JP5494916B2 - Tumor-specific promoters and their uses - Google Patents

Description

  The present invention relates to a tumor-specific promoter that enables the expression of foreign genes in tumor cells or tumor tissues in a tumor-specific manner. More specifically, the present invention relates to a brain tumor-specific promoter that exhibits a specifically high promoter activity in brain tumor cells or brain tumor tissue and can be widely used for cancer gene therapy by tumor-specific gene expression.

  The present invention also relates to a viral vector comprising the promoter in an operably linked state with a foreign gene base sequence (heterologous sequence). Furthermore, the present invention relates to a gene therapy technique (pharmaceutical composition, therapeutic method) and a gene diagnostic technique (diagnostic composition, diagnostic method) using the viral vector.

  In recent years, gene therapy that treats cancer by introducing foreign genes into cells has been attracting attention. Examples of gene therapy for cancer include, for example, (1) gene therapy targeting oncogene / tumor suppressor gene that suppresses oncogene function or activates inactivated tumor suppressor gene, (2) Suicide that kills only the cells into which the drug metabolizing enzyme gene has been introduced by introducing into the cancer cell a drug metabolizing enzyme gene that does not originally exist in human cells, and then administering a prodrug for cancer treatment activated by that enzyme Gene therapy, (3) Immune gene therapy that introduces cytokine genes into cells and enhances the immune function inherent in humans to treat cancer, and (4) Adenovirus early gene, essential for adenovirus growth An oncolytic virus that specifically propagates in tumor cells by inserting a tumor-specific promoter upstream of E1A or E1B To, and the like gene therapy to kill tumor cells specifically by this virus.

  In such gene therapy, the specific expression of the target gene in tumor cells or tumor tissues is important from the viewpoint of efficiency and safety of gene therapy. This is one of the challenges. An important key enabling such tumor-specific gene expression is the development of a promoter that specifically controls the expression of the transgene.

  Known tumor-specific promoters include α-fetoprotein promoter, carcinoembryonic antigen (CEA) promoter, prostate-specific antigen promoter, and the like. Moreover, as a tumor specific promoter used for suicide gene therapy, human telomerase catalytic subunit promoter (Patent Document 1, Non-Patent Documents 1 and 2), gastrin releasing peptide (GRP) promoter (Patent Document 2, Non-Patent Documents) 3-4), type II hexokinase promoter (Patent Document 3, Non-Patent Document 5) and the like are known.

  By the way, malignant glioma is an intractable brain tumor that has not achieved significant improvement in treatment results even with the development of energetic new therapies over several decades. Development is desired. In the United States, gene therapy for this disease was started by transplanting cells that produce a viral vector encoding a suicide gene into the brain of a patient. However, due to the low efficiency of gene transfer, a sufficient therapeutic effect was obtained. (Non-patent document 6).

  Therefore, the development of tumor-specific promoters that are tumor-specific and have high promoter activity and can be used effectively for gene therapy, particularly the development of tumor-specific promoters that can be used effectively for the treatment of brain tumors such as malignant glioma Is desired.

U.S. Patent No. 6,777,203 U.S. Patent No. 7,329,649 International Publication No. 1997/004104

Jiam Gu, et al., Cancer Research 60, 5359-5364, October 1, 2000 Tadashi Komata et al., Cancer Research 61, 5796-5802, August 1, 2001 Inase N, et al., International Journal of Cancer 85, 716-719. March 1, 2000. Morimoto E, et al., Anticancer Research 21,329-331, Jan-Feb, 2001. Mathupala SP et al., Journal of Biological Chemistry 270, 16918-16925, July 14, 1995. Rainov NG.Human Gene Therapy 11, 2389-2401, Nov 20, 2000.

  An object of the present invention is mainly to provide a tumor-specific promoter that can be used effectively in suicide gene therapy targeting a malignant tumor using a retroviral vector. In particular, an object of the present invention is to provide a promoter that is specific to a brain tumor and exhibits high activity.

  Another object of the present invention is to provide a brain tumor-specific viral vector into which a suicide gene that is effectively used for gene therapy of brain tumor is introduced, and gene therapy technology (pharmaceutical composition, treatment method) using the same. .

  Furthermore, an object of the present invention is to provide a brain tumor-specific reporter vector that is effectively used for the diagnosis of a brain tumor, and a genetic diagnosis technique (diagnostic composition, diagnostic method) using the same.

  The present inventors have made extensive studies to achieve the above object, and as a gene specifically expressed in brain tumor cells from the cancer testis antigen gene group, Homo sapiens synovial sarcoma, X breakpoint 4 (SSX4) A gene (hereinafter referred to as “SSX4 gene”) was found, and it was confirmed that the SSX4 gene was not expressed in normal astrocytes but specifically expressed in tumor cells. Furthermore, the present inventors have identified a minimal sequence (SEQ ID NO: 1) having promoter activity for the SSX4 gene, and the SSX4 promoter having the minimal sequence has extremely low activity in normal astrocytes, and tumor cells. It was confirmed that the activity was specifically shown in FIG. Thus, when a vector that controls the expression of a suicide gene by this promoter was introduced into tumor cells and immortalized human fibroblasts, it was observed that cell death was specifically induced only against tumor cells. In addition, when cells treated with this vector were inoculated subcutaneously in mice, it was confirmed that the formation of tumors was specifically suppressed by the activity of the hSSX4 promoter. From these results, the SSX4 promoter having the base sequence shown in SEQ ID NO: 1 as the minimum sequence is a brain tumor-specific promoter that specifically exhibits promoter activity in tumor cells, particularly brain tumor cells, as shown in FIG. In particular, I was convinced that it was extremely useful in gene therapy for brain tumors.

The present invention has been completed based on such findings, and has the following specific embodiments.
(I) Tumor-specific promoter (I-1) having a base sequence that hybridizes under stringent conditions to the base sequence shown in SEQ ID NO: 1 or a base sequence complementary to the sequence, and a tumor-specific promoter activity A tumor-specific promoter consisting of a polynucleotide having
(I-2) A polynucleotide having the base sequence shown in SEQ ID NO: 1 and having tumor-specific promoter activity is 2832 to 2864 from any one of bases 1 to 2578 in the base sequence shown in SEQ ID NO: 2. The tumor-specific promoter according to (I-1), which is a 255 bp to 2864 bp polynucleotide comprising a nucleotide sequence of a region consisting of any of the first bases.
(I-3) The tumor-specific promoter described in (I-1) or (I-2), which is a promoter specific to a brain tumor.

(II) A viral vector comprising the tumor-specific promoter of any one of (II-1) (I-1) to (I-3) in an operably linked state with a base sequence of a foreign structural gene.
(II-2) The viral vector according to (II-1), wherein the foreign structural gene is a gene encoding a protein that is toxic to cells.
(II-3) The viral vector according to (II-1), wherein the foreign structural gene is a gene that makes a drug sensitive to cells.
(II-4) The foreign structural gene is a herpes simplex virus thymidine kinase gene, cytosine deaminase gene, varicella-zoster virus thymidine kinase gene, E. coli. E. coli gpt gene, cytochrome P450 2B1 gene, human deoxycytidine kinase gene, E. coli. E. coli UPRT gene, E. coli. The virus vector according to (II-3), which is at least one selected from the group consisting of an E. coli deoD gene and a bacterial nitroreductase gene.
(II-5) The above drugs are gancyclovir, acyclovir, 5-fluorocytosine, 6-methoxypriarabinoside, 6-thioxanthine, cyclophosphamide, cytosine arabinoside, 5-fluorouracil, 6-methylpurine-2 The viral vector according to (II-3), which is at least one selected from the group consisting of '-deoxyribonucleoside and CB1954 (5- (aziridin-1-yl) -2,4-dinitrobenzamide).
(II-6) The viral vector according to (II-3), wherein the drug is ganciclovir or acyclovir and the gene is thymidine kinase.
(II-7) The viral vector according to (II-1), wherein the foreign structural gene is a reporter gene.
(II-8) The viral vector according to (II-6), wherein the foreign structural gene is a gene encoding a fluorescent protein, a phosphorescent protein, a chemiluminescent protein, or a protein having an enzyme activity.

