JP5406253B2 - Amino acid bioassay based on protein expression - Google Patents

Description

  The present invention relates to a method for quantifying the amount of amino acids contained in a sample using an amino acid-requiring lactic acid bacterium containing a detectable protein in a state in which expression can be regulated.

  Amino acid analysis is used as a marker for food quality control and detection of various diseases, and the development of a rapid and simple quantitative method is strongly desired from an industrial and medical standpoint.

  Examples of known amino acid quantification methods include an instrumental analysis method using HPLC, an enzyme method using a quantification enzyme, and a bioassay method using lactic acid bacteria (Non-patent Document 1). In this bioassay method, lactic acid bacteria exhibiting requirements for the amino acid species to be measured are used. When this lactic acid strain is cultured in a mixed solution of a target amino acid species-restricted medium and a sample until the stationary phase, a cell growth amount proportional to the content of the target amino acid in the sample can be obtained. The bioassay method is a method for quantifying amino acids based on the amount of growth of such lactic acid bacteria.

  Non-Patent Document 2 discloses an amino acid quantification method using amino acid-requiring E. coli. In this method, amino acid-requiring Escherichia coli is used in place of amino acid-requiring lactic acid bacteria, gene-transferred luciferase is expressed, and amino acid quantification is performed using the action of the expressed luciferase.

  Non-patent document 3 discloses that ATP produced by Bifidobacterium was quantified by introducing a luciferase gene into Bifidobacterium and expressing the gene-generated luciferase. However, Non-Patent Document 3 does not mention quantification of amino acids.

Amino Acid / Nucleic Acid Meeting “Amino Acid Fermentation” Kyoritsu Shuppan Co., Ltd. (1972) 358-378 Kim, M. I. et al ,, (2010), Anal Chem 82, 4072-4077. Guglielmetti, S. et al ,, (2008), Int J Food Microbiol 124, 285-290

The bioassay method based on the growth of lactic acid bacteria described in Non-Patent Document 1 has the following problems.
(a) Because it is necessary to grow until the stationary phase, the culture requires a long time (16 hours or more)
(b) Since the amount of bacterial growth is measured by turbidity, sensitivity and accuracy are poor.
(C) Because it is a quantitative method based on the amount of bacterial growth, it is greatly affected by contaminants that affect growth.

  In the method described in Non-Patent Document 2, a long culture time of 4 hours or more is required for quantification, and light emission due to the action of luciferase is observed as an indicator of the growth amount of E. coli. Therefore, from this viewpoint, the method described in Non-Patent Document 2 is a measurement method based on the same principle as the bioassay method using lactic acid bacteria described in Non-Patent Document 1. Further, E. coli used in the method described in Non-Patent Document 2 shows requirements only for one type of amino acid, and it is necessary to prepare and use the same number of strains as the type of amino acid to be measured. Furthermore, this Escherichia coli was obtained from random mutant strains, and it is unclear what mutation each strain has, and what properties (especially amino acid requirement) it does not know. Thus, it is not easy to provide E. coli having the desired amino acid requirement.

  Bifidobacterium used in the method described in Non-Patent Document 3 is “Bifidobacteria”, and is not included in “lactic acid bacteria” in a narrow sense at least. Furthermore, with regard to Bifidobacterium longum tested in Non-Patent Document 3, there is no document that has examined the amino acid requirement in detail. However, genome analysis has been reported, and it is estimated that it has biosynthetic ability of various amino acids because there are biosynthetic pathway genes of almost all amino acids in the genome (Schell, MA et al , (2002), Proc Natl Acad Sci USA 99, 14422-14427). Therefore, it is presumed that, in principle, it is impossible to quantify amino acids using the bacteria prepared by the method described in Non-Patent Document 3 using the amino acid requirement of the bacteria.

  There are many lactic acid bacteria that exhibit requirements for a plurality of types of amino acids depending on the strain, and therefore, a single type of strain can be used to determine many types of amino acids. In addition, lactic acid bacteria have been subjected to property analysis and genome analysis for many years, and their properties are well understood. Accordingly, there is an awaiting provision of a method that can solve the above-mentioned problems (a) to (c) using such lactic acid bacteria.

  Therefore, the present invention is a method for quantifying amino acids that can be measured with high sensitivity and high accuracy in a short time by using lactic acid bacteria having auxotrophy related to amino acids, and is less susceptible to factors that affect the growth of bacteria. The purpose is to provide.

  The present inventors introduced a detectable protein expression system into amino acid-requiring lactic acid bacteria and allowed protein expression under conditions in which the amino acid amount was varied in various concentrations. As a result, there was a high correlation between the protein expression amount and the amino acid concentration. Found to show. However, if the lactic acid bacterium used for amino acid concentration quantification does not have a protein expression regulation mechanism, the protein is also expressed in the culture of the lactic acid bacterium before use for quantification. It became clear that it became a background in the case of, and hindered measurement with high sensitivity and high accuracy. Therefore, the present invention has been completed by incorporating means for solving such a new problem.

