binding test for these aptamers are shown in FIG. All of these shortened aptamers showed binding ability to HSV-1-gD, but the binding ability of mini-1 aptamer was weaker than that of mini-2 aptamer, whereas mini-2 aptamer It showed the same degree of binding as the original aptamer (aptamer-1).

(2) In-Line probing
In-line probing was tried to investigate the HSV-1-gD binding site of Mini-2 aptamer.
The 3 ′ end of the mini-2 aptamer obtained in (1) above was labeled with ³² p-labeled pCp and RNA ligase (Krol and Carbon, 1989). The labeled mini-2 aptamer was reacted at 25 ° C. for 40 hours with a solution containing 5 mM MgCl ₂ , 50 mM Tris-HCl (pH 8.3, 25 ° C.) and 100 mM KCl.
In this case, the protein concentration was changed to 100-300 nM depending on whether the protein was added or not. After each reaction, the degradation product was degraded by 12% denaturing (7 M urea) PAGE and autoradiography was performed.

The in-line probing method is a method of adding Mg to analyze the natural cleavage site, but cleavage occurs when the conformation around the phosphate group is easy to cleave. At the HSV-1-gD binding site, a conformational change occurs around the phosphate group, and a change in the cleavage pattern is expected. The cleavage pattern of the obtained aptamer HSV-1-gD complex is shown in FIG. 10, and the cleavage position (arrow) on the two-dimensional structure is shown in FIG.
According to this, cleavage is seen in the 3 'terminal phosphate group of G29, G30, ∪34, C38, A39, G40, A44 residues. In particular, strong cleavage was observed at C38, suggesting binding to HSV-1-gD at this location.

(3) Boundary analysis The bond between the degradation product fragment and HSV-1-gD was examined, and the length of the bond from the 5 'end or 3' end was determined as follows.
It was performed from both the 3 ′ end and 5 ′ end of aptamer-1. The 3 ′ end labeled aptamer-1 and the 5 ′ end labeled aptamer-1 were electrophoresed using a 10% polyacrylamide / 7 M urea gel. These labeled RNAs were partially hydrolyzed by reacting them with alkaline hydrolysis buffer (Ambion) and 3 μg of yeast RNA at 95 ° C. for 15 minutes. The reaction was neutralized with 3M sodium acetate (pH 5.2) and ethanol precipitated. Labeled RNA with a count of 100 kcpm was reacted with 500 nM HSV1-gD for 10 minutes at room temperature in binding buffer. The complex was separated with a nitrocellulose filter, and the bound molecule was recovered by adding a buffer containing 7M urea and reacting at 95 ° C. for 2 minutes. After ethanol precipitation, it was loaded onto a 10% polyacrylamide / 7 M urea gel. For confirmation, alkaline hydrolysis of aptamer and RNase T1 degradation product were electrophoresed simultaneously. The gel was dried and irradiated with X-rays for autoradiography.

  The results are shown in FIG. It was suggested that the 3'-end label was 3'-end side from the 19th residue, and the 5'-end was 5'-end side from the 60th residue, so that residues 19-60 were involved in binding. From this result, the base sequence of mini-3 aptamer was designed, PCR amplified using the following template and primers, and the resulting dsDNA was transcribed in vitro to create mini-3 aptamer.

Template Clone 1 (aptamer 1) obtained in Example 1
Primer
5′-AGTAAT ACGACTCACTATAGGGCACGAGAGAGGTCGT-3 ′ (SEQ ID NO: 23) and
5′-CCAGGAGCACG AGTTCTC -3 ′ (SEQ ID NO: 24)

The prepared mini-3 aptamer is a 44-mer RNA molecule containing 19-60 residues (including gg at 5'-end during transcription), and its nucleotide sequence is shown in SEQ ID NO: 4. This mini-3 aptamer has higher binding ability than mini-2 aptamer (FIG. 15).
On the other hand, the first model of the secondary structure of aptamer 1 was created by BayesFold. In order to confirm this, the site of hydrolysis by ribonuclease T1 was analyzed. This result did not support the first secondary structure model. Prominent hydrolysis sites were G27, G29 and G30. On the other hand, G40 and G42, which were expected to be single strands, were not hydrolyzed or only slightly hydrolyzed (FIG. 14). From the above, the mini-3 aptamer was predicted to have a pseudoknot-like structure (FIG. 13).