(III) Use of a viral vector (II-1) A pharmaceutical composition (tumor therapeutic agent) for killing tumor cells, comprising the viral vector according to any one of (II-1) to (II-6).
(II-2) The pharmaceutical composition (brain tumor therapeutic agent) described in (II-1), wherein the tumor cells are brain tumors.
(II-3) A composition for detecting a brain tumor, comprising the viral vector according to (II-7) or (II-8).

  The tumor-specific promoter of the present invention exerts promoter activity specifically on tumor cells and tumor tissues, particularly brain tumor cells and brain tumor tissues. Therefore, by using the tumor-specific promoter of the present invention, such as the virus vector of the present invention described in (II-1) to (II-5) above, it is extremely safe against tumors, particularly brain tumors. And effective gene therapy becomes possible. Further, by using the tumor-specific promoter of the present invention, such as the reporter vector of the present invention described in (II-6) or (II-7) above, a tumor, particularly a brain tumor, can be specifically detected. This makes it possible to diagnose brain tumors with high accuracy.

It is a figure which shows typically that the SSX4 promoter of this invention does not exhibit promoter activity in a normal cell, but exhibits promoter activity specifically in a tumor cell, especially a brain tumor cell. This shows the base sequence of the region from upstream -255 to downstream +32 from the transcription start position (+1) of the base sequence of the human SSX4 gene (SEQ ID NO: 3). Testis, normal human astrocytes, anaplastic astrocytoma cells ONS-75, glioblastoma cells (UW18, SNB19, U87MG, T98G, U373, ONS-12, ONS-23, ONS-65, KN-1) The result of having measured the expression of hSSX4 gene in medulloblastoma cells (UW228, ONS-76) by RT-PCR is shown (Experimental example 1). FIG. 3A shows the expression band of the hSSX4 gene and β-actin (ACTB) gene used as a standard marker. FIG. 3B shows the expression level of the hSSX4 gene as a relative ratio (SSX4 / ACTB) to the expression level of the ACTB gene. In Experimental Example 2, plasmids 1-9 for detecting promoter activity into which various constructs (deletion mutant promoters) were inserted were used as normal astrocytes (NHA), immortalized human fibroblasts into which telomerase catalytic subunit was introduced BJ- 5ta and glioma cell lines (U87-MG, SNB19, and T98G) were transfected, and the promoter activity was determined. The results are shown in a relative ratio with respect to the promoter activity of the pGL3 Control Vector used as a control. In addition, a result shows the average value which measured the promoter activity 3 times. The conceptual diagram of the various retrovirus vectors (pCMV-HSVtk, pRΔ-HSVtk, pSSX255-HSVtk, pSSX485-HSVtk) prepared in Experimental Example 3 is shown. The retroviral vectors (pCMV-HSVtk, pRΔ-HSVtk, pRSSX255-HSVtk, pRSSX485-HSVtk) prepared in Experimental Example 3 were transformed into tumor cells (glioblastoma cell line U87MG (-■-), mouse glioblastoma cell line) RSV-M (-◆-)) or normal cells (human fibroblasts BJ-5ta (-▲-)), and each cell thus obtained is supplied with each concentration of ganciclovir (GCV) as a prodrug. The result of measuring the cell viability (vertical axis) 5 days after addition (horizontal axis) using the MTT assay is shown. In the figure, FIG. A (Wild Type) is the result of measuring the viability of cells after 5 days after adding various concentrations of ganciclovir in the same manner as described above for various cells into which no retroviral vector was introduced. . In Experimental example 4, the result of having examined the tumorigenic effect when the mouse | mouth glioblastoma cell strain | stump | stock RSV-M which introduce | transduced various vectors was inoculated subcutaneously of the syngeneic mouse C3H / HeN is shown. Cells in which a vector containing the SSX4 promoter (pRSSX255-HSVtk, pRSSX485-HSVtk) as a retrovirus vector has not been introduced are shown as-♦-Wild Type,-■ -CMV,-▲ -Δ in the figure. In addition, cells in which a vector containing the SSX4 promoter has been introduced but GCV is not administered are indicated as-● -pSSX4-255 w / o GCV and-□ -pSSX4-485 w / o GCV.

1. Definition of terms used in the present invention Indications by abbreviations such as nucleotide sequences (nucleotide sequences) and nucleic acids in the present specification are defined by IUPAC-IUB [IUPAc-IUB communication on Biological Nomenclature, Eur. J. Biochem., 138; 9 (1984)], “Guidelines for the preparation of specifications including base sequences or amino acid sequences” (edited by the Patent Office) and conventional symbols in the field.

  In the present specification, the “SSX4 gene” means a synovial sarcoma, X breakpoint 4 (SSX4) gene. Among the SSX4 genes, the human (Homo sapiens) -derived SSX4 gene (hSSX4 gene) is located in the region from positions 48127912 to 48137729 of human X chromosome Xp11.23 (Genbank Accession No. NC_000023.9) It is a 9818 bp gene (Genbank Accession No. NG_005575). It is known that there are two transcription variants (Genbank Accession No. NM_005636 (transcript variant 1) and NM_175729 (transcript variant 2) in the mRNA that is the transcript. Transcription variant 1 (transcript variant 1) Are six exon regions of the hSSX4 gene (1..38, 508..596, 1036..1150, 1827..1922, 3786..3835, 5821..5956, 8344..8448, 9231..9818) The transcript variant 2 is composed of 5 exon regions (1..38, 508..596, 1036..1150, 1827..1922, 3786) of the hSSX4 gene. .. 3835, 8344 .. 8448, 9231..9818).

  The SSX4 gene includes not only the above human-derived SSX4 gene (hSSX4 gene) but also human-derived proteins (hSSX4) and biologicals such as orthologous genes conserved among species such as humans, mice, and rats. “Gene” encoding proteins with equivalent functions (eg, homologs (such as homologs and splice variants), mutants and derivatives). For example, as a gene encoding a homologue of human-derived hSSX4, genes of other species such as mice and rats corresponding to the hSSX4 gene encoding hSSX4 can be exemplified. These genes (homologs) can be identified by HomoloGene (http://www.ncbi.nlm.nih.gov/HomoloGene/). Specifically, the specific human gene name (hSSX4 gene) and the accession number (GenBank Accession No. NG_005575) of the base sequence are searched for LocusLink (http://www.ncbi.nlm.nih.gov/LocusLink/). Find the relevant human genetic data. From the list showing the homologues of the homologues of other species and human genes displayed by accessing HomoloGene in the link menu of the data, the genes of other species such as rats corresponding to the hSSX4 gene (homologues) ) Can be selected. Moreover, it is known that the human SSX4B gene (GenBank Accession No. NG_005575.1) paralog exists in the region from 48101375 to 48192195 of the human X chromosome Xp11.23 (Genbank Accession No. NC_000023.9). . The paralog is also included in the SSX4 gene in the present invention as long as the biological function is equivalent to that of the human SSX4B gene.

  In this specification, “gene” refers to a regulatory region, a coding region, an exon, and an intron without distinction unless otherwise specified. Specifically, when the term “SSX4 gene” is used herein, the term includes not only the above-described hSSX4 gene (Genbank Accession No. NG_005575) and its homologs, but also their transcripts, unless otherwise specified. Some mRNAs and cDNAs are included. In addition, when specifically referring to the mRNA which is the transcription product as distinguished from the SSX4 gene, it is referred to as “SSX4 mRNA”.

  In the present specification, unless otherwise specified, “DNA” refers to double-stranded DNA including human genomic DNA, single-stranded DNA (sense strand) including cDNA and synthetic DNA, and a sequence complementary to the sense strand. These include both single-stranded DNA (antisense strand) and fragments thereof.

  In this specification, “RNA” includes not only single-stranded RNA but also single-stranded RNA having a sequence complementary thereto, and further double-stranded RNA composed thereof, unless otherwise specified. Used for purposes. The RNA includes synthetic RNA such as total RNA, mRNA, rRNA, and siRNA.