  That is, the amino acid-requiring lactic acid bacterium introduced with the detectable protein in a state in which expression can be regulated is preliminarily cultured under expression-suppressing conditions, and the culture after mixing the specimen with the target amino acid-restricted medium is performed under expression-inducing conditions. It was found that the protein was expressed by quantifying the amount of the expressed protein and the amount of the expressed protein was quantified to suppress the background, and the amino acid could be quantified with high sensitivity and high accuracy, thereby completing the present invention.

The present invention is as follows.
[1]
A lactic acid bacterium having auxotrophy for the amino acid to be measured is introduced in a state in which the expression of the protein gene can be regulated to obtain a recombinant lactic acid bacterium, provided that the protein is a protein whose expression level can be quantified, step (A),
In a medium containing a measurement target amino acid at a predetermined concentration, a step of obtaining a correlation between the amount of the protein produced by the recombinant lactic acid bacteria and the amino acid concentration under expression induction conditions of the protein gene (B),
Specimens are mixed in a medium not containing the amino acid to be measured, and the recombinant lactic acid bacteria are cultured in the obtained medium under the conditions for inducing expression of the protein gene, and are contained in the culture solution during or after the culture. Step (C) for measuring the amount of protein, and step (D) for determining the amount of amino acid contained in the sample from the amount of protein measured in step (C) based on the correlation obtained in step (B) (D )
Method for quantifying amino acids in a sample containing
[2]
The recombinant lactic acid bacterium obtained in the step (A) is cultured under the condition for suppressing the expression of the protein gene, and then collected if necessary, and the cultured or collected lactic acid bacterium recombinant is the step (B) and the step ( The method according to [1], which is used in C).
[3]
The method according to [1] or [2], wherein the recombinant is obtained by introducing a vector containing the protein gene downstream of an expression regulatory sequence into the lactic acid bacterium.
[Four]
The method according to [3], wherein the expression regulatory sequence is a nisin-inducible promoter.
[Five]
The method according to any one of [1] to [3], wherein the protein is selected from the group consisting of a photoprotein, a fluorescent protein, a binding protein, and an enzyme.
[6]
The method according to any one of [1] to [5], wherein the expression level of the protein can be quantified by an optical, immunological, electrochemical, or enzymatic method.

The present invention has advantages over the bioassay method based on the growth of lactic acid bacteria described in Non-Patent Document 1 as follows.
・ Measurement is possible in a short time of about 30 minutes. (However, it is not intended to limit the measurement time.)
-Highly sensitive and highly accurate measurement is possible by introducing and using a detectable protein such as luciferase in a state where expression can be regulated.
・ It can be measured even in the presence of contaminants that affect growth.

Furthermore, the present invention has the following advantages over the amino acid quantification method using amino acid-requiring E. coli described in Non-Patent Document 2.
・ There is no need for cumbersome operations such as the creation of random mutation libraries and screening of auxotrophic strains when using the host. ・ Multiple amino acids can be quantified in a single strain, making it easy to prepare bacteria. The protein that can be expressed and expressed is not limited to luciferase, and various detection methods other than luminescence can be used.

  In the method described in Non-Patent Document 2, it is considered difficult to quantify amino acids with high sensitivity and high accuracy based on protein expression. The reason for this is that the gene expression method of Non-Patent Document 2 is a system in which it is difficult to suppress the necessary expression before mixing with the sample, and the background is expected to be high. This is because it is expected that quantification based on protein expression is difficult even if amino acid quantification based on the growth of lactic acid bacteria is possible when suppression before expression induction is not sufficient.

Fig. 3 shows changes over time in luminescence intensity when luciferase-expressing Lactococcus lactis NZ9000 strain was placed in the presence of various concentrations of Leu. The numbers on the right of each curve indicate the Leu final concentration in the sample. The Leu standard curve by luciferase expression L. lactis NZ9000 strain is shown. The Ile standard curve by luciferase expression L. lactis NZ9000 strain is shown. The Val calibration curve by luciferase expression L. lactis NZ9000 strain is shown. The Arg calibration curve by L. lactis NZ9000 strain expressing luciferase is shown. Lluactase expression L. lactis Glu standard curve by NZ9000 strain is shown. The His calibration curve by luciferase expression L. lactis NZ9000 strain is shown. The Pro standard curve by luciferase expression L. lactis NBRC 100933 strain is shown. β-galactosidase expression L. lactis The NZ9000 strain is shown in β-galactosidase activity ratio when various concentrations of Arg are placed. The activity of the Arg concentration 1600 nM sample was taken as 100%. The Arg calibration curve by L. lactis NZ9000 strain when 0.75 μg / ml casamino acid is added or not is shown. The time-dependent change of the luminescence intensity of luciferase expression L. lactis NZ9000 strain under the condition of addition / non-addition of various antibiotics is shown. The Arg standard curve of luciferase-expressing L. lactis NZ9000 strain with and without ampicillin added is shown.