Example 4
Binding inhibition analysis (1) For aptamer 1 and aptamer 1C (sequence complementary to aptamer 1) for comparison, CC50 and IC50 were determined as shown below, and SI was calculated.

CC50 (50% cytotoxic concentration)
Cultured cells (Vero cells) were cultured in MEM medium containing 5% FBS and serum-free MEM medium for 72 hours at 37 ° C., respectively, while changing the concentrations of aptamer 1 and aptamer 1C (sequence complementary to aptamer 1). The number of viable cells was determined by trypan blue staining. Inhibition data was plotted as a concentration-response curve based on CC50 (50% cytotoxic concentration).

IC50 (50% inhibitory concentration)
Cultured Vero cells are infected with (PFU) at 0.1 plaque generating units per HSV-1 cell. After washing 3 times with PBS, the cells were cultured for 20-24 hours in a carrier (MEM + 2% FBS) containing HSV-1 or HSV-2. Virus production was determined based on plaques on Vero cell monolayers. Antiviral activity was expressed as IC50.

Calculation of selection index (SI) SI (CC50 / IC50) was calculated from CC50 and IC50 obtained by the above test. In general, when the SI value of a compound or aptamer is 10 or more, it can be evaluated as an effective antivirus.
The results are shown in Table 2 and FIG. According to this, it was clear that aptamer 1 had a sufficiently low IC50 and antiviral activity, while no cytotoxicity was observed, and the selectivity index exceeded 10. On the other hand, aptamer 1C having a sequence complementary to aptamer 1 had an IC50 and CC50 of 10 or more, and the selectivity index was extremely low.

(2) The antiviral activity against HSV-2 was determined as IC50 in the same manner as in the IC50 measurement method of (1) above. The results are shown in Table 3. According to this, it is clear that aptamer 1 does not show antiviral activity against HSV-2, and the antiviral activity is specific to HSV-1.

(Example 5)
(1) Analysis of antiviral activity of aptamer Aptamer ability to inhibit the interaction between virus and host cell, inhibition of Aptamer-1 binding to receptor, inhibition of viral entry into host cell I examined it.

(2) Virus adsorption analysis Vero cell suspension (1 × 10 ^-4 cells / 25 µl), HSV-1 (1 × 10 ^-4 PFU / 25 µl) and aptamer-1 or aptamer-1C (0.2, 2 µM ) Were cooled on ice for 3 hours, respectively, 25 μl each, but 50 μl each of aptamer-1 and aptamer-1C were mixed and reacted at 4 ° C. for 1 hour. Cells were washed three times with ice-cold phosphate buffer (PBS), and free virus and aptamer were removed. Cell pellets were added to Vero cell monolayers immediately after being diluted 10-100 times with ice-cold PBS. On top of that, a reagent containing 0.5% methylcellulose was added for plaque analysis. The results are shown in Table 4. According to this, the number of detected plaques is almost the same between the case where no aptamer is added and the case where the aptamer is used, and it is clear that aptamer 1 hardly binds to the viral receptor on the cell surface. is there.

(3) Virus invasion analysis Vero cell monolayers in 24-well plates, previously chilled on ice for 3 hours, use HSV-1 (approximately 100 PFU / well) in the presence or absence of aptamer-1 or aptamer-1C. Infects for 1 hour at 4 ° C. After washing 3 times with ice-cold PBS, the Vero cell monolayer was reacted at 37 ° C. with a solution containing aptamer. After 0, 0.5, 1, 2, 3, and 6 hours, the cell monolayer was treated with 40 mM citrate buffer (pH 3.0) for 1 minute to inactivate non-invading virus. On top of that, a reagent containing 0.5% methylcellulose was added for plaque analysis, and the invading virus was detected as a plaque after 2 days. The results are shown in Table 5. According to this, it is clear that the aptamer 1 has a suppressed number of appearing plaques, particularly at a concentration of 1.0 μM, and inhibits virus entry into the host cell. Moreover, from this, it is considered that aptamer 1 binds to the C-terminus of gD protein.

(4) Virus destruction experiment
To determine the effect of aptamer-1 or aptamer-1C directly inactivating virus particles, HSV-1 (2 × 10 ⁴ PFU / 25 μl) was added to this volume of aptamer-1 or aptamer-1C (10, 20 μM) at 37 ° C. for 1 hour. The mixture was diluted 100 times to ignore the aptamer effect, added to the Vero cell monolayer, and left at room temperature for 1 hour. A reagent containing 0.5% methylcellulose was added for plaque analysis. The results are shown in Table 6. As is apparent from this result, aptamer 1 has little direct effect on virus particles.

