JP5334575B2 - 2-Indolylimidazo [4,5-d] phenanthroline derivatives and their use in cancer treatment - Google Patents

Description

[Technical field to which the invention belongs]
The present invention relates to the field of cancer therapy, and in particular to the use of 2-indolimidazo [4,5-d] phenatrine derivatives in the treatment of cancer.
[Background of the invention]

Metal chelators have been developed for the treatment of diseases caused by excess metal. However, because iron has an important role in the active sites of various proteins involved in energy metabolism, respiration, and DNA synthesis, recently, compounds capable of chelating iron have been studied as potential anticancer therapies. . One of these proteins, ribonucleotide reductase (RR), is an iron-containing protein that is indispensable for converting ribonucleotides into deoxyribonucleotides for DNA synthesis, and is therefore a target for anticancer therapy. Many iron chelators are potent inhibitors because of their ability to bind iron (Richardson, DR (2002) Crit Rev Oncol Hematol 42 (3): 267-81.). For example, the iron chelator desferrioxamine (DFO), which has been clinically approved for the treatment of iron overload diseases, including β-thalassemia (Buss, JL, BT Greene, J. Turner, FM Torti and SV Torti (2004) Curr Top Med Chem 4 (15): 1623-35), also considered to be an inhibitor of RR. Some aggressive tumors also appear to be sensitive to iron chelation by DFO. However, the use of DFO is expensive and requires long-term subcutaneous administration, and the compound exhibits a short half-life. In addition to DFO, other iron chelators with anti-proliferative activity are under development, such as Triapine (currently phase 2), 311, tachpyridine, and O-Trenxox (Richardson, supra). However, since Triapine has a low water-soluble content, its effectiveness as an anticancer therapy may be limited.

  US Pat. No. 6,589,966 describes a new family of metal chelators characterized as hexadentate compounds that bind iron and have growth inhibitory activity against tumor cells. Further, US Patent Application No. 2002/0119955 is further based on 3-AP (which is structurally related to Triapine) that may show appropriate therapeutic utility for the treatment of neoplasms, including cancer. Compounds are described.

Zinc chelation may be a determinant of the biological effects of iron chelators, which are important but relatively unstudied. For example, the iron chelator tachpyridine, under preclinical research as a potential anticancer agent, chelates zinc in addition to iron, which affects its cytotoxicity (Zhao, R. et al. (2004) Biochem Pharmacol 67 ( 9): 1677-88.). Zinc has a catalytic and structural role in hundreds of zinc-dependent enzymes and zinc finger motifs of proteins involved in DNA-protein or protein-protein interactions. Thus, not only an excess of zinc but also a deficiency causes various alterations in mammalian metabolism. In vitro zinc reduction appears to cause apoptosis (McCabe, MJ, Jr., SA Jiang and S. Orrenius (1993) Lab Invest 69 (1): 101-10) and colon. Significantly reduced cell proliferation of tumor HT-29 cells (Kindermann B., F. Doring, M. Pfaffl and H. Daniel (2004) J. NutR 134 (1): 57-62) and altered cell cycle progression (Chen, X. et al. (2001) J. Biol . Chem 276 (32): 30423-8).

Alternatively, other metal chelating agents may exert an antitumor effect by forming a chelate complex having cytotoxicity. This occurs mainly with redox active metals, iron and copper. For example, bleomycin is a family of glycopeptide antibiotics with antitumor activity. They are used clinically in combination chemotherapy for lymphoma, squamous cell carcinoma and germ cell tumor. They contain a DNA binding domain and a metal binding domain that binds Fe (II) or Cu (I). The presence of oxygen and a reductant causes DNA cleavage by formation of a radical intermediate (Chen, J. and J. Stubbe (2005) Nat Rev Cancer 5 (2): 102-12). The iron chelator, Triapine, which chelates iron and inhibits RR, can damage RR and other important molecules by the production of active oxygen in iron complex formation (Chaston, TB et al. (2003)). Clin Cancer Res 9 (1): 402-14). The use of bleomycin conjugates to target compounds to body tumors is described in US Pat. No. 4,758,421.

  The cytotoxicity of the metal chelator 1,10-phenanthroline (OP) is due to its ability to function as both a chelator and a chelate. As a chelating agent, it appears to bind zinc or iron, thereby inhibiting enzymes that require zinc or iron for activity.