The method for quantifying amino acids in a sample of the present invention includes the following steps (A) to (D) (A):
A protein gene is introduced into a lactic acid bacterium having auxotrophy for the amino acid to be measured in a state in which the expression can be regulated to obtain a recombinant lactic acid bacterium. However, the protein is a protein whose expression level can be quantified.
Process (B):
In a medium containing the amino acid to be measured at a predetermined concentration, a correlation between the amount of protein produced by the recombinant lactic acid bacteria and the amino acid concentration is determined under the expression induction condition of the protein gene.
Process (C):
Specimens are mixed in a medium not containing the amino acid to be measured, and the recombinant lactic acid bacteria are cultured in the obtained medium under the conditions for inducing expression of the protein gene, and are contained in the culture solution during or after the culture. Measure the amount of protein.
Process (D):
Based on the correlation obtained in the step (B), the amount of amino acid contained in the sample is obtained from the amount of protein measured in the step (C).

Process (A)
In the present invention, the “measuring amino acid” in “lactic acid bacteria having auxotrophy for the measuring amino acid” can be, for example, a protein-constituting amino acid, and the protein-constituting amino acids are L-alanine, L-proline, L-valine, L-leucine, L-isoleucine, L-lysine, L-histidine, L-arginine, L-glutamine, L-serine, L-aspartic acid, L-glutamic acid, L-threonine, L-phenylalanine, L -Methionine, L-glycine, L-tyrosine, L-asparagine, L-tryptophan, L-cysteine. Further, “nutritional requirement for measurement target amino acid” means a property that lactic acid bacteria cannot synthesize the measurement target amino acid themselves in the body and need to be supplied from the medium in order to grow. Furthermore, the “lactic acid bacterium having an auxotrophy for the measurement target amino acid” means a lactic acid bacterium having an auxotrophy for the amino acid including the “measurement target amino acid”. The amino acid to be measured can be one kind or plural kinds.

  Examples of lactic acid bacteria having auxotrophy for amino acids are not particularly limited, but examples include those shown in the following table. Table 1 lists the lactic acid bacteria strain names and amino acids showing auxotrophy. Furthermore, Table 2 shows examples of lactic acid bacteria having auxotrophy for amino acids quoted from the Japanese Society for Lactic Acid Bacteria, Kyoto University Academic Press, and 2010 “Science of Lactic Acid Bacteria and Bifidobacteria”. In addition, “Science and Technology of Lactic Acid Bacteria” in the footnotes in Table 2 is edited by the Lactic Acid Bacteria Research Meeting, Society Publication Center, 1996.

*: Mandatory requirement, +: Promotion,-: No requirement §: When vitamin B ₆ system is removed from the medium A: Lactobacillus plantarum ATCC 8014
B: Lactobacillus rhamnosus ATCC 7469
C: Lactobacillus fermentum ATCC 9338
D: Enterococcus hirae ATCC 8043
E: Pediococcus acidilactici ATCC 8042
F: Pediococcus acidilactici ATCC 8081
G: Lactobacillus leichmanni

In addition, in the amino acid requirement of each lactic acid bacterium described in Table 1, amino acids marked as “*: essential requirement” can be quantified by the method of the present invention. Since all the lactic acid bacteria described in Table 1 have at least one amino acid marked “*: Essential requirement”, any of them can be used in the amino acid quantification method according to the method of the present invention. On the other hand, when the amino acid marked “+: accelerated” can be used for the quantification of amino acids according to the method of the present invention due to the behavior of lactic acid bacteria in the absence of the amino acid labeled “+: accelerated”. There are cases where it is impossible.
(1) When available for quantification:
・ When growth starts after a certain amount of lag is left until growth or when growth is possible but the growth rate is extremely low
(2) When it cannot be used for quantification (background expression in the absence of amino acids increases):
-It shows the growth rate close to that at the time of existence, and when there is no lag until the start of growth, it can be easily clarified by preliminary experiments whether each lactic acid bacterium shows the above behavior when each "promoting" amino acid is not added.

  In step (A), a protein gene is introduced in a state in which expression can be regulated to obtain a recombinant lactic acid bacterium. The protein is a protein capable of quantifying the expression level in the recombinant lactic acid bacteria. Examples of such proteins are shown in the following table together with the method for quantifying the expression level. However, it is not the intention limited to these.