  Further, in this specification, “nucleotide”, “oligonucleotide” and “polynucleotide” are synonymous with nucleic acid and include both DNA and RNA. These may be double-stranded or single-stranded, and in the case of “nucleotide” having a certain sequence (or “oligonucleotide”, “polynucleotide”), it is complementary to this unless otherwise specified. “Nucleotide” (or “oligonucleotide” and “polynucleotide”) having a typical sequence is also intended to be inclusive. Furthermore, when the “nucleotide” (or “oligonucleotide” and “polynucleotide”) is RNA, the base symbol “T” shown in the sequence listing shall be read as “U”.

  In the present specification, the “tumor” is not particularly limited, but is preferably a brain tumor. Brain tumor is a general term for primary and metastatic neoplasms that develop in the cranium, and includes both malignant and benign tumors. A malignant brain tumor is preferred. Brain tumors include gliomas such as astromas, oligodendroma, ependymomas, glioblastomas and anaplastic astrocytomas, metastatic brain tumors, medulloblastomas, malignant lymphomas, germ cells Tumors, meningiomas, pituitary tumors, and schwannomas are included. Brain tumors that are preferably targeted in the present invention are malignant gliomas (glioblastoma and anaplastic astrocytoma) that have a high incidence and are considered difficult to treat.

2. Tumor-specific promoter The tumor-specific promoter of the present invention is characterized by comprising a polynucleotide having the base sequence shown in SEQ ID NO: 1 in the sequence listing as its minimum sequence. The polynucleotide is not particularly limited as long as it exhibits promoter activity specifically as a SSX4 promoter in a tumor-specific, preferably brain tumor-specific manner. Specifically, for example, in the base sequence shown in SEQ ID NO: 2, 1 to 2578 A polynucleotide having a length of a minimum of 255 bp to a maximum of 2864 bp consisting of a base sequence in a region consisting of any of the 2832 to 2864th bases from any of the first bases is included.

  Here, the base sequence shown in SEQ ID NO: 1 is the first from the 255th (−255) upstream of the transcription start point when the transcription start point of the SSX4 gene (the first base sequence of exon 1) is +1. -1) corresponds to the 255 bp nucleotide sequence. The base sequence shown in SEQ ID NO: 2 is 32 bp downstream (+32 bp) from 2832 bp upstream (−2832) to the transcription start point when the transcription start point of SSX4 gene (the first base sequence of exon 1) is +1. It corresponds to the base sequence of a total region of 2864 bp. In addition, in FIG. 2, when the transcription start point of SSX4 gene (the first base sequence of exon 1) is +1, from the 255th upstream (-255) to the 32nd downstream (+32) of the transcription start point. The base sequence of the region (SEQ ID NO: 3) is shown.

  In addition, the tumor-specific promoter of the present invention hybridizes under stringent conditions to a base sequence complementary to the base sequence shown in SEQ ID NO: 1 and is tumor-specific like the base sequence shown in SEQ ID NO: 1. Those having various promoter activities. Furthermore, in the tumor-specific promoter of the present invention, in the base sequence shown in SEQ ID NO: 2, a base sequence complementary to a base sequence in a region consisting of at least the 2578th base to the 2832st base, for example, “any of 1 to 2578th To the base sequence complementary to the base sequence of any of the 2832 to 2864th bases from these bases "and is tumor-specific in the same manner as the base sequence shown in SEQ ID NO: 1 Those having a typical promoter activity are also included.

  The base sequence that hybridizes with stringent here is, for example, a reaction at 65 ° C. for 12 hours in a solution containing 6 × SSPE, 2 × Denhardt's solution, 0.5% SDS, 0.1 mg / ml salmon testis DNA. This is a base sequence that hybridizes with DNA having any of the above base sequences by performing Southern hybridization under the conditions of

  The tumor-specific promoter has a promoter function similar to that of the hybridized target base sequence, that is, a promoter activity comparable to tumor specificity, particularly brain tumor specificity. Examples of such a base sequence include those having, for example, 85% or more, preferably 90% or more, more preferably 95% identity with the target base sequence. The identity of the base sequence is typically calculated by determining the optimal alignment between the two sequences and comparing the two sequences. Optimal alignment of the sequences was determined by the homology alignment algorithm of Needleman and Wunsch et al. (J. Mol. Biol. 48: 443 (1970)) and by Pearson and Lipman et al. (Proc. Natl. Acad. Sci. USA 85: 2444 (1988). )) By searching for similarity methods, by computer implementation of these algorithms (GAP, BESTFIT, FASTA, and TFASTA at Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI) or by inspection Can be performed using the local homology algorithm of Smith and Waterman (1981) Adv. Appl. Math. 2: 482. A suitable algorithm for measuring sequence similarity is the BLAST algorithm, which is described in Altschul et al. (J. Mol. Biol. 215: 403-410 (1990)) and Shpaer et al. (Genomics 38: 179-191 (1996)). It can be carried out according to the methods described. Software for performing the BLAST analysis is publicly available at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/).

  The above-described tumor-specific promoter of the present invention can be obtained by a well-known method using the PCR method based on the already reported sequence information of the SSX4 gene. These methods can be easily performed according to basic documents such as Molecular Cloning: A Laboratory Manual, Second Edition (1989) (Cold Spring Harbor Laboratory Press), Current Protocols in Molecular Biology (Greene Publishing Associates and Wiley-Interscience). it can. The tumor-specific promoter of the present invention having a base sequence that hybridizes under the above-mentioned stringent conditions can be easily obtained by, for example, site-directed mutagenesis, PCR, or ordinary hybridization. Specifically, it can be carried out with reference to basic documents such as Molecular Cloning.

  The tumor-specific promoter of the present invention does not act in normal cells and normal tissues, and is specific in tumor cells or tumor tissues, particularly brain tumor cells or brain tumor tissues, as will be demonstrated in the experimental examples described later. It has the characteristic property of exerting promoter activity.

  The tumor-specific promoter of the present invention introduces cancer gene therapy by tumor-specific gene expression, for example, suicide gene therapy in which a drug-metabolizing enzyme gene and a prodrug for cancer treatment are combined, a cytokine gene, etc. into cancer cells. Thus, it can be used for immune gene therapy for improving cancer immune function.

  The combination of drug metabolizing enzyme gene and prodrug for cancer treatment (drug) used in suicide gene therapy includes herpes simplex virus thymidine kinase gene and ganciclovir or acyclovir, cytosine deaminase gene and 5-fluorocytosine A combination of varicella-zoster virus cymidine kinase gene and 6-methoxypriarabinoside, a combination of E. coli gpt gene and 6-thioxanthine, a combination of cytochrome P450 2B1 gene and cyclophosphamide, a combination of human deoxycytidine kinase gene and cytosine arabinoside; a combination of the E. coli UPRT gene and 5-fluorouracil; Examples include a combination of an E. coli deoD gene and 6-methylpurine-2′-deoxyribonucleoside, and a combination of a bacterial nitroreductase gene and CB1954 (5- (aziridin-1-yl) -2,4-dinitrobenzamide). The A combination of herpes simplex virus thymidine kinase gene and ganciclovir or acyclovir is preferred.

  To actually perform suicide gene therapy, construct an expression vector incorporating the tumor-specific promoter of the present invention and a drug metabolizing enzyme gene downstream thereof so that the gene can be expressed, and introduce the expression vector into tumor cells. Subsequently, it can be performed by administering a prodrug (drug) for cancer treatment. Here, examples of the expression vector include vectors usually used for gene transfer such as a retrovirus vector, an adenovirus vector, and an adeno-associated virus vector. A retroviral vector is preferred. Alternatively, the tumor-specific promoter of the present invention and the plasmid DNA incorporated downstream so that the drug-metabolizing enzyme gene can be expressed are encapsulated in liposomes or introduced into tumor cells as a polylysine-DNA-protein complex. You can also

  In order to introduce the drug-metabolizing enzyme gene linked to the above-described tumor-specific promoter of the present invention into tumor cells, these vectors, liposome inclusion bodies or polylysine-DNA-protein complexes can be introduced into veins or arteries or directly into tumor tissue. It is done by injecting inside or around the tumor tissue. At this time, it is also possible to increase gene transfer efficiency by using an electroporation method or ultrasonic waves in combination. After such gene introduction, a prodrug (drug) for cancer treatment is administered by a usual method such as oral, intravenous, or intraarterial administration.

