JP5583311B2 - Purine substance producing bacteria and method for producing purine substance - Google Patents

Description

  The present invention is used in a method for producing purine-based substances such as purine nucleotides typified by 5'-inosinic acid and 5'-guanylic acid, and purine nucleosides such as inosine and guanosine, which are important materials for their synthesis. The present invention relates to a Bacillus bacterium. Purine substances are useful as seasonings, medicines, and raw materials thereof.

Regarding the production of inosine and guanosine by fermentation, microorganisms belonging to the genus Bacillus (see Patent Documents 1 to 8) imparted resistance to various drugs including adenine-requiring strains or purine analogs, and Brevibacterium genus A method using a microorganism (see Patent Documents 9 and 10 or Non-Patent Document 1) is known.
In order to obtain such mutant strains, conventionally, mutagenesis treatment such as ultraviolet irradiation or nitrosoguanidine (N-methyl-N'-nitro-N-nitrosoguanidine) treatment is performed, and an appropriate selective medium is used. A method of obtaining a mutant strain has been carried out.

On the other hand, breeding of purine-based substance producing strains using genetic engineering techniques is also possible for microorganisms belonging to the genus Bacillus (see Patent Documents 11 to 20), microorganisms belonging to the genus Brevibacterium (see Patent Document 21), and microorganisms belonging to the genus Escherichia (patents). Reference 22). Specifically, for example, a method for efficiently producing nucleic acid substances such as hypoxanthine, uracil, guanine, and adenine using a Bacillus bacterium in which the repressor protein gene (purR) of purine operon is disrupted (Patent Literature) 23).
In Bacillus subtilis, in addition to the purine operon gene group, the repressor protein includes a purA gene involved in AMP biosynthesis (see Non-Patent Document 2) and a glyA gene involved in formyltetrahydrofolate biosynthesis (Non-Patent Document). 3) and a pbuG gene encoding a hypoxanthine / guanine transporter (see Non-Patent Document 4) is known to regulate the expression.

  Furthermore, in addition to purR gene disruption, the succinyl-AMP synthase gene (purA) is disrupted to confer adenine requirement, and the purine nucleoside phosphorylase gene (deoD) is disrupted to degrade inosine into hypoxanthine. A method for efficiently producing inosine by suppressing it is disclosed (see Patent Document 8).

The oxidative pentose phosphate pathway is a pathway in which glucose is phosphorylated by glucose kinase to biosynthesize glucose-6-phosphate, and the glucose-6-phosphate is oxidatively converted to ribose-5-phosphate. is there. The relationship between this pathway and the biosynthetic pathway of purine substances is not well known, and no attempt has been made to breed purine substance-producing bacteria by modifying the oxidative pentose phosphate pathway of microorganisms.

Japanese Patent Publication No. 38-23099 Japanese Examined Patent Publication No. 54-17033 Japanese Patent Publication No.55-2956 Japanese Patent Publication No. 55-45199 Japanese Patent Publication No.57-14160 Japanese Patent Publication No.57-41915 JP 59-42895 JP 2004-242610 A Japanese Patent Publication No.51-5075 Japanese Patent Publication No.58-17592 JP 58-158197 A JP 58-175493 A JP 59-28470 A JP-A-60-156388 JP-A-1-27477 JP-A-1-174385 JP-A-3-58787 Japanese Patent Laid-Open No. 3-164185 JP-A-5-84067 JP-A-5-192164 JP-A-63-248394 International Publication No. 99/03988 Pamphlet US Pat. No. 6,284,495 Agric.Biol.Chem., 1978, 42, 399-405 Proc. Natl. Acad. Sci. USA, 1995, 92, 7455-7459 J. Bacteriol., 2001, 183, 6175-6183 J. Bacteriol., 2003, 185, 5200-5209,

  The present invention provides a Bacillus bacterium suitable for producing purine substances such as purine nucleosides and / or purine nucleotides by a fermentation method, and provides a method for producing a purine substance using the bacteria. Is an issue.

  The present inventor has intensively studied to solve the above problems. As a result, purine nucleosides and the like can be obtained by enhancing enzyme activity of the oxidative pentose-phosphate pathway, particularly glucose-6-phosphate-dehydrogenase or ribose-5-phosphate isomerase in Bacillus bacteria. It has been found that the purine nucleotide production ability is improved. Further, by modifying so that the expression of a gene encoding phosphoribosyl pyrophosphate (PRPP) synthetase or an enzyme involved in purine nucleotide biosynthesis is increased, or by modifying so that purine nucleoside phosphorylase activity is reduced, Furthermore, the inventors have found that the ability to produce purine substances of Bacillus bacteria can be improved, and have completed the present invention.

That is, the present invention is as follows.
(1) A bacterium belonging to the genus Bacillus having a purine-based substance-producing ability and modified so as to increase the activity of an enzyme in the oxidative pentose phosphate pathway.
(2) The Bacillus bacterium according to (1), wherein the purine substance is a purine nucleoside selected from the group consisting of inosine, xanthosine, guanosine, and adenosine.
(3) The Bacillus bacterium according to (1), wherein the purine substance is a purine nucleotide selected from the group consisting of inosinic acid, xanthylic acid, guanylic acid, and adenylic acid.
(4) The Bacillus bacterium according to any one of (1) to (3), wherein the enzyme of the oxidative pentose phosphate pathway is glucose-6-phosphate-dehydrogenase or ribose 5-phosphate isomerase.
(5) The enzyme activity of the oxidative pentose phosphate pathway is enhanced by increasing the copy number of the gene encoding the enzyme, or by modifying the expression regulatory sequence of the gene (1) to (4) Bacillus bacteria.
(6) The enzyme is glucose-6-phosphate-dehydrogenase, and the gene encoding the glucose-6-phosphate-dehydrogenase encodes a protein shown in the following (A) or (B) (5) A bacterium belonging to the genus Bacillus.
(A) a protein having the amino acid sequence set forth in SEQ ID NO: 48 (B) including a substitution, deletion, insertion, addition, or inversion of one or several amino acid residues in the amino acid sequence set forth in SEQ ID NO: 48 A protein having an amino acid sequence and having glucose-6-phosphate dehydrogenase activity.
(7) The enzyme is ribose 5-phosphate isomerase, and the gene encoding the ribose 5-phosphate isomerase is a gene encoding the protein shown in (E) or (F) below (5) Bacteria (E) Protein having the amino acid sequence set forth in SEQ ID NO: 50 (F) Substitution, deletion, insertion, addition, or inversion of one or several amino acid residues in the amino acid sequence set forth in SEQ ID NO: 50 A protein having an amino acid sequence comprising, and having ribose 5-phosphate isomerase activity.
(8) The Bacillus bacterium according to any one of (6) and (7), wherein the several are 1 to 20.
(9) The enzyme is glucose-6-phosphate-dehydrogenase, and the gene encoding the glucose-6-phosphate-dehydrogenase is DNA shown in (a) or (b) below (5 ) Bacillus bacteria.
(A) DNA comprising the base sequence set forth in SEQ ID NO: 47.
(B) a DNA that hybridizes under stringent conditions with a probe that can be prepared from a complementary sequence of the base sequence set forth in SEQ ID NO: 47 or the same base sequence, and glucose-6-phosphate dehydrogenase DNA encoding a protein having activity.
(10) The bacterium belonging to the genus Bacillus of (5), wherein the enzyme is ribose 5-phosphate isomerase, and the gene encoding the ribose 5-phosphate isomerase is the DNA shown in (e) or (f) below.
(E) DNA comprising the base sequence set forth in SEQ ID NO: 49.
(F) a DNA that hybridizes under stringent conditions with a probe that can be prepared from a complementary sequence of the nucleotide sequence set forth in SEQ ID NO: 49 or the same nucleotide sequence, and that has ribose 5-phosphate isomerase activity DNA encoding
(11) The Bacillus bacterium according to any one of (1) to (10), wherein the bacterium is further modified so that phosphoribosyl pyrophosphate synthetase activity is increased.
(12) The bacterium belonging to the genus Bacillus according to any one of (1) to (11), which is further modified to increase the expression level of the purine operon.
(13) The expression of the purine operon increased due to the destruction of the purR gene, which is a gene encoding the repressor of the purine operon, or the removal of part of the attenuator region of the purine operon. (12) A bacterium belonging to the genus Bacillus. (14) Further, any one of the bacteria belonging to the genus Bacillus (15) (1) to (14) of any one of (1) to (13), wherein the purine nucleoside phosphorylase activity is modified. A method for producing a purine-based material comprising culturing Bacillus bacteria in a medium, accumulating the purine-based material, and recovering the purine-based material.
(16) The production method of (15), wherein the purine substance is a purine nucleoside or a purine nucleotide.
(17) The production method of (16), wherein the purine substance is a purine nucleoside selected from the group consisting of inosine, xanthosine, guanosine, and adenosine.
(18) The production method of (16), wherein the purine substance is a purine nucleotide selected from the group consisting of inosinic acid, xanthylic acid, guanylic acid, and adenylic acid.
(19) A purine nucleoside is produced by the method of (17), and a phosphoric acid donor selected from the group consisting of polyphosphoric acid, phenylphosphoric acid and carbamylphosphoric acid and a nucleoside-5′-phosphate ester are produced on the purine nucleoside. A method for producing a purine nucleotide, which comprises producing a purine nucleotide by the action of a microorganism having an ability or acid phosphatase, and collecting the purine nucleotide.

Purine substances such as purine nucleosides and purine nucleotides can be efficiently produced by using the Bacillus bacterium of the present invention.

<1> Bacteria belonging to the genus Bacillus of the present invention (I) Providing the ability to produce purine substances The Bacillus bacterium of the present invention has the ability to produce purine substances and enhances the activity of enzymes of the oxidative pentose-phosphate pathway. Bacillus bacterium modified as described above.

“Purine-based substance” refers to a substance containing a purine skeleton, and examples thereof include purine nucleosides and purine nucleotides. Here, purine nucleoside means inosine, xanthosine, guanosine, adenosine and the like, and purine nucleotide means 5'-phosphate ester of purine nucleoside, such as inosinic acid (inosine-5'-phosphate, hereinafter also referred to as "IMP"). ), Xanthylic acid (xanthosine-5′-phosphoric acid, hereinafter also referred to as “XMP”), guanylic acid (guanosine-5′-monophosphoric acid, hereinafter also referred to as “GMP”), adenylic acid (adenosine-5′-monophosphoric acid or less) It is also called “AMP”).
“Purine-based substance-producing ability” means that when the Bacillus bacterium of the present invention is cultured in a medium, the purine-based substance can be secreted, generated and accumulated in the cell or medium to the extent that it can be recovered from the cell or medium. Says ability. In addition, the Bacillus bacterium of the present invention may have two or more kinds of productivity among the purine substances.

  As a Bacillus bacterium having the ability to produce purine substances, those originally having the ability to produce purine substances may be used. However, the following Bacillus bacteria may be used by a mutation method or a recombinant DNA method. Then, it may be obtained by modifying so as to have a purine-based substance producing ability. Further, it may be a Bacillus bacterium imparted with a purine substance-producing ability by modifying the enzyme activity of the oxidative pentose phosphate synthesis pathway to increase as described later.

Examples of the Bacillus bacterium used for obtaining the Bacillus bacterium of the present invention include Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus and the like.
Examples of Bacillus subtilis include Bacillus subtilis 168 Marburg (ATCC6051) and Bacillus subtilis PY79 (Plasmid, 1984, 12, 1-9). ATCC 23842), and Bacillus amyloliquefaciens N (ATCC 23845).

  A Bacillus bacterium having an inosine-producing ability can be obtained by, for example, imparting resistance to drugs such as adenine requirement or a purine analog to the Bacillus bacterium as described above. (See JP-B-38-23099, JP-B-54-17033, JP-B-55-45199, JP-B-57-14160, JP-B-57-41915, JP-B-59-42895, US2004-0166575A). Bacillus bacteria having auxotrophy and drug resistance are used for usual mutation treatments such as N-methyl-N'-nitro-N-nitrosoguanidine (NTG) or EMS (ethane methanesulfonate). It can be obtained by treatment with a mutagen.

As a specific example of an inosine producing strain belonging to the genus Bacillus, Bacillus subtilis KMBS1
Six strains can be used. The strain contains a deletion of the purR gene encoding purine operon repressor (purR :: spc), a deletion of the purA gene encoding succinyl-AMP synthase (purA :: erm), and the deoD gene encoding purine nucleoside phosphorylase. It is a derivative of a known strain of Bacillus subtilis trpC2 (168 Marburg) into which a deletion (deoD :: kan) has been introduced. (Japanese Patent Laid-Open No. 2004-242610) Also, Bacillus subtilis strain AJ3772 (FERM P-2555) (Japanese Patent Laid-Open No. Sho 62-014794) can be used. Also, a 6-ethoxypurine resistant strain of Bacillus subtilis (US2004-0166575A) and a strain in which IMP dehydrogenase (IMP dehydrogenase) (EP273660) is weakened can be used.

  As Bacillus bacteria having the ability to produce guanosine, Bacillus bacteria with increased IMP dehydrogenase activity (Japanese Patent Laid-Open No. 3-58787), and a vector incorporating a purine analog resistance or decoinin resistance gene introduced into an adenine-requiring mutant Bacillus bacteria (Japanese Patent Publication No. 4-28357) and the like.

