JP5398982B2 - Nanoparticles containing RNA ligands - Google Patents

Description

  The present invention relates to nanoparticles, and more particularly to nanoparticles comprising RNA ligands such as small interfering RNA (siRNA) and microRNA (miRNA), and their use in various applications.

  Small RNA molecules have been found to play diverse roles in regulating gene expression. These include targeted degradation of mRNA by small interfering RNA (siRNA), post-transcriptional gene silencing (PTG), and sequence-specific translational repression and targeting of developmentally regulated mRNA by microRNA (miRNA). Transcribed gene silencing. RNAi activity limits transposon mobilization and provides antiviral protection (Pal-Bhadra et al., 2004). The RNAi mechanism and the role of small RNAs in targeting heterochromatin complexes and epigenetic gene silencing at specific chromosomal loci have also been demonstrated (Verdel et al., 2004). In addition, double-stranded RNA (dsRNA) -dependent post-transcriptional silencing, also known as small inhibitory RNA (siRNA) or RNA interference (RNAi), is a specific homologous gene for dsRNA complexes for short-term silencing. It is a phenomenon that can be targeted. Acts as a signal to promote degradation of mRNA with sequence identity. A 20 nt siRNA is generally long enough to induce gene-specific silencing but short enough to escape the host response (Elbashir et al., 2001). The reduction in expression of the targeted gene product can be significant, with 90% silencing induced by several molecules of siRNA.

  The use of siRNA can have advantages over conventional gene therapy, since delivery of small oligonucleotides can avoid the difficulties associated with gene therapy. To date, efficient delivery of vector-based therapeutic genes in vivo remains a hindrance to the success of gene therapy. Although knockdown of the target gene by siRNA is not permanent, it has been observed that single siRNA transfection can result in prolonged inhibition of the target protein in parental and progeny cells (Tuschl, 2001). ). However, there are still problems in the technical field of siRNA delivery.

  WO02 / 32404 (Consejo Superior de Investigaciones Scientificas) discloses nanoparticles formed from metal or semiconductor atoms in which a carbohydrate-containing ligand is covalently bound to the core of the nanoparticle. These nanoparticles are used to modify carbohydrate-mediated interactions and are soluble and non-toxic. The PCT application claiming priority from GB-A-0313259.4 (Consejo Superior de Investigaciones Scientificas and Midatech Limited) is a core containing passivated and magnetic metal atoms, covalently bound to the ligand Magnetic nanoparticles having a core are disclosed.

SUMMARY OF THE INVENTION In general, the present invention relates to nanoparticles comprising metal and / or semiconductor atoms and having a core bound to an RNA ligand. RNA ligands are generally short RNA sequences designed to mimic small interfering RNA (siRNA) and microRNA sequences (miRNA). Nanoparticles can be used to deliver RNA ligands and in a wide range of applications have in vitro systems and uses for therapeutic or diagnostic applications. As an example, the nanoparticles of the present invention can be used for (1) targeted transcriptional gene silencing, (2) targeted mRNA degradation, (3) mRNA imaging, (4) multiple on the same or different nanoparticles. Inhibiting pathways by using RNA ligands of (5) for example, aerosol delivery to the lung, (6) in combination with mRNA silencing to target siRNA resistant mRNA, and (7) tools in functional genomics Can be used to

  In the art, short RNA sequences are referred to as “small interfering RNA” (siRNA) or “microRNA” (miRNA) depending on their origin. Both types of sequences can be used to down-regulate gene expression by either binding to complementary RNA (nmRNA) and causing mRNA exclusion (RNAi) or stopping translation of mRNA into protein. . siRNAs are obtained by processing long double stranded RNAs and are usually of exogenous origin when found in nature. Micro-interfering RNA (miRNA) is a small, non-coding RNA that is endogenously encoded and obtained by short hairpin processing. Both siRNA and miRNA can inhibit translation of mRNA that retains a partially complementary target sequence without cleaving the RNA, and can degrade mRNA that retains a completely complementary sequence. The RNAi pathway also acts on the genome as discussed in Science, 301: 10106-1061, 2003.

  The RNA associated with the nanoparticle may be single-stranded or double-stranded. When miRNA-like sequences are used as ligands, the RNA sequences can be hairpins, i.e., contain regions that are partially complementary towards the ends that can be annealed to form hairpins. The nanoparticles can optionally include additional types of ligands, such as carbohydrates to form sugar nanoparticles, and / or two or more types of siRNA. Nanoparticles and their uses are discussed in more detail below. Advantageously, the binding of siRNA to the nanoparticles can provide protection from exoribonucleases present in the siRNA in the blood, tissue culture medium or cells.

  Accordingly, in a first aspect, the present invention provides a nanoparticle comprising a core containing metal and / or semiconductor atoms, wherein the core is covalently bound to a plurality of ligands including an RNA ligand.

  The siRNA ligand that forms the nanoparticle may be single-stranded or double-stranded. However, in order to optimize the effectiveness of RNA-mediated down-regulation of target gene function, the length of the siRNA molecule ensures the correct recognition of the siRNA by the RISC complex that mediates siRNA recognition of the mRNA target. Preferably, the siRNA is short enough to reduce the host response when the nanoparticles are administered in vivo.

  miRNA ligands are usually single-stranded and have partially complementary regions that allow the ligand to form a hairpin. miRNAs are usually in the form of single-stranded RNA and are thought to regulate the expression of other genes. miRNAs are RNA genes that are transcribed from DNA but not translated into protein. The DNA sequence encoding the miRNA gene is longer than the miRNA. This DNA sequence includes the miRNA sequence and the appropriate reverse complement. When this DNA sequence is transcribed into a single-stranded RNA molecule, the miRNA sequence and its reverse complement base pair form a double-stranded RNA segment, and the entire RNA structure is called the hairpin structure (`` short hairpin RNA '' Or shRNA). Dicer enzyme then cleaves the double stranded region from the hairpin structure, releasing the mature miRNA.

  shRNA can be produced intracellularly by transfecting cells with a DNA construct that encodes an shRNA sequence under the control of an RNA polymerase III promoter, eg, the human H1 or 7SK promoter. Alternatively, shRNA can be synthesized exogenously and introduced directly into cells.

  Usually, RNA ligands intended to mimic the action of siRNA or miRNA are between 10 and 40 ribonucleotides (or synthetic analogues thereof), more preferably between 17 and 30 ribonucleotides, more preferably It has between 19 and 25 ribonucleotides, most preferably between 21 and 23 ribonucleotides. In some embodiments of the invention using double stranded siRNA, the molecule may have, for example, a synthetic 3 ′ overhang of 1 or 2 (ribo) nucleotides, usually a UU of a dTdT3 ′ overhang. is there.

  When miRNA is generated by cleavage of shRNA, the shRNA sequence is preferably between 40 and 100 bases in length, more preferably between 40 and 70 bases in length. The stem of the hairpin is preferably between 19 and 30 base pairs in length. The stem can include GU pairing to stabilize the hairpin structure.