  Specific examples of proteins and gene information sources of each protein are shown below.

  The method for quantifying the protein expression level is not particularly limited, and examples thereof include optical, immunological, electrochemical or enzymatic methods, growth tests, and the like, or combinations thereof. The method for quantifying the expression level of protein will be described in detail in step (B).

  The recombinant lactic acid bacterium used in the present invention can be obtained by introducing a protein gene into a host lactic acid bacterium in a state in which expression can be regulated. In order to introduce a protein gene in a state in which expression control is possible, an expression control sequence and an expression vector containing the protein gene downstream of the expression control sequence can be used. The expression vector may be any vector as long as it can express the protein in the amino acid-requiring host to be used. The higher the expression efficiency of the target protein, the more measurement is possible with the use of a smaller amount of recombinant lactic acid bacteria. As an expression system, for example, NICE system (MoBiTec) known for lactic acid bacteria can be mentioned. Introduction of an expression regulatory sequence and an expression vector containing a protein gene downstream of the expression regulatory sequence into a lactic acid bacterium which is a host can be performed by a conventional method.

  Examples of the expression regulatory sequence include a nisin-inducible promoter sequence (AAACGGCTCTGATTAAATTCTGAAGTTTGTTAGATACAATGATTTCGTTCGAAGGAACTACAAAATAAATTATAAGGAGGCACTCA, SEQ ID NO: 2).

  By using a recombinant lactic acid bacterium introduced with a protein gene in a state in which expression can be regulated, the expression level of the protein whose expression is regulated in the absence of an expression inducer can be suppressed to low or zero, and the background can be lowered. Thus, in culture under the expression-inducing condition to which an expression-inducing substance is added in step (B), the expression level of the protein whose expression is regulated is increased or the expression can be obtained for the first time. Enable. The expression inducer for the nisin-inducible promoter sequence is nisin. Nisin is an antimicrobial peptide composed of 34 amino acid residues.

  The recombinant lactic acid bacterium obtained in step (A) can be cultured by a conventional method to obtain a lactic acid bacterium recombinant used in steps (B) and (C). It is appropriate that this culture is carried out under conditions for suppressing the expression of the introduced protein. The culture under expression suppression conditions is culture in the absence of an expression inducer. The culture is performed in an environment in which the recombinant lactic acid bacteria can grow normally, except that it is performed in the absence of an expression inducer. After culturing, the recombinant lactic acid bacteria is used as it is together with the culture solution in the steps (B) and (C), or separated from the culture solution, collected and used in the steps (B) and (C). In the recombinant lactic acid bacterium obtained by culturing under the expression suppression condition, the expression of the introduced protein is suppressed, and the recombinant lactic acid bacterium does not substantially contain an expression product of the introduced protein gene. Therefore, in steps (B) and (C) performed under expression-inducing conditions, the introduced protein is expressed for the first time after culturing, and therefore depends on the presence and amount of the amino acid to be measured. The amount of protein expression changes, enabling highly sensitive and highly accurate measurement.

Process (B):
In a medium containing the amino acid to be measured at a predetermined concentration, a correlation between the amount of protein produced by the recombinant lactic acid bacteria and the amino acid concentration is determined under the expression induction condition of the protein gene.
The amino acid to be measured is determined in consideration of the type of specimen and the amino acid requirement of the lactic acid bacteria recombinant used. The medium used in the present invention may be any medium as long as it does not contain the measurement target amino acid, suppresses protein synthesis when the measurement target amino acid is not added, and causes rapid protein synthesis when the measurement target amino acid is added. That is, as a culture medium, amino acids other than the measurement target contain types and amounts necessary for the growth of recombinant lactic acid bacteria, and also contain nutritional components other than amino acids.

  A plurality of types of media containing a predetermined concentration of the measurement target amino acid corresponding to the measurement concentration range are prepared in this medium. Furthermore, since culture using each medium is performed under the conditions for inducing protein gene expression, an expression inducer is added to each medium. The expression inducer is appropriately selected from substances that activate the expression regulatory sequence. The addition amount of the expression inducer can be appropriately determined according to the type of the expression inducer.

  The quantification of the amount of protein produced by the recombinant lactic acid bacterium can be appropriately selected depending on the type of protein, and can be performed, for example, by an optical, immunological, electrochemical or enzymatic method or bioassay. The optical method is, for example, a method for measuring a light emission amount, a fluorescence amount, an absorbance, or the like. The method based on luminescence detection and fluorescence detection enables highly sensitive quantification. The immunological method is a method using an antibody against a protein, and when an antibody with a fluorescent label is used, it can be combined with an optical method. The electrochemical method is a method of electrochemically measuring the concentration of a substance produced by the action of an enzyme when the protein is an enzyme, for example. For example, when the substance produced by the action of the enzyme is hydrogen ion or hydroxide ion, the hydrogen ion concentration can be electrochemically measured using a pH electrode. In the enzymatic method, for example, a protein is an enzyme, and substances that can be measured, for example, luminescence or electrochemically are generated by the action of the enzyme, and these are measured by an optical method or an electrochemical method. be able to. Toxin bioassay is a method using bacteria or cells sensitive to toxin and can be measured by examining the size of the inhibition circle and the minimum growth concentration.