Alternatively, chelate complexes of 1,10-phenanthroline with divalent metal ions have been reported to be cytotoxic (Sulman, A. and GA A. Raycock (1977) Chem Biol Interact 16 (1): 89-99. ), Copper-chelates promote the degradation of DNA (Downey, KM, BG Que and AG So (1980). Biochem Biophys Res Commun 93 (1): 264-70). . Copper-OP complexes can bind noncovalently to the DNA minor groove and catalyze single-strand breaks in nucleic acids in the presence of hydrogen peroxide and reductants (Sigma, DS et al. (1979) J. Mol. Biol.Chem 254 (24): 12269-72).

Copper-OP complexes are frequently used as chemical nucleases, and highly specific DNA cleaving agents have been generated by attachment to sequence-specific DNA binding proteins (Pan, CQ, R. Landgraf and DS Sigma (1994) Mol Microbiol 12 (3): 335-42.). OP is also widely used as an inhibitor of matrix metalloproteases (Springman, EB et al. (1995) Biochemistry 34 (48): 15713-20) and synthesis of glycophosphatidylinositol (GPI) anchors by zinc chelation. (Mann, KJ and D. SeverveR (2001) Biochemistry 40 (5): 1205-113).

Although deregulation of tumor suppressor genes is associated with cancer growth, the clear role of these tumor suppressor genes in cancer growth is still unclear. The Krueppel-like factor (KLF) family of genes is a family of transcription factors containing evolutionarily conserved zinc fingers that have various regulatory roles in cell growth, proliferation, culture and embryogenesis (Ghaleb) A. et al. (2005) Cell Res 15 (2): 92-6). KLFs function as transcriptional activators and / or repressors by interacting with specific amino-terminal regions, the promoters they bind to, and coactivators or repressor complements through the cellular context of their function (Kaczynski, J., T. Cook and R. Urutia (2003) Genome Biol 4 (2): 206). Several members of the KLF family are thought to be tumor suppressors and are involved in carcinogenesis. For example, downregulation of KLF4 is found in colorectal cancer (Dang DT et al. (2000) FEBS Lett , 476: 203-7) and downregulation of KLF5 and KLF10 occurs in breast cancer (Chen C et al. (2002) Oncogene , 21: 6567-72; Subramaniam M et al. (1998) J Cell Biochem , 68: 226-36). KLF6 has also been suggested to be a candidate tumor suppressor gene at chromosome position 10p15 with frequent mutations found in prostate adenocarcinoma. KLF6 has also been shown to transcriptionally activate WAF1, which encodes a cell cycle cyclin-dependent kinase inhibitor, through a p53-dependent pathway (Narla G et al. (2001) Science , 294: 2563-6).

Deregulation of KLF4 is associated with cancers other than colon cancer both in vitro and in vivo, and it has been suggested that KLF4 may have a tumor suppressor effect. In colorectal cancer, the level of KLF4 mRNA is reduced compared to normal matched tissues (Dang et al. (2000), supra), and reexpression of KLF4 in colorectal cancer cell lines results in decreased tumorigenicity ( Dang, DT et al. (2003) Oncogene 22 (22): 3424-30). Similar down-regulation and growth-inhibitory effects of KLF4 were found in bladder cancer (Ohnishi, S. et al. (2003) Biochem Biophys Res Commun 308 (2): 251-6), gastric cancer (Wei, D. et al. (2005) Cancer Res 65 (7): 2746-54), esophageal cancer (Wang, N. et al. (2002) World J Gastroenterol 8 (6): 966-70), and adult T cell leukemia (Yasunaga, J. et al. (2004) Cancer Res 64 (17): 6002-9). In contrast to the tumor suppressor effects of KLF4, increased KLF4 expression is associated with breast cancer (Foster, KW, et al. (2000) Cancer Res 60 (22): 6488-95.) And squamous cell carcinoma of the oral cavity. (Foster, KW, et al. (1999). Cell Growth Differ 10 (6): 423-34.). Furthermore, KLF4 is regarded as a marker for malignant phenotype in early invasive ductal carcinoma (Pandya, AY et al. (2004) Clin Cancer Res 10 (8): 2709-19.). Thus, while KLF4 appears to play a role as a tumor suppressor in gastrointestinal cancer and leukemia, the role of KLF4 in the growth of other types of cancer remains unclear.

KLF4 expression is negatively regulated by zinc. In studies on the effect of zinc reduction on gene expression in colon tumor HT-29 cells using human oligonucleotide sequences, KLF4 gene expression is one of the most significantly elevated of 10,000 target genes tested It was supposed to be. Therefore, it has been postulated that KLF4 may be a direct link between intracellular zinc status and growth inhibition (Kindermann, B., F. Doring, M. Pfaffl and H. Daniel (2004) J. Nutr 134 ( 1): 57-62.). In subsequent studies, KLF4 expression was found to be increased in cells overexpressing metal transcription factor-1 (MTF-1) (Kindermann, B., F. Doring, J. Budczies and H. Daniel) (2005). Biochem Cell Biol 83 (2): 221-9.).