(5) Effect of pretreatment on the host cell itself To determine whether the aptamer is non-specifically bound to the host cell, the Vero cell monolayer is placed in a 35 mm dish and aptamer-1 or aptamer-1C (0.1, 1, 10 μM) at 37 ° C. for 1 hour. To remove the aptamer, after washing 3 times with PBS, the cell monolayer was infected with HSV-1 (100 PFU / dish) for 1 hour at room temperature, and the plaques that appeared were counted. The results are shown in Table 7. According to this, there is almost no difference in the number of appearance of plaque between the case where aptamer 1 is used and the case where aptamer 1 is not used, and aptamer 1 acts directly on Vero cells and the cells themselves It does not provide antiviral activity.

(Example 6)
(1) In vivo antiviral experiments
25 μl HSV-1 (2 × 10 ⁵ PFU) was mixed with 25 μl sample (PBS, 10 μM aptamer-1, 10 μM aptamer-1C) in the presence of 1 μl RNase inhibitor, respectively. BALB / c mice (♀, 5-weeks old, n = 3) were used and each mixture sample was injected intravaginally. Three and five days after infection (pi), the vagina was washed (100 μl / mouse) and plaque analysis of individual mice was performed. Herpes lesions and death were recorded for 2 weeks.
The results are shown in Table 8. According to this, none of the mice died due to the use of PBS alone or aptamer-1C, and this point was indistinguishable. However, in the aptamer 1-containing mixed sample, the number of plaques in the mouse decreased compared to the others. In experiments using mice, Aptamer-1 was found to have anti-HSV-1 activity.

(Example 7)
(1) Preparation of Substituted Aptamer To obtain an optimized aptamer with respect to aptamer binding ability, stability, and cost reduction of aptamer preparation, substitution and modification of aptamer residues were performed. First, the substitution product was prepared by a chemical synthesis method using aptamer having a pseudoknot-like structure in FIG. 13 as a starting material. Three G's at the 5 'end were necessary for synthesis by in vitro transcription method, but they were not assigned by chemical synthesis method, except for the residue numbers (HV1-41 (SEQ ID NO: 27)). In Example 3, when the residues from A7 to G11 were substituted in the loop region predicted to bind to the gD protein, HV1-41-II (FIG. 17) in which A9 was substituted with U was binding activity. Increased. The sequence of HV1-41-II is shown below, and its secondary structure model is shown in FIG.

Aptamer HV1-41-II (SEQ ID NO: 25)
5'- CACGAGAGUGGUCGUCCCCAGGGGAGAACUCGUGCUCCUGG-3 '

(2) Production of stable and inexpensive aptamer (modification at 2 'position)
RNA has a hydroxyl group (2'-OH) at the 2 'position of the ribose site, and pyrimidine nucleotides are particularly susceptible to degradation by ribonuclease. To stabilize this, the sequence of the aptamer (HV1-41-II) (SEQ ID NO: Based on 25), aptamer RNA modified with a methoxy group was obtained by chemical synthesis using each amidite of cytidine and uridine having a methoxy group (2′-OMe). Moreover, in addition to the amidite, using adenosine and guanosine modified with methoxy group, the 2nd position of the ribose site of the base pair nucleotide inside the stem region of aptamer RNA (HV1-41-II-Va) is all methoxy group (2 '-OMe) -modified aptamer RNA (HV1-41-II-Va1) was synthesized, and then we examined idT and (CH ₂ ) ₁₂ NH ₂ modified cytidine (modified at the ribose 5 ′ position of cytidine), aptamer RNA (HV1-41-II-Va1 3′-end, 5′-end is idT, (CH ₂ ) ₁₂ An aptamer RNA modified with NH ₂ (HV1-41-II-Va1-idT) was prepared.
The production of this chemically modified RNA was requested from a commissioned synthesis company (Chem Genes Corporation).
The cost of chemical synthesis increases in the order of methoxy group (2'-OMe) <hydroxyl group (2'-OH) <fluoro group (2'-F). It is advantageous in terms of both stability and cost. However, this chemical modification has the possibility of losing the binding activity depending on the modification site. Those modified with C decreased in activity, while those modified with U (HV1-41-II-Va) maintained activity. A secondary structure model of this aptamer (HV1-41-Va) is shown in FIG. FIG. 17 shows a secondary structure model of HV1-41-Va1 in which all base pair nucleotides inside the stem region are modified with methoxy groups (2′-OMe) to further reduce the cost.