Examples of Bacillus bacteria that produce purine nucleotides include the following.
As inosinic acid-producing bacteria, inosine-producing strains with reduced phosphatase activity of Bacillus subtilis have been reported (Uchida, K. et al., Agr. Biol. Chem., 1961, 25, 804-805, Fujimoto, M. Uchida, K., Agr. Biol. Chem., 1965, 29, 249-259). As a guanylate-producing bacterium, it has adenine requirement, is resistant to decoinin or methionine sulfoxide, and can produce 5′-guanylate (guanosine-5′-monophosphate, hereinafter also referred to as “GMP”). A mutant of the genus Bacillus having (Japanese Patent Publication No. 56-12438)

  Moreover, the following method is mentioned as a method of breeding the Bacillus genus bacteria which have purine-type substance production ability. Examples include a method for increasing the intracellular activity of an enzyme involved in purine biosynthesis common to purine nucleosides and purine nucleotides, that is, purine biosynthesis enzyme. The intracellular activity of the enzyme is preferably increased as compared with an unmodified strain of Bacillus bacterium, for example, a wild-type Bacillus bacterium. “The activity increases” corresponds to, for example, a case where the number of enzyme molecules per cell increases or a case where the specific activity per enzyme molecule increases. For example, the activity can be increased by increasing the expression level of the enzyme gene.

  Examples of the enzyme involved in purine biosynthesis include phosphoribosyl pyrophosphate (PRPP) amide transferase and PRPP synthetase.

  A part of catabolite produced by metabolism by a sugar source such as glucose incorporated into the pentose-phosphate system becomes ribose-5-phosphate via ribulose-5-phosphate. Biosynthesized ribose-5-phosphate produces PRPP, an essential precursor for purine nucleosides, histidine, and tryptophan biosynthesis. Specifically, ribose-5-phosphate is converted to PRPP by phosphoribosyl pyrophosphate synthetase (PRPP synthetase [EC: 2.7.6.1]). Therefore, by modifying so that the activity of PRPP synthetase is increased, the ability to produce purine substances can be imparted to Bacillus bacteria, which is more effective when combined with the enhancement of pentose-phosphate biosynthesis enzymes. is there.

“The activity of phosphoribosyl pyrophosphate synthetase is enhanced” means that the activity of phosphoribosyl pyrophosphate synthetase is increased relative to an unmodified strain such as a wild strain or a parent strain. The activity of phosphoribosyl pyrophosphate synthetase should be measured by, for example, the method of Switzer et al. (Methods Enzymol., 1978, 51, 3-11), the method of Roth et al. (Methods Enzymol., 1978, 51, 12-17) Can do. Bacteria belonging to the genus Bacillus having an enhanced activity of phosphoribosyl pyrophosphate synthase can be obtained by, for example, phosphoribosyl pyrolin by a method using a plasmid or a method of integrating on a chromosome in the same manner as described in JP-A-2004-242610. It can be produced by highly expressing a gene encoding acid synthetase in Bacillus bacteria. Examples of the gene encoding phosphoribosyl pyrophosphate synthetase that can be used in the present invention include the prs gene derived from the genus Bacillus described in SEQ ID NO: 57 (Genbank Accession No. X16518). Any gene can be used as long as it encodes a protein belonging to the genus Bacillus and having phosphoribosyl pyrophosphate synthetase activity.

On the other hand, when PRPP, which is a precursor essential to purine nucleoside, histidine, and tryptophan biosynthesis, is produced, a part of it is converted into purine nucleoside and purine nucleotide by the enzyme group involved in purine biosynthesis. The genes encoding such enzyme groups include the Bacillus subtilis purEKB-purC (orf) QLF-purMNH (J) -purD operon gene (Ebbole DJ and Zalkin H, J. Biol. Chem., 1987, 262 , 17, 8274-87) (Currently also called purEKBCSQLFMNHD: Bacillus subtilis and Its Closest Relatives, Editor in Chief: AL Sonenshein, ASM Press,
Washington DC, 2002), and Escherichia coli pur regulon gene (Escherichia and Salmonella, Second Edition, Editor in Chief: FC Neidhardt, ASM Press, Washington DC, 1996).
Therefore, the ability to produce purine substances can be imparted by enhancing the expression of these genes. The purine operon genes that can be used in the present invention are not limited to these genes, and genes derived from other microorganisms and animals and plants can also be used.

  In order to increase the expression level of the purine operon, the enzyme activity of the oxidative pentose phosphate pathway, which will be described later, is increased. The method of making it express highly is mentioned.

As a second method for increasing the expression level of the purine operon, replacement of the promoter unique to the purine operon with a stronger promoter, and substitution of the -35 and -10 regions of the unique promoter with consensus sequences can be mentioned. .
For example, in Bacillus subtilis 168 Marburg strain (ATCC6051), the −35 sequence of the purine operon is a consensus sequence (TTGACA), but the −10 sequence is TAAGAT and is different from the consensus sequence TATAAT ( Ebbole, DJ and H. Zalikn, J. Biol. Chem., 1987, 262, 8274-8287). Therefore, the transcriptional activity of the purine operon can be increased by modifying the -10 sequence (TAAGAT) to be the consensus sequence TATAAT or sequences TATAGAT and TAAAAT that are close to the consensus sequence. The replacement of the promoter sequence can be performed by the same method as the gene replacement described below.

As a third method of increasing the expression level of the purine operon, a method of decreasing the expression level of the purine operon repressor can also be mentioned. (US 6,284,495)

In order to reduce the expression level of the purine repressor, for example, the Bacillus bacterium was treated with a mutation agent usually used for mutation treatment such as UV irradiation or NTG or EMS, and the expression level of the purine repressor was reduced. A method of selecting a mutant strain can be employed.
Further, Bacillus bacteria having a reduced expression level of the purine repressor may include, for example, a homologous recombination method using genetic recombination (Experiments in Molecular Genetics, Cold Spring Harbor Laboratory press (1972); According to Matsuyama, S. and Mizushima, S., J. Bacteriol., 1985, 162, 1196-1202), a gene encoding a purine repressor on the chromosome (purR; GenBank Accession NC_000964 SEQ ID NO: 51) functions normally. It can be obtained by replacing with a gene that does not (hereinafter sometimes referred to as “destructive gene”).
In order to replace a normal gene on a host chromosome with a disrupted gene, for example, the following may be performed. In the following example, the purR gene will be described as an example, but other genes, for example, a purA or deoD gene described later, can be similarly disrupted.

  Homologous recombination has a sequence homologous to the sequence on the chromosome, and when a plasmid or the like that cannot be replicated in a Bacillus bacterium is introduced into the cell, recombination occurs at a certain frequency at the sequence with homology. Wake up and the entire introduced plasmid is integrated on the chromosome. After this, when recombination occurs at the position of the homologous sequence on the chromosome, the plasmid falls off from the chromosome again, but at this time the gene destroyed by the position where recombination occurs is fixed on the chromosome, The original normal gene may fall off the chromosome along with the plasmid. By selecting such a strain, it is possible to obtain a strain in which a normal purR gene on a chromosome is replaced with a disrupted purR gene.

  Such a gene disruption technique by homologous recombination has already been established, and a method using linear DNA, a method using a temperature-sensitive plasmid, and the like can be used. The purR gene can also be disrupted by using a plasmid containing a purR gene into which a marker gene such as drug resistance is inserted and which cannot be replicated in the target microorganism cell. That is, a transformant that has been transformed with the plasmid and has acquired drug resistance has a marker gene incorporated in the chromosomal DNA. Since this marker gene is likely to be incorporated by homologous recombination between the purR gene sequence at both ends thereof and the purR gene on the chromosome, a gene-disrupted strain can be efficiently selected.

  Specifically, the destructive purR gene used for gene disruption specifically deletes a certain region of the purR gene by restriction enzyme digestion and recombination, or inserts another DNA fragment (such as a marker gene) into the purR gene, Site-specific mutagenesis (Kramer, W. and Fritz, HJ, Methods Enzymol., 1987, 154, 350-367) or recombinant PCR (PCR Technology, Stockton Press (1989)), sodium hyposulfite, hydroxylamine, etc. By treatment with chemical agents (Shortle, D. and Nathans, D., Proc. Natl. Acad. Sci. USA, 1978, 75, 2170-2174), the base sequence such as the coding region or promoter region of the purR gene One or more base substitutions, deletions, insertions, additions or inversions have been caused to reduce or eliminate the activity of the encoded repressor, or to reduce the purR gene transcription or Can be obtained by selecting the disappeared one. Among these aspects, a method of deleting a certain region of the purR gene by restriction enzyme digestion and recombination, or a method of inserting another DNA fragment into the purR gene is preferable from the viewpoint of certainty and stability.

The purR gene can be obtained from a chromosomal DNA of a microorganism having a purine operon by a PCR method using an oligonucleotide prepared based on the base sequence of a known purR gene as a primer. Further, the purR gene can be obtained from a chromosomal DNA library of a microorganism having a purine operon by a hybridization method using an oligonucleotide prepared based on a known purR gene base sequence as a probe. In the Bacillus subtilis 168 Marburg strain, the base sequence of the purR gene has been reported (GenBank accession No. D26185 (coding region is base number 118041 to 118898), NC_000964 (coding region is base number 54439 to 55296)). The nucleotide sequence of the purR gene and the amino acid sequence encoded by the same gene are shown in SEQ ID NOs: 51 and 52 in the Sequence Listing (see Japanese Patent Application Laid-Open No. 2004-242610).
The primer used in PCR for obtaining the purR gene may be any primer that can amplify a part of the purR gene. Specifically, the bases shown in SEQ ID NO: 59 (GAAGTTGATGATCAAAA) and SEQ ID NO: 60 (ACATATTGTTGACGATAAT) Examples include oligonucleotides having a sequence.

The purR gene used for the preparation of a disrupted gene does not necessarily need to include the entire length, and may have a length necessary to cause gene disruption. In addition, the microorganism used for obtaining each gene is not particularly limited as long as the gene has homology to the degree that homologous recombination occurs with the purR gene of the Bacillus genus bacterium used to create the gene disruption strain. However, it is usually preferable to use a gene derived from the same bacterium as the target Bacillus bacterium.
The DNA capable of causing homologous recombination with the purR gene of Bacillus bacteria is a DNA encoding an amino acid sequence containing one or several amino acid substitutions, deletions, insertions or additions in the amino acid sequence shown in SEQ ID NO: 52. There may be. The “several” is, for example, 1 to 50, preferably 1 to 30, more preferably 1 to 10.

Examples Specifically the DNA capable of causing purR gene homologous recombination Bacillus bacterium, a DNA having the nucleotide sequence shown in SEQ ID NO 51, hybridizing DNA are mentioned under stringent conditions. Examples of stringent conditions include conditions in which washing is performed at a salt concentration corresponding to 60 ° C., 0.1 × SSC, and 0.1% SDS .

  Examples of the marker gene include drug resistance genes such as a spectinomycin resistance gene and a kanamycin resistance gene. The spectinomycin resistance gene derived from Enterococcus faecalis was prepared by preparing plasmid pDG1726 from Escherichia coli ECE101 marketed by Bacillus Genetic Stock Center (BGSC) and removing it from the plasmid as a cassette. Can get. In addition, the erythromycin resistance gene of Staphylococcus aureus is prepared from Escherichia coli ECE91 strain commercially available from Bacillus Genetic Stock Center (BGSC) and removed from the plasmid as a cassette. Can be obtained. Furthermore, the kanamycin resistance gene was prepared from Streptococcus faecalis kanamycin resistance gene by preparing plasmid pDG783 from Escherichia coli ECE94 strain commercially available from Bacillus Genetic Stock Center (BGSC). Can be obtained by taking out as

  When a drug resistance gene is used as a marker gene, the gene is inserted into an appropriate site of the purR gene in a plasmid, a microorganism is transformed with the resulting plasmid, and a transformant that has become drug resistant is selected. A purR gene disrupted strain is obtained. The destruction of the purR gene on the chromosome can be confirmed by analyzing the purR gene or marker gene on the chromosome by Southern blotting or PCR. Confirmation that the spectinomycin resistance gene, erythromycin resistance gene or kanamycin resistance gene has been incorporated into the chromosomal DNA can be carried out by PCR using primers capable of amplifying these genes.

In addition, it is known that the expression of the purine operon is controlled by a terminator-antiterminator sequence (hereinafter referred to as an attenuator sequence) located downstream of the promoter (Ebbole, DJ and Zalkin, H., J. Biol Chem., 1987, 262,
8274-8287, Ebbole, DJ and Zalkin, H., J. Biol. Chem., 1988, 263, 10894-10902, Ebbole, DJ and Zalkin, H., J. Bacteriol., 1989, 171, 2136-2141) (See FIG. 1). Therefore, by deleting the attenuator sequence, the expression level of the purine operon can be increased. Deletion of the attenuator sequence can be performed in the same manner as purR destruction.

  In order to further increase the purine operon transcription, the above methods may be combined, for example, by destroying the purR gene and further amplifying the purine operon lacking the attenuator sequence with a plasmid, or Such a purine operon may be multicopyed on the chromosome.