  In embodiments using double stranded RNA, the sense and antisense strands can be annealed to form a double strand. By including double strands in the reaction mixture to form nanoparticles, RNA can bind to the core during particle self-assembly. Depending on the number of derivatized ends of the double-stranded siRNA (4 possibilities, 5 'and 3' ends of each strand), up to 4 nanoparticles are bound to a single siRNA duplex In theory, up to 15 possible constructs are formed for each double-stranded siRNA, one of which has 4 nanoparticles (2 at each end) and 4 of which are 1 6 types have 2 nanoparticles and 4 types have 3 nanoparticles. When single-stranded siRNA is used, the nanoparticle core can be attached to either or both derivatized ends of the siRNA (i.e., the 5 ′ or 3 ′ end), e.g., three different types of Nanoparticles are produced. These nanoparticles may be used in this form, or the method may optionally include an additional step of annealing the siRNA containing nanoparticles with the complementary strand of the siRNA, thereby pre-forming in situ. Double strands are formed on the nanoparticles. In the formation of miRNA-like ligands, usually one or two nanoparticles are bound to the end of the RNA sequence.

Accordingly, in a further aspect, the present invention provides a method for producing the nanoparticles described herein. The method involves derivatizing RNA strands (both strands) with a linker and conjugated the RNA ligand to the nanoparticle core by including the derivatized RNA in the reaction mixture in which the nanoparticle core is synthesized. Conveniently including gating. During nanoparticle self-assembly, the nanoparticle core binds to RNA via a linker. The linker is preferably a disulfide linker, such as a mixed disulfide linker, although ethylene linkers or peptide linkers can also be used. Exemplary linker groups are represented by the general formula HO— (CH ₂ ) _n —SS— (CH ₂ ) _m —OH, where n and m are independently between 1 and 5. The RNA is conveniently attached to the spacer via a terminal phosphate group and, in the case of the preferred mixed disulfide linker, via one of the terminal hydroxy groups. When synthesizing nanoparticles, the linker -SS- can be split to form two thiolinkers, which can each be covalently bonded to the nanoparticle core via the -S- group. The use of mixed disulfide linkers helps avoid the formation of RNA dimers.

  As indicated above, when the RNA bound to the nanoparticle core is single stranded, the method anneals RNA molecules that are complementary to the first strand and binds to the nanoparticles. A further step of providing the present double stranded RNA ligand may be included. It is also possible to prepare nanoparticles containing an annealed double-stranded RNA, with one or both of the strands functionalized with a disulfide linker. Alternatively or additionally, the sense and antisense strands of RNA can be combined with different nanoparticles and annealed together.

  In a preferred embodiment of the invention, one or both ends of the RNA can be derivatized with mixed disulfides so that double-stranded RNA is incorporated in the self-assembly of the nanoparticles. After incorporation of the double strand into the nanoparticle, both the RNA and mixed disulfide chemical components are incorporated into the beads. As a result, the mixed disulfide chemical composition can itself contain important information, such as targeting properties (e.g., members of a specific binding pair), or additional physical characteristics in the final formed nanoparticles. May offer. Mixed disulfides can be attached to either the 3 ′ end (or both ends) or 5 ′ end (or both ends) of the sense or antisense strand.

In one embodiment, nanoparticles having a core containing a gold atom can be synthesized using the protocol originally described in WO02 / 32404, in which a disulfide linker is used to derivatize the ligand in the presence of a reducing agent. The derivatized ligand is reacted with HAuC1 ₄ (tetrachloroauric acid) to produce nanoparticles. In this method, disulfide protected RNA in methanol or water can be added to an aqueous solution of tetrachloroauric acid. A preferred reducing agent is sodium borohydride. These or other features of this method are described in WO02 / 32404.

  In some applications, multiple different RNA molecules can be used. These may be provided as different ligands conjugated to a set of nanoparticles, or different RNA molecules may be separate populations of nanoparticles and mixed together as appropriate. In the first case, one of ordinary skill in the art will appreciate that mixing of products occurs as a result of conjugation of RNA to nanoparticles, and as indicated above, a series of nanoparticles can contain various products. When using multiple ligands, ligands that mimic both siRNA and miRNA can be used.

  In addition to RNA molecules, nanoparticles can include one or more additional types of ligands, and / or RNA ligands can include one or more different types of groups or domains in addition to RNA components. . For example, the additional ligand or group or domain of the ligand may comprise one or more peptides, protein domains, nucleic acid molecules, lipid groups, carbohydrate groups, any organic group or anionic or cationic group. The carbohydrate group can be a polysaccharide, oligosaccharide or monosaccharide group. Preferred ligands include glycoconjugates, thereby forming sugar nanoparticles. As shown below in the discussion on the use of nanoparticles, the ligand (RNA or additional ligand) can be a member of a specific binding pair and the nanoparticle to the target location where the other member of the specific binding pair is present. Can be used for targeting. In addition to RNA ligands, where a nucleic acid molecule is present, the nucleic acid molecule can include single-stranded or double-stranded DNA or RNA. The particles can have more than one type of ligand immobilized thereon, for example 2, 3, 4, 5, 10, 20 or 100 different ligands. Alternatively or additionally, a plurality of different types of nanoparticles may be used together. In a preferred embodiment, the average number of total ligands bound to the individual metal cores of the particle is at least 1 ligand, more preferably 50 ligands and most preferably 60 ligands.

  The nanoparticles have a core with an average diameter between 0.5 and 50 nm, more preferably between 0.5 and 10 nm, more preferably between 1.0 and 5 nm, even more preferably between 3.0 and 7.0 nm. Is preferred. When considering ligands in addition to the core, the total average diameter of the particles is preferably between 5.0 and 100 nm, more preferably between 5 and 50 nm, most preferably between 10 and 30 nm. The average diameter can be measured using techniques well known in the art, such as a transmission electron microscope.

The core material may be a metal or a semiconductor and may be formed from more than one type of atom. The core material is preferably a metal selected from Au, Fe or Cu. Nanoparticle cores may also be formed from alloys including Au / Fe, Au / Cu, Au / Gd, Au / Fe / Cu, Au / Fe / Gd and Au / Fe / Cu / Gd, Can be used in the present invention. Preferred core materials are Au and Fe, and the most preferred material is Au. The core of the nanoparticle preferably comprises between about 100 and 500 atoms (eg, gold atoms) to provide a core diameter in the nanometer range. Other particularly useful core materials are doped with one or more atoms that are NMR active, allowing the nanoparticles to be detected using NMR both in vitro and in vivo. Examples of NMR active atoms include Mn ^{+ 2} , Gd ^{+ 3} , Eu ^{+ 2} , Cu ^{+ 2} , V ^{+ 2} , Co ^{+ 2} , Ni ^{+ 2} , Fe ^{+ 2} , Fe ^{+ 3} and lanthanide ^{+ 3} or Examples include quantum dots described elsewhere.

  Nanoparticle cores containing semiconductor atoms can act as quantum dots, i.e. they can absorb light, thereby exciting electrons in the material to higher energy levels, followed by photons of light at a frequency characteristic of the material. Can be detected as a semiconductor crystal of nanometer scale that emits. Examples of semiconductor core materials include cadmium selenide, cadmium sulfide, and cadmium telluride. Also included are zinc compounds such as zinc sulfide.