  The introduced gene is such that a drug-metabolizing enzyme is specifically expressed in tumor cells by the action of the tumor-specific promoter of the present invention, and the prodrug for cancer treatment is activated in the tumor cells by the expressed drug-metabolizing enzyme. To the cancer therapeutic agent, and the transformed cancer therapeutic agent selectively kills tumor cells to complete suicide gene therapy.

  Such a suicide gene therapy technique itself is already known, and in particular, a combination of herpes simplex virus thymidine kinase gene and ganciclovir has been clinically applied in brain tumors (Oldfield, EH, Hum. Gene Ther., 4 , 39-69, 1993).

  As immunity gene therapy using the tumor-specific promoter of the present invention, genes encoding cytokines such as interferon, TNFα, interleukin and the like are used together with the tumor-specific promoter of the present invention in the same manner as the suicide gene therapy described above. A method of treating a tumor by incorporating it into an expression vector or encapsulating in a liposome and introducing it into tumor cells to express cytokines, thereby enhancing the immune response, which is a biological defense mechanism inherent in humans, is employed.

  As gene therapy with an oncolytic virus using the tumor-specific promoter of the present invention, for example, the tumor-specific promoter of the present invention is inserted upstream of the early gene E1A or E1B, which is an essential gene for adenovirus growth, Alternatively, by replacing the early gene E1A or E1B promoter, or by inserting the tumor-specific promoter of the present invention upstream of the corresponding early gene of herpes simplex virus or replacing the early gene promoter, in tumor cells or tumor tissues A method of treating an tumor by constructing an oncolytic virus that specifically grows and kills tumor cells and administering this virus is mentioned. For such gene therapy, references such as Heise, C. et al., J. Clin. Invest., 105, 847-851, 2000 are referred to.

   In addition, by using the tumor-specific promoter of the present invention, an oncogene antisense gene and a normal tumor suppressor gene are specifically expressed in a tumor, and as a result, the tumor is decancerated (reverted to normal), It can induce cell death (apoptosis), and further enhancement of anticancer drug sensitivity and radiation sensitivity of tumor cells.

  The above gene therapy using the tumor-specific promoter of the present invention having the base sequence shown in SEQ ID NO: 1 as the minimum sequence is digestive cancer such as colorectal cancer, pancreatic cancer, liver cancer, lung cancer, breast cancer, neuroblastoma, brain tumor It is effective for the treatment of brain tumors.

3. Viral vector and pharmaceutical composition The viral vector of the present invention is characterized in that it contains the aforementioned tumor-specific promoter in an operably linked state with the base sequence of a foreign structural gene. Here, “operably linked” refers to a functional relationship between a tumor-specific promoter and a foreign structural gene. For example, the above-described tumor-specific promoter is a foreign gene in a tumor cell or tumor tissue. When the transcription of the base sequence (coding sequence) is stimulated to bring about the desired transcription, it can be said that the tumor-specific promoter is operably linked to the base sequence (coding sequence) of the foreign structural gene. In general, base sequences that are operably linked are adjacent to each other. Here, the host cell is an animal, particularly a mammalian cell, and more preferably a human cell.

  The virus vector of the present invention exhibits a desired function in the above host cell, and a minimal element other than a tumor-specific promoter for producing a desired protein by effectively expressing a foreign structural gene. Examples of retroviral vectors include LTR, packaging signal region, and PPT (polypurine tract) sequence.

  It can also contain translation or other control signals. Expression efficiency can also be facilitated by including an enhancer appropriate for the cell line used (Scharf et al., 1994, Results Probl. Cell Differ. 20: 125; and Bittner et al., 1987, Meth. Enzymol., 153: 516). Therefore, the viral vector of the present invention can also be used to increase expression in mammalian host cells, such as LTR (long terminal repeat), SV40 enhancer, or CMV enhancer.

  Useful viral vectors used in the present invention include retrovirus, adenovirus, adeno-associated virus, herpes virus based vector, SV40, papilloma virus, HBP Epstein Barr virus based vector, vaccinia virus vector, and Semliki Forest virus ( SFV). A retrovirus is preferred.

  The viral vector used for introducing the tumor-specific promoter and foreign structural gene of the present invention is preferably designed for gene therapy. Commercially available packaging or helper cells usually (2) exogenous to render the virus incapable of growing in the target cell while maintaining its ability to grow in vector form. Incorporate new sequences that allow for the insertion of DNA sequences (base sequences of foreign structural genes) in the viral genome and (3) encode the gene of interest and allow proper expression Modifications have been made to allow for this. Examples of such commercially available packaging cells or helper cells include RetroPack PT67 and AmphoPack-293 (both are TaKaRa).

  Adenoviral vectors that can be used for human gene therapy are described, for example, in Rosenfeld et al., 1992, Cell 68: 143; PCT Publications WO 94/12650; 94/12649; 94/12629. Insertion in the E1 or E3 non-essential region of the viral genome results in a live virus that can be expressed in infected host cells (Logan and Shenk, 1984, Proc. Natl. Acad. Sci., 81: 3655).

(3-1) Viral vector and pharmaceutical composition for gene therapy As one embodiment of the viral vector of the present invention, a viral vector comprising a gene encoding a protein that is toxic to animal cells as a foreign structural gene. Can be mentioned. In Experimental Example 3, a retroviral vector is constructed in which the tumor-specific promoter of the present invention and the suicide gene herpesvirus-thymidine kinase (HSV tk) are operably linked in animal cells. Here, in place of HSV tk, when a gene encoding a protein that is toxic to animal cells is used, the tumor-specific promoter of the present invention is specifically activated in the tumor animal cells, whereby the tumor Animal cells can be brought to morbidity or death. That is, the viral vector containing the tumor-specific promoter of the present invention operably linked to a gene encoding such a toxic protein can be effectively used as an active ingredient of a pharmaceutical composition for killing tumor cells.

  Further, as one embodiment of the viral vector of the present invention, as shown in Experimental Example 3, as a foreign structural gene, it acts on a drug that is not itself toxic to cells and converts the drug so that it is toxic to cells. And a viral vector containing a gene encoding a protein having a function (conversion function to an active form).

  Examples of such drugs include so-called prodrugs. Specific examples of prodrugs for cancer treatment include gancyclovir, acyclovir, 5-fluorocytosine, 6-methoxypriarabinoside, 6-thioxanthine. , Cyclophosphamide, cytosine arabinoside, 5-fluorouracil, CB1954 (5- (aziridin-1-yl) -2,4-dinitrobenzamide) and 6-methylpurine-2′-deoxyribonucleoside . Examples of genes encoding proteins used to activate such cancer therapeutic prodrugs include herpes simplex virus thymidine kinase gene, cytosine deaminase gene, varicella-zoster virus thymidine kinase gene, E. coli. E. coli gpt gene, cytochrome P450 2B1 gene, human deoxycytidine kinase gene, E. coli. E. coli UPRT gene, bacterial nitroreductase gene and E. coli Examples thereof include drug metabolizing enzyme genes such as the E. coli deoD gene.

  The virus vector can be prepared by incorporating the tumor-specific promoter of the present invention and the above-described drug metabolizing enzyme gene downstream so that it can be expressed. The virus vector thus prepared is a suicide gene. In therapy, tumor animal cells can be brought to a pathological state or killed by being introduced into tumor cells and then administered a prodrug (drug) for cancer treatment. That is, in this case, the tumor-specific promoter of the present invention is specifically activated in tumor animal cells to express and produce a foreign structural protein (drug-metabolizing enzyme gene), which is administered in parallel due to its action. A prodrug drug for cancer treatment is converted to an active form, which results in tumor animal cells becoming morbid or dead (suicide gene therapy). Therefore, a viral vector comprising a tumor-specific promoter of the present invention operably linked to a gene encoding such a protein is a pharmaceutical composition used in combination with the above-mentioned cancer therapeutic prodrug to kill tumor cells. It can be effectively used as a component (medicinal auxiliary component).