  Further, the activity of an enzyme involved in purine biosynthesis can be enhanced by releasing the regulation of the enzyme involved in purine biosynthesis, for example, by a method of releasing feedback inhibition of the enzyme (WO99 / 03988). .

  Furthermore, the ability to produce purine substances can also be enhanced by weakening the incorporation of purine substances into cells. For example, purine nucleoside uptake into cells can be attenuated by blocking reactions involved in purine nucleoside uptake into cells. The reaction involved in the incorporation of the purine nucleoside into the cell is, for example, a reaction catalyzed by a nucleoside permease.

Furthermore, the activity of an enzyme that degrades purine substances may be reduced in order to enhance the ability to produce purine substances. Examples of such an enzyme include purine nucleoside phosphorylase.
Purine nucleotides biosynthesized from PRPP by enzymes involved in purine biosynthesis are dephosphorylated to produce purine nucleosides. In order to accumulate the purine nucleoside efficiently, it is preferable to further degrade the purine nucleoside to reduce the activity of purine nucleoside phosphorylase such as hypoxanthine. That is, it is desirable to modify so that the purine nucleoside phosphorylase using purine nucleosides such as inosine as a substrate is weakened or deleted.
Specifically, it can be achieved by destroying the deoD gene and the pupG gene encoding purine nucleoside phosphorylase in Bacillus bacteria. The Bacillus bacterium of the present invention may be modified so that the deoD gene and the pupG gene as described above are singly or simultaneously destroyed. As the deoD gene and the pupG gene, for example, genes derived from the genus Bacillus (deoD; Genbank Accession No. NC — 000964 (SEQ ID NO: 55), pupG; Genbank Accession No. NC — 000964 (SEQ ID NO: 53)) can be used. A gene-disrupted strain can be obtained by this method.
Furthermore, the activity of inosine monophosphate (IMP) dehydrogenase may be reduced in order to enhance the ability to produce purine substances. Examples of the gene encoding IMP dehydrogenase include the guaB gene. As a guaB gene, for example, GenBank Accession No. One having a base sequence registered in NC_000964 (15913..17376) is exemplified (SEQ ID NO: 61).

Further, as a method for enhancing the ability to produce purine substances, it is conceivable to amplify a gene that encodes a protein having an activity of discharging purine substances. As a bacterium in which such a gene is amplified, for example, a Bacillus bacterium that has amplified the rhtA gene. (JP 2003-219876)
In addition, the microorganism used in the present invention can accumulate nucleosides or nucleotides corresponding to each of them if the gene encoding nucleosidase or nucleotidase is further deleted. Precursors on the biosynthetic pathway and related substances can be accumulated.

(II) Modification for increasing the enzyme activity of the oxidative pentose phosphate pathway The Bacillus bacterium of the present invention is designed to increase the enzyme activity of the oxidative pentose phosphate pathway for a strain having the purine substance-producing ability as described above. Can be obtained by modifying However, the order of modification is not limited, and purine nucleotide production ability may be imparted after modification so as to increase the enzyme activity of the oxidative pentose phosphate pathway.

  Here, the “oxidative pentose phosphate pathway” means that glucose taken into cells is phosphorylated by glucose kinase to biosynthesize glucose-6-phosphate, and glucose-6-phosphate is oxidized oxidatively. It means the pathway converted to ribose-5-phosphate. Specifically, an enzyme of the oxidative pentose phosphate pathway is glucose-6-phosphate dehydrogenase (EC: 1.1.1.49), 6-phosphate-gluconate dehydrogenase (EC: 1.1.1.44), or , Ribose-5-phosphate isomerase (EC: 5.3.1.6) and the like, and Bacillus bacteria of the present invention include glucose-6-phosphate-dehydrogenase and ribose-5--5 among these enzymes. It may be modified so that the activity of any of the phosphate isomerases is increased.

  The enzyme activity of the oxidative pentose-phosphate pathway is preferably higher than the activity of the wild strain or the unmodified strain. The increase in enzyme activity can be measured by the following method. For example, the enzyme activity of glucose-6-phosphate dehydrogenase is measured by the method for measuring the production of NADPH as described in Example 1 (1), or the enzyme activity of ribose-5-phosphate isomerase is It can be measured by the method of measuring the production of ribulose-5-phosphate as described in Example 6, (2).

In order to modify the enzyme activity of the oxidative pentose phosphate pathway, for example, a gene encoding the enzyme of the oxidative pentose phosphate pathway may be amplified. The gene that can be used is not particularly limited as long as it is a gene encoding a protein having an enzymatic activity of the oxidative pentose phosphate pathway, and examples thereof include genes derived from the genus Bacillus.
Bacillus subtilis glucose-6-phosphate dehydrogenase (glucose-6-phosphate dehydrogenase) is composed of 489 amino acids shown in SEQ ID NO: 48, and preferably a gene encoding the protein, preferably SEQ ID NO: 47 (zwf gene; Genbank
A gene having the base sequence of Accession No. NC — 000964) can be used for modification. The zwf gene is present at 212 degrees on the Bacillus subtilis chromosome.

  Examples of ribose-5-phosphate isomerase include a protein composed of 149 amino acids shown in SEQ ID NO: 50, and a gene encoding the protein, preferably a gene having the base sequence of SEQ ID NO: 49 (ywlF Gene; Genbank Accession No. NC — 000964) can be used for modification. The ywlF gene is present at 324 degrees on the Bacillus subtilis chromosome in proximity to the glyA gene encoding serine hydroxymethyltransferase. In addition, ribose-5-phosphate isomerase includes what is called ribose-5-phosphate epimerase.

In addition, genes encoding enzymes of the oxidative pentose phosphate pathway derived from bacteria other than the genus Bacillus, such as other microorganisms or animals and plants, can also be used. A gene encoding an enzyme of the oxidative pentose phosphate pathway derived from a microorganism or animal or plant has an enzyme activity of the oxidative pentose phosphate pathway based on a gene whose base sequence has already been determined, or homology with those base sequences. It is possible to use a gene that encodes a protein having the nucleotide sequence isolated from a chromosome of a microorganism, animal or plant, etc. In addition, after the base sequence is determined, a gene synthesized according to the sequence can be used. These can be obtained by amplifying a region containing the promoter and the ORF portion by a hybridization method or a PCR method. For the sequence information, a database such as Genbank can be used.

In Bacillus bacteria, the intracellular activity of these target enzymes can be increased by enhancing the expression of a gene encoding the enzyme. Enhancement of the expression level of the gene is achieved by increasing the copy number of the gene. For example, a gene fragment encoding the enzyme is ligated with a vector that functions in a Bacillus bacterium, preferably a multi-copy vector, to produce a recombinant DNA, which is introduced into a Bacillus bacterium host and transformed. That's fine.
As a gene to be introduced, any of genes derived from Bacillus bacteria and genes derived from other organisms such as Escherichia bacteria can be used as long as they function in Bacillus bacteria.
The target gene can be obtained, for example, by PCR using chromosomal DNA of Bacillus bacteria as a template (PCR: polymerase chain reaction; see White, TJ et al., Trends Genet., 1989, 5, 185-189) can do. Chromosomal DNA is obtained from bacteria that are DNA donors, for example, by the method of Saito and Miura (H. Saito and K. Miura, Biochem. Biophys. Acta, 1963, 72, 619-629, Biotechnology Experiments, Japanese Biology). (See Engineering Society, 97-98, Bafukan, 1992)). The primer for PCR can be prepared based on a known gene sequence of Bacillus bacteria or based on information on a region where the sequence is conserved between known genes in other bacteria.
Examples of autonomously replicable vectors for introducing a target gene into Bacillus bacteria include pUB110, pC194, pE194, and the like. Examples of vectors for incorporating the target gene into the chromosomal DNA include E. coli such as pHSG398 (Takara Shuzo Co., Ltd.) and pBluescript SK- (Stratagene). and vectors for E. coli.
In order to prepare a recombinant DNA by linking a target gene and a vector carrying a marker that functions in Bacillus bacteria, the vector is cleaved with a restriction enzyme that matches the end of the target gene. Ligation is usually performed using a ligase such as T4 DNA ligase.

Examples of marker genes that function in the genus Bacillus include drug resistance genes such as a spectinomycin resistance gene and a kanamycin resistance gene. The spectinomycin resistance gene derived from Enterococcus faecalis was prepared by preparing plasmid pDG1726 from Escherichia coli ECE101 marketed by Bacillus Genetic Stock Center (BGSC) and removing it from the plasmid as a cassette. Can get. In addition, the erythromycin resistance gene of Staphylococcus aureus is prepared from Escherichia coli ECE91 marketed by the Bacillus Genetic Stock Center (BGSC) and removed from the plasmid as a cassette. Can be obtained. Further, the kanamycin resistance gene is prepared from Streptococcus faecalis kanamycin resistance gene, and the plasmid pDG783 is prepared from Escherichia coli ECE94 strain commercially available from Bacillus Genetic Stock Center (BGSC). Can be obtained by taking out as

  In order to introduce the recombinant DNA prepared as described above into a bacterium belonging to the genus Bacillus, it may be carried out according to the transformation methods reported so far. For example, a method of preparing competent cells from cells at the growth stage and introducing DNA (Dubnau, D., and Davidoff-Abelson, R., J. Mol. Biol., 1971, 56, 209-221), or , A method of introducing a recombinant DNA into a DNA-receptive bacterium by making a host cell into a protoplast or a spheroplast that easily takes up the recombinant DNA (Chang, S. and Cohen, SN, Molec. Gen. Genet., 1979 , 168, 111-115).

  Increasing the copy number of the target gene can also be achieved by making the gene exist in multiple copies on the chromosomal DNA of Bacillus bacteria. In order to introduce the target gene in multiple copies on the chromosomal DNA of a Bacillus genus, homologous recombination is carried out using a sequence present in multiple copies on the chromosomal DNA as a target. As a sequence present in multiple copies on chromosomal DNA, a transposon, a repetitive sequence, an inverted repeat present at the end of a transposable element, or the like can be used.

In addition to the gene amplification described above, the enhancement of the activity of the target enzyme can also be achieved by replacing an expression regulatory sequence such as a promoter of the target gene on the chromosomal DNA or plasmid with a strong one. The strength of the promoter is defined by the frequency of RNA synthesis initiation. Methods for evaluating promoter strength and examples of strong promoters are described in Goldstein et al. (Prokaryotic promoters in biotechnology. Biotechnol. Annu. Rev., 1995, 1, 105-128). Further, as disclosed in International Publication W000 / 18935, it is possible to introduce a base substitution of several bases into the promoter region of the target gene and modify it to be more powerful. In addition, it is known that substitution of several nucleotides in the spacer between the ribosome binding site (RBS) and the initiation codon, particularly in the sequence immediately upstream of the initiation codon, greatly affects the translation efficiency of mRNA. Modification of these expression regulatory sequences may be combined with increasing the copy number of the target gene.
For example, promoters that function in Bacillus include veg promoter, spac promoter, xyl promoter and the like.

  The enzyme of the oxidative pentose phosphate pathway that increases the activity in the microorganism of the present invention is one or several at one or more positions in the sequence of SEQ ID NO: 48 or 50, as long as the respective enzyme activity is not impaired. It may be an enzyme protein containing amino acid substitutions, deletions, insertions or additions. Here, “several” differs depending on the position and type of the amino acid residue in the three-dimensional structure of the protein, but specifically 1 to 30, preferably 1 to 20, and more preferably 1 to 10 It is a piece.

  The mutation of the enzyme protein in the oxidative pentose phosphate pathway is a conservative mutation that maintains the enzyme activity. A substitution is a change in which at least one residue in the amino acid sequence is removed and another residue is inserted therein. Amino acids that replace the original amino acid of the enzyme protein and are considered conservative substitutions include ala to ser or thr, arg to gln, his or lys, asn to glu, gln, lys, his or asp substitution, asp to asn, glu or gln substitution, cys to ser or ala substitution, gln to asn, glu, lys, his, asp or arg substitution, glu to gly, asn, gln, lys or asp, gly to pro, his to asn, lys, gln, arg or tyr, ile to leu, met, val or phe, leu to ile, met, substitution from val or phe, substitution from lys to asn, glu, gln, his or arg, substitution from met to ile, leu, val or phe, substitution from phe to trp, tyr, met, ile or leu, ser to thr or ala, thr to ser or ala, trp to phe or tyr, tyr to his, phe or trp, and val to met, ile or leu Can be mentioned

  DNA encoding a protein that is substantially the same as the enzyme protein of the oxidative pentose phosphate pathway as described above can be substituted, deleted, inserted, added, amino acid residues at a specific site by, for example, site-directed mutagenesis. Alternatively, it can be obtained by modifying the base sequence encoding these enzymes so as to include an inversion. The modified DNA as described above can also be obtained by a conventionally known mutation treatment. As the mutation treatment, a method of treating DNA before mutation treatment with in vitro hydroxylamine or the like, and a microorganism retaining the DNA before mutation treatment, for example, Escherichia bacteria, are irradiated with ultraviolet rays or N-methyl-N′-nitro-N -A method of treating with a mutating agent usually used for mutating treatment such as nitrosoguanidine (NTG) or nitrous acid.