  In some embodiments, the nanoparticles or RNA molecules of the invention comprise a detectable label. The label can be the core of the nanoparticle or an RNA ligand or an element of another ligand. The label can be detected by the intrinsic properties of the element of the nanoparticle or by being bound, conjugated or associated with a further moiety that is detectable. Preferable examples of the label include a fluorescent group, a radionuclide, a magnetic label, or a label that is a dye. Fluorescent groups include fluorescein, rhodamine or tetramethylrhodamine, Texas Red, Cy3, Cy5, etc., which can be detected by fluorescence label excitation and detection of synchrotron radiation using Raman scattering spectroscopy (YCCao, R. Jin, CAMirkin, Science 2002, 297: 1536-1539).

In some embodiments, the nanoparticle is a radionuclide used to detect the nanoparticle using radioactivity emitted by the radionuclide, e.g., by using PET, SPECT, or therapeutic, i.e. target It may contain a radionuclide for killing the cells. Examples of radionuclides commonly used in the art that can be easily adapted for use in the present invention are present in various oxidation states, the most stable being TcO ^{4- 99m} Tc, ³² P Or ⁶⁷ Cu, Ga ³⁺ salt, often used as ³³ P, ⁵⁷ Co, ⁵⁹ Fe, Cu ²⁺ salt, for example, ⁶⁷ Ga, ⁶⁸ Ge, ⁸² Sr, ⁹⁹ Mo, ¹⁰³ Pd, usually ¹¹¹ In used as an In ³⁺ salt, usually used as sodium iodide, ¹²⁵ I or ¹³¹ I, ¹³⁷ Cs, ¹⁵³ Gd, ¹⁵³ Sm, ¹⁵⁸ Au, ¹⁸⁶ Re, usually Tl ⁺ salts such as thallium chloride ²⁰¹ Tl, ³⁹ Y ³⁺ , ⁷¹ Lu ³⁺ and ²⁴ Cr ²⁺ used as The general use of radionuclides as labels and tracers is well known in the art and can be readily adapted by those skilled in the art for use in embodiments of the present invention. Radionuclides are most easily used by doping the core of the nanoparticle or by including them as labels that are present as part of the ligand immobilized on the nanoparticle.

Additionally or alternatively, the results of their interaction with the nanoparticles of the present invention, or other species, can be obtained by using labels associated with the nanoparticles as indicated above, or by using their properties. Detection can be accomplished using a number of techniques well known in the art. These nanoparticle detection methods, for example, detect aggregation that occurs when nanoparticles bind to another species by simple visual inspection or by using light scattering (transmittance of solutions containing nanoparticles). To the use of sophisticated techniques such as transmission electron microscopy (TEM) or atomic force microscopy (AFM) to visualize nanoparticles. A further method of detecting metal particles is to use plasmon resonance, which is excitation of electrons on the surface of the metal, usually caused by optical radiation. The phenomenon called surface plasmon resonance (SPR) exists at the interface between a metal (eg, Ag or Au) and a dielectric such as air or water. A change in SPR occurs when the analyte binds to the ligand immobilized on the surface of the nanoparticle and the refractive index of the interface changes. A further advantage of SPR is that it can be used to monitor real-time interactions. As described above, if the nanoparticles contain or are doped with atoms that are NMR active, this technique is used, both in vitro or in vivo, using techniques well known in the art. Particles can be detected. Nanoparticles can also be detected using a system based on quantitative signal amplification using silver (I) reduction promoted by nanoparticles. If the nanoparticles contain a ligand as a fluorescent probe, fluorescence spectroscopy can be used.
Carbohydrate isotope labels can also be used to facilitate its detection.

  The present invention provides a method for presenting a spherical array of ligands that has advantages over other types of arrays proposed in the prior art. Specifically, the nanoparticles are soluble in most organic solvents, particularly water. This can be used for its purification, and importantly it can be used in solution to present the ligands immobilized on the surface of the particles. The fact that the nanoparticles are soluble has the advantage of presenting the ligand in its natural conformation. For therapeutic applications, the nanoparticles are non-toxic under physiological conditions, soluble and stable.

  In some embodiments, the core of the nanoparticle is magnetic and may include magnetic metal atoms, optionally in combination with passivated metal atoms. As an example, the passivating metal can be gold, platinum, silver or copper and the magnetic metal can be iron or gadolinium. In a preferred embodiment, the passivating metal is gold and the magnetic metal is iron. In this case, the ratio of passivated metal atoms to magnetic metal atoms in the core is conveniently between about 5: 0.1 and about 2: 5. More preferably, the ratio is between about 5: 0.1 and about 5: 1. As used herein, the term “passivated metal” refers to a metal that does not exhibit magnetic properties and is chemically stable to oxidation. The passivating metal of the present invention can be diamagnetic. Diamagnetism refers to a material in which all electrons are paired and thus do not have a permanent net magnetic moment per atom. Magnetic materials have some unpaired electrons and are positively affected by external magnetic fields. That is, the external magnetic field induces alignment along the field where electrons are applied, and thus the magnetic moments of the electrons are aligned. The magnetic material can be paramagnetic, superparamagnetic or ferromagnetic. Paramagnetic materials are less sensitive to external magnetic fields and do not retain their magnetic properties when the external magnetic field is removed. Ferromagnetic materials are highly sensitive to external magnetic fields and include magnetic domains even in the absence of an external magnetic field because adjacent atoms cooperate and their electron spins are parallel. The external magnetic field aligns the magnetic moments of adjacent domains and expands the magnetic action. Usually very small particle materials with ferromagnetic properties are not ferromagnetic because particles below 300 nm do not cooperate and as a result the material does not have permanent magnetism. However, the particles are still very sensitive to external magnetic fields, have strong paramagnetic properties and are known as superparamagnetism. The nanoparticles of the present invention are preferably superparamagnetic.

Examples of nanoparticles with cores containing paramagnetic metals include Mn ⁺² , Gd ⁺³ , Eu ⁺² , Cu ⁺² , V ⁺² , Co ⁺² , Ni ⁺² , Fe ⁺² , Fe ⁺³ And those containing lanthanide ⁺³ .

  Other magnetic nanoparticles can be formed from materials such as MnFe (spinel ferrite) or CoFe (cobalt ferrite) can be formed into nanoparticles (ferrofluid, additional core material as defined above). With or without addition). Examples of self-assembled binding chemistry to produce such nanoparticles are Biotechnol.Prog., 19: 1095-100 (2003), J.Am.Chem.Soc.125: 9828-33 (2003 ), J. Colloid Interface Sci. 255: 293-8 (2002).

  In a further aspect, the present invention provides a composition comprising one or more populations of particles as defined above. In some embodiments, the population of nanoparticles can have the same or different ligands associated with the core at various densities. In some cases, it may be desirable to encapsulate the nanoparticles so that multiple nanoparticles can be delivered to the target site. Suitable encapsulation techniques are well known to those skilled in the art. The population of nanoparticles encapsulated can be one, two, three or more different types. In one embodiment, the present invention provides a nanoparticulate aerosol composition as defined herein. The aerosol composition may comprise nanoparticles and optionally a diluent. Examples of the use of these compositions are discussed below.

  The following nanoparticle application examples are provided by way of illustration and not limitation to support the broad applicability of the techniques described herein. A review of the general use of siRNA is given in Dorseet & Tuschl, Nature Reviews, 3: 318-329, 2004.

  In a further aspect, the present invention provides a nanoparticle as defined above for use in therapy or diagnosis.