  MTF-1 is a zinc-sensitive transcriptional activator with six zinc fingers that binds to the target gene's metal response element (MRE), and the KLF4 promoter also has three MREs. MTF-1 is normally upregulated in zinc-deficient cells, and increased MTF-1 expression is seen in zinc-deficient HT-29 cells (Kindermann et al., 2004, supra). Thus, the zinc reaction of KLF4 in HT-29 is regulated at least in part by MTF-1 (Kindermann et al., 2005, supra). The expression of KLF4 is primarily associated with the terminally differentiated state of epithelial cells of organs such as viscera, skin and thymus (Kaczynski et al., 2003, supra).

As mentioned above, 1,10-phenanthroline (OP) is a well-known metal chelator. Recent work has investigated the derivatives of 1,10-phenanthroline and their ability to chelate various metals. For example, Chao et al. Synthesized 1,3-bis ([1,10]) phenanthroline- [5,6-d] imidazol-2-yl) benzene (mbpibH2) and its (bpy) 2Ru2 ⁺ complex, Was studied (Polyhedron, 2000, 1975-1983). Liu et al. Prepared ruthenium complexes with 2- (2-hydroxyphenyl) imidazo [4,5-f] [1,10] phenanthroline (HPIP) and studied the binding properties of these complexes to calf thymus DNA. (JBIC, 2000, 5, 119-128). Similarly, Xu et al. Describe the synthesis of 2 (4-methylphenyl) imidazole [4,5-f] 1,10-phenanthroline and its Ru (II) complex and binding of the prepared complex to calf thymus DNA. (New J. Chem., 2003, 27, 1255-1263).

International Patent Application No. PCT / IB04 / 052433 (WO2005 / 047266) describes a broad class of 2,4,5-trisubstituted imidazole compounds, including some 1,10-phenanthroline substituted compounds, and their use in the treatment of cancer. Is described.
This reference is provided to illustrate the possibility that the well-known information considered by the applicant is relevant to the present invention. It is not necessarily intended for approval and any prior information should not be construed as constituting the prior art against the present invention.

式中、Ｒ１、Ｒ２、Ｒ３、Ｒ４、Ｒ６およびＲ７は、水素、ハロゲン、ヒドロキシル、チオール、低アルキル、置換低アルキル、低アルケニル、置換低アルケニル、低アルキニル、置換低アルキニル、アルコキシ、アルキルチオ、アシル、アリールオキシ、アミノ、アミド、カルボキシル、アリール、置換アリール、ヘテロサイクル、置換ヘテロサイクル、ヘテロアルキル、置換ヘテロアルキル、ヘテロアリール、置換ヘテロアリール、シクロアルキル、置換シクロアルキル、ニトロ、シアノ、または‐Ｓ（Ｏ）_１‐２Ｒ（式中、Ｒはアルキル、置換アルキル、アリール、置換アリール、ヘテロサイクル、ヘテロアリール、置換ヘテロサイクル、または置換ヘテロアリールである）から単独で選択され、
Ｒ５はＨ、アルキル、置換アルキル、アルケニル、置換アルケニル、アルキニル、置換アルキニル、アリール、置換アリール、ヘテロアリール、置換ヘテロアリール、アシル、‐ＣＨ_２‐アリール、‐ＣＨ_２‐ヘテロアリールである。 [Summary of Invention]
The object of the present invention is the provision of 2-indolylimidazo [4,5-d] phenatrine derivatives and their use in the treatment of cancer. According to one aspect of the present invention, there is provided the use of a compound having structural formula (I), or a salt thereof, in inhibiting the growth of cancer cells,

Wherein R1, R2, R3, R4, R6 and R7 are hydrogen, halogen, hydroxyl, thiol, low alkyl, substituted low alkyl, low alkenyl, substituted low alkenyl, low alkynyl, substituted low alkynyl, alkoxy, alkylthio, acyl , Aryloxy, amino, amide, carboxyl, aryl, substituted aryl, heterocycle, substituted heterocycle, heteroalkyl, substituted heteroalkyl, heteroaryl, substituted heteroaryl, cycloalkyl, substituted cycloalkyl, nitro, cyano, or -S (O) _1-2 R alone, wherein R is alkyl, substituted alkyl, aryl, substituted aryl, heterocycle, heteroaryl, substituted heterocycle, or substituted heteroaryl;
R5 is H, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, acyl, -CH ₂ - aryl, -CH ₂ - heteroaryl.