By expressing the DNA having the mutation as described above in an appropriate cell and examining the activity of the expression product, DNA encoding a protein substantially identical to the enzyme of the oxidative pentose phosphate pathway can be obtained. Further, the cell carrying DNA encoding or containing enzymes of oxidative pentose phosphate pathway having a mutation in the complementary sequence under stringent conditions the nucleotide sequence of SEQ ID NO: 47 or 49, for example the sequence listing A DNA that hybridizes and encodes a protein having the enzymatic activity of the oxidative pentose phosphate pathway is obtained. The “stringent conditions” referred to herein are conditions under which so-called specific hybrids are formed and non-specific hybrids are not formed. It is difficult to clearly quantify this condition, One example, 60 ° C. a condition washing Southern hybridization normal, 0. Examples include conditions for hybridizing at a salt concentration corresponding to 1 × SSC and 0.1% SDS.

  As a probe, a partial sequence of a complementary sequence of the nucleotide sequences of SEQ ID NOs: 47 and 49 can also be used. Such a probe can be prepared by PCR using oligonucleotides prepared based on the nucleotide sequences of SEQ ID NOs: 47 and 49 as primers and DNA fragments containing the nucleotide sequences of SEQ ID NOs: 47 and 49 as templates. When a DNA fragment having a length of about 300 bp is used as a probe, hybridization washing conditions include 50 ° C., 2 × SSC, and 0.1% SDS.

Specifically, the DNA encoding a protein substantially the same as the enzyme of the oxidative pentose phosphate pathway is specifically the amino acid sequence shown in SEQ ID NOs: 48 and 50, preferably 50% or more, more preferably 70% or more, and still more preferably Is a DNA encoding a protein having a homology of 80%, particularly preferably 90% or more, most preferably 95% or more, and having an enzyme product activity of the oxidative pentose phosphate pathway.

<2> Method for Producing Purine Substance The Bacillus bacterium of the present invention efficiently produces a purine substance. Accordingly, by culturing the Bacillus bacterium of the present invention in a suitable medium, purine-based substances such as purine nucleosides and purine nucleotides can be produced and accumulated in the medium.
The medium used in the present invention can be performed by a conventional method using a normal nutrient medium containing a carbon source, a nitrogen source, inorganic salts, and other organic trace nutrients such as amino acids and vitamins as necessary. Either synthetic or natural media can be used. The carbon source and nitrogen source used in the medium may be any one that can be used by the strain to be cultured.
As the carbon source, glucose, fructose, sucrose, maltose, mannose, galactose, arabinose, xylose, trehalose, ribose, starch hydrolysate, sugars such as molasses, alcohols such as glycerol and mannitol are used, and other gluconic acids Organic acids such as acetic acid, citric acid, maleic acid, fumaric acid and succinic acid may be used alone or in combination with other carbon sources.
As the nitrogen source, ammonia, ammonium salts such as ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium phosphate, and ammonium acetate, and organic nitrogen such as nitrate or soybean hydrolysate are used.
As organic micronutrients, amino acids, vitamins, fatty acids, nucleic acids, and peptone, casamino acid, yeast extract, soy proteolysate containing these are used, and nutritional requirements that require amino acids, nucleosides, etc. for growth When using mutants, it is necessary to supplement the required nutrients.
As the inorganic salts, phosphates, magnesium salts, calcium salts, iron salts, manganese salts and the like are used.

The culture conditions depend on the type of bacteria belonging to the genus Bacillus. For example, in Bacillus subtilis, aeration culture is performed while controlling the fermentation temperature at 20 to 50 ° C. and the pH at 4 to 9. If the pH drops during the culture, neutralize with an alkali such as ammonia gas. Thus, purine nucleosides are accumulated in the culture medium by culturing for about 40 hours to 3 days.
As a method for collecting purine substances such as inosine accumulated in the culture solution after completion of the culture, a known method may be used. For example, it can be isolated by precipitation or ion exchange chromatography.

  Furthermore, 5'-inosinic acid or 5'-guanylic acid is obtained by allowing purine nucleoside phosphorylase and phosphoribosyltransferase to act on inosine or guanosine produced by the method of the present invention.

Moreover, the microorganism which has the capability to produce | generate the phosphoric acid donor selected from the group which consists of polyphosphoric acid, phenylphosphoric acid, carbamyl phosphoric acid, and nucleoside-5'-phosphate ester in the purine nucleoside produced using the microorganisms of this invention Alternatively, purine nucleotides (nucleoside-5′-phosphate esters) can be produced by the action of acid phosphatase. The microorganism having the ability to produce a nucleoside-5′-phosphate ester is not particularly limited as long as it has the ability to convert purine nucleosides into purine nucleotides. For example, the microorganism as described in International Publication Pamphlet WO9637603 Is mentioned. Also, Escherichia blattae JCM 1650, Serratia ficaria ATCC 33105, Klebsiella planticola IFO 14939 (ATCC
33531), Klebsiella pneumoniae IFO 3318 (ATCC 8724), Klebsiella terrigena IFO 14941 (ATCC 33257), Morganella morganii IFO 3168, Enterobacter aerogenes IFO 12010, Enterobacter aerogenes IFO 13534 (ATCC 13048), Chromobacterium fluaceum 614 Cedecea lapagei JCM 1684, Cedecea davisiae JCM 1685, Cedecea neteri JCM 5909, etc. can also be used.
As the acid phosphatase (EC 3.1.3.2), for example, those disclosed in JP-A-2002-000289, US6,010,851, US6,015,697, WO01 / 18184 can be used, and more preferably affinity for nucleosides. Acid phosphatase with increased activity (see JP-A-10-201481), mutant acid phosphatase with reduced nucleotidase activity (see WO9637603), mutant acid phosphatase with reduced phosphate ester hydrolysis activity (US 6,010,851), etc. be able to.

[Example]
Hereinafter, the present invention will be described more specifically with reference to examples.

<Construction and culture evaluation of purine nucleoside phosphorylase-deficient strain>
(1) Construction of purine nucleoside phosphorylase (pupG) -deficient strain Derived from B. subtilis 168 Marburg strain (ATCC6051), purine operon repressor gene (purR), succinyl-AMP synthase gene (purA), purine nucleoside phosphorylase A strain in which a pupG gene deficiency was introduced into a recombinant KMBS16 (Japanese Patent Laid-Open No. 2004-242610) deficient in the gene (deoD) was prepared as follows.

(I) Cloning of 5′-side region of pupG Based on the information of the gene data bank (GenBank Accession No. NC — 000964), 20-mer and 29-mer PCR primers having the following base sequences were prepared.
ATTGCACGGCCGTTCGTCGG (SEQ ID NO: 1)
cgcagatctCCGGATTTTCGATTTCGTCC (lower case bases indicate tags containing BglII sites, SEQ ID NO: 2)
B. PCR (94 ° C, 30 seconds; 55 ° C, 1 minute; 72 ° C, 2 minutes; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by PerkinElmer) )) To obtain an amplified fragment containing about 610 bp upstream of the pupG gene translation initiation codon and about 120 bp downstream thereof.
The PCR amplified fragment was purified by phenol-chloroform extraction and ethanol precipitation, and cloned into the attached pT7Blue plasmid using Perfectly Blunt Cloning Kit (NOVAGEN). Both ends of the multicloning site of this plasmid were EcoRI and HindIII, and a plasmid pKM48 in which the upstream region of the pupG gene was on the EcoRI side was obtained.

(Ii) Cloning of the 3′-side region of pupG Based on the information of the gene data bank (GenBank Accession NC — 000964), 20-mer and 29-mer PCR primers having the following base sequences were prepared, respectively.
CAAAGATCTGTCCAGCCTGG (SEQ ID NO: 3)
cgcctgcagTGCCTTTATCTAAAGCTTCC (lower case base indicates tag containing PstI site, SEQ ID NO: 4)
PCR (94 ° C, 30 seconds; 55 ° C, 1 minute; 72 ° C, 2 minutes; 30 cycles; Gene Amp PCR System Model 9600 (Perkin Elmer) The amplified fragment containing about 340 bp upstream of the pupG gene translation stop codon and about 400 bp downstream thereof was obtained.
In the same manner as in the cloning of the 5′-side region of pupG, the plasmid was cloned into the pT7Blue plasmid to obtain a plasmid pKM49 in which the downstream region of the pupG gene was on the EcoRI side.

(Iii) Cloning of DpupG fragment
pKM49 was treated with SpeI, blunted with Klenow fragment, and further treated with PstI to excise a DNA fragment of about 740 bp. PKM48 was treated with BglII, blunted with Klenow fragment, and then ligated with a plasmid fragment treated with PstI and T4 DNA ligase to obtain pKM75. This plasmid carries an insert of about 1470 bp containing pupG deficient DNA with about 360 bp deleted in the pupG structural gene.

(Iv) Construction of pupG disruption plasmid
pKM75 was treated with SacI and PstI to cut out the insert, and this fragment was chromosomal recombination vector pJPM1 (Mueller et. al., J. Bacteriol., 1992, 174, 4361-4373) treated with the same enzyme and T4. Ligation was performed using DNA ligase to obtain pKM76.
The obtained plasmid pKM76 was used to transform competent cells of the KMBS16 strain prepared by the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209-221), and 2.5 μg / ml Colonies that grow on LB agar plates containing chloramphenicol were obtained (one-time recombinant strain).
The obtained single recombinant strain was inoculated into 10 ml of chloramphenicol-containing LB medium, subcultured at 37 ° C for several days, and colonies that became chloramphenicol sensitive on LB agar medium were identified. Screened. Chromosomal DNA was prepared from the obtained chloramphenicol-sensitive colonies and PCR was performed in the same manner as described above using the primers of SEQ ID NOs: 5 and 6, and the pupG gene on the chromosome was deleted from the pupG gene (DpupG ) And a strain (purR :: spc purA :: erm deoD :: kan DpupG) substituted by recombination twice. One of the two recombinant strains thus obtained was named KMBS93.
GGTCTGAGCTTTGCGAACC (SEQ ID NO: 5)
CGCCTGCAGTGCCTTTATCTAAAGCTTCC (SEQ ID NO: 6)

(2) Recombinant KMBS13 derived from B. subtilis 168 Marburg strain (ATCC6051) and lacking purine operon repressor gene (purR) and succinyl-AMP synthase gene (purA) (Japanese Patent Laid-Open No. 2004-242610) A strain having a pupG gene deficiency introduced therein was prepared as follows.
pKM76 was used to transform competent cells of KMBS13 strain prepared by the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209-221), and 2.5 μg / ml chlorampheny Colonies that grow on LB agar plates containing cole were obtained (single recombinant strain).
The obtained single recombinant strain was inoculated into 10 ml of chloramphenicol-containing LB medium, subcultured at 37 ° C for several days, and colonies that became chloramphenicol sensitive on LB agar medium were identified. Screened. Chromosomal DNA was prepared from the obtained chloramphenicol-sensitive colonies and PCR was performed in the same manner as described above using the primers of SEQ ID NOs: 5 and 6, and the pupG gene on the chromosome was deleted from the pupG gene (DpupG ) And a strain (purR :: spc purA :: erm DpupG) substituted by recombination twice. One of the two recombinant strains thus obtained was named KMBS113.

(3) Production of purine nucleosides from pupG gene-deficient strains
PupG gene-deficient strains (KMBS93 and KMBS113) and control strain KMBS16 were added to PS medium plate (Soluble starch 30 g / L, Yeast extract 5 g / L, Polypeptone 5 g / L, Agar 20 g / L, KOH). (Adjusted to pH 7.0). Cells of 1/8 plate were inoculated into 20 ml of fermentation medium in a 500 ml Sakaguchi flask, and then calcium carbonate was added to 50 g / L and cultured at 34 ° C. with shaking. Sampling was performed 100 hours after the start of the culture, and the amounts of inosine and hypoxanthine contained in the culture solution were measured by a known method. In the control strain KMBS16, a large amount of hypoxanthine was detected in the culture medium, but the pupG gene-deficient strains KMBS93 and KMBS113 had very low amounts of hypoxanthine accumulation and were clearly identified as HPLC peaks. (Table 1). The inosine accumulation of KMBS93 and KMBS113 was higher than that of the control strain KMBS16.