  In a further aspect, the present invention provides the use of a nanoparticle as defined above for the preparation of a medicament for treating a condition ameliorated by administration of the nanoparticle. Examples of specific uses that can be treated according to the present invention are described below along with other applications of nanoparticles for both in vitro and in vivo use. For example, the nanoparticles or derivatives thereof described herein can be formulated into pharmaceutical compositions and administered to patients in various forms, particularly to treat conditions ameliorated by administration of RNA ligands. As an example, a condition in which the gene is down-regulated by RNA, treatment of a condition ameliorated by down-regulation of gene expression by RNA, or a condition associated with overexpression of a gene targeted and down-regulated by RNA This can be used to treat

Regulation of gene expression
Using RNA-containing nanoparticles, targeted degradation of mRNA by small interfering RNA (siRNA), post-transcriptional gene silencing (PTG), and developmentally regulated mRNA sequence-specific by microRNA (miRNA) Gene expression can be regulated in several ways, including translational repression and targeted transcriptional gene silencing.

  Generally speaking, the present invention provides the use of the nanoparticles described herein for down-regulation of target genes. In this application, downregulation may be in vitro, for example to examine gene expression, or in vivo, either in the experimental system of interest or for medical use. That is, the nanoparticles are used for the preparation of a medicament for treating a condition that is ameliorated by down-regulation of target gene expression by RNA or for treating a condition associated with overexpression of the target gene it can. For example, the condition includes cancer, eg, breast cancer that can be treated with RNA based on the Her2 / Neu sequence. As shown herein, the down-regulation provided by RNA can be substantially transient, so in some embodiments the nanoparticle is a cell in which the nano-particle down-regulates the target gene. Preferably, it further comprises a radionuclide, drug or other agent for treating or killing.

  RNA interference can be used to treat any disease associated with an overactive gene or genes, eg, most types of cancer, using RNA for oncogenic gene suppression, for example. It is also the purpose of RNA therapy to stop the activity of certain genes such as cell death receptors in hepatitis or other disorders where overactive gene expression contributes to disease pathology. Further examples of conditions suitable for treatment using the nanoparticles of the present invention include macular degeneration of the eye, or RNA in its natural role as a means of fighting pathogenic viruses by disabling their RNA May include HIV, hepatitis C or influenza among others (Check, 2003; Zamore et al., 2003; Song et al., 2003; Matzke & Matzke, 2003).

Pathway down-regulation It is particularly noteworthy that the present invention allows for the delivery of two or more RNA molecules, something that has never been possible before in the art. Thus, in some embodiments, the present invention provides a composition of at least two different types of nanoparticles that are conjugated to the same nanoparticles that can be used to down-regulate expression in the genetic pathway. Provided is a nanoparticle composition having at least two different RNA sequences present in the article. The number of RNA ligands present in the composition will vary depending on the complexity of the pathway and the number of genes that need to be targeted for down regulation. Examples of pathways that can be targeted for either research or treatment include inflammatory pathways, antiviral pathways, signaling pathways in cancer, metastatic pathways or metabolic pathways. As an example, this includes the regulation of the gluconeogenesis pathway for glucose production in type II diabetes.

  In further related embodiments, RNA-nanoparticles can be used to down-regulate gene family expression by designing RNA to target domains that are conserved among family members.

  For any use of nanoparticles to inhibit gene expression with RNA, the nanoparticles can also include siRNA sequences and mRNA silencing sequences for the target mRNA. These nanoparticles can be used to inhibit siRNA resistant mRNA. This can be used in situations where the target cell is resistant to siRNA silencing to express a protein that inhibits the siRNA inhibition mechanism. In this case, siRNA resistance can be restored by targeting a gene product in which siRNA is expressed to induce resistance.

Targeting Applications Using Additional Ligands or Using RNA In one application, the nanoparticle composition of the invention can be used to impart targeting properties for delivering RNA to target cells. This includes nanoparticles containing domains associated with RNA ligands that allow additional types of ligands or RNA nanoparticles conjugated to the core of the nanoparticle to specifically interact with the target cell population. Can be achieved by providing. As an example, RNA-containing nanoparticles can be selectively selected for a cell population by providing a nanoparticle comprising a ligand that is a member of a specific binding pair that can specifically bind to its binding partner present on or inside the target cell. For example, specific cellular structures such as the nucleus can be targeted. Examples of specific binding pairs suitable for use as ligands conjugated to them to target nanoparticles include ligands and receptors, but numerous alternatives will be apparent to those skilled in the art. Will. For example, glucose-derivatized nanoparticles can be used to target cells containing members of the GLUT family of proteins (18). Other sugar ligands such as Glcβ4GlcNAc or Glcβ4GlcNH ₂ may be used for the nanoparticles. First, using the former, siRNA-containing nanoparticles are targeted to the cell surface GLUT transport protein, and then upon entry into the cell (after cleavage by glycosidase), GlcNAc further targets the siRNA nanoparticles to the nucleus. The latter construct adds a positive charge to the nanoparticle surface, making it easier to adhere to and take up cells. Self-assembled nanoparticles can be used to incorporate a heterologous ligand, such as a lipid, peptide or some other chemical moiety (e.g., as described above in the discussion of ligands) linked to a disulfide by a spacer. As such, a variety of other targeting molecules can be used to target RNA nanoparticles to specific cell types. As an example, these techniques can be used to target RNA-carrying nanoparticles to tumor cells.

  In a further use case of nanoparticles for targeting cell types, an entity that provides nanoparticle targeting by directing the nanoparticle RNA ligand to a cell that expresses mRNA that interacts with the RNA ligand. Can be used as Examples of types of target cells that can be targeted in this way include tumor cells or virus-infected cells by using RNA to target the expression of viral genes or tumor markers or oncogenes in the target cells. In this embodiment, the effect that RNA-nanoparticles can permeate through cell membranes, their small size, and can be optionally enhanced by derivatizing nanoparticles with membrane translocation signals is preferred (Nature Biotechnology 18 410-414, 2000). Targeting RNA-nanoparticles to cells in which the corresponding mRNA is expressed has the advantage of cell-selectively down-regulating the target mRNA. However, since this effect is generally transient, it is preferable to provide nanoparticles with radionuclides or drugs to selectively kill cells targeted using RNA. Target cells and therapeutic processes can be imaged and tracked, for example, by labeling the nanoparticles with radioactive or magnetic nanoparticles as described above.

In a further aspect, the present invention provides a method for detecting and / or imaging mRNA using the nanoparticles described herein. In particular, prior to the present invention, there were no methods known in the art for imaging mRNA. This method involves contacting RNA with a nanoparticle either in vivo or in a sample under conditions where the RNA ligand present on the nanoparticle interacts with the target mRNA and the nanoparticle-RNA-mRNA complex. Detecting. The step of detecting the complex can be by using the intrinsic properties of the nanoparticles or by detecting the label associated with the nanoparticles. Preferred examples of labels suitable for use in this aspect of the invention include nanoparticles comprising magnetic groups, quantum dots or radionuclides. For example, quantum dots as provided by cadmium selenide nanocrystals, or other anions, such as sulfides, in addition to selenides can be used, but this is biological in both electronic and optical devices. It may be used in imaging, quantum computers and candidate drug screening.