  Quantification of the amount of protein produced by the recombinant lactic acid bacteria can be performed continuously or intermittently in parallel with the expression of the protein by the recombinant lactic acid bacteria depending on the quantitative method. For example, when a photoprotein such as luciferase or a fluorescent protein such as GFP is used, luminescence and fluorescence can be monitored over time while protein expression is performed. Also, in the electrochemical method, a substance to be measured electrochemically can be measured simultaneously with protein expression.

  In step (B), the correlation between the amount of protein produced by the recombinant lactic acid bacteria and the amino acid concentration is determined. The obtained correlation can be, for example, a calibration curve or a correlation equation can be input to a computer.

Process (C):
Specimens are mixed in a medium not containing the amino acid to be measured, and the recombinant lactic acid bacteria are cultured in the obtained medium under the conditions for inducing expression of the protein gene, and are contained in the culture solution during or after the culture. Measure the amount of protein. Culture of the recombinant lactic acid bacteria and measurement of the amount of protein can be carried out in the same manner as in step (B).
Depending on the measurement method, the amount of protein contained in the culture solution can be measured continuously or intermittently during the culture, and depending on the measurement method, the components in the culture solution can be analyzed after the culture. Sometimes it is done at. Moreover, when measuring after culture | cultivation, after isolate | separating a microbial cell from a culture solution, the quantity of the protein contained in a culture solution can also be measured by measuring the quantity of the protein in a microbial cell sample. .

  There is no particular limitation on the sample targeted by the amino acid quantification method of the present invention. The sample used in the present invention may be any sample as long as it may contain the measurement target amino acid. A substance that inhibits / promotes the growth of the recombinant lactic acid bacterium to be used may be included as long as it does not contain a substance that inhibits protein synthesis of the recombinant lactic acid bacterium used and amino acid incorporation into the cell. Examples thereof include biological samples such as food samples, various media, and plasma.

Step (C) is more specifically,
A step of mixing a medium and sample limited only to the measurement target amino acid, a recombinant lactic acid bacterium introduced in a state in which the expression of the protein required for the measurement target amino acid can be regulated, a protein expression inducer, and, if necessary, water or a buffer ( C1),
The step of leaving the reaction solution obtained by the mixing for a predetermined time at a temperature suitable for protein expression (C2), and the step of measuring the amount of expressed protein present in the reaction solution after standing (C3)
including.

  The temperature in the step (C2) may be any temperature that is suitable for the growth of recombinant lactic acid bacteria, and may be, for example, in the range of 10 to 40 ° C. In addition, the predetermined time for leaving in the step (C2) is appropriately determined according to the concentration of the amino acid to be measured contained in the specimen, the type of recombinant lactic acid bacteria, particularly the type of bacterial cells that became the host and the type of protein to be expressed. Can be determined.

  Steps (C1) to (C3) may be carried out in separate containers, or steps (C1) to (C3) may be carried out in a single container. As an example of the former, after completion of the step (C1), the mixed solution is transferred to a protein expression container and used for the step (C2), and then transferred to a measurement container and used for the step (C3). Examples of the latter include an example in which steps (C1) to (C3) are continuously performed in a container capable of mixing various components and expressing and measuring proteins. In the latter example, a method may be used in which the step (C2) and the step (C3) are performed simultaneously, that is, the amount of the protein is monitored while being expressed.

  The amount of sample liquid in the steps (C1) to (C3) may be any as long as mixing and measurement are possible. A solution of the order of milliliters or more may be measured, a solution of the order of several tens to several hundreds of microliters may be measured with a 96-well plate, or a trace amount solution of the order of microliters or less is measured using a microchannel device. May be. Alternatively, the steps (C1) to (C3) may be performed by immobilizing the recombinant lactic acid bacteria in a microarray and dropping a sample thereon.

Process (D):
Based on the correlation obtained in the step (B), the amount of amino acid contained in the sample is obtained from the amount of protein measured in the step (C). In step (B), the correlation equation is input to the computer, the measurement result of the amount of protein obtained in step (C) is input to the computer, the amino acid concentration is converted by the computer, and the result is output. You can also Alternatively, when a calibration curve is prepared in step (B), the amino acid concentration can also be converted by comparing the measurement result of the amount of protein obtained in step (C) with the calibration curve.