[Fermentation medium composition]
Glucose 80 g / L
KH ₂ PO ₄ 1 g / L
NH ₄ Cl 32 g / L
Tono (TN) ^* 1.35 g / L
DL-methionine 0.3 g / L
L-tryptophan 0.02 g / L
Adenine 0.1 g / L
MgSO ₄ 0.4 g / L
FeSO ₄ 0.01 g / L
MnSO ₄ 0.01 g / L
GD113 0.01 ml / L
(Adjusted to pH 7.0 with KOH)
Calcium carbonate 50 g / L
*: Protein hydrolyzate

(1) Introduction of mutant guaB gene Derived from the aforementioned Bacillus subtilis 168 Marburg strain (ATCC6051), purine operon repressor gene (purR), succinyl-AMP synthase gene (purA), purine nucleoside phosphorylase gene ( A strain in which a guaB (A1) mutation in the IMP dehydrogenase gene guaB was introduced into a recombinant KMBS1113 lacking pupG) was produced as follows. The guaB (A1) mutation is a leaky mutation (mutation that decreases IMP dehydrogenase activity) in which alanine at position 226 of SEQ ID NO: 62 is substituted with valine.
(I) Preparation of a strain in which a kanamycin resistance gene is inserted in the middle of the guaB gene of a B. subtilis 168 Marburg-derived strain
In the amplification of the upstream region of the guaB gene, 34-mer and 50-mer PCR primers having the following base sequences were prepared based on information from the gene data bank (GenBank Accession NC_000964 and V01547).
cgcggatccGGCTTAACGTTCGACGATGTGCTGC (lower case base is tag containing BamHI site-SEQ ID NO: 7)
gctttgcccattctatagatatattGAGTCATTGTATCGCCAGTTACACC (lower-case base is the sequence upstream of the promoter of the kanamycin resistance gene (kan) cloned on pDG783 (BGSC), SEQ ID NO: 8)
B. PCR (94 ° C, 30 seconds; 55 ° C, 1 minute; 72 ° C, 1 minute; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by Perkin Elmer) )) To obtain an amplified fragment (about 710 bp) of the 5 ′ region of the guaB gene.
For amplification of the 3 ′ side region of the guaB gene, 50-mer and 34-mer PCR primers having the following base sequences were prepared based on the information of the gene data bank (GenBank Accession NC — 000964 and V01547), respectively.
cctagatttagatgtctaaaaagctGTGATTGTTATCGATACAGCTCACG (SEQ ID NO: 9; the lower case base is the sequence downstream of the structural gene of the kanamycin resistance gene (kan) cloned on pDG783 (BGSC))
cgcgaattcGTAATCTGTACGTCATGCGGATGGC (Lower case base is tag including EcoRI site, SEQ ID NO: 10)
B. PCR (94 ° C, 30 seconds; 55 ° C, 1 minute; 72 ° C, 1 minute; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by Perkin Elmer) )) To obtain an amplified fragment (about 730 bp) of the 3 ′ side region of the guaB gene.
In amplification by the PCR method for the 3 ′ region of the kan gene, 50-mer PCR primers each having the following base sequences were prepared based on the information of the gene data bank (GenBank Accession No. V01277 and NC_000964).
ggtgtaactggcgatacaatgactcAATATATCTATAGAATGGGCAAAGC (the lower case base is a sequence in the upstream region of guaB and is designed to complement the 3 ′ end region of SEQ ID NO: 8, SEQ ID NO: 11)
cgtgagctgtatcgataacaatcacAGCTTTTTAGACATCTAAATCTAGG (the lower case base is a sequence in the downstream region of guaB and is designed to complement the 3 ′ end region of SEQ ID NO: 9, SEQ ID NO: 12)
Using a plasmid DNA carrying a kanamycin resistance gene (kan), such as pDG783, as a template, PCR using the above primers (94 ° C, 30 seconds; 55 ° C, 1 minute; 72 ° C,
1 minute; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by PerkinElmer)), and an amplified fragment of about 1150 bp containing the kan gene was obtained.
In the amplification by recombinant PCR of the guaB region into which the kan gene has been inserted, the three types of DNA fragments amplified as described above are purified using MicroSpin Column S-400 (Amersham Pharmacia Biotech), and then mixed in appropriate amounts as a template. PCR was performed using SEQ ID NOs: 7 and 10 (94 ° C., 30 seconds; 55 ° C., 1 minute; 72 ° C., 2 minutes; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by PerkinElmer)), and kan An amplified fragment of the guaB region into which the gene was inserted was obtained.
The obtained guaB region (guaB :: kan) DNA fragment into which the kan gene was inserted was subjected to agarose gel electrophoresis, and the target fragment was extracted from the gel. The purified DNA fragment was used to transform competent cells of the B. subtilis standard strain prepared by the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209-221). Colonies that grew on LB agar plates containing 2.5 μg / ml kanamycin and 20 μg / ml guanine were obtained. Chromosomal DNA was prepared from these colonies, and guaB region on the chromosome was replaced twice with guaB region (guaB :: kan) in which the guaB region on the chromosome was replaced with a kanamycin resistance gene by PCR using SEQ ID NOs: 7 and 10. Recombinant strains were identified. The recombinant strain thus obtained is a guanine-requiring strain, and one of these strains was named KMBS193.

(Ii) Preparation of a strain into which a guaB mutation (A1) from a B. subtilis 168 Marburg-derived strain has been inserted
For amplification of the 5 ′ region of the guaB gene, 25-mer and 46-mer PCR primers having the following base sequences were prepared based on the information of the gene data bank (GenBank Accession NC — 000964).
CATAAAATGTACGCATAGGCCATTC (SEQ ID NO: 13)
TTGTATCGCCAGTTACACCAACTaCCGCGCCAACGATCAGGCGGCC (lower case base indicates mutation point, SEQ ID NO: 14)
B. PCR (94 ° C, 30 seconds; 55 ° C, 1 minute; 72 ° C, 1 minute; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by Perkin Elmer) )) To obtain an amplified fragment (about 1210 bp) in the 5 ′ end region and upstream region of the guaB gene.
Next, the guaB gene 3 ′ region was amplified. Based on the information of the gene data bank (GenBank Accession NC — 000964), 46-mer and 26-mer PCR primers having the following base sequences were prepared.
GGCCGCCTGATCGTTGGCGCGGtAGTTGGTGTAACTGGCGATACAA (lower case base indicates mutation point, complementary to SEQ ID NO: 14 primer, SEQ ID NO: 15)
CCTTGATCAATTGCTTCCAATAACAG (SEQ ID NO: 16)
B. PCR (94 ° C, 30 seconds; 55 ° C, 1 minute; 72 ° C, 1 minute; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by Perkin Elmer) )) To obtain an amplified fragment (about 1220 bp) in the 3 ′ end region and downstream region of the guaB gene.
In the amplification by the recombinant PCR method of the guaB region into which the guaB mutation (A1) was introduced, the two DNA fragments amplified as described above were subjected to agarose electrophoresis, and the target DNA fragment was purified. Using a mixture of appropriate amounts of both DNA fragments as a template and using SEQ ID NOS: 13 and 16, PCR (94 ° C, 30 seconds; 55 ° C, 1 minute; 72 ° C, 2 minutes; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by Perkin Elmer)) to obtain an amplified fragment of the guaB region into which the guaB mutation (A1) was introduced.
The obtained guaB mutation (A1) -introduced DNA fragment of the guaB region (guaB (A1)) was subjected to agarose gel electrophoresis, and the target fragment was extracted from the gel. The purified DNA fragment was used to transform competent cells of KMBS193 prepared by the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209-221) Colonies that grew on the agar plates were obtained. Chromosomal DNA was prepared from these colonies, and the guaB :: kan region on the chromosome was replaced with a guaB region containing a guaB (A1) mutation by recombination twice by PCR using SEQ ID NOs: 13 and 16. A strain was identified. The recombinant strain thus obtained is a guanine non-requiring strain, and one of these strains was named YMBS9.

(Iii) Preparation of a strain in which the guaB mutation (A1) is introduced into the inosine-producing bacterium KMBS113
A chromosomal DNA of KMBS193 (guaB :: kan) was prepared, and a chromosomal DNA of KMBS113 prepared by the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209-221) was used. Tent cells were transformed to obtain colonies that grew on LB agar plates containing 2.5 μg / ml kanamycin and 20 μg / ml guanine. Such a strain is a guanine requirement, and one of these strains was named YMBS6 (purR :: spc purA :: erm DpupG guaB :: kan trpC2).
Next, chromosomal DNA of YMBS9 (guaB (A1)) was prepared, and YMBS6 prepared by the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209-221) was used. Strain competent cells were transformed to obtain colonies that grew on minimal medium agar plates containing 20 μg / ml adenine. Such a strain is a guanine leaky requirement, and one of these strains was named YMBS2 (purR :: spc purA :: erm guaB (A1) DpupG trpC2).

(2) Purine nucleic acid production of inosine-producing strain introduced with guaB mutation
Inosine-producing strain (YMBS2 strain) introduced with guaB mutation (A1) and KMBS113, which is a control strain, were added to PS medium plate (Soluble starch 30 g / L, Yeast extract 5 g / L, Polypeptone 5 g / L, Agar 20 g / (Adjusted to pH 7.0 with L and KOH), and evenly spread and cultured overnight at 34 ° C. Cells of 1/8 plate were inoculated into 20 ml of fermentation medium in a 500 ml Sakaguchi flask, and then calcium carbonate was added to 50 g / L and cultured at 34 ° C. with shaking. Sampling was conducted at 96 hours after the start of culture, and the amounts of inosine and hypoxanthine contained in the culture were measured by a known method.
[Fermentation medium composition]
Glucose 60 g / L
KH ₂ PO ₄ 1 g / L
NH ₄ Cl 32 g / L
Tono (TN) ^* 1.35 g / L
DL-methionine 0.3 g / L
L-tryptophan 0.02 g / L
Adenine 0.1 g / L
MgSO ₄ 0.4 g / L
FeSO ₄ 0.01 g / L
MnSO ₄ 0.01 g / L
GD113 0.01 ml / L
(Adjusted to pH 7.0 with KOH)
Calcium carbonate 50 g / L
*: Protein hydrolyzate

<Production of purine operon amplification strain>
(1) <Preparation of Ppur disruption strain>
A strain derived from Bacillus subtilis 168 Marburg strain (ATCC6051) and disrupting the purine operon promoter (Ppur) was prepared as follows.

(I) Amplification by PCR of upstream region of Ppur Based on the information of gene data banks (GenBank Accession NC — 000964 and V01277), PCR primers of 34 mer and 50 mer having the following base sequences were prepared.
cgcggatccTTATTTAGCGGCCGGCATCAGTACG (SEQ ID NO: 17; lowercase base is a tag containing BamHI site)
cgtttgttgaactaatgggtgctttATGGATAATGTCAACGATATTATCG (SEQ ID NO: 18; the lower case base is the sequence upstream of the promoter of the chloramphenicol resistance gene (cat) cloned on pC194)
B. PCR (94 ° C, 30 seconds; 55 ° C, 1 minute; 72 ° C, 1 minute; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by Perkin Elmer) )) To obtain an amplified fragment containing the Ppur-35 sequence and about 730 bp upstream.

(Ii) Amplification by PCR of downstream region of Ppur Based on the information of gene data banks (GenBank Accession NC — 000964 and V01277), PCR primers of 50 mer and 34 mer having the following base sequences were prepared.
acagctccagatccatatccttcttCCTCATATAATCTTGGGAATATGGC (SEQ ID NO: 19; lower case base is the sequence of the downstream region of the structural gene of the chloramphenicol resistance gene (cat) cloned on pC194)
cgcggatccTCTCTCATCCAGCTTACGGGCAAGG (SEQ ID NO: 20; lowercase base is a tag containing BamHI site)
B. PCR (94 ° C, 30 seconds; 55 ° C, 1 minute; 72 ° C, 1 minute; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by Perkin Elmer) )) To obtain an amplified fragment containing about 230 bp upstream of the purE gene translation initiation codon and about 440 bp downstream thereof.

(Iii) Amplification of cat gene by PCR method Based on the information of gene data banks (GenBank Accession No. V01277 and NC_000964), 50-mer PCR primers each having the following base sequences were prepared.
cgataatatcgttgacattatccatAAAGCACCCATTAGTTCAACAAACG (SEQ ID NO: 21; the lower case base is designed to complement the 3 ′ end region of SEQ ID NO: 18 in the upstream region of Ppur)
gccatattcccaagattatatgaggAAGAAGGATATGGATCTGGAGCTGT (SEQ ID NO: 22; the lower case base is the sequence upstream of the purE gene translation start codon and is designed to complement the 3 ′ end region of SEQ ID NO: 19)
Using a plasmid DNA carrying a chloramphenicol resistance gene (cat), for example, pC194 as a template, PCR using the above primers (94 ° C, 30 seconds; 55 ° C, 1 minute;
72 ° C., 2 minutes; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by PerkinElmer)), and an amplified fragment of about 980 bp containing the cat gene was obtained.

(Iv) Amplification of the Ppur region into which the cat gene has been inserted by recombinant PCR (i) to (iii) The DNA fragment amplified by MicroSpin Column S-400 (Amersham Pharmacia Biotech) and then mixed with an appropriate amount as a template And using SEQ ID NOs: 17 and 20, PCR (94 ° C., 30 seconds; 55 ° C., 1 minute; 72 ° C., 2 minutes; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by PerkinElmer)) An amplified fragment of the Ppur region into which the cat gene was inserted was obtained.

(V) Preparation of strain with disrupted Ppur The DNA fragment of the Ppur region (Ppur :: cat) inserted with the cat gene obtained in (iv) was subjected to agarose gel electrophoresis, and the target fragment was extracted from the gel. The purified DNA fragment was used to transform competent cells of B. subtilis standard strains prepared by the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209-221). Colonies that grew on LB agar plates containing 2.5 μg / ml chloramphenicol were obtained. Chromosomal DNA was prepared from these colonies, and the PCR method shown in (iv) was repeated twice with the Ppur region (Ppur :: cat) in which the Ppur region on the chromosome was replaced with a chloramphenicol resistance gene. Recombinant strains were identified. The recombinant strain thus obtained is an adenine-requiring strain, and one of these strains was named KMBS198.

(2) <Preparation of purine operon promoter mutant>
Preparation of a strain derived from Bacillus subtilis (B. subtilis 168 Marburg strain; ATCC6051) and modified so that the Ppur-10 sequence becomes a consensus sequence TATAAT (Ppur1), or TATGAT (Ppur3), TAAAAT (Ppur5). It carried out as follows.