According to another aspect of the invention, there is provided the use of a compound having the structural formula (I), or a salt thereof, in inducing apoptosis in cancer cells.
According to another aspect of the invention, there is provided the use of a compound having the structural formula (I), or a salt thereof, in chelating a transition metal ion in a cell.

  According to another aspect of the invention, there is provided the use of a compound having the structural formula (I), or a salt thereof, in increasing the expression of Krueppel-like factor 4 (KLF4) in cancer cells and / or tumors. .

  According to another aspect of the present invention there is provided the use of a compound having structural formula (I), or a salt thereof, in the preparation of a medicament in the treatment of cancer.

According to another aspect of the present invention there is provided the use of a compound having structural formula (I), or a salt thereof,
Wherein R 1, R 2, R 3, R 4 are each independently hydrogen, halogen, C ₁ -C ₄ alkyl, C ₁ -C ₄ alkoxy, or C ₆ -C ₁₄ aryl,
R5 is _hydrogen, C 1 -C _{4 alkyl, C} 1 -C ₄ alkyl substituted with C 6 _{-C 14} aryl or _C 4 -C ₆ cycloalkyl,
R6 is hydrogen, _halogen, C 1 -C ₄ alkyl, _C 1 -C ₄ alkyl substituted by _C 5 -C ₆ heterocycloalkyl heteroatom is _N, C 6 _{-C 14 aryl,} C 1 -C ₄ alkyl or halo substituted C ₆ -C ₁₄ aryl, C ₅ -C ₆ cycloalkyl, C ₅ -C ₆ heterocycloalkyl, or polycycloalkyl.

According to another aspect of the present invention there is provided the use of a compound having structural formula (I), or a salt thereof,
Wherein R 1, R 2, R 3, R 4 are independently hydrogen, halogen, C ₁ -C ₄ alkyl, C ₁ -C ₄ alkoxy, or phenyl,
R5 is _hydrogen, C 1 -C ₄ alkyl, _C 1 -C ₄ alkyl substituted with phenyl or cyclopentyl,
R6 is hydrogen, _halogen, C 1 -C ₄ alkyl, _C 5 -C ₆ heterocycloalkyl that is substituted with _C 1 -C ₄ alkyl the heteroatom is N, _phenyl, in C 1 -C ₄ alkyl or halo Substituted phenyl, C ₅ -C ₆ cycloalkyl, C ₅ -C ₆ heterocycloalkyl, or adamantane, and R 7 is H.
Detailed Description of the Invention

  The present invention relates to 2-indolylimidazo [4,5-d] phenanthroline compounds of formula I. As demonstrated herein, compounds of formula I are capable of intracellular chelation of transition metals, and have antiproliferative effects in one or more cancer cells that are cytostatic and / or cytotoxic. Can affect. Thereby, one embodiment of the present invention provides the use of a compound of formula I for inhibiting the growth of cancer cells. The present invention further provides methods and uses of compounds of formula I in the treatment of cancer.

  Induction of programmed cell death (apoptosis) is a useful method for the treatment of cancer. As demonstrated herein, in one embodiment of the invention, the compound of formula I can induce apoptosis in cancer cells and thus can have a cytotoxic effect. Thereby, the present invention further provides methods and uses of compounds of formula I for inducing apoptosis in cancer cells. In another example, the use of a compound of formula I for inducing apoptosis for the treatment of various leukemias is provided.

  In another embodiment of the invention, the compound of formula I can selectively inhibit the growth of one or more prostate cancer cells, colon cancer cells, non-small cell lung cancer cells and leukemia cells. Thus, in this example, the present invention provides the use of a compound of formula I for selectively inhibiting the growth of one or more prostate cancer cells, colon cancer cells, non-small cell lung cancer cells and leukemia cells. The ability of a compound of formula I to selectively inhibit the growth of one or more prostate cancer cells, colon cancer cells, non-small cell lung cancer cells and leukemia cells is a group of prostate cancer, colon cancer, non-small cell lung cancer and leukemia. Further provided are methods and uses of compounds of formula I for treating cancer selected from:

  As mentioned above, compounds of formula I can chelate transition metal ions in the cellular environment. Thereby, the present invention further provides methods and uses of compounds of formula I for chelating transition metal ions in vivo or in vitro. In one embodiment of the invention, compounds of formula I can alter the expression of genes regulated by transition metals in cancer cells by chelation of transition metals. For example, in one example, a compound of formula I can increase the expression of a transition metal regulated tumor suppressor gene in cancer cells. In many cases, the function of a tumor suppressor gene is related to the control of cell growth, so that the compound of formula I inhibits the growth of cancer cells by the expression of a transition metal-controlled tumor suppressor gene that functions to control cell growth. Can do. In certain examples, compounds of formula I can increase the expression of the zinc-regulated tumor suppressor KLF4, and thus include, but are not limited to, KLF4, including bladder cancer, gastrointestinal cancer and various leukemias. Is useful for inhibiting cancer cell growth acting as a tumor suppressor.