  As described above, the specimen in the method of the present invention can be, for example, a biological sample such as a food sample, various media, or plasma. Therefore, the method of the present invention can be used as a method for analyzing amino acids in foods, and further can be used as a method for analyzing amino acids in biological samples such as plasma.

  Hereinafter, the present invention will be described in detail with reference to examples, but the present invention is not limited thereto.

Example 1 Construction of recombinant lactic acid bacteria (step (A))
1. Example of construction of luciferase expression system pNZ8148 (MoBiTec) was used as an expression vector, and a gene on pGL3 (Promega) was used as a firefly-derived luciferase gene. pGL3 was subjected to NcoI and XbaI treatment, and a luciferase gene fragment (SEQ ID NO: 1) was isolated. This was ligated with the pNZ8148 vector subjected to the same combination of restriction enzyme treatments, and an expression plasmid having a luciferase gene downstream of the nisin-inducible promoter (SEQ ID NO: 2, origin Lactococcus lactis NZ9700 strain) was constructed.

2. Example of construction of β-galactosidase expression system β-galactosidase gene lacZ (SEQ ID NO: 3, origin) using Escherichia coli K-12 genome as a template and the following lacZ-F and lacZ-R as primers Escherichia coli K-12 strain) was amplified. The obtained PCR product and pNZ8148 were subjected to NcoI and HindIII treatment and ligation. The resulting expression plasmid has lacZ downstream of the nisin inducible promoter (SEQ ID NO: 2).
lacZ-F: AACCATGGGGACCATGATTACGGATTCAC (SEQ ID NO: 4)
lacZ-R: TATAAGCTTATTTTTGACACCAGACCAACTG (SEQ ID NO: 5)

3. Expression plasmid introduction into each strain of Lactococcus lactis L. lactis NZ9000 strain and L. lactis NBRC 100933 strain were used as hosts for luciferase and β-galactosidase expression systems. Competent cell preparation was performed according to the procedure according to the Promega NICE system manual. Competent cells were mixed with the above luciferase or β-galactosidase expression plasmid, transferred to a 1 mm gap electroporation cuvette, and electroporated with an Electro Cell Manipulator 600 manufactured by BTX at 1500 V and 182Ω. The bacterial suspension was cultured in a selective medium, and a transformant retaining the expression plasmid was obtained.

  In order for transcription from the Nisin-inducible promoter to occur, a nisin response regulator is required. The L. lactis NZ9000 strain has a regulator gene in the genome, whereas the L. lactis NBRC 100933 strain has no regulator gene. Therefore, for the above-mentioned expression plasmid-retaining L. lactis NBRC 100933 strain, a competent cell was further prepared, and plasmid pNZ9530 (MoBiTec) having a nisin regulator gene (SEQ ID NO: 6, 7, origin Lactococcus lactis NZ9700 strain) And transformed again. The obtained strain was used as L. lactis NBRC 100933 strain for expression.

Example 2 Creating a calibration curve (process (B))
1. Luciferase expression L. lactis NZ9000 strain luminescence profile and calibration curve under various amino acid measurement conditions
Since L. lactis NZ9000 strain shows Leu requirement, the luminescence profile in the presence of various concentrations of Leu was examined.
The above luciferase-expressing L. lactis NZ9000 strain was cultured in a normal medium for lactic acid bacteria (M17 medium supplemented with 0.5% glucose; nisin not added), and then collected with 20 mM K-PO ₄ buffer (pH 7.0) Washed to prepare a bacterial suspension from which the medium components were removed. To achieve 2% inoculum, the suspension of the fungus, Leu measurement medium with the composition shown in Tables 5 and 6, nisin solution (final concentration 10 μg / ml), and luciferin solution (final concentration) as a substrate for luciferase 250 μM) and various concentrations of Leu solution were mixed. The above mixed solution was set in a microplate reader set at 30 ° C., and the change in luminescence intensity over time was monitored.

  The change in luminescence intensity of each sample containing different concentrations of Leu is shown in FIG. In the sample with high Leu concentration, the emission intensity increased from the start of monitoring. A high positive correlation was found between the rate of increase in luminescence intensity and the Leu addition concentration.

  In the change from the basic composition of the medium for amino acid measurement shown in Table 6 above, when the amino acid to be measured is Glu and Ile, Asp is replaced with Asn in Glu measurement, and Leu Val is used in Ile measurement. Reduced the amount. These changes were made based on the description of Non-Patent Document 1. However, in the method of the present invention, even in the measurement under the conditions where these changes are not made, there was no significant difference between the quantitative results and the cases where the changes were made. In addition, Ala non-addition in Glu measurement was adopted as a result of examination by the present inventor because it was found that non-Ala addition slightly improved the linearity of the Glu calibration curve. However, Glu can be quantified even under Ala addition conditions.