In order to evaluate the binding activity, the 5 ′ end of the aptamer was labeled, and a filter binding analysis similar to the method reported previously (Non-Patent Documents 11, 12, 13) was used.
That is, [γ-32P] ATP was mixed with 10 nM aptamer and reacted in a binding buffer (50 mM Tris-HCl, 50 mM KCl, pH 7.5) to label the 5 ′ end of the aptamer. The labeled aptamer was denatured at 90 ° C. for 2 minutes, annealed at 25 ° C. for 10 minutes, and mixed with various concentrations of gD protein for binding experiments.
FIG. 18 shows a comparison of the measurement results read with the BAS2000 apparatus and the binding ability of HV1-41-II and HV1-41-Va1 to HSV-1 ectodomain gD protein. The upper panel shows the binding ability of HV1-41-II to gD according to the gD concentration. Number 1 assigned to each spot is 2 nM aptamer only, 2 to 10 are those in which gD protein is bound to the filter and 2 nM aptamer is added, and then unbound aptamer is washed away, of which 2 is no gD added 3 added gD25 nM, 4 added gD50 nM, 5 added gD100 nM, 6 added gD150 nM, 7 added gD200 nM, 8 added gD300 nM, 9 Is added with gD400 nM, 10 is added with gD800 nM. The lower row shows the ability of HV1-41-Va1 to bind to gD. 1 is only 2 nM aptamer, 2 is not added gD, 3 is added gD25 nM, 4 is added gD50 nM, 5 is added gD100 nM , 6 with gD150 nM added, 7 with gD200 nM added, 8 with gD300 nM added, 9 with gD400 nM added, 10 with gD800 nM added. The table on the right side of FIG. 18 shows the amount of aptamer RNA binding in terms of RI count. The first row subtracts the gD concentration, the second row counts the total count, and the third row subtracts the count without gD addition. The net count number and the fourth column show the binding ratio (%) as a numerical value. From FIG. 18, it is clear that the binding ability of HV1-41-Va1 is almost the same as that of HV1-41-II.

FIG. 19 shows a comparison of the stability of HV1-41-II and HV1-41-Va1 in 2% bovine serum. That is, the 5 'end of the following complementary primer (DNA complementary to 27 residues on the 3' end side of HV1-41) is labeled with ³² P with T4 polynucleotide kinase to form a complex between the aptamer and the primer. This was investigated in the gel shift analysis experiment.
Complementary primer (SEQ ID NO: 26)
5'-CCAGGAGCACG AGTTCTCCCCTGGGGA -3 '(SEQ ID NO: 26)
1 μg of aptamer is cultured at 37 ° C. with cleavage buffer (1.5 M NaCl; 200 mM Tris-HCl pH 7.4; 20 mM MgCl ₂ ; 20 mM CaCl ₂ ) in 2% bovine serum (30 min, 60 min, 120 min) Then, complementary primers were added to each product RNA obtained by phenol-chloroform extraction and ethanol precipitation. Next, it was denatured in an annealing buffer at 90 ° C. for 2 minutes and then annealed at 25 ° C. for 10 minutes. From the left end of the 15% native polyacrylamide electrophoresis diagram of FIG. 19, Oligo only (primer only), Duplex control (complex of aptamer and primer), 0, 30, 60, 120 minutes after addition of HV1-41-II, It is shown in the order of 0, 30, 60, 120 minutes after the addition of HV1-41-Va1, the lower part shows the primer, and the interruption shows the migration position of the complex of aptamer and primer. In addition, parentheses in the figure indicate aptamer degradation products. From FIG. 19, it is clear that HV1-41-Val has more complex than HV1-41-II and less degradation products, suggesting that it is stable. It is also clear that the degradation half-life of HV1-41-Val is over 2 hours.