  The present invention further provides metal chelate complexes of compounds of formula I, such as copper complexes of compounds of formula I, and the use of these complexes in the treatment of cancer.

  The present invention is directed to the therapeutic application of compounds of formula I in the treatment of diseases or disorders in which transition metals need to be chelated, as well as various non-therapeutic situations where transition metal chelation is required. To do.

Definition

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

The terms are defined as follows:
In one embodiment of the present invention, “selective inhibition” as used herein for the anti-cancer activity of compounds of formula I is used in the NCI-NIH development treatment program in vitro screen (Table 1 below). Can be defined using a panel of cancer cell lines composed of at least 50 of the 60 cancer cell lines, wherein the panel comprises at least 4 from each of the listed prostate cancer cell lines and other cancers listed. It consists of two cultured cell lines. Compound, breast cancer compounds, central nervous system cancer, melanoma, selected cancer has at least 10% lower mean GI ₅₀ than the average GI ₅₀ for inhibition of cell lines from each of ovarian and renal cancer (i.e., When inhibiting the growth of cultured cell lines from prostate cancer, colon cancer, non-small cell lung cancer and / or leukemia), it is said to show selective inhibition of the selected cancer.

The term “down-regulation” as used herein with respect to the expression of transition metal tumor suppressor genes in cancer cells means that the gene is not overexpressed in cancer cells, ie the cells are at a reduced level compared to normal cells. Or substantially the same level of gene expression.
As an example, colon cancer cells show decreased expression of the KLF4 gene compared to normal colon cells, and prostate cancer cells show the same level of KLF4 expression compared to normal prostate cancer cells, but the expression level is in excess of KLF4. Lower than expressing breast cancer cells.

The term “halogen” refers to fluorine, bromine, chlorine and iodine atoms.
The term “hydroxyl” refers to the group —OH.
The term “thiol” or “mercapto” refers to the group —SH, and —S (O) _0-2 .
The term “lower alkyl” refers to a straight or branched chain, or cyclic, alkyl group of 1 to 8 carbon atoms.
The term “substituted lower alkyl” refers to hydroxyl, thiol, alkylthiol, halogen, alkoxy, amino, amide, carboxyl, cycloalkyl, substituted cycloalkyl, heterocycle, substituted heterocycle, cycloheteroalkyl, substituted cycloheteroalkyl, One or more groups such as acyl, aryl, substituted aryl, aryloxy, heteroaryl, substituted heteroaryl, aralkyl, heteroaralkyl, alkylalkenyl, alkylalkynyl, alkylcycloalkyl, alkylcycloheteroalkyl, nitro, cyano, etc. Refers to low alkyl as described, including. These groups may be attached to any carbon atom of the lower alkyl moiety.

The term “low alkenyl” refers to a straight or branched chain hydrocarbon of 2 to 8 carbon atoms with at least one carbon double bond.
The term “substituted lower alkenyl” refers to hydroxyl, thiol, alkylthiol, halogen, alkoxy, amino, amide, carboxyl, cycloalkyl, substituted cycloalkyl, heterocycle, substituted heterocycle, cycloheteroalkyl, substituted cycloheteroalkyl, Acyl, aryl, substituted aryl, aryloxy, heteroaryl, substituted heteroaryl, aralkyl, heteroaralkyl, alkyl, alkenyl, alkynyl, alkyl alkenyl, alkylalkynyl, alkylcycloalkyl, alkylcycloheteroalkyl, nitro, cyano, Reference is made to low alkenyl as described, including one or more groups. These groups may be attached to any carbon atom to produce a stable compound.
The term “lower alkynyl” refers to a straight or branched chain hydrocarbon of 2 to 8 carbon atoms with at least one carbon triple bond.