RNA-nanoparticles as a tool in functional genomics Genomic screening typically utilizes a randomly generated RNA sequence which is then transfected into test cells and monitored for changes in protein expression. The nanoparticles of the present invention have two major advantages over these prior art methods for genome screening. First, a large number of random siRNA sequences are not actually effective, but currently test cells need to be individually screened, increasing the effort and cost of these experiments in this form. The present invention allows multiple siRNA sequences to be included as ligands on the nanoparticles, thereby increasing the screening rate. Thus, when an effect is observed in a cell, it is possible to screen which RNA molecule is present on the bead to determine which sequence was responsible for the effect. In addition, nanoparticles provide a delivery system for RNA, thus avoiding the use of transfection agents as required in the prior art. This is a desirable advantage because the transfection agent can itself cause a change in protein expression in the cell being tested. Thus, in a further aspect, the nanoparticles of the present invention can be used as a tool in functional genomics, as described, for example, in Nature Reviews, Volume 3, April 2004, pages 318-329. Nanoparticles can be used to study gene function in vivo and as a tool for genome-wide screening, with 3 or more, 6 or more, 11 or more, 21 or more, or 101 or more RNAs per particle. Can have a sequence.

Aerosol delivery In a further aspect, the present invention provides the use of the nanoparticles described herein in an aerosol. This is made possible by small sized nanoparticles. For imaging and / or therapeutic applications, for example in the treatment of conditions affecting the lung, aerosol compositions can be used to deliver RNA ligands, particularly to the lung.

  In any of the above embodiments, the nanoparticles can be conjugated with a therapeutically active substance such as an antibody or a drug that kills the tumor. Tumors can also be targeted by using the magnetic properties of the nanoparticles and guiding the nanoparticles to tumor cells using a magnetic field. However, the use of a magnetic field alone to direct the nanoparticles to the tumor cells is not usually suitable or accurate, so the present invention allows the nanoparticles to become tumor cells via a tumor-specific ligand. Offers the advantage of being able to be specifically directed to. As a result, since the drug is directed only to the required cells and not to healthy cells, it is possible to use fewer drugs and reduce the chance of side effects.

  Another advantage of the nanoparticles of the present invention is their very small size, which makes them easy to be taken up by cells even when bound to targeting or therapeutic molecules.

  In a further aspect, nanoparticles whose ligand is an antigen can be administered as a vaccine, for example, by impact using a delivery gun to accelerate its transdermal passage through the outer layer of the epidermis. The nanoparticles can then be taken up by, for example, dendritic cells and mature as they migrate through the lymphatic system, resulting in modulation of the immune response to the antigen and vaccination.

  The nanoparticles of the present invention can be formulated as a pharmaceutical composition that can be in the form of a solid or liquid composition. Such compositions are usually some type of carrier, for example solid carriers such as gelatin or adjuvants or inert diluents, or liquid carriers such as water, petroleum, animal or vegetable oils, mineral oils or synthetic oils. including. Saline solutions or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included. Such compositions and preparations typically contain at least 0.1 wt% of the compound.

  The nanoparticle composition can be administered to the patient by any number of different routes. Parenteral administration includes administration by the following routes: intravenous route, cutaneous route or subcutaneous route, nasal route, intramuscular route, intraocular route, transepithelial route, intraperitoneal route and topical route (transdermal route). , Including intraocular, rectal, nasal, inhalation and aerosol) and rectal systemic routes. For intravenous, cutaneous or subcutaneous injection, or injection to the site of pain, the active ingredient is pyrogen-free and has a suitable pH, isotonicity and stability, a parenterally acceptable aqueous solution It can be in the form of A person skilled in the art is well able to prepare a suitable solution using, for example, a solution of the compound or derivative thereof in a dispersion prepared using, for example, saline, glycerol, liquid polyethylene glycol or oil. It is.

  The composition comprises one or more compounds, one or more pharmaceutically acceptable excipients, carriers, buffers, stabilizers, isotonic agents, in combination with other active ingredients, as appropriate. Preservatives, or antioxidants or other materials well known to those skilled in the art may be included. Such materials must be non-toxic and should not interfere with the effectiveness of the active ingredient. The exact nature of the carrier or other material may vary depending on the route of administration, eg, oral or parenteral.

  Liquid drug compositions are usually formulated to have a pH between about 3.0 and 9.0, more preferably between about 4.5 and 8.5, and even more preferably between about 5.0 and 8.0. The pH of the composition can be maintained by using a buffer such as acetic acid, citric acid, phosphoric acid, succinic acid, Tris or histidine, which is usually used in the range of about 1 mM to 50 mM. Alternatively, the pH of the composition can be adjusted by using a physiologically acceptable acid or base.

  Preservatives are typically included in pharmaceutical compositions to prevent microbial growth, extend the shelf life of the composition, and allow for multiple use packaging. Examples of preservatives include phenol, metacresol, benzyl alcohol, parahydroxybenzoic acid and its esters, methyl paraben, propyl paraben, benzalkonium chloride, and benzethonium chloride. Preservatives are usually used in the range of about 0.1 to 1.0% (w / v).

  The pharmaceutical composition is preferably given to the individual in a prophylactically effective amount or a therapeutically effective amount (although prevention may be considered treatment in some cases), which is sufficient to benefit the individual. Usually this will cause a therapeutically useful activity and provide benefits to the individual. The actual amount of compound administered, as well as the rate and time course of administration, will vary depending on the nature and severity of the condition being treated. Treatment instructions such as dose determination are within the responsibility of general practitioners and other physicians and are generally known to the disorder being treated, individual patient condition, delivery site, method of administration and practitioner. Consider other factors. Examples of the techniques and protocols described above can be found in Handbook of Pharmaceutical Additives, 2nd edition (edited by M. Ash and I. Ash), 2001 (Synapse Information Resources, Endicott, New York, USA), Remington's Pharmaceutical Sciences, Id. 18th edition, Mack Publishing Company, Easton, Pa., 1990, and Handbook of Pharmaceutical Excipients, 2nd edition, 1994. By way of example, the composition is preferably administered to a patient at a dosage of between about 0.01 and 100 mg of active compound per kg body weight, more preferably between about 0.5 and 10 mg / kg body weight.

  Embodiments of the present invention will now be described by way of example and not limitation with reference to the accompanying figures.

Detailed description
[Example]
The Her-2 / neu oncogene and its encoded product pl85Her-2 / neu belong to the epidermal growth factor receptor tyrosine kinase (Bargmann et al., 1986). The HER receptor family consists of four transmembrane tyrosine kinases: EGFR (also known as Her-1 or erbB-1), erbB-2 (Her-2), erbB-3 (Her-3) and erbB- 4 (Her-4). The Her-2 / neu signaling pathway has been shown to play an important role in cell proliferation and differentiation, malignant transformation and resistance to chemotherapeutic drugs (Yarden & Sliwkowski, 2001). Her-2 / neu is overexpressed in about 1/3 of human and ovarian cancers, and its overexpression is associated with a poor prognosis (Berchuck et al., 1990).

  Numerous attempts have been made as potential therapeutic approaches to inhibit Her-2 / neu expression in cancer cells. Humanized monoclonal antibodies against Her-2 / neu (trastuzumab or herceptin) were effective in Her-2 / neu overexpressing metastatic cancers (Mendelsohn & Baselga, 2000; Baselga et al., 1996) I found it up-regulating. Antisense oligonucleotides against Her-2 / neu have been shown to induce apoptosis in human breast cancer cell lines overexpressing Her-2 / neu (Roh et al., 2000). Gene therapy with E1A delivered by liposomes or by adenoviral vectors can reduce mortality among tumor-bearing mice in a model of Her-2 / neu overexpressing ovarian cancer and also a model of breast cancer Can reduce the incidence of distant metastases (Chang et al., 1996).