  As a combination of a drug metabolizing enzyme gene and a prodrug for cancer treatment (drug) used in the suicide gene therapy, a combination of herpes simplex virus thymidine kinase gene and ganciclovir or acyclovir, cytosine deaminase gene and 5-fluorocytosine A combination of varicella-zoster virus thymidine kinase gene and 6-methoxypriarabinoside, E. a combination of E. coli gpt gene and 6-thioxanthine, a combination of cytochrome P450 2B1 gene and cyclophosphamide, a combination of human deoxycytidine kinase gene and cytosine arabinoside; a combination of the E. coli UPRT gene and 5-fluorouracil; Examples include a combination of E. coli deoD gene and 6-methylpurine-2′-deoxyribonucleoside, or a combination of bacterial nitroreductase gene and CB1954 (5- (aziridin-1-yl) -2,4-dinitrobenzamide). The A combination of herpes simplex virus thymidine kinase gene and ganciclovir or acyclovir is preferred.

  Here, as the expression vector, a vector usually used for gene transfer, such as a retrovirus vector, an adenovirus vector, and an adeno-associated virus vector, as described above, is preferably used.

  Such viral vectors can be introduced into cells or tissues in vivo, in vitro, or ex vivo as gene therapy vectors. More specifically, the virus vector is injected into a vein or artery, or directly into or around a tumor tissue. At this time, it is also possible to increase gene transfer efficiency by using an electroporation method or ultrasonic waves in combination.

  The present invention relates to a pharmaceutical composition comprising such a viral vector as a component. Such a pharmaceutical composition can contain arbitrary carriers and additives, for example, pharmaceutically acceptable carriers and additives, in addition to the virus vector.

  Formulations suitable for parenteral administration (for example, subcutaneous injection, intramuscular injection, local injection, intraperitoneal administration, etc.) in gene therapy include aqueous and non-aqueous isotonic sterile injection solutions. Antioxidants, buffers, antibacterial agents, tonicity agents and the like may be included. In addition, parenteral administration preparations include aqueous and non-aqueous sterile suspensions, including suspensions, solubilizers, thickeners, stabilizers, preservatives, and the like. It may be included.

  The dosage of the pharmaceutical composition of the present invention varies depending on the body weight and age of the subject to be administered, the type of tumor and its severity, etc., and cannot be generally set, for example, in the case of suicide gene therapy As an effective amount of the prodrug for cancer treatment to be used, several mg to several tens mg / kg body weight per day for an adult can be mentioned, and this can be administered once to several times a day. .

(3-2) Virus vector and pharmaceutical composition for gene diagnosis As one embodiment of the virus vector of the present invention, a virus vector (reporter vector) containing a reporter gene as a foreign structural gene can be mentioned.

  Examples of the foreign structural gene that can serve as a reporter gene include a fluorescent protein, a phosphorescent protein, a chemiluminescent protein, or a gene encoding a protein having enzyme activity. In Experimental Example 3, a retroviral vector is constructed in which the tumor-specific promoter of the present invention and the suicide gene herpesvirus-thymidine kinase (HSV tk) are operably linked in animal cells. Here, when the reporter gene is used, the reporter gene is expressed by specifically activating the tumor-specific promoter of the present invention in tumor animal cells, thereby labeling tumor cells and tumor tissues ( Fluorescence, phosphorescence, chemiluminescence, enzyme activation). Therefore, the presence of a tumor can be specifically detected by using this as an index.

  That is, the viral vector comprising the tumor-specific promoter of the present invention operably linked to such a reporter gene can be effectively used as an active ingredient of a pharmaceutical composition (diagnostic composition) for detecting a tumor. .

  Such a pharmaceutical composition (diagnostic composition) can also contain any carrier or additive, for example, a pharmaceutically acceptable carrier and additive, in addition to the viral vector, as in the case of the therapeutic composition described above. .

  The viral vector (for treatment and diagnosis) of the present invention is prepared and introduced into cells, tissues or organs of patients (including humans and other animals) by various methods in the above treatment or diagnosis. As such methods, any known method can be used, for example, calcium chloride transformation method (for bacterial system), electroporation method, calcium phosphate treatment method, liposome-mediated transformation method, injection and microinjection method, Ballistic method, virosome, immunoliposome method, polycation: nucleic acid complex, naked DNA, artificial virion, herpesvirus structural protein VP22 (Elliot and O'Hare, Cell 88: 223) Fusion, drug-promoted uptake of DNA, and ex vivo transduction methods.

  The present invention will be described with reference to the following examples, but the present invention is not limited to such examples. In the following experimental examples, unless otherwise specified, genetic manipulation, cell culture, etc., Molecular Cloning: A Laboratory Manual, Second Edition (1989) (Cold Spring Harbor Laboratory Press), Current Protocols in Molecular Biology (Greene Publishing Associates and Wiley-Interscience) and the like.

Materials Various cells used in the experimental examples described later were prepared according to the following method.

(1) Normal human astrocytes Normal human astrocytes (Cambrex Corporation) were prepared by culturing at 37 ° C. under conditions of 5% CO ₂ using an astrocyte medium kit (TaKaRa).

(2) Various tumor cells Glioblastoma cell lines (UW18, SNB19, U87MG, T98G, U373, ONS-12, ONS-23, ONS-65, KN-1), anaplastic astrocytoma ONS-75, and The medulloblastoma cell line (UW228, ONS-76) was added to DMEM containing 10% fetal bovine serum to give a final concentration of 10% fetal bovine serum, and final concentrations of 100 unit / ml and 100 μg / Each medium was prepared by culturing at 37 ° C. under 5% CO ₂ in a medium supplemented with penicillin and streptomycin. Of the above cell lines, U87MG, T98G and U373 were obtained from (American type culture collection; ATCC). UW18, SNB19 and UW228 were provided by Dr. Silber (University of Washington, Seattle, WA), and ONS-12, ONS-23, ONS-65, KN-1, ONS-75 and ONS-76 were covered by the present invention. Is a cell line established by Shimizu et al.

(3) Human fibroblasts Immortalized human fibroblasts BJ-5ta (obtained from the American Type Culture Collection (ATCC)) has a final concentration of 4: 1 (volume ratio) in a medium containing DMEM and Medium199. Incubate at 37 ° C with 5% CO ₂ in fetal bovine serum at 10% and medium supplemented with penicillin and streptomycin at final concentrations of 100 unit / ml and 100 μg / ml, respectively. Prepared.

Methods of RT-PCR and quantitative RT-PCR In Experimental Example 1 described later, RT-PCR and quantitative RT-PCR were performed according to the following methods.

(1) Synthesis of cDNA (complementary DNA) Total RNA is extracted from various cells using RNA mini Kit (QIAGEN), and reverse transcription reaction is performed from 1 μg of RNA using Superscript II cDNA synthesis kit (Invitrogen). Synthesize (complementary DNA).

(2) Semi-quantitative PCR reaction
Using AmpliTaq Gold (Applied biosystems), 35 cycles of initial denature 95 ° C, 10 minutes later, 95 ° C for 30 seconds, 58 ° C for 30 seconds, 72 ° C for 30 seconds, followed by extension reaction at 72 ° C Do for 1 minute. The following primers are used for amplification.

<For hSSX4 gene>
Forward primer; CGTAGTAAACGGGCTGCAGACTT (SEQ ID NO: 4),
Reverse primer; GAGGCTGCCGAAAGTCATCTG (SEQ ID NO: 5).

<For β-actin gene>
Forward primer; AACTCCATCATGAAGTGTGACG (SEQ ID NO: 6),
Reverse primer; GATGGACATCTGCTGGAAGG (SEQ ID NO: 7).

(3) Quantitative PCR
Follow Quantitect SYBR Green PCR kit (QIAGEN) with Lightcycler (Roche) according to product instructions. For amplification, use the same primers as above. The reaction is initially denatured at 95 ° C., 15 minutes later, 94 ° C. for 15 seconds, 55 ° C. for 10 seconds and 72 ° C. for 20 seconds for 45 cycles.