  The term “substituted lower alkynyl” refers to hydroxyl, thiol, alkylthiol, halogen, alkoxy, amino, amide, carboxyl, cycloalkyl, substituted cycloalkyl, heterocycle, substituted heterocycle, cycloheteroalkyl, substituted cycloheteroalkyl, 1 such as acyl, aryl, substituted aryl, aryloxy, heteroaryl, substituted heteroaryl, aralkyl, heteroaralkyl, alkyl, alkenyl, alkynyl, alkyl alkenyl, alkylalkynyl, alkylcycloalkyl, alkylcycloheteroalkyl, nitro, cyano, etc. Reference to low alkynyl as described, including one or more groups. These groups may be attached to any carbon atom to produce a stable compound.

The term “alkoxy” refers to R being low alkyl, substituted low alkyl, acyl, aryl, substituted aryl, aralkyl, substituted aralkyl, heteroalkyl, heteroarylalkyl, cycloalkyl, substituted cycloalkyl, cyclohetero, as defined below. Reference is made to the group -OR which is alkyl or substituted cycloheteroalkyl.
The term “alkylthio” refers to the group —SR, —S (O) _{n = 1−2} —R, where R is low alkyl, substituted low alkyl, aryl, substituted aryl, aralkyl or substituted aralkyl as defined below. means.
The term “acyl” refers to the group —C (O) R where R is hydrogen, lower alkyl, substituted lower alkyl, aryl, substituted aryl.
The term “aryloxy” refers to the group —OAr where Ar is an aryl, substituted aryl, heteroaryl, or substituted heteroaryl group, as defined below.

The term “amino” means that R and R ′ are independently hydrogen, lower alkyl, substituted lower alkyl, aryl, substituted aryl, heteroaryl, cycloalkyl, substituted cycloalkyl or substituted heteroaryl, as defined below, or acyl. Reference may be made to the group of NRR ′ which may be.
The term “amide” refers to —C (O where R and R ′ are independently hydrogen, lower alkyl, substituted lower alkyl, cycloalkyl, substituted cycloalkyl, aryl, substituted aryl, hetaryl, substituted hetaryl as defined below. ) Refers to the group NRR ′.
The term “carboxyl” refers to the group —C (O) OR, where R alone is hydrogen, lower alkyl, substituted lower alkyl, aryl, substituted aryl, hetaryl, substituted hetaryl, etc., as defined.
The term “aryl” or “Ar” means at least one aromatic in which at least one ring is aromatic (eg, 1,2,3,4-tetrahydronaphthyl, naphthyl, anthryl, or phenanthryl, 9-fluorenyl, etc.). Reference is made to an aromatic carbocyclic group having a ring (eg phenyl or biphenyl) or multiple condensed rings.

  The term “substituted aryl” includes, for example, halogen, hydroxyl, thiol, low alkyl, substituted low alkyl, trifluoromethyl, low alkenyl, substituted low alkenyl, low alkynyl, substituted low alkynyl, alkylalkenyl, alkyl alkynyl, alkoxy, alkylthio, Acyl, aryloxy, amino, amide, carboxyl, aryl, substituted aryl, heterocycle, substituted heterocycle, heteroaryl, substituted heteroaryl, heteroalkyl, substituted heteroalkyl, cycloalkyl, substituted cycloalkyl, alkylcycloalkyl, alkylcyclo Heteroalkyl, nitro, sulfoamide, cyano, or R and R ′ are H, alkyl, substituted alkyl, aryl, substituted aryl, heterocycle, substituted heterocycle, hetero Reference is made to aryl optionally substituted with one or more functional groups, such as -N = CRR ', selected alone from aryl or substituted heteroaryl.

The term “heterocycle” refers to a single ring (eg morpholino, pyridyl or furyl) or multiple condensed rings (eg naphthapyridyl, quinoxalyl, quinolinyl, indolizinyl, indanyl or benzo [b] thienyl) and N, O or Reference is made to saturated, unsaturated, or aromatic carbocyclics having at least one heteroatom such as S.
The term “substituted heterocycle” is halogen, hydroxyl, thiol, low alkyl, substituted low alkyl, trifluoromethyl, low alkenyl, substituted low alkenyl, low alkynyl, substituted low alkynyl, alkylalkenyl, alkylalkynyl, alkoxy, alkylthio, acyl , Aryloxy, amino, amide, carboxyl, aryl, substituted aryl, heterocycle, substituted heterocycle, heteroaryl, substituted heteroaryl, heteroalkyl, substituted heteroalkyl, cycloalkyl, substituted cycloalkyl, alkylcycloalkyl, alkylcyclo Reference is made to heterocycles optionally substituted with, for example, teloalkyl, nitro, sulfoamide or cyano.