  Down-regulation of Her-2 / neu expression results in a decrease in PI3K, Akt and phosphorylated Akt, which reduces the expression of cyclin D1, cyclin, which is involved in the regulation of G0 / G1 cell arrest and oncogene transformation (Sherr & Roberts, 1999). Recent studies comparing the effectiveness of antisense oligonucleotides and siRNA have demonstrated that siRNA is at least 10-fold more effective at silencing reporter genes on an nM basis (Miyagishi et al., 2003). Several previous studies have shown that Her-2 / neu stimulates transcription of VEGF, a potent pro-angiogenic factor (Kumar & Yarmand-Bagheri, 2001) and levels after silencing Her-2 / neu expression Has been demonstrated to be significantly reduced. Down-regulation of Her-2 / neu by retroviral siRNA increased thrombospondin-1 levels, a potent inhibitor of angiogenesis (Izumi et al., 2002). In vitro data demonstrated that HER2 siRNA treatment also significantly upregulates HLA class I surface expression in human tumors (Choudhury et al., 2004).

a.Strategy: Silencing
Her2 / Neu cDNA target sequence: AAG CCT CAC AGA GAT CTT GAA
a) Sense: 5'-G CCU CAC AGA GAU CUU GAAdTdT-3 '
b) Antisense: 3'-dTdTC GGA GUG UCU CUA GAA CUU-5 '
c) Sense: 5'-G CCU CAC AGA GAU CUU GAAdTdT-3'SS
d) Antisense: 3'SS-dTdTC GGA GUG UCU CUA GAA CUU-5 '

b. Annealing

c. Possible GNP combinations

d.Method
1.Cell line
SK-BR-3 human breast adenocarcinoma (Cat. No. HTB-30) obtained from ATCC. OVCAR-3 human ascites adenocarcinoma obtained from NCI-Frederick Cancer DCTD Tumor / cell line repository (vial 0502296).
2. siRNA stock solution The selected Her-2 / neu DNA target sequence was AAGCCTCACA GAGATCTTGAA.
The sense siRNA had the sequence r (GCCUCACAGAGAUCUUGAA) d (TT) 3Thss. Antisense sequence r (UUCAAGAUCUCUGUGAGGC) d (TT) 3Thss (K-salt molecular weight 7409.57) was obtained from Qiagen.
The control (non-silencing) siRNA duplex sequence was obtained from Qiagen (Cat # 1022076), the sense was r (UUC UCC GAA CGU GUC ACG U) d (TT), and the antisense was r (ACG UGA CAC GUU CGG AGA A) d (TT) and the molecular weight of the annealed K-salt was 14839.5.
Dissolve the contents of one sense siRNA tube (296.65 μg) in 1 ml of sterile buffer (100 mM potassium acetate, 30 mM Hepes-KOH, 2 mM magnesium acetate pH 7.4) to make a 40 μM stock solution. Contains 0.297 μg siRNA per μl.
The contents of one antisense siRNA test tube (296.38 μg) were dissolved in 1 ml of sterile buffer (100 mM potassium acetate, 30 mM Hepes-KOH, 2 mM magnesium acetate pH 7.4) to prepare a 40 μM stock solution. Contained 0.296 μg siRNA per μl.
For annealing, 30 μl of each RNA oligo solution was mixed with 15 μl of 5 × annealing buffer. The final buffer concentration was 50 mM Tris, pH 7.5-8.0, 100 mM NaCl, dissolved in DEPC-treated water. The final volume was 75 μl and the final concentration of siRNA duplex was 16 μM.
The solution was incubated in a 90-95 ° C. water bath for 1 minute and allowed to cool to room temperature (ie, below 30 ° C.). The tube was centrifuged briefly to collect all liquid at the bottom of the tube. It took 45-60 minutes to cool slowly to room temperature. The resulting solution was stored at −20 ° C. until ready to use and was resistant to repeated freezing and thawing.
3.siRNA Nanogold stock solution General method
HAuCl ₄ (99.999%) and NaBH ₄ were purchased from Aldrich Chemical. 2-thioethyl-β-D-glucopyranoside was synthesized using standard procedures in a cur laboratory. All experiments and solutions used Nanopure water (18.1 mΩ) treated with DEPC (diethyl pyrocarbonate). All Eppendorfs, spatulas and vials were RNase free. Annealing double-stranded siRNA was purchased from Qiagen-Xeragon. The details were as follows.
DNA target sequence AAGCCTCACAGAGATCTTGAA
Sense siRNA r (GCCUCACAGAGAUCUUGAA) d (TT) 3 'to 3'-thiol- (SS) -C3-linker
(K-salt molecular weight 7416.25)
Antisense r (UUCAAGAUCUCUGUGAGGC) d (TT)
(K-salt molecular weight 7409.57)

e.Preparation of RNA-Au-Glc nanoparticles
In a solution of 2-thioethyl-β-D-glucopyranoside (0.9 mg, 3.75 μmol) and siRNA (0.148 mg, 0.01 μmol) in TRIS buffer 100 mM, pH 7.7 (250 μL), aqueous HAuCl ₄ solution (22 μL, 0.025 M) Was added. Then, a 1N aqueous solution of NaBH ₄ (30 μL) was added several times and rapidly shaken. The formed brown suspension was shaken for an additional hour at 4 ° C. This suspension was purified by centrifugal filtration (AMICON molecular weight 10000, 30 minutes, 4 ° C., 14000 rpm). This process was repeated twice and washed with 125 μL TRIS buffer. When the residue in the AMICON filter was dissolved in 250 μL TRIS buffer and lyophilized, 4 mg RNA-Au-Glc nanoparticles were obtained (in 20 mM TRIS buffer by resuspending the solid in 1 mL water). A 6 ± 1 μM solution of RNA should be obtained). The filtrate was desalted using AMICON (molecular weight 3000, 4 ° C., 14000 rpm) and lyophilized. The weight of the residue was <50 μg. The transmission electron micrograph (TEM) shown in FIG. 1 shows that the average particle size was 2.8 nm, and as shown in FIG. 4, an average of 807 gold atoms / particles, siRNA and 100 With molecular glucose derivatives, the approximate molecular weight is> 160,000.

f. Testing for the presence of RNA in nanoparticles
RNA-Au-Glc nanoparticles, Glc-Au nanoparticles and RNA-Au-Glc nanoparticle washing residues presumed to contain RNA oligonucleotides and glucose derivatives were each dissolved in 30 μL of water. Aliquots (1 μL) of these solutions were mixed with an aqueous solution of ethidium bromide (EtBr) (1 μL, 0.1% v / v). When fluorescence was observed under a UV lamp (see Figure 2), the nanoparticles thus prepared contained siRNA (Figure 2b, test tube 1), but nanoparticles containing only glucose were fluorescent. (FIG. 2b, test tube 2).
4 mg of siRNA / nanogold complex prepared from 148 μg siRNA was dissolved in 1 ml of water to obtain a stock solution of 6 ± 1 μM in 20 mM tris. It contained 0.078 μg siRNA equivalent per 1 μl of solution.