(I) Amplification by PCR of upstream region of Ppur including -10 sequence modification Based on the information of Gene Data Bank (GenBank Accession No. NC_000964), the primer for 25-mer PCR shown in SEQ ID NO: 42 having the following base sequence A 38-mer primer for modification containing 3 types of modified Ppur sequences was prepared.
AATAGATATAAAGAGGTGAGTCTGC (SEQ ID NO: 42)
<For Ppur1 modification>
TTTTGATTTCATGTTTattataACAACGGACATGGATA (SEQ ID NO: 23; lower case base indicates Ppur1 sequence)
<For Ppur3 modification>
TTTTGATTTCATGTTTatcataACAACGGACATGGATA (SEQ ID NO: 24; lower case base indicates Ppur3 sequence)
<For Ppur5 modification>
TTTTGATTTCATGTTTattttaACAACGGACATGGATA (SEQ ID NO: 25; lower case base indicates Ppur5 sequence)
B. PCR (94 ° C, 30 seconds; 55 ° C, 1 minute; 72 ° C, 1 minute; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by Perkin Elmer) )) To obtain an amplified fragment containing Ppur and its upstream sequence (about 1060 bp).

(Ii) Amplification by PCR of downstream region of Ppur including -10 sequence modification Based on the information of the gene data bank (GenBank Accession No. NC_000964), the primer for 25-mer PCR shown in SEQ ID NO: 26 having the following base sequence A 38-mer primer for modification containing 3 types of modified Ppur sequences was prepared.
GGGTAATAAGCAGCAGCTCACTTCC (SEQ ID NO: 26)
<For Ppur1 modification>
TATCCATGTCCGTTGTtataatAAACATGAAATCAAAA (SEQ ID NO: 27; the lower case base indicates the Ppur1 sequence and is complementary to the primer shown in SEQ ID NO: 23)
<For Ppur3 modification>
TATCCATGTCCGTTGTtatgatAAACATGAAATCAAAA (SEQ ID NO: 28; the lower case base indicates the Ppur3 sequence and is complementary to the primer shown in SEQ ID NO: 24)
<For Ppur5 modification>
TATCCATGTCCGTTGTtaaaatAAACATGAAATCAAAA (SEQ ID NO: 29; the lower case base indicates the Ppur5 sequence and is complementary to the primer shown in SEQ ID NO: 25)
B. PCR (94 ° C, 30 seconds; 55 ° C, 1 minute; 72 ° C, 1 minute; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by Perkin Elmer) )) To obtain an amplified fragment containing the Ppur-10 sequence and its downstream sequence (about 1070 bp).

(Iii) Amplification by PCR of Ppur region containing -10 sequence modification (i) and DNA fragment amplified in (ii) after purification with MicroSpin Column S-400 (Amersham Pharmacia Biotech), mixed with appropriate amount as template And using SEQ ID NOs: 42 and 26, PCR (94 ° C., 30 seconds; 55 ° C., 1 minute; 72 ° C., 2 minutes; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by PerkinElmer)) An amplified fragment of the Ppur region in which the -10 sequence was modified to Ppur1, Ppur3, or Ppur5 was obtained.

(Iv) Agarose gel electrophoresis of DNA fragments of the Ppur region (Ppur1, Ppur3, or Ppur5) containing the -10 sequence modification obtained in the preparation of a strain in which the -10 sequence is modified with Ppur1, Ppur3, or Ppur5 (iii) Thereafter, the target fragment was extracted from the gel. Using the DNA fragment thus purified, a competent cell of KMBS198 prepared by the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209-221) was transformed, Colonies that grew on the medium agar plate were obtained. Chromosomal DNA was prepared from these colonies, and a strain in which the Ppur :: cat region on the chromosome was replaced with Ppur1, Ppur3, or Ppur5 by recombination twice was identified by the PCR method shown in (iii). The recombinant strains thus obtained are non-adenine-requiring strains, and one of these strains is named KMBS210, KMBS211 and KMBS222, respectively.

(3) Production of a purine operon attenuator sequence-deficient strain A strain derived from B. subtilis 168 Marburg strain (ATCC6051) and lacking the attenuator sequence located downstream of Ppur is constructed as follows. I went there. FIG. 1 shows the missing sequence.

(I) Partially deleted attenuator sequence and amplification by PCR in the upstream region Based on the information of the gene data bank (GenBank Accession No. NC_000964), the PCR primer shown in SEQ ID NO: 17 and the following base sequence A 52-mer primer shown in SEQ ID NO: 30 was prepared.
GCTTTTGTTTTCAGAAAATAAAAAATAcgATATATCCATGTCAGTTTTATCG (SEQ ID NO: 30; lower case base is a newly created junction due to partial sequence (75 bp) deletion of attenuator sequence)
B. PCR (94 ° C, 30 seconds; 53 ° C, 1 minute; 72 ° C, 1 minute; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by PerkinElmer) )) To obtain an amplified fragment containing a partially deleted attenuator sequence and its upstream sequence (about 840 bp).

(Ii) Partially deleted attenuator sequence and its amplification by PCR in the downstream region Based on the information of the gene data bank (GenBank Accession No. NC_000964), the PCR primer shown in SEQ ID NO: 26 and the following base sequence A 52-mer primer shown in SEQ ID NO: 31 was prepared.
CGATAAAACTGACATGGATATATcgTATTTTTTATTTTCTGAAAACAAAAGC (SEQ ID NO: 31; lowercase base is a newly created junction due to deletion of a partial sequence (75 bp) of the attenuator sequence, and this primer is complementary to the primer shown in SEQ ID NO: 30)
B. PCR (94 ° C, 30 seconds; 53 ° C, 1 minute; 72 ° C, 1 minute; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by PerkinElmer) )) To obtain an amplified fragment containing a partially deleted attenuator sequence and its downstream sequence (about 850 bp).

(Iii) Amplification of Ppur region containing attenuator sequence partial deletion by PCR method (i) and DNA fragment amplified in (ii) after purification with MicroSpin Column S-400 (Amersham Pharmacia Biotech) and mixing in appropriate amounts PCR (94 ° C, 30 seconds; 53 ° C, 1 minute; 72 ° C, 2 minutes; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by PerkinElmer)) The amplified fragment of the Ppur region containing the attenuator sequence partial deletion was obtained.

(Iv) Preparation of a strain having a partial deletion of the attenuator sequence (iii) The DNA fragment of the Ppur region (Ppur-Datt) containing the partial deletion of the attenuator sequence obtained in (iii) is subjected to agarose gel electrophoresis, and the target fragment is obtained. Extracted from the gel. Using the DNA fragment thus purified, a competent cell of KMBS198 prepared by the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209-221) was transformed, Colonies that grew on the medium agar plate were obtained. Chromosomal DNA was prepared from these colonies, and a strain in which the Ppur :: cat region on the chromosome was replaced with Ppur-Datt by recombination twice was identified by the PCR method shown in (iii). The recombinant strain thus obtained is an adenine non-required strain, and one of these strains was named KMBS252.

(4) Preparation of a strain derived from B. subtilis 168 Marburg strain (ATCC6051), modified so that the -10 sequence of Ppur becomes the consensus sequence TATAAT (Ppur1), and the attenuator sequence is partially deleted Was performed as follows.

(I) Amplification by PCR of upstream region of Ppur containing -10 sequence modification (Ppur1) (3) Using a chromosomal DNA of a strain deficient in the attenuator sequence prepared in (3), for example, chromosomal DNA of KMBS252 as a template PCR (94 ° C., 30 seconds; 55 ° C., 1 minute; 72 ° C., 1 minute; 30 cycles) using the primers shown in SEQ ID NO: 42 and SEQ ID NO: 23, prepared based on the information of Accession No. NC — 000964); Gene Amp PCR System Model 9600 (manufactured by Perkin Elmer)) was performed to obtain an amplified fragment (about 1060 bp) in the upstream region of Ppur containing Ppur1.

(Ii) Ppur1 and a partially deleted attenuator region and its downstream region by amplification by PCR method (3) A strain which is partially deleted, for example, chromosomal DNA of KMBS252 is used as a template, gene data bank ( PCR (94 ° C., 30 seconds) using the primers shown in SEQ ID NO: 26 and SEQ ID NO: 27, prepared based on the information of GenBank Accession No. NC — 000964);
55 ° C, 1 minute; 72 ° C, 1 minute; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by PerkinElmer)), Ppur1 and partially deleted attenuator sequence and its downstream amplified fragment (about 990 bp).

(Iii) Amplification of Ppur region containing partial deletion of Ppur1 and attenuator sequence by PCR (i) and DNA fragment amplified in (ii) after purification with MicroSpin Column S-400 (Amersham Pharmacia Biotech) Using the mixture as a template and using SEQ ID NOS: 42 and 26, PCR (94 ° C., 30 seconds; 55 ° C., 2 minutes; 72 ° C., 2 minutes; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by PerkinElmer) )) To obtain an amplified fragment of the Ppur region containing a partial deletion of Ppur1 and the attenuator sequence.

(Iv) Ppur region (Ppur1-Datt containing Ppur1 and attenuator sequence partially deleted obtained in (iii) Preparation of a strain in which the -10 sequence is modified to become Ppur1 and the attenuator sequence partially deleted ) Was subjected to agarose gel electrophoresis, and the target fragment was extracted from the gel. Using the DNA fragment thus purified, a competent cell of KMBS198 prepared by the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209-221) was transformed,
Colonies that grow on minimal medium agar plates were obtained. Chromosomal DNA was prepared from these colonies, and a strain in which the Ppur :: cat region on the chromosome was replaced with Ppur1-Datt by recombination twice was identified by the PCR method shown in (iii). The recombinant strain thus obtained is an adenine non-requiring strain, and one of these strains was named KMBS261.

(5) Construction of plasmid for measuring purine operon transcription activity Based on the information of the gene data bank (GenBank Accession No. NC — 000964), 29-mer PCR primers each having the following base sequence were prepared.
cgcaagcttTATTTTCTGAAAACAAAAGC (SEQ ID NO: 32; lowercase base is a tag containing HindIII site)
cgcggatccTTTCTCTTCTCTCATCCAGC (SEQ ID NO: 33; lowercase bases are tags containing BamHI sites)
B. PCR (94 ° C, 30 seconds; 55 ° C, 1 minute; 72 ° C, 2 minutes; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by PerkinElmer) )) To obtain an amplified fragment of a part of purE structural gene (445 bp) and an upstream region (40 bp) containing the SD sequence.
PCR amplified fragments were cleaned up with MinElute PCR Purification Kit (QIAGEN) and restricted with HindIII and BamHI. The purified DNA fragment was ligated upstream of lacZ of pMutin4 (Vagner, V., et. Al., Microbiology, 1998, 144, 3097-3104) treated with the same enzyme using T4 DNA ligase, and pKM191 was ligated. Obtained. This pKM191 contains a part of purE structural gene (445 bp) and an upstream region (40 bp) containing its SD sequence.

(6) Preparation of strain for measuring purine operon transcriptional activity A strain for measuring purine operon transcriptional activity was constructed as follows.
(I) Production of strains introduced with Ppur disruption
Chromosomal DNA of KMBS198 (Ppur :: cat) was prepared and used to purR deficient (purR) prepared by the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209-221). :: spc) strain KMBS4 (Japanese Patent Laid-Open No. 2004-242610) was transformed to obtain colonies that grew on LB agar plates containing 2.5 μg / ml chloramphenicol. The recombinant strain thus obtained was purR-deficient and adenine-requiring, and one of these was named KMBS278.

(Ii) Production of a strain having a purR-deficient and modified Ppur region
Chromosomal DNAs of KMBS210, KMBS211, KMBS222, KMBS252 and KMBS261 strains were prepared and used to prepare KMBS278 by the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209-221). Strain competent cells were transformed and grown on minimal medium agar plates and colonies resistant to spectinomycin on LB agar plates were obtained. Chromosomal DNA was prepared from these colonies, and a strain in which Ppur :: cat on the chromosome was replaced with the modified Ppur region by recombination twice was identified by the PCR method shown in (1) (iv). One of these strains was named KMBS283, KMBS284, KMBS285, KMBS286, and KMBS287, respectively.

(Iii) Preparation of a strain into which pKM191 has been introduced A plasmid pKM191 for measuring the purine operon transcription activity was prepared by the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209-221). Competent cells of subtilis 168 Marburg strain, KMBS4, KMBS283, KMBS284, KMBS285, KMBS286, KMBS287 were transformed to obtain colonies that grew on LB agar plates containing 2.5 μg / ml chloramphenicol. The colony obtained in this way is a one-time recombinant strain in which the purE gene containing the lacZ gene of pKM191 is replaced with the wild-type purE gene, and lacZ is expressed by Ppur, and 80 μg / ml of X-Gal is expressed. Blue colonies on LB agar plates containing. One of these strains was named KMBS292, KMBS295, KMBS296, KMBS297, KMBS298, KMBS299, and KMBS300, respectively.