The term “heteroaryl” or “hetaryl” refers to a heterocycle in which at least one heterocycle is aromatic.
The term “substituted heteroaryl” includes, for example, halogen, hydroxyl, thiol, low alkyl, substituted low alkyl, trifluoromethyl, low alkenyl, substituted low alkenyl, low alkynyl, substituted low alkynyl, alkylalkenyl, alkylalkynyl, alkoxy, alkylthio. , Acyl, aryloxy, amino, amide, carboxyl, aryl, substituted aryl, heterocycle, substituted heterocycle, heteroaryl, substituted heteroaryl, heteroalkyl, substituted heteroalkyl, cycloalkyl, substituted cycloalkyl, alkylcycloalkyl, alkyl Reference is made to heterocycles optionally mono- or polysubstituted with one or more functional groups such as cycloheteroalkyl, nitro, sulfoamide or cyano.
The term “cycloalkyl” refers to cyclic or polycyclic alkyl groups containing from 3 to 15 carbons. For polycyclic groups, these may be multiple condensed rings where one of the terminal rings may be aromatic (eg, tetralin, etc.).

  The term “substituted cycloalkyl” includes, for example, halogen, hydroxyl, thiol, low alkyl, substituted low alkyl, trifluoromethyl, low alkenyl, substituted low alkenyl, low alkynyl, substituted low alkynyl, alkylalkenyl, alkyl alkynyl, alkoxy, alkylthio , Acyl, aryloxy, amino, amide, carboxyl, aryl, substituted aryl, heterocycle, heteroaryl, substituted heterocycle, heteroalkyl, cycloalkyl, substituted cycloalkyl, alkylcycloalkyl, alkylcycloheteroalkyl, nitro, sulfoamide Or refers to a cycloalkyl group consisting of one or more substituents such as cyano.

  As used interchangeably herein, the terms “therapy” and “treatment” alleviate the symptoms associated with a disease, disorder or such condition, prevent their onset, and describe their pathology. Refers to practice performed with the intention of altering. Thus, the terms therapy and treatment are used in the broadest sense and include prevention (prophylaxis), alleviation, management, alleviation, or treatment of various stages of a disease, disorder or such condition. Prevention or alleviation of the progression of a disease, disorder or such condition is included in these terms. Also included in these terms are medical treatments that result in alterations in biological physiology and / or biochemistry. Those who need therapy / treatment are not only those who already have the disease, disease or such condition, but also those who are likely to develop the disease, disease or such condition, those who may develop it, and the disease , Including those in whom a disease or such condition has been prevented. Accordingly, therapeutic application of the compounds of the invention refers to therapy or treatment, as defined herein.

As used herein, “subject” or “patient” refers to an animal in need of treatment, including humans and other mammals.
Administration of a compound of the invention “in combination” with one or more additional therapeutic agents is intended to include simultaneous (combination) administration and continuous administration. Continuous administration is intended to include various administration orders of the therapeutic agent and the compound of the invention to the subject.

  As used herein, the term “adjuvant therapy” refers to a treatment that is added to increase the effectiveness of the primary therapy. In cancer, adjuvant therapy refers to chemotherapy, hormonal therapy or radiation therapy usually performed after surgery (primary therapy) to increase the likelihood of killing all cancer cells.

  As used herein, the term “neoadjuvant therapy” refers to treatment that occurs prior to primary therapy. Examples of neoadjuvant therapy are chemotherapy, radiation therapy, and hormone therapy.

  As used herein, the term “about” refers to a +/− 10% variation from the normal value. The variation is always included in any value given herein, whether or not specifically mentioned.

またはその塩を提供し、 I. 2-Indolylimidazo [4,5-d] phenanthroline compounds

The present invention relates to a compound of the following general formula (I):

Or provide its salt,

Wherein R1, R2, R3, R4, R6 and R7 are hydrogen, halogen, hydroxyl, thiol, low alkyl, substituted low alkyl, low alkenyl, substituted low alkenyl, low alkynyl, substituted low alkynyl, alkoxy, alkylthio, acyl , Aryloxy, amino, amide, carboxyl, aryl, substituted aryl, heterocycle, substituted heterocycle, heteroalkyl, substituted heteroalkyl, heteroaryl, substituted heteroaryl, cycloalkyl, substituted cycloalkyl, nitro, cyano, or -S (O) _1-2 R alone, wherein R is alkyl, substituted alkyl, aryl, substituted aryl, heterocycle, heteroaryl, substituted heterocycle, or substituted heteroaryl;
R5 is, H, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, acyl, -CH ₂ - aryl, -CH ₂ - heteroaryl.