Cell plating
1. 6 × 10 ⁴ cells were pipetted into a 24-well plate 24 hours prior to transfection and the volume was adjusted to 0.5 ml with an appropriate culture medium.
2. The cells were allowed to reach 50-80% confluency over approximately 24 hours.
3. The culture medium was removed and replaced with 300 μl fresh medium / well.

Transfection of cells with siRNA complexes
1.3.3 μl (or 12.8 μl of nanogold complex) of the appropriate double-stranded siRNA stock solution was dispensed into 24-well plates corresponding to those containing cells.
2. To each well, 96.7 μl (or 87.2 μl for nanogold complex) of the appropriate culture medium was added and mixed well by pipetting up and down 5 times.
3. To each well (other than nanogold complex wells), 6 μl of RNAiFect was added and mixed well by pipetting up and down 5 times.
4. This solution was incubated at room temperature for 10-15 minutes to form a complex.
5. Cells in 300 μl of cell culture medium were covered with 100 μl of the appropriate transfection complex.
6. Gently rock this plate and mix while avoiding rotation.
7. The plate was incubated for 48-72 hours at 37 ° C. in a CO ₂ incubator.
8. The medium was removed and the cells were washed 3 times with ice-cold PBS.
9. Cells were lysed and the protein content of the lysate was determined.
10. Proteins were separated by SDS-PAGE followed by Western blotting using Her2 / ErbB2 polyclonal rabbit antibody (Cat # 2242) obtained from Cell Signaling Technology.
11. The blot was treated with anti-rabbit IgG-HRP complex followed by ECL expression.

g. Results
Preliminary observations using 1 μg siRNA / well are shown in FIGS. 3a and 3b. siRNA-gold nanoparticles were added to the cells without using RNAiFectamine. SKBR3 cells reached 80% confluency later than OVCAR cells. SKBR3 results were obtained from lysates 48 hours after transfection and OVCAR results were obtained from lysates 72 hours after transfection. A schematic diagram of the nanoparticles is shown in FIG.

Non-toxicity of siRNA-Au-Glc nanoparticles to cells Cells were transfected with siRNA alone and with siRNA conjugated to gold sugar nanoparticles. FIG. 5 shows that siRNA conjugated with nanoparticles was effective and had no toxic effects. A dose-dependent effect on cell number was seen, indicating that siRNA nanoparticles increased cell proliferation.

Invasion of siRNA-Au-Glc nanoparticles into cells
OVCAR cells were transfected with siRNA-nanoparticles with or without transfection reagents normally required for transfection of cells with siRNA. FIG. 6 shows that no transfection reagent was required for entry of the siRNA-nanoparticles into the cells. This result showed that siRNA nanoparticles were efficiently delivered into cells even in the absence of transfection reagent, and in fact, delivery appeared to be more efficient without transfection reagent . The dose dependence of the effect on cell number indicates a true response to siRNA-nanoparticles.

References All references mentioned herein are expressly incorporated by reference.
Pal-Bhadra et al., RNAi-Mediated targeting of Heterochromatin by the RITS complex.Science (2004) 303, 669
Verdel et al., Heterochromatic silencing and HP1 localization in Drosphila are dependent on the RNAi Machinery.Science (2004) 303, 672
Elbashir et al., Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells.Nature 2001, 411, 494-8.
Tuschl, RNA interference and small interfering RNAs.Chem Biochem 2001, 2, 239-45
Bargmann et al., The neu oncogene encodes an epidermal growth factor receptor-related protein. (1986) Nature 319, pp. 226-230.
Yarden & Sliwkowski, Untangling the ErbB signaling network. (2001) Nat Rev Mol Cell Biol 2, 127-137
Berchuck et al., Overexpression of HER-2 / neu is associated with poor survival in advanced epithelial ovarian cancer. (1990) Cancer Res 50, 4087-4091.
Mendelsohn & Baselga.The EGF receptor family as targets for cancer therapy. (2000) Oncogene 19, pp. 6550-6565
Baselga et al., Et al. Phase II study of weekly intravenous recombinant humanized anti-p185HER2 monoclonal antibody in patients with HER2 / neu over expressing metastatic breast cancer. J Clin Oncol 1996, 14, 737-44.
Roh et al., Down regulation of HER2 / neu expression induces apoptosis in human cancer cells that over-express HER2 / neu. (2000) Cancer Res 60, 560-565.
Chang et al., Inhibition of intratracheal lung cancer development by systemic delivery of E1A. (1996) Oncogene 13, 1405-1412
Sherr & Roberts, CDK inhibitors: positive and negative regulators of Gl-phase progression. (1999) Genes Dev 13, 1501-1512
Miyagishi et al., Comparison of the suppressive effects of antisense oligonucleotides and siRNAs directed against the same targets in mammalian cells.Antisense Nucleic Acid Drug Dev 2003, 13, 1-7
Kumar & Yarmand-Bagheri, The role of HER2 in angiogenesis. (2001) Semin Oncol 28, 27-32
Izumi et al., Tumor biology: herceptin acts as an antiangiogenic cocktail. (2002) Nature 416, 279-280
Choudhury et al., Small interfering RNA (siRNA) inhibits the expression of the Her2 / Neu gene, upregulates HLA Class I and induces apoptosis of Her2 / Neu positive tumour cell lines.Int J Cancer 108, 71-77, 2004
Overbaugh, HTLV sweet-talks its way into cells.Nat.Med (2004), 10, 20
Check, RNA to the rescue, Nature (2003), 425, 10-12
Zamore et al., SiRNAs knock down hepatitis.Nature (2003) 9: 266-267
Song et al., RNA interference targeting Fas protects mice from fulminant hepatitis.Nat.Med. (2003) 9: 347-351
Matzke & Matzke, RNAi Extends its Reach.Science (2003) 301, 1060-1061
WO 02/32404
PCT application claiming priority from GB-A-0313259.4

It is a figure which shows the transmission electron micrograph of RNA-Au-Glc nanoparticle. It is a figure which shows the test about presence of RNA in the prepared nanoparticle. (a) No UV light: 1. RNA-Au-Glc nanoparticles + EtBr, 2.Glc-Au + EtBr, 3.Glc-Au, 4. Washing liquid residue + EtBr. (b) With UV light: 1. RNA-Au-Glc nanoparticles + EtBr, 2.Glc-Au + EtBr, 3.Glc-Au, 4. Washing liquid residue + EtBr. FIG. 3a shows a Western blot of Her-2 / neu protein obtained from lysates of equal volumes of SKBR3 cells 48 hours after transfection with Her-2 / neu siRNA. C = control (untreated) cells, Au = cells treated with siRNA bound to gold nanoparticles without RNAiFectamine. S = silencing siRNA using RNAiFectamine, NS = non-silencing siRNA using RNAiFectamine. FIG. 3b shows a Western blot of Her-2 / neu protein obtained from an equal volume of OVCAR cell lysate 72 hours after transfection with Her-2 / neu siRNA. C = control (untreated) cells, Au = cells treated with siRNA bound to gold nanoparticles without RNAiFectamine. FIG. 2 shows a schematic diagram of a preferred nanoparticle of the invention comprising siRNA and a carbohydrate ligand. siRNA alone (A) or siRNA-nanoparticle (B), 0.25 μg (diamond), 0.5 μg (square), 1.0 μg (triangle), 1.5 μg (gray ×) and 2.0 μg (black) per 1000 cells (X) Effect on cell proliferation for OVCAR cells transfected with siRNA-nanoparticles. X axis = day, Y axis = cell count (log ₁₀ ). FIG. 2 shows the effect on cell proliferation for OVCAR cells transfected with siRNA-nanoparticles with and without transfection reagent. Three concentrations of nanoparticles were used: 1: with transfection reagent (square) and without transfection reagent (diamond), 2: with transfection reagent (gray ×) and without transfection reagent (triangle), 3: transfection With reagent (circle) and no transfection reagent (black x). X axis = day, Y axis = number of cells (log ₁₀ )