Experimental Example 1 Determination of Brain Tumor Specific Genes Among the cancer testis antigen genes that are not expressed in normal tissues other than testis but are expressed in tumors, Homo sapiens synovial sarcoma, The X breakpoint 4 (SSX4) gene (hereinafter referred to as “hSSX4 gene”) was selected. The hSSX4 gene is located in the region of positions 48127912 to 48137729 of the human X chromosome Xp11.23 (Genbank Accession No. NC_0000232.9) (Genbank Accession No. NG_005575). It is known that there are two transcription variants (Genbank Accession No. NM_005636 (transcript variant 1) and NM_175729 (transcript variant 2)). Hereinafter, the transcript mRNA of this hSSX4 gene is referred to as “hSSX4 mRNA” inclusive of the two transcriptional variants.

  Testis, normal human astrocytes, anaplastic astrocytoma cells ONS-75, glioblastoma cells (UW18, SNB19, U87MG, T98G, U373, ONS-12, ONS-23, ONS-65, KN-1) The expression of hSSX4 gene in medulloblastoma cells (UW228, ONS-76) was measured by RT-PCR. In addition, expression was similarly measured using β-actin (ACTB) gene as a standard marker for expression. As a result, as shown in FIG. 3A, the expression of hSSX4 gene was confirmed in all tumor cells but not in normal human astrocytes. The amount of hSSX4 gene expression was measured by quantitative RT-PCR. As shown in FIG. 3B, the expression level in normal human astrocytes was below the detection limit.

  Therefore, the hSSX4 gene is not expressed in normal tissues other than testis, but is a brain tumor-specific gene that is specifically expressed in tumors, particularly brain tumors, and the expression of the hSSX4 gene in normal tissues is extremely strict. It was thought to be suppressed.

Experimental Example 2 Identification of tumor-specific promoter region (FIG. 4)
A promoter region was identified for the hSSX4 gene determined to be a brain tumor-specific gene in Experimental Example 1, and a minimal region having promoter activity was further determined.

(1) Experimental method (1-1) Construction of SSX4 promoter construct and creation of promoter activity detection plasmid First, RLM-RACE (RNA ligation mediated Rapid Amplification of cDNA ends) kit (manufactured by Invitrogen) and the following primers were used. Thus, in the normal testis and malignant glioma cell line SNB19, the transcription start point of the hSSX4 gene was determined.
SSX4GSP1; CCTCAGGGTCGCTGATCTCTTCATAAAC (SEQ ID NO: 8)
SSX4GSP2; TCTCTCACGCAGTCTGTGGGTCCAG (SEQ ID NO: 9)
SSX4GSP3; CCGTGGAAGTCTGCAGCCCGTTTAC (SEQ ID NO: 10).

  As a result, the transcription start point of the hSSX4 gene is the base sequence of the 5 'end region and the base sequence of the 5' end region of the two transcripts (hSSX4 mRNA) (transcript variants 1, 2) (NM_005636, NM_175729). Therefore, the 5 'end base of the hSSX4 gene is the transcription start point (+1), and the transcription start point (base 5' end base of the SSX4 gene) is used as a reference, and it is 32bp downstream from 2832 bp upstream (-2832) The region of (+32) (−2832 to +32), a total region of 2864 bp was isolated.

  Next, in order to determine the minimal region showing the tumor-specific activity of the SSX4 promoter, as shown below, the transcription start point (base at the 5 ′ end of the SSX4 gene) as the base point (+1), 2832, 1931, 1162, 885, 485, 255, 107, 60, or 22 bp upstream (-2832, -1931, -1162, -885, -485, -255, -107, -60, -22) to 32 bp downstream (+ 32) Create unidirectional deletion mutant promoters (see Fig. 4, "Constructs 1, 2, 3, 4, 5, 6, 7, 8, and 9" in order from the top of Fig. 4). These were ligated to pGL3 Basic Vector (manufactured by promega) to prepare a plasmid for detecting promoter activity.

  Specifically, a promoter activity detection plasmid into which construct 1 (-2832 to +32 bp) was inserted was prepared as follows.

(i) Using 100 ng genomic DNA extracted from normal human lymphocytes as a template and using phusion DNA polymerase, the following primers were used from 38 bp (+32) downstream of the transcription start site of SSX4 gene to 2863 bp upstream (-2863) Amplify):
SSX4 promoter F; GCTTCATGGGTTCATTTCTCAGG (SEQ ID NO: 11),
SSX4 promoter R; GTGGAAGAATCAAAAGGGCAAATC (SEQ ID NO: 12).

(ii) Next, the following primers added with a Bgl II recognition site were added to the DNA fragment obtained by amplification:
SSX4 ProF +; TTAGATCTGCTTCATGGGTTCATTTCTCAGG (SEQ ID NO: 13), and
SSX4 ProR +; GAAGATCTGTGGAAGAATCAAAAGGGCAAATC (SEQ ID NO: 14)
Then, the amplified DNA obtained is digested with BglII and cloned into the BglII recognition site of pGL3 Basic Vector (Promega) having the firefly luciferase gene as a structural gene.

Constructs 2 to 9 were also obtained by PCR amplification using the following primers and the above SSX4 promoter R (SEQ ID NO: 12) using genomic DNA extracted from normal human lymphocytes as a template in the same manner as described above. The amplified DNA was cleaved with Nhe I and Bgl II and inserted into the multicloning site of pGL3 Basic Vector (Promega) to prepare a promoter activity detection plasmid.
Construct 2 [SSX4 (-1931 to +32)]; ATGCTAGCGATCTCAGCTCAATGCAACC (SEQ ID NO: 15)
Construct 3 [SSX4 (-1162 to +32)]; ATGCTAGCAATGAGATGGGAGGATTGAC (SEQ ID NO: 16)
Construct 4 [SSX4 (-885 to +32)]; ATGCTAGCAGGGACATGGATGAAATTG (SEQ ID NO: 17)
Construct 5 [SSX4 (-485 to +32)]; ATGCTAGCCAACAGATGTAGAAGCCAC (SEQ ID NO: 18)
Construct 6 [SSX4 (-255 to +32)]; ATGCTAGCACAAAGTGTGGCTGGAGG (SEQ ID NO: 19)
Construct 7 [SSX4 (-107 to +32)]; TTGCTAGCCCAGGCTCTAGGGACAGAACCT (SEQ ID NO: 20)
Construct 8 [SSX4 (-60 to +32)]; TTGCTAGCACTCTGATTTTCCCGCCGAAAG (SEQ ID NO: 21)
Construct 9 [SSX4 (-22 to +32)]; TTGCTAGCCTACTTTAAATTCAGAGTACGC (SEQ ID NO: 22).

(1-2) Measurement of promoter activity Immobilization of promoter activity detection plasmids 1-9, into which the various constructs created above were inserted, with normal astrocytes (NHA) and telomerase catalytic subunit introduced Human fibroblast BJ-5ta and glioma cell lines U87-MG, SNB19, and T98G were transfected, and the activity of firefly luciferase in the cell lysate was measured to determine the promoter activity.

Specifically, each of the plasmids 1-9 (0.5 μg) for detecting promoter activity prepared as described above and pGL3 Control vector (Promega) (0.5 μg) containing the SV40 virus promoter and enhancer as a control is contained in each of the plasmids. As a sex control vector, 50 ng of phRL-TK (Promega) was mixed, and the above cells were transfected using FuGENE6 transfection reagent (Roche) according to the instruction manual. By the way, as the various cells, those previously seeded on a 12-well plate at a ratio of 1 × 10 ⁵ cells on the day before transfection were used. Two days after transfection, the cells were washed with PBS, lysed with 100 μl of passive lysis buffer, centrifuged, and the supernatant was used as a cell lysate.

  Measure the activity of firefly luciferase caused by the plasmid for promoter activity detection in the cell lysate and sangoluciferase caused by the endogenous control vector using Dual Luciferase reporter assay system (Promega) according to the instruction manual. Did. The endogenous control vector is for standardizing the efficiency of gene transfer, and the firefly luciferase activity was corrected based on the activity of coral luciferase by the TK promoter.