  In addition, it is guessed that the reason for making the above changes in Non-Patent Document 1 is to suppress biosynthesis of Asle to Glu, Leu, or Val from Ile. If the above-described change is not made in the quantification method of Non-Patent Document 1, it is unclear whether it will have little or no significant effect as in the quantification method of the present invention. In the latter case, the above-mentioned biosynthesis may occur depending on the type of bacteria, or the method of Non-Patent Document 1 requires a longer period of culture to complete the growth compared to the present invention. The possibility of giving is considered. In any case, the method of the present invention had little influence.

2. Luciferase expression L. lactis NZ9000 strain Arg, His, Glu, Leu, Ile, Val calibration curve 30 minutes after the start of monitoring from the luminescence amount change data of Fig. 1 obtained by the above procedure When the luminescence intensity was extracted and plotted with the horizontal axis as the Leu concentration, it was as shown in FIG. 2, and a high correlation was observed between the Leu concentration and the luminescence intensity. Therefore, it was shown that a Leu calibration curve having high linearity can be obtained by the measurement method as described above.

  Furthermore, measurement was also performed on Arg, His, Glu, Ile, and Val, which are required amino acids of L. lactis NZ9000 strain, by the same procedure as Leu. The obtained luminescence intensity and each amino acid concentration at that time are shown in FIGS. For any amino acid, a high correlation was observed between the amino acid concentration and the luminescence intensity. Therefore, it was shown that an Arg, His, Glu, Ile, Val calibration curve having high linearity can be obtained by the measurement method as described above.

3. Pro calibration curve with luciferase expression L. lactis NBRC 100933 strain
L. lactis NZ9000 strain is non-Pro-required, and unlike the above Arg, His, Glu, Leu, Ile, Val, it does not show an increase in luminescence depending on the amino acid concentration for Pro. On the other hand, L. lactis NBRC 100933 is known to have Pro requirements. It was verified whether or not a Pro calibration curve could be created using a luciferase-expressing strain constructed from the original strain of L. lactis NBRC 100933. The measurement using the L. lactis NBRC 100933 strain was carried out in the same procedure as the above-mentioned measurement using the L. lactis NZ9000 strain except that the nisin concentration was 50 μg / ml.

  The obtained emission intensity and each Pro acid concentration at that time are shown in FIG. A high correlation was found between Pro concentration and luminescence intensity. Therefore, it was shown that a Pro calibration curve having high linearity can be obtained by the measurement method as described above. Moreover, it was shown that the target amino acid can be quantified by introducing an expression system into an organism exhibiting a requirement for the amino acid to be measured.

4. β-galactosidase expression L. lactis Arg standard curve with NZ9000 strain Above β-galactosidase expression L. lactis NZ9000 strain normal medium for lactic acid bacteria (0.5% glucose added M17 medium; nisin not added) After culturing, the cells were washed and washed with 20 mM K-PO ₄ buffer (pH 7.0) to prepare a bacterial suspension from which the medium components were removed. The bacterial suspension was mixed with an Arg measurement medium having the composition shown in Tables 5 and 6, a nisin solution (final concentration of 10 μg / ml), and various concentrations of Arg solutions so that the amount of inoculation was 5%. The mixture was allowed to stand at 30 ° C. for 1 hour, and then galactosidase activity was measured.

  The measurement result is shown in FIG. 9, and a high correlation was observed between the Arg concentration and the luciferase activity. Therefore, it was shown that an Arg calibration curve having high linearity can be obtained by the measurement method as described above. Moreover, the protein to be expressed is not limited to luciferase, and it was shown that amino acid quantification is possible by looking at the expression level of other proteins.

Example 3 Arg addition and recovery experiment in casamino acid solution (process (B), (C))
Luciferase expression in Reference Example 2 above L. lactis NZ9000 strain In the same procedure as preparing an Arg calibration curve, a sample with a final concentration of 0.75 μg / ml casamino acid added to the mixture was added. Another set of samples that did not exist was prepared.
FIG. 10 shows the obtained emission intensity and the Arg concentration at that time. The group with and without casamino acid added showed the same slope in FIG. 10, indicating that the quantitativeness by this method was not impaired by the addition of casamino acid.
From the luminescence intensity of the sample added with casamino acid and not added with Arg, the concentration of Arg derived from casamino acid in the sample was calculated to be 140 nM. On the other hand, when the casamino acid solution was analyzed with an amino acid analysis system Waters UPLC Amino Acid Analysis Solution system, the Arg concentration in the 0.75 μg / ml casamino acid solution was calculated to be 133 nM. Since almost the same quantitative values were obtained by both methods, the quantitative property by the method of the present invention was supported.