(7) Measurement of Purine Operon Transcriptional Activity Using the strain prepared in (6) (iii), Ppur transcriptional activity was measured with lacZ. That is, the control strain is KMBS292 having a background of 168 Marburg strain or KMBS295 having a background of purine operon repressor PurR gene deletion. Other strains are purR-deficient backgrounds, strains with modified -10 sequences (KMBS296, KMBS297, KMBS298), strains with partially deleted attenuator sequences (KMBS299), consensus sequencing of -10 sequences (Ppur1) This is a strain (KMBS300) in which a partial deletion of the attenuator sequence was introduced at the same time.
These 6 strains are cultured in LB medium (20 ml) containing guanine (20 mg / L) at 37 ° C until the late logarithmic growth phase (OD600 = 1.1-1.4). Activity measurements were performed. b-galacotosidase activity was measured according to the method of Fouet et al. (Fouet, A. and Sonenshein, ALJ Bacteriol., 1990, 172, 835-844). The results are shown in FIG. Compared with the 168M strain, the activity was increased about 4.5 times in the DpurR strain. Furthermore, by modifying the -10 sequence to be Ppur1, it increased about 3-fold. Moreover, due to partial deletion of the attenuator sequence, the activity was about 15-fold, and the strain having both mutations increased to 26.5-fold.

<Construction and evaluation of modified Ppur domain introduction strain>
(1) Derived from B. subtilis 168 Marburg strain (ATCC6051) and lacks purine operon repressor gene (purR), succinyl-AMP synthase gene (purA), and purine nucleoside phosphorylase gene (pupG). Using the recombinant YMBS2 in which the guanine leaky requirement mutation guaB (A1) is introduced into the enzyme gene (guaB), the purine operon promoter is modified and the attenuator sequence is partially deleted as follows. went.
Chromosomal DNA of B. subtilis 168 Marburg strain was prepared and used, and KMBS113 strain (purR: prepared by Dubnau and Davidoff-Abelson method (J. Mol. Biol., 1971, 56, 209-221) was used. : spc purA :: erm DpupG trpC2) was transformed, and colonies that grew on minimal medium agar plates (that is, no adenine required) and were resistant to spectinomycin on LB agar plates were obtained. Chromosomal DNA was prepared from these colonies, and the strain DpupG was identified by the PCR method shown in Example 1 (1) (iv). One of these strains was named KMBS180 (purR :: spc DpupG trpC2).
Next, a chromosomal DNA of KMBS198 strain was prepared, and using this, competent cell of KMBS180 strain prepared by the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209-221). And colonies that grew on LB agar plates containing 2.5 μg / ml chloramphenicol were obtained. Chromosomal DNA was prepared from these colonies, and a strain in which the Ppur region on the chromosome was replaced with Ppur :: cat twice by recombination was identified by the PCR method shown in Example 3 (1) (iv). Such strains are required for adenine, and one of these strains was named KMBS216 (Ppur :: cat purR :: spc DpupG trpC2).
Next, chromosomal DNA of KMBS252 (Ppur-Datt) was prepared, and KMBS216 strain prepared by the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209-221) was used. Were transformed to obtain colonies that grew on the minimal medium agar plate. Chromosomal DNA was prepared from these colonies, and a strain in which Ppur :: cat on the chromosome was replaced with the Ppur-Datt region by recombination twice was identified by the PCR method shown in Example 3 (1) (iv). did. Such a strain is not required for adenine, and one of these strains was named KMBS264 (Ppur-Datt purR :: spc DpupG trpC2). The strain KMBS261 introduced with Ppur1-Datt was also obtained according to the same procedure.
Next, chromosomal DNA of KMBS9 (purA :: erm trpC2; JP-A-2004-242610) was prepared, and using this, the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209). -2
Competent cells of KMBS264 or KMBS261 prepared in 21) were transformed to obtain colonies that grew on LB agar plates containing 0.5 μg / ml erythromycin. Such strains are not required for adenine, and one of these strains is KMBS265 (Ppur-Datt purR :: spc purA :: erm DpupG trpC2) and KMBS267 (Ppur1-Datt purR :: spc purA :: erm DpupG trpC2).
Next, chromosomal DNA of KMBS193 (guaB :: kan) was prepared, and this was used to prepare KMBS265 prepared by the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209-221). Or KMBS267 competent cells were transformed to obtain colonies that grew on LB agar plates containing 2.5 μg / ml kanamycin and 20 μg / ml guanine. Such strains are required for guanine, and one of these strains is KMBS270 (Ppur-Datt purR :: spc purA :: erm guaB :: kan DpupG trpC2) and KMBS271 (Ppur1-Datt purR :: spc purA :: erm guaB :: kan DpupG trpC2).
Finally, chromosomal DNA of YMBS2 (guaB (A1)) was prepared, and this was used to prepare KMBS270 by the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209-221). Strain or KMBS271 competent cells were transformed to obtain colonies that grow on minimal medium agar plates containing 20 μg / ml adenine. Such strains have become guanine leaky requests, and one of these strains is KMBS279 (Ppur-Datt purR :: spc purA :: erm guaB (A1) DpupG trpC2) and KMBS280 (Ppur1-Datt purR :: spc purA :: erm guaB (A1) DpupG trpC2).

(2) Confirmation of purine nucleoside production of a strain having a modified Ppur region A strain (KMBS279 and KMBS280) having a modified Ppur region and a control strain, YMBS2, were added to a PS medium plate (Soluble starch 30 g / L, Yeast extract). 5 g / L, Polypeptone 5 g / L, Agar 20 g / L, adjusted to pH 7.0 with KOH) and evenly spread and cultured at 34 ° C. overnight. Cells of 1/8 plate were inoculated into 20 ml of fermentation medium in a 500 ml Sakaguchi flask, and then calcium carbonate was added to 50 g / L and cultured at 34 ° C. with shaking. Sampling was conducted at 96 hours after the start of culture, and the amounts of inosine and hypoxanthine contained in the culture were measured by a known method.
[Fermentation medium composition]
Glucose 60 g / L
KH ₂ PO ₄ 1 g / L
NH ₄ Cl 32 g / L
Tono (TN) ^* 1.35 g / L
DL-methionine 0.3 g / L
L-tryptophan 0.02 g / L
Adenine 0.1 g / L
Guanine 0.05 g / L
MgSO ₄ 0.4 g / L
FeSO ₄ 0.01 g / L
MnSO ₄ 0.01 g / L
GD113 0.01 ml / L
(Adjusted to pH 7.0 with KOH)
Calcium carbonate 50 g / L
*: Protein hydrolyzate

<Preparation of PRPP synthetase enhanced strain>
(1) Derived from Bacillus subtilis 168 Marburg strain (ATCC6051), lacks purine operon repressor gene (purR), succinyl-AMP synthase gene (purA), purine nucleoside phosphorylase gene (pupG), and IMP Using recombinant KMBS280 in which the guaB mutation (A1) is introduced into the dehydrogenase gene (guaB) and the purine operon promoter region is modified, the production of a strain in which the SD sequence of the PRPP synthetase gene (prs) is modified, It carried out as follows.

B． subtilis 168 Marburg株の染色体DNAを鋳型とし、上記プライマーを用いてPCR（94℃, 30秒; 55℃, 1分; 72℃, 1.5分; 30サイクル; Gene Amp PCR System Model 9600（パーキンエルマー社製））を行い、prs開始コドン上流配列（約1040 bp）と下流配列（10 bp）を含む増幅断片を得た。 (I) Amplification of the SD sequence upstream region including the SD sequence modification by PCR method Based on the information of the gene data bank (GenBank Accession No. NC_000964), the primer for 34-mer PCR shown in SEQ ID NO: 34 having the following base sequence A 46-mer primer for modification containing 3 types of modified Ppur sequences was prepared.

B. PCR (94 ° C, 30 seconds; 55 ° C, 1 minute; 72 ° C, 1.5 minutes; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by PerkinElmer) )) To obtain an amplified fragment containing a prs start codon upstream sequence (about 1040 bp) and a downstream sequence (10 bp).

B． subtilis 168 Marburg株の染色体DNAを鋳型とし、上記プライマーを用いてPCR（94℃, 30秒; 55℃, 1分; 72℃, 1.5分; 30サイクル; Gene Amp PCR System Model 9600（パーキンエルマー社製））を行い、prs開始コドン上流配列（36 bp）と下流配列（約960 bp）を含む増幅断片を得た。 (Ii) Amplification of the downstream region of the SD sequence including the SD sequence modification by PCR method Based on the information of the gene data bank (GenBank Accession No. NC_000964), the primer for 34-mer PCR shown in SEQ ID NO: 38 having the following base sequence A 46-mer modification primer containing three types of modified SD sequences was prepared.

B. PCR (94 ° C, 30 seconds; 55 ° C, 1 minute; 72 ° C, 1.5 minutes; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by PerkinElmer) )) To obtain an amplified fragment containing a prs start codon upstream sequence (36 bp) and a downstream sequence (about 960 bp).

(Iii) Amplification of the region containing the modified SD sequence by PCR (i) and (ii) The DNA fragment amplified by MicroSpin Column S-400 (Amersham Pharmacia Biotech) is purified and mixed in an appropriate amount as a template. PCR was performed using SEQ ID NOs: 34 and 38 (94 ° C., 30 seconds; 55 ° C., 1 minute; 72 ° C., 2.5 minutes; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by PerkinElmer)), and SD An amplified fragment of the DNA whose sequence was modified with the modified SD sequence 1, 2, or 3 (SD1, SD2, SD3) was obtained.

(Iv) Cloning of the region containing the modified SD sequence The DNA fragment of the region containing the modified SD sequence (SD1, SD2, SD3) was cleaned up, the DNA fragment treated with BamHI was treated with the same enzyme, and Calf intestinal Ligation using phosphatase dephosphorylation vector pJPM1 (Mueller et. al., J. Bacteriol., 1992, 174, 4361-4373) and T4 DNA ligase, pKM196 (SD1), pKM197 (SD2 ), PKM198 (SD3) was obtained.

(V) Production of inosine-producing strain into which modified SD sequence is introduced Using the obtained plasmids pKM196 (SD1), pKM197 (SD2), or pKM198 (SD3), the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209-221), transformed competent cells of KMBS280 strain, and obtained colonies that grew on LB agar plates containing 2.5 μg / ml chloramphenicol (once) Recombinant strain).
The obtained single recombinant strain was inoculated into 10 ml of LB medium, subcultured at 37 ° C. for several days, and colonies that became chloramphenicol sensitive on LB agar medium were screened. Chromosomal DNA was prepared from the obtained chloramphenicol sensitive colonies, PCR was performed in the same manner as described above using the primers of SEQ ID NOs: 34 and 38, and the DNA sequence was analyzed, whereby the SD of the prs gene on the chromosome was analyzed. A strain was identified in which the sequence was replaced twice by recombination with the modified SD sequence. One of the two recombinant strains thus obtained was named KMBS310 (SD1), KMBS318 (SD2), and KMBS322 (SD3).

(2) Purine nucleoside production of inosine producing strain introduced with modified SD sequence Inosine producing strain (KMBS310 strain, KMBS318 strain and KMBS322 strain) introduced with modified SD sequence SD1, SD2 or SD3 and control strain KMBS280, Spread evenly on PS medium plate (Soluble starch 30 g / L, Yeast extract 5 g / L, Polypeptone 5 g / L, Agar 20 g / L, adjusted to pH 7.0 with KOH) and incubate overnight at 34 ° C . Cells of 1/8 plate were inoculated into 20 ml of fermentation medium in a 500 ml Sakaguchi flask, and then calcium carbonate was added to 50 g / L and cultured at 34 ° C. with shaking. Sampling was performed 120 hours after the start of the culture, and the amounts of inosine and hypoxanthine contained in the culture were measured by a known method.
[Fermentation medium composition]
Glucose 60 g / L
KH ₂ PO ₄ 1 g / L
NH ₄ Cl 32 g / L
Tono (TN) ^* 1.35 g / L
DL-methionine 0.3 g / L
L-tryptophan 0.02 g / L
Adenine 0.1 g / L
Guanosine 0.075 g / L
MgSO ₄ 0.4 g / L
FeSO ₄ 0.01 g / L
MnSO ₄ 0.01 g / L
GD113 0.01 ml / L
(Adjusted to pH 7.0 with KOH)
Calcium carbonate 50 g / L
*: Protein hydrolyzate

Construction of a strain with increased enzyme activity of the oxidative pentose-phosphate pathway (1) Construction of a glucose-6-phosphate-dehydrogenase activity amplification strain Derived from Bacillus subtilis 168 Marburg strain (ATCC6051) An operon repressor gene (purR), a succinyl-AMP synthase gene (purA), a purine nucleoside phosphorylase gene (pupG and deoD) are deleted, and a guaB mutation (A1) is introduced into the IMP dehydrogenase gene (guaB), and Using a recombinant in which the purine operon promoter region and the SD sequence of the PRPP synthetase gene (prs) are modified, a plasmid carrying a gene zwf encoding glucose-6-phosphate dehydrogenase of the oxidative pentose-phosphate pathway The introduced strain was produced as follows.

(I) Amplification by PCR of zwf structural gene and its upstream region Based on the information of Gene Data Bank (GenBank Accession No. NC_000964 CAB14317. Glucose-6-phospha ... [gi: 2634820]), it has the following base sequence A 29-mer PCR primer was prepared.
cgcggatccGCCTCTGAAAAGAACAATCC (SEQ ID NO: 43; lowercase bases are tags containing BamHI sites)
cgcggatccAAGCTCTTAAGCTTTGGGGG (SEQ ID NO: 44; lowercase base is tag containing BamHI site)
B. PCR (94 ° C, 30 seconds; 55 ° C, 1 minute; 72 ° C, 2 minutes; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by PerkinElmer) )) To obtain an amplified fragment containing the zwf structural gene and its upstream region (about 160 bp).