Claims (31)

The use of nanoparticles in the manufacture of a medicament order to you downregulating the target gene by in vivo, the nanoparticles comprise a core containing gold atoms, the core is covalently linked to a plurality of ligands and which, said ligand siRNA ligands, see containing a RNA ligand selected from the group consisting of miRNA ligand and shRNA ligands, the nanoparticle is covalently bound to the RNA ligand through a thiol linker group, the RNA ligand The use as described above having a sequence specific to the target gene . Medicament for downregulating the target gene, is for treating cancer, viral infection or eye macular degeneration Use according to claim 1.   Use according to claim 2, wherein the cancer is breast cancer or the virus is HIV, hepatitis or influenza. 4. Use according to any one of claims 1 to 3 , wherein the nanoparticles further comprise a ligand comprising a carbohydrate group. Use according to any one of claims 1 to 4 , wherein the length of the RNA ligand is between 17 and 30 ribonucleotides. 6. Use according to any one of claims 1-5 , wherein the ligand is a siRNA ligand and comprises a 3 'overhang of 2 ribonucleotides. Use according to any one of claims 1 to 6 , wherein the first sense or antisense strand of the RNA molecule is covalently linked to the nanoparticle core via its 5 'and / or 3' end. 8. Use according to claim 7 , wherein the second strand of the RNA molecule that is complementary to the first strand anneals with the first strand of the RNA molecule. 9. Use according to claim 8 , wherein the second RNA strand is covalently attached to the nanoparticle core via its 5 'and / or 3' end. Use according to claim 8 or 9 , wherein the first and second strands of the RNA molecule are individually associated with the nanoparticle core, but later anneal together. An RNA ligand miRNA ligand comprises a hairpin Use according to any one of claims 1 to 5 or 7-10. RNA ligand is a shRNA ligands Use according to any one of claims 1 to 5 or 7-10. 13. Use according to claim 12 , wherein the length of the shRNA ligand is between 40 and 100 bases. 14. Use according to claim 12 or 13 , wherein the shRNA ligand is a hairpin and has a double stranded stem, the length of the double stranded stem being between 19 and 30 base pairs. 15. Use according to any one of claims 1 to 14 , wherein the RNA ligand is based on the Her2 gene sequence. 16. Use according to any one of claims 1 to 15 , wherein the nanoparticles comprise a label. 17. Use according to claim 16 , wherein the label is a fluorescent group, a radionuclide, a magnetic label, a dye, an NMR active atom or an atom that can be detected using surface plasmon resonance. (a) the fluorescent group is fluorescein, rhodamine or tetramethylrhodamine, Texas Red, Cy3 or Cy5; or
(b) Radionuclides are ^99m Tc, ³² P, ³³ P, ⁵⁷ Co, ⁵⁹ Fe ³⁺ , ⁶⁷ Cu ²⁺ , ⁶⁷ Ga ³⁺ , ⁶⁸ Ge, ⁸² Sr, ⁹⁹ Mo, ¹⁰³ Pd, ¹¹¹ In ³⁺ , ¹²⁵ I, ¹³¹ I, ¹³⁷ Cs, ¹⁵³ Gd, ¹⁵³ Sm, ¹⁵⁸ Au, ¹⁸⁶ Re, ²⁰¹ Tl ⁺ , ³⁹ Y ³⁺ , ⁷¹ Lu ³⁺ or ²⁴ Cr ²⁺ ; or
(c) Paramagnetic group whose magnetic label contains Mn ⁺² , Gd ⁺³ , Eu ⁺² , Cu ⁺² , V ⁺² , Co ⁺² , Ni ⁺² , Fe ⁺² , Fe ⁺³ or lanthanide ⁺³ Or
(d) the NMR active atom is Mn ⁺² , Gd ⁺³ , Eu ⁺² , Cu ⁺² , V ⁺² , Co ⁺² , Ni ⁺² , Fe ⁺² , Fe ⁺³ or lanthanide ⁺³ ,
Use according to claim 17 . 19. Use according to any one of claims 1 to 18 , wherein the nanoparticles are water soluble. (a) the average diameter of the core of the nanoparticles is between 0.5 and 10 nm; or
(b) the average diameter of the core of the nanoparticles is between 1 and 5 nm; or
(c) the average diameter of the nanoparticles containing the ligand is between 10 and 30 nm,
Use according to any one of claims 1 to 19. 21. Use according to any one of claims 1 to 20 , wherein the nanoparticles comprise a plurality of different types of RNA ligands. (a) the ligand further comprises a peptide, protein domain, nucleic acid segment or carbohydrate group; or
(b) the ligand further comprises a polysaccharide, oligosaccharide or monosaccharide group; or
(c) the ligand further comprises a sugar nanocomplex; or
(d) the ligand further comprises a sugar nanocomplex comprising a glycolipid or glycoprotein,
Use according to any one of claims 1 to 21 . A in vitro method for downregulating the target gene, comprising a cell containing the gene is contacted with the nanoparticles as defined in any one of claims 1 to 22 said method. 24. The method of claim 23 , wherein the method results in a temporary knockout of the target gene. At least two in the pathway using nanoparticles with at least two different RNA ligands conjugated to the same nanoparticle or present in a composition of at least two different types of nanoparticles 25. A method according to claim 23 or 24 , wherein the expression of a species gene is downregulated. 26. The method of claim 25 , wherein the pathway is an inflammatory pathway, an antiviral pathway, a signaling pathway in cancer, a metastatic pathway or a metabolic pathway. 27. A method according to any one of claims 23 to 26 , wherein the RNA ligand is based on a conserved domain of the gene family and down regulates the expression of multiple members of the gene family. 23. Use of a nanoparticle as defined in any one of claims 1 to 22 in an in vitro method for detecting or imaging RNA in a sample or cell. 24. An in vitro method for detecting and / or imaging mRNA in a sample or cell using nanoparticles as defined in any one of claims 1 to 23 , wherein the RNA ligand present on the nanoparticles is the target mRNA. Contacting the nanoparticle with a sample or cell containing the target mRNA under conditions that interact with the nanoparticle and detect the nanoparticle-RNA-mRNA complex. 30. The method of claim 29 , wherein the step of detecting the complex uses the intrinsic property of the nanoparticle or by detecting a label associated with the nanoparticle. Use of an aerosol composition comprising nanoparticles as defined in any one of claims 1 to 23 for the preparation of a medicament for delivery to the lung, wherein the nanoparticles comprise a label for imaging Use that is or for the treatment of a condition that affects the lungs of a mammal.

Images