Example 4
1. Luminescence profile and amino acid calibration curve in the presence of antibiotics The above luciferase-expressing L. lactis strain NZ9000 was cultured in a normal medium for lactic acid bacteria (M17 medium supplemented with 0.5% glucose; nisin not added). After the bacterium was washed with 20 mM K-PO ₄ buffer (pH 7.0) to prepare a microbial suspension excluding the medium components. The bacterial suspension, the medium having the basic composition shown in Table 5, and the nisin solution (final concentration 10 μg / ml) were mixed so that the amount of inoculation was 2%. After adding ampicillin, erythromycin, tetracycline, or water to this mixed solution, the mixed solution was set in a microplate reader set at 30 ° C., and the change in luminescence intensity over time was monitored.

  FIG. 11 shows changes with time in the emission intensity of each sample. The ampicillin added sample showed almost the same increase in luminescence as the non-added sample for a short time of about 30 minutes after mixing. Ampicillin is known to inhibit cell wall synthesis and stop bacterial growth, but not protein translation. The above results clearly show that the increase in the amount of luminescence in this system is not due to bacterial growth. On the other hand, in the sample to which erythromycin or tetracycline that inhibits protein translation was added, no significant increase in luminescence was observed. This result indicates that an increase in the amount of luminescence in this system occurs depending on protein translation.

  A sample in which 10 μg / ml ampicillin was added to the mixed solution was also prepared by the same procedure as the above Arg calibration curve preparation, and the luminescence intensity was measured about 30 minutes after mixing. FIG. 12 shows an Arg calibration curve prepared from the sample with or without Ampicillin added. Even in the presence of Ampicillin, a calibration curve that was not significantly different from the calibration curve in the absence was obtained. From this, it was shown that this quantification method can be quantified without being affected even in the presence of substances such as ampicillin that affect the growth of bacteria. Moreover, since a calibration curve could be created even in the presence of ampicillin that inhibits the growth of bacteria, it was clearly shown that this quantification method is not a technique based on the growth of bacteria as in the conventional bioassay method.

Amino acid analysis is used as a marker for food quality control and detection of various diseases, and can be said to be a technology in demand in a wide range of industrial fields. At present, there is almost no choice but to use instrumental analysis such as HPLC in order to perform various types of amino acid analysis. However, instrumental analysis requires expensive and large-scale analytical instruments, and it is difficult to perform quick measurements on site. In addition, when request analysis is performed instead of on-site measurement, expensive analysis is required for sample analysis, storage and transportation, and its use is limited to a limited range.
The method of the present invention can rapidly measure many kinds of amino acids. In addition, by changing the protein to be expressed according to available detection equipment, it is possible to perform detection at low cost by various methods. Therefore, the present invention is highly versatile according to the measurement environment, and can be said to be a technique that can be widely used in the food and medical fields. Furthermore, this technology can be integrated and miniaturized using microchannels, and can be applied to high-throughput measurement systems.

Claims (6)

A protein gene is introduced into a lactic acid bacterium having an auxotrophy for the amino acid to be measured in a state in which the expression of the protein gene can be regulated, and cultured under conditions for suppressing the expression of the protein gene to obtain a recombinant lactic acid bacterium, provided that the expression level of the protein is Step (A), which is a quantifiable protein
In a medium containing a measurement target amino acid at a predetermined concentration, culturing the recombinant lactic acid bacteria obtained in the step (A) under the conditions for inducing expression of the protein gene, and the amount of protein produced within 60 minutes after the start of the culture and the above Step of obtaining a correlation with amino acid concentration (B),
A sample is mixed in a medium not containing an amino acid to be measured, and in the obtained medium, the lactic acid bacteria group obtained in the step (A) is the same as the step (B), under the conditions for inducing expression of the protein gene. Culturing the recombinant, measuring the amount of protein produced in the culture solution within 60 minutes after the start of the culture (C), and based on the correlation obtained in the step (B), in the step (C) Step of determining the amount of amino acid to be measured contained in the sample from the measured protein amount (D)
Method for quantifying amino acids in a sample containing The recombinant lactic acid bacterium obtained in the step (A) is cultured under the condition for suppressing the expression of the protein gene, and then collected if necessary, and the cultured or collected lactic acid bacterium recombinant is the step (B) and the step ( The method according to claim 1 used in C). 3. The method according to claim 1, wherein the recombinant is obtained by introducing a vector containing the protein gene downstream of an expression regulatory sequence into the lactic acid bacterium. 4. The method of claim 3, wherein the expression regulatory sequence is a nisin inducible promoter. The method according to any one of claims 1 to 3, wherein the protein is selected from the group consisting of a photoprotein, a fluorescent protein, a binding protein, and an enzyme. 6. The method according to any one of claims 1 to 5, wherein the expression level of the protein can be quantified by an optical, immunological, electrochemical or enzymatic method.