(Ii) Cloning of zwf structural gene and its upstream region
E. coli-Bacillus shuttle vector pHY300PLK (manufactured by Yakult) ) And T4 DNA ligase to obtain a zwf gene amplification plasmid.

(Iii) Preparation of inosine-producing strain introduced with plasmid for amplifying zwf gene Using the obtained plasmid or control pHY300PLK vector, the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209 -221), the competent cell of KMBS321 strain was transformed to obtain colonies that grew on LB agar plates containing 12.5 μg / ml tetracycline. One of the strains in which the plasmid carrying zwf was introduced was named TABS125, and one of the strains in which pHY300PLK was introduced was named TABS100.
The KMBS321 strain was produced as follows.
Using genomic DNA prepared by the method of Fouet and Sonenshein (J. Bacteriol., 1990, 172, 835-844) from KMBS16 (purR :: spc purA :: erm deoD :: kan; US2004-0166575A) A competent cell of the subtilis 168 Marburg strain was transformed to obtain colonies that grew on LB agar plates containing 5 μg / ml kanamycin. Among several colonies thus obtained, a colony that was not resistant to spectinomycin or erythromycin was selected, and one of them was named KMBS5 (deoD :: kan).
Using KMBS5 (deoD :: kan), the competent cell of the above KMBS310 strain was transformed with genomic DNA prepared by the method of Fouet and Sonenshein (J. Bacteriol., 1990, 172, 835-844). Colonies that grew on LB agar plates containing / ml kanamycin and 20 μg / ml guanine were obtained. Several colonies obtained in this way were selected and it was confirmed that the wild type deoD gene was replaced with deoD :: kan and that all mutations derived from KMBS310 were not replaced with the wild type sequence. One of the transformants was named KMBS321.

It was confirmed by the following method that glucose-6-phosphate dehydrogenase was elevated.

glucose-6-phosphate 1-dehydrogenase (zwf gene product) activity measurement method Reaction solution
50 mM Tris-HCl (pH7.6)
10 mM MgSO ₄・ 7H ₂ O
0.3 mM NADP
4 mM Glucose 6-phosphate
Enzyme solution

The above reaction solution (1 ml) was prepared, and the reaction was started at 37 ° C. Absorption at 340 nm was measured for the concentration change of the produced NADPH.

(Iv) Purine nucleic acid production of inosine-producing strain introduced with a plasmid carrying zwf
TABS100 or TABS125 in PS medium plate containing 12.5 μg / ml tetracycline (Soluble starch 30 g / L, Yeast extract 5 g / L, Polypeptone 5 g / L, Agar 20 g / L, pH in KOH)
(Adjusted to 7.0) It was applied evenly and cultured at 34 ° C overnight. Inoculate 20 ml of fermentation medium in a 500 ml Sakaguchi flask with 1/8 plate of cells, and then add calcium carbonate to 50 g / L and culture at 34 ° C with shaking. Sampling was performed 120 hours after the start of the culture, and the amounts of inosine and hypoxanthine contained in the culture were measured by a known method (Table 5). By such a method, a strain having an improved purine nucleoside production ability could be obtained.
[Fermentation medium composition example]
Glucose 60 g / L
KH ₂ PO ₄ 1 g / L
NH ₄ Cl 32 g / L
Tono (TN) ^* 1.35 g / L
Yeast Extract 1 g / L
DL-methionine 0.3 g / L
L-tryptophan 0.02 g / L
Adenine 0.1 g / L
Guanosine 0.075 g / L
MgSO ₄ 0.4 g / L
FeSO ₄ 0.01 g / L
MnSO ₄ 0.01 g / L
GD113 0.01 ml / L
(Adjusted to pH 7.0 with KOH)
Calcium carbonate 50 g / L
*: Protein hydrolyzate

(2) Construction of a ribose-5-phosphate isomerase activity-enhancing strain Derived from Bacillus subtilis 168 Marburg strain (ATCC6051), purine operon repressor gene (purR), succinyl-AMP synthase gene (purA), purine A nucleoside phosphorylase gene (pupG and deoD) deleted, a guaB mutation (A1) introduced into the IMP dehydrogenase gene (guaB), and the SD sequence of the purine operon promoter region and PRPP synthetase gene (prs) modified Using the recombinant, a strain into which a plasmid carrying the oxidative pentose-phosphate pathway gene ywlF was introduced was prepared as follows.

(I) Amplification by PCR of the ywlF structural gene and its upstream region Based on the information of the gene data bank (GenBank Accession No. NC_000964 CAB15709. [Gi: 2636217]), each 34-mer PCR primer having the following base sequence Was made.
cgcgaattcGTAGATAAGTTGTCAGAAAATCTGC (SEQ ID NO: 45; lowercase bases are tags containing EcoRI sites)
cgcgaattcTGTTTCAACTCATTCATTAAACAGC (SEQ ID NO: 46; lowercase base is a tag containing EcoRI site)
B. PCR (94 ° C, 30 seconds; 55 ° C, 1 minute; 72 ° C, 1 minute; 30 cycles; Gene Amp PCR System Model 9600 (manufactured by Perkin Elmer) )) To obtain an amplified fragment containing the ywlF structural gene and its upstream region (about 160 bp).

(Ii) Cloning of the ywlF structural gene and its upstream region
The ywlF structural gene and its upstream DNA fragment were cleaned up, the EcoRI-treated DNA fragment was treated with the same enzyme, and dephosphorylated with Calf intestinal phosphatase, the E. coli-Bacillus shuttle vector pHY300PLK (manufactured by Yakult ) And T4 DNA ligase to obtain a ywlF gene amplification plasmid.

(Iii) Preparation of inosine-producing strain introduced with plasmid for amplifying ywlF gene Using the obtained plasmid or the control pHY300PLK vector, the method of Dubnau and Davidoff-Abelson (J. Mol. Biol., 1971, 56, 209 -221), the competent cell of the above KMBS321 strain was transformed to obtain colonies that grew on LB agar plates containing 12.5 μg / ml tetracycline. One of the strains into which the plasmid carrying ywlF was introduced was named TABS102.
It was confirmed by the following method that ribose-5-phosphate isomerase activity was increased.

Ribose 5-phosphate isomerase (ywlF gene product) activity measurement method Reaction solution
50 mM HEPES (pH 7.5)
0.1 M NaCl
10 mM Ribose 5-phosphate
Enzyme solution

The above reaction solution (1 ml) was prepared, and the reaction was started at 37 ° C. Absorption at 290 nm was measured for the concentration change of Ribulose 5-phosphate produced.

(Iv) Purine nucleic acid production of inosine-producing strain introduced with a plasmid carrying ywlF
TABS100 or TABS102 with PS medium plate containing 12.5 μg / ml tetracycline (Soluble starch 30 g / L, Yeast extract 5 g / L, Polypeptone 5 g / L, Agar 20 g / L, pH in KOH)
(Adjusted to 7.0) It was applied evenly and cultured at 34 ° C overnight. Cells of 1/8 plate were inoculated into 20 ml of fermentation medium in a 500 ml Sakaguchi flask, and then calcium carbonate was added to 50 g / L and cultured at 34 ° C. with shaking. Sampling was performed 120 hours after the start of the culture, and the amounts of inosine and hypoxanthine contained in the culture were measured by a known method (Table 6). The ribose-5-phosphate isomerase activity-enhanced strain improved inosine production ability compared to the unmodified strain.
[Fermentation medium composition example]
Glucose 60 g / L
KH ₂ PO ₄ 1 g / L
NH ₄ Cl 32 g / L
Tono (TN) ^* 1.35 g / L
Yeast Extract 1 g / L
DL-methionine 0.3 g / L
L-tryptophan 0.02 g / L
Adenine 0.1 g / L
Guanosine 0.075 g / L
MgSO ₄ 0.4 g / L
FeSO ₄ 0.01 g / L
MnSO ₄ 0.01 g / L
GD113 0.01 ml / L
(Adjusted to pH 7.0 with KOH)
Calcium carbonate 50 g / L
*: Protein hydrolyzate

  By using the Bacillus bacterium of the present invention, the production efficiency of purine nucleosides and / or purine nucleotides can be improved.

The figure which shows the structure of the upstream area | region of a purine operon. The sequence enclosed by the box is the purin operon promoter, the sequence shown by the upper solid line is antiterminator dyad (anti-terminator pair), and the sequence shown by the lower broken line is terminator dyad (terminator pair). The deleted sequence (75 bp) is shown in capital letters. The figure which shows the transcriptional activity of each modified purine operon promoter. WT shows the activity of KMBS296 strain, ΔRpurR shows the activity of KMBS295 strain, ΔR + Ppur1 shows the activity of KMBS296 strain, ΔR + Ppur3 shows the activity of KMBS297 strain, ΔR + Ppur5 shows the activity of KMBS298 strain ΔR + Ppur-Δatt indicates the activity of KMBS299 strain, and ΔR + Ppur1-Δatt indicates the activity of KMBS300 strain.

Claims (9)

Inosine or guanosine characterized by culturing Bacillus bacteria selected from Bacillus subtilis, Bacillus pumilus and Bacillus amyloliquefaciens in a medium to accumulate inosine or guanosine and recovering inosine or guanosine from the medium The manufacturing method of
When the Bacillus bacterium is cultured in a medium, the bacterium belonging to the genus Bacillus has the ability to secrete and accumulate inosine or guanosine in the medium to the extent that it can be recovered from the medium, and glucose-6-phosphate-dehydrogenation Increasing the activity of glucose-6-phosphate dehydrogenase or ribose 5-phosphate isomerase by increasing the copy number of the gene encoding the enzyme or ribose 5-phosphate isomerase or replacing the promoter of the gene Thus, the method is characterized in that the bacterium belonging to the genus Bacillus has an improved ability to secrete and accumulate inosine or guanosine in the medium to such an extent that the inosine or guanosine can be recovered from the medium . The method according to claim 1, wherein the gene encoding glucose-6-phosphate dehydrogenase is a gene encoding a protein shown in (A) or (B) below.
(A) Protein having the amino acid sequence set forth in SEQ ID NO: 48 (B) In the amino acid sequence set forth in SEQ ID NO: 48, including substitution, deletion, insertion, addition, or inversion of 1 to 20 amino acid residues A protein having an amino acid sequence and having glucose-6-phosphate dehydrogenase activity. The method according to claim 1, wherein the gene encoding ribose 5-phosphate isomerase is a gene encoding a protein shown in (E) or (F) below.
(E) a protein having the amino acid sequence set forth in SEQ ID NO: 50 (F) including the substitution, deletion, insertion, addition, or inversion of 1 to 20 amino acid residues in the amino acid sequence set forth in SEQ ID NO: 50 A protein having an amino acid sequence and having ribose 5-phosphate isomerase activity. The method according to claim 1, wherein the gene encoding glucose-6-phosphate dehydrogenase is DNA shown in the following (a) or (b).
(A) DNA comprising the base sequence set forth in SEQ ID NO: 47.
(B) a complementary sequence of the nucleotide sequence set forth in SEQ ID NO: 47 and 60 ° C., 0.1 × SSC, 0.1% S
DNA that hybridizes under conditions corresponding to DS and that encodes a protein having glucose-6-phosphate-dehydrogenase activity. The method according to claim 1, wherein the gene encoding ribose 5-phosphate isomerase is the DNA shown in (e) or (f) below.
(E) DNA comprising the base sequence set forth in SEQ ID NO: 49.
(F) DNA that hybridizes with a complementary sequence of the nucleotide sequence set forth in SEQ ID NO: 49 under conditions of salt concentration corresponding to 60 ° C., 0.1 × SSC, 0.1% SDS, and ribose 5 -DNA encoding a protein having phosphate isomerase activity. The bacterium belonging to the genus Bacillus is further modified so that phosphoribosyl pyrophosphate synthetase activity is increased by increasing the copy number of a gene encoding phosphoribosyl pyrophosphate synthetase or by replacing the promoter of the gene. The method according to any one of claims 1 to 5. In the bacterium belonging to the genus Bacillus, the expression level of the purine operon is further reduced when the purR gene, which is a gene encoding the repressor of the purine operon, is disrupted or part of the attenuator region of the purine operon is removed. The method according to claim 1, wherein the method is modified so as to increase. The bacterium belonging to the genus Bacillus is further modified so that purine nucleoside phosphorylase activity is decreased by disrupting a deoD gene and / or a pupG gene encoding purine nucleoside phosphorylase. Or 1
The method according to item. An inosine or guanosine is produced by the method according to any one of claims 1 to 8, wherein the inosine or guanosine comprises a phosphate donor selected from the group consisting of polyphosphoric acid, phenylphosphoric acid and carbamylphosphoric acid, and a nucleoside- Production of inosinic acid or guanylic acid characterized by producing inosinic acid or guanylic acid by acting a microorganism having the ability to produce 5'-phosphate ester or acid phosphatase to produce inosinic acid or guanylic acid Law.

Images