(2) Results The results are shown in FIG. The results are shown in a relative ratio with respect to the promoter activity of the pGL3 Control Vector used as a control. In addition, a result shows the average value which measured the promoter activity 3 times.

  As shown in FIG. 4, a construct containing a region 255 bp upstream from the transcription start point (base at the 5 ′ end of the SSX4 gene) (in FIG. 4, the sixth construct 6 from the top: containing −255 to +32 bp) Showed a strong promoter activity almost equivalent to the promoter activity of the construct containing the region upstream of 255 bp (constructs 1 to 5 from the top to the fifth in FIG. 4). Moreover, the said construct 6 shows a promoter activity specifically only in a tumor cell (glioma cell line U87-MG, SNB19, and T98G) similarly to the constructs 1-5, a normal astrocyte (NHA) or an immortal cell. Almost no promoter activity was observed in cultured human fibroblasts (BJ-5ta). From this result, the transcription start point of the SSX4 gene (base at the 5 'end of the SSX4 gene) is the base point + 1, and the 255 bp upstream region ("-255 to -1" region: SEQ ID NO: 1) is the smallest brain tumor specific Was found to be a typical promoter region.

Experimental Example 3 Induction of tumor-specific cell death by a brain tumor-specific promoter (see FIG. 5)
(1) Preparation of retroviral vector (Fig. 5)
As a brain tumor-specific promoter having the minimum promoter region identified in Experimental Example 1, construct 6 (-255 to +32 region) including a region 255 bp upstream from the transcription start point (base at the 5 ′ end of SSX4 mRNA) ( SEQ ID NO: 19) and construct 5 (-485 to +32 region) (SEQ ID NO: 18) containing a region 485 bp upstream from the transcription start point were used as “SSX4 promoter 1” and “SSX4 promoter 2”, respectively. Retroviral vectors (pSSX255-HSVtk, pSSX485-HSVtk) that control the expression of suicide genes were prepared (see FIG. 5). As a suicide gene, a herpesvirus thymidine kinase (HSVtk) gene was used.

  For comparison, a retroviral vector (pCMV-HSVtk) containing a CMV promoter as a promoter and a retroviral vector (pRΔ-HSVtk) from which the promoter was deleted were prepared (see FIG. 5).

  Specifically, each vector was prepared according to the following method using pRetroQ DsRed (Invitrogen), which is a retroviral vector. In addition, pRetroQ DsRed was introduced into the cell, and the reverse transcription in the infected cell was followed by the deletion of the LTR that functions as a promoter of viral RNA expression regulation and as an enhancer (3 ′ replacing 5 ′ LTR) Deletion within LTR enhancer), a self-inactivating SIN (self-inactivated) vector.

(1-1) Construction of retroviral vector (pCMV-HSVtk) containing CMV promoter
HSVtk was prepared by first performing PCR using a retroviral vector (MBP / pIP250 +) as a template and HSVtk1F: CGCCACCATGGCTTCGTACCCCTGCCATCA (SEQ ID NO: 23), HSVtk1R: TCAGTGAGCCTCCCCCATC (SEQ ID NO: 24) as primers, and the resulting amplification product. After purification, PCR was performed again using HSVtk2F; AATTGGATCCCGCCACCATGGCTTCGTAC (SEQ ID NO: 25) and HSVtk2R; TATGCGGCCGCTCAGTGAGCCTCCCCCATC (SEQ ID NO: 26) as primers. The amplified product thus obtained is digested with BamH I and Not I, HSVtk is excised, inserted into pRetroQ DsRed (Invitrogen) vector cleaved with the same enzyme, and DsRed is replaced with HSVtk. (PCMV-HSVtk) was prepared.

(1-2) Preparation of retrovirus vector (pRΔ-HSVtk) with deleted promoter
PCR was performed using pRetroQ DsRed (Invitrogen) as a template and pRetroDelF; TCCGCTAGCGCTACCGGA (SEQ ID NO: 27), pRetroDelR; AGCTAGCTATGATCTTCAATTCCG (SEQ ID NO: 28) as primers. The obtained amplification product was digested with Nhe I and self-ligated to delete the CMV promoter and DsRed (CMV promoter / DsRed deletion / pRetroQ DsRed vector). After the CMV promoter / DsRed deletion / pRetroQ DsRed vector thus obtained was digested with BamH I and Not I, HSVtk prepared by the method described in (1-1) was inserted, and the retro deleted the promoter. A viral vector (pRΔ-HSVtk) was prepared.

(1-3) Construction of retroviral vector (pSSX255-HSVtk) containing construct 6
In (1-2), after inserting HSVtk into the CMV promoter / DsRed deletion / pRetroQ DsRed vector, SSX4pro2R; ATAATGTCGACGTGGAAGAATCAAAAGGGC (SEQ ID NO: 29) and SSX4-255 (construct 6 (SSX4 (-255 to +32)) PCR was performed using (SEQ ID NO: 19) as a primer, and then the SSX4 promoter digested with Nhe I and Sal I (construct 6) was deleted from the CMV promoter / DsRed deletion / HSVtk digested with the same restriction enzyme A retroviral vector (pRSSX255-HSVtk) containing the construct 6 was prepared by inserting into the pRetroQ DsRed vector.

(1-4) Construction of retroviral vector (pSSX485-HSVtk) containing construct 5
After inserting HSVtk into pRetroQ DsRed vector lacking CMV promoter and DsRed in (1-2), SSX4pro2R; ATAATGTCGACGTGGAAGAATCAAAAGGGC (SEQ ID NO: 29) and SSX4-485 (Construct 5 (SSX4 (-485 to +32)) PCR was carried out using (SEQ ID NO: 18) as a primer, and then the SSX4 promoter digested with Nhe I and Sal I (construct 5) was converted into a CMV promoter / DsRed deletion / HSVtk digested with the same restriction enzyme / A retroviral vector (pRSSX485-HSVtk) containing construct 5 was constructed by inserting into the pRetroQ DsRed vector.

  The constructed vectors were all determined by sequencing and confirmed to match the sequences on the database.

(2) Retrovirus production and gene transfer
Packaging cells capable of producing Amphotropic retrovirus PAMP51 (Yoshimatsu T. et al., Human Gene Therapy 9, January, 161-172, 1998.) 2x10 ⁵ cells containing antibiotics in each well of a 6-well plate Inoculated with DMEM containing 10% fetal bovine serum and the next day, 2 μg of each retroviral vector prepared in (1) above was used on the cells using Fugene 6 Transfection Reagent (Roche). Lipofected as described. On the next day, the culture supernatant was replaced with a culture solution containing antibiotics and cultured at 32 ° C. Four days later, the culture supernatant was filtered through a 0.45 μm filter to remove cells, and this was used as a virus solution.

The retroviral vector was introduced into the mouse glioblastoma cell line RSV-M, the human glioblastoma cell line U87MG, and T98G. The day before infection, 2 × 10 ⁵ cells were seeded in a 6-well plate and 1 ml of 1 × 10 ^The culture medium was exchanged with 4-10 ⁵ cfu virus and 1 μg / ml polybren, and the virus was infected for 3 hours at 37 ° C. After adding 2 ml of the new culture medium, the cells were cultured at 37 ° C for 2 days. The cells into which the virus vector was introduced were selectively cultured in a culture solution containing 500 μg / ml G418 for 2 weeks and used for the subsequent experiments. The titer of the virus solution was determined using the mouse immortalized cell line NIH3T3.

(3) Measurement of cell death-inducing effect by GCV The retroviral vectors (pCMV-HSVtk, pRΔ-HSVtk, pRSSX255-HSVtk, pRSSX485-HSVtk) prepared above were transformed into tumor cells (glioblastoma cell line U87MG, mouse glioma). Blastoma cell line RSV-M), or normal cells (human fibroblasts BJ-5ta), and thus obtained cells were treated with ganciclovir (GCV) (concentration: 0, 0.01, 0.05, 0.1) as a prodrug. , 0.5, 1, 5, 10 μM) and cell viability after 5 days was measured using the MTT assay. As a control test, various types of cells into which no retroviral vector had been introduced were added with various concentrations of ganciclovir (GCV) in the same manner as described above, and the cell viability after 5 days was measured using an MTT assay. .