(3) Production of stable and inexpensive aptamers (modification of 3'- and 5'-terminal residues)
Modification of the 2'-position hydroxyl group (2'-OH) of the nucleotide ribose site helps to prevent degradation by endonuclease, but it is not sufficient to prevent exonuclease that degrades from the end of RNA. It is thought that this is the reason why the decomposition product is generated as shown. In order to prevent degradation by exonuclease, we modified the end of aptamer RNA (HV1-41-Val).
FIG. 21 shows that the amino-coupling ((CH ₂ ) ₁₂ NH ₂ ) is a step before PEGylation at the 3′-end of HV1-41-Val used in this experiment, but at the 5′-end. 2) is a diagram showing a secondary structure model of HV1-41-Va1-idT. In addition, aptamer RNA having a — (CH ₂ ) ₁₂ NH ₂ group at the 5 ′ end is reacted with NHS PEG in a reaction buffer (DMF containing 10% sodium bicarbonate) ((CH ₂ ) ₁₂ NHCO ) Can be easily converted into aptamer RNA bound with polyethylene.
FIG. 20 shows the results of comparison of stability between HV1-41-Va1 and HV1-41-Va1-idT using the same experimental method as in FIG. From the upper left of the figure, Oligo only (primer only), Duplex control (complex of aptamer and primer), 0, 30, 60, 120 minutes after adding HV1-41-Va1, HV1-41-Va1-idT added This is shown in the order of 0, 30, 60, and 120 minutes later, the lower row shows the primer, and the interruption shows the migration position of the complex of aptamer and primer. In addition, parentheses in the figure indicate aptamer degradation products. Compared with HV1-41-Val1, the degradation products shown in parentheses are dramatically reduced in HV1-41-Va1-idT, and the effect of stabilization by idT is obvious.

Claims (14)

  The nucleotide sequence shown in SEQ ID NO: 1 or 28, or a nucleotide sequence in which one or several bases are deleted, substituted or added in the nucleotide sequence, and binding ability to the gD domain of HSV-1 An aptamer RNA characterized by comprising:   It consists of the base sequence represented by any of SEQ ID NOs: 2 to 6 and 27, or includes a base sequence in which one or several bases are deleted, substituted or added, and HSV-1 An aptamer RNA having a binding ability to a gD domain. In the base sequence represented by any of SEQ ID NOs: 2 to 5 and 27, among these base sequences, the base sequence consists of a base sequence in which the 9th A in the following common sequence is substituted with U, or in the substituted base sequence An aptamer RNA comprising a nucleotide sequence in which one or several bases are deleted, substituted or added, and having an ability to bind to the gD domain of HSV-1.

CACGAGAGAG GUCGUCCCCA GGGGAGAACU CGUGC
  The aptamer RNA according to any one of claims 1 to 3, wherein the aptamer RNA has a chemically modified nucleotide.   The 2'-position of the ribose moiety in the pyrimidine nucleotide is modified with a fluoro group (2'-F) or a methoxy group (2'-OMe) or substituted with hydrogen, according to claim 4, The aptamer RNA described.   The aptamer RNA according to any one of claims 1 to 5, wherein 3 'and / or 5' end thereof is modified with inburst deoxythymidine (idT) or polyethylene glycol (PEG). .   It includes the base sequence shown in SEQ ID NO: 7, or a base sequence in which one or several bases are deleted, substituted or added in the base sequence, and has binding ability to the gD domain of HSV-1. DNA that can be converted into an aptamer.   It consists of the base sequence represented by any of SEQ ID NOs: 8 to 12 and 29, or contains a base sequence in which one or several bases are deleted, substituted or added, and HSV-1 DNA that can be converted into an aptamer that has the ability to bind to the gD domain. In the base sequences represented by any of SEQ ID NOs: 8 to 12 and 29, among these base sequences, the base sequence consists of a base sequence in which the 9th A in the following common sequence is substituted with T, or in the substituted base sequence A DNA comprising a nucleotide sequence in which one or several bases are deleted, substituted or added, and capable of being converted into an aptamer capable of binding to the gD domain of HSV-1.

CACGAGAGAG GTCGTCCCCA GGGGAGAACT CGTGC
  DNA having a base sequence complementary to the DNA according to any one of claims 7 to 9.   A double-stranded DNA in which the DNA according to any one of claims 7 to 9 and its complementary DNA are hybridized.   An RNA having a base sequence complementary to the aptamer RNA according to any one of claims 1 to 3.   A test agent for HSV-1 comprising the aptamer RNA according to any one of claims 1 to 6 as an active ingredient. The aptamer RNA according to any one of claims 1 and 3 to 6 , or the base sequence represented by any one of SEQ ID NOs: 2 to 5 and 27, or in the base sequence, one or several bases An antiviral against HSV-1, comprising an aptamer RNA comprising an deleted, substituted or added nucleotide sequence and having an ability to bind to the gD domain of HSV-1 as an active ingredient Agent.