(4) Experimental results The results are shown in FIG. Tumor cells (RSV-M (-◆-) and U87MG (-■-) in figures d and e) into which vectors containing SSX4 promoter (pRSSX255-HSVtk, pRSSX485-HSVtk) are introduced depend on the concentration of GCV added. Sensitivity and cell growth was inhibited or died. On the other hand, almost no growth inhibition was observed in normal cells (human fibroblast BJ-5ta:-▲-) into which a vector containing SSX4 promoter (pRSSX255-HSVtk, pRSSX485-HSVtk) was introduced. On the other hand, as shown in FIG. C, it was observed that the cells into which the vector (pCMV-HSVtk) containing the CMV promoter was introduced, both the tumor cells and normal cells were suppressed in cell growth depending on the addition concentration of GCV. In addition, as shown in FIGS. A and b, wild type cells into which no vector has been introduced (Wild type) and cells into which a promoter has been deleted (pRΔ-HSVtk) are resistant to the addition of GCV. Growth inhibition was not observed. Based on the above, it was confirmed that the vector using the SSX4 promoter having the nucleotide sequence set forth in SEQ ID NO: 1 as the minimum sequence for HSVtk expression control induces growth inhibition and cell death specifically in tumor cells in vitro. It was done.

Example 4 Examination of tumor formation inhibitory effect by tumor-specific retroviral vector (FIG. 7)
Next, in order to confirm the in vivo effect of the retroviral vectors (pRSSX255-HSVtk, pRSSX255-HSVtk) prepared in Experimental Example 3, RSV-M into which these vectors were introduced was subcutaneously injected into syngeneic mouse C3H / HeN. The tumorigenic effect was examined.

(1) Experimental method
Search of antitumor effect in mouse skin The retroviral vectors (pCMV-HSVtk, pRΔ-HSVtk, pRSSX255-HSVtk, pRSSX485-HSVtk) prepared in Experimental Example 3 were introduced into the mouse glioblastoma cell line RSV-M. Cells (5x10 ⁶ cells) and wild-type cells (5x10 ⁶ cells) without retrovirus vector were suspended in 100 μl of PBS, respectively, and mouse C3H / HeN syngeneic with mouse glioblastoma cell line RSV-M It was administered subcutaneously. From the next day, GCV (25 mg / kg) was intraperitoneally administered daily, and the change in the tumor volume (mm ³ ) formed was measured every other day for 25 days. The volume of the tumor was calculated by “the square of the short side × the long side” of the tumor.

As a comparative experiment, cells (5x10 ⁶ cells) prepared by introducing pRSSX255-HSVtk and pRSSX485-HSVtk as retroviral vectors into RSV-M were suspended in 100 μl of PBS and administered subcutaneously to mouse C3H / HeN. The change in the tumor volume (mm ³ ) formed was measured every other day for 25 days without GCV (25 mg / kg) being administered intraperitoneally.

(2) Experimental results The results are shown in FIG. Cells that have not been introduced with vectors containing SSX4 promoter (pRSSX255-HSVtk, pRSSX485-HSVtk) as retroviral vectors (in the figure,-◆-Wild Type,-■-CMV, indicated as-▲ -Δ), SSX4 promoter In cells that have been transfected with a vector but have not been treated with GCV (shown as-● -pSSX4-255 w / o GCV,-□ -pSSX4-485 w / o GCV in the figure) The tumor increased in about 4 weeks.

  On the other hand, in the cells (-△-pSSX4-255,-○-pSSX4-485 in the figure) into which vectors containing SSX4 promoter (pRSSX255-HSVtk and pRSSX485-HSVtk) were introduced, administration of GCV significantly increased tumor growth. Suppressed. In these mice, tumor cells were considered to be completely eliminated because no tumor growth was observed in mice that had been administered GCV for 3 months or more. Based on this result, HSVtk expression control by the SSX4 promoter with the base sequence described in SEQ ID NO: 1 as the minimum sequence is effective in vivo, and cell growth suppression and cell death are induced specifically in tumor cells. Was confirmed.

  In addition, as shown in Experimental Example 1, the SSX4 gene is a gene that is specifically expressed in brain tumor cells and brain tumor tissues, and is strictly suppressed in normal cells and normal tissues other than testis. Therefore, it is considered that the promoter (SSX4 promoter) having the base sequence described in SEQ ID NO: 1 as the minimum sequence is useful as a brain tumor-specific promoter.

SEQ ID NO: 1 shows the minimum sequence of the tumor-specific promoter of the present invention, and SEQ ID NOS: 2 and 3 show examples of the base sequence of the tumor-specific promoter. SEQ ID NOs: 4 to 29 all mean the base sequences of the following primers. SEQ ID NO: 4: Forward primer for hSSX4 gene, SEQ ID NO: 5: Reverse primer for hSSX4 gene, SEQ ID NO: 6: Forward primer for β-actin gene, SEQ ID NO: 7: Reverse primer for β-actin gene, SEQ ID NO: 8: SSX4GSP1 primer, Sequence No. 9: SSX4GSP2 primer, SEQ ID NO: 10: SSX4GSP3 primer, SEQ ID NO: 11: SSX4 promoter F, SEQ ID NO: 12: SSX4 promoter R, SEQ ID NO: 13: SSX4 ProF + primer, SEQ ID NO: 14: SSX4 ProR + primer, SEQ ID NO: 15: Construct 2 [SSX4 (-1931 to +32)] construction primer, SEQ ID NO: 16: Construct 3 [SSX4 (-1162 to +32)] construction primer, SEQ ID NO: 17: Construct 4 [SSX4 (-885 to +32) Construction primer, SEQ ID NO: 18: Construct 5 [SSX4 (-485 to +32)] Construction primer, SEQ ID NO: 19: Const Primer for constructing lacto 6 [SSX4 (-255 to +32)], SEQ ID NO: 20: Construct 7 [SSX4 (-107 to +32)] Primer for constructing, SEQ ID NO: 21: construct 8 [SSX4 (-60 to +32) )] Construction primer, SEQ ID NO: 22: Construct 9 [SSX4 (-22 to +32)] Construction primer, SEQ ID NO: 23: HSVtk1F primer, SEQ ID NO: 24: HSVtk1R primer, SEQ ID NO: 25: HSVtk2F primer, SEQ ID NO: 26 : HSVtk2R primer, SEQ ID NO: 27: pRetroDelF primer, SEQ ID NO: 28: pRetroDelR primer, SEQ ID NO: 29: SSX4pro2R primer.

Claims (10)

Having a nucleotide sequence shown in SEQ ID NO: 1 and consisting of a polynucleotide having a brain tumor specific promoter activity, brain tumor-specific promoter. Having the nucleotide sequence of the SEQ ID NO: 1 and a polynucleotide having a brain tumor specific promoter activity, or from 1 to 2578 th either base 2832-2864 th in the nucleotide sequence of SEQ ID NO: 2 of a 255bp~2864bp polynucleotide consisting of the nucleotide sequence of a region comprising the nucleotide according to claim 1, brain tumor-specific promoters described. Viral vectors, including the claims 1 or 2 of the brain tumor specific promoter, while operably linked to a nucleotide sequence of the foreign structural gene. The viral vector according to claim 3 , wherein the foreign structural gene is a gene encoding a protein that is toxic to cells. The viral vector according to claim 3 , wherein the foreign structural gene is a gene that makes a drug sensitive to cells. The viral vector according to claim 5 , wherein the drug is ganciclovir or acyclovir and the gene is thymidine kinase. The viral vector according to claim 3 , wherein the foreign structural gene is a reporter gene. The viral vector according to claim 7 , wherein the foreign structural gene is a gene encoding a fluorescent protein, a phosphorescent protein, a chemiluminescent protein, or a protein having enzyme activity. A pharmaceutical composition for killing tumor cells, comprising the viral vector according to any one of claims 3 to 6 . A composition for detecting a brain tumor, comprising the viral vector according to claim 7 or 8 .

Images