  In another embodiment of this invention, in the compound of formula I, R1, R3, R4, R5 and R7 are H and R2 and R6 are as described above.

In another embodiment of the invention the compound of formula I is
Wherein R 1, R 2, R 3, R 4 are each independently hydrogen, halogen, C ₁ -C ₄ alkyl, C ₁ -C ₄ alkoxy, or C ₆ -C ₁₄ aryl,
R5 is _hydrogen, C 1 -C _{4 alkyl, C} 1 -C ₄ alkyl substituted with C 6 _{-C 14} aryl or _C 4 -C ₆ cycloalkyl,
R6 is hydrogen, _halogen, C 1 -C ₄ alkyl, _C 1 -C ₄ alkyl substituted by _C 5 -C ₆ heterocycloalkyl heteroatom is _N, C 6 _{-C 14 aryl,} C 1 -C Compounds that are C ₆ -C ₁₄ aryl, C ₅ -C ₆ cycloalkyl, C ₅ -C ₆ heterocycloalkyl, or polycycloalkyl substituted with ₄ alkyl or halo.

In another embodiment of the invention the compound of formula I is
Wherein, R1, R2, R3, R4, alone hydrogen, _halogen, C 1 -C _{4 alkyl,} C 1 -C ₄ alkoxy or phenyl,
R5 is _hydrogen, C 1 -C ₄ alkyl, _C 1 -C ₄ alkyl substituted with phenyl or cyclopentyl,
R6 is hydrogen, _halogen, C 1 -C ₄ alkyl, _C 5 -C ₆ heterocycloalkyl that is substituted with _C 1 -C ₄ alkyl the heteroatom is N, _phenyl, in C 1 -C ₄ alkyl or halo Compounds that are substituted phenyl, C ₅ -C ₆ cycloalkyl, C ₅ -C ₆ heterocycloalkyl, or adamantane, and R 7 is H.

In another embodiment of the invention the compound of formula I is
Wherein R1, R2, R3, R4 are each independently hydrogen, halogen, or C ₁ -C ₄ alkyl;
R5 is _hydrogen, C 1 -C ₄ alkyl, _C 1 -C ₄ alkyl substituted with phenyl or _C 4 -C ₆ cycloalkyl,
R6 _is, C 1 -C ₄ alkyl, _C 1 -C ₄ alkyl substituted by _C 5 -C ₆ heterocycloalkyl heteroatom is _N, C 5 -C ₆ cycloalkyl, adamantane, phenyl, or _{C 1,} is phenyl substituted with -C ₄ alkyl or halo, and R7 is a compound which is H.

In another embodiment of the invention the compound of formula I is
Wherein R1, R2, R3, R4 are each independently hydrogen, halogen, or C ₁ -C ₄ alkyl;
R5 is hydrogen, C ₁ -C ₄ alkyl, or C ₄ -C ₆ cycloalkyl,
Compounds in which R 6 is C ₁ -C ₄ alkyl, adamantane, phenyl, or phenyl substituted with C ₁ -C ₄ alkyl or halo, and R 7 is H.

In another embodiment of the invention the compound of formula I is
Wherein, R1, R2, R3, R4 are individually hydrogen, halogen or _C 1 _{-C 4 C} 1 _-C 4 alkyl,
R5 is hydrogen;
A compound in which R 6 is C ₁ -C ₄ alkyl, or adamantane, and R 7 is H.

In another embodiment of the invention the compound of formula I is
Wherein R1, R2, R3, R4 are each independently hydrogen, halogen, or C ₁ -C ₄ alkyl;
R5 is hydrogen;
A compound in which R 6 is C ₁ -C ₄ alkyl and R 7 is H.

In another embodiment of the invention the compound of formula I is
Wherein R 1, R 2, R 3, R 4 are each independently hydrogen, C ₁ -C ₄ alkyl, or C ₁ -C ₄ alkoxy;

R5 _is C 1 -C ₄ alkyl or _C 4 -C ₆ cycloalkyl,
R6 is _hydrogen, C 1 -C ₄ alkyl, adamantane, phenyl or phenyl substituted by _C 1 -C ₄ alkyl or halo, and R7 is a compound which is H.

In another embodiment of the invention the compound of formula I is
Wherein R 1, R 2, R 3, R 4 are each independently hydrogen, C ₁ -C ₄ alkyl, or C ₁ -C ₄ alkoxy;
R5 _is C 1 -C ₄ alkyl, _C 1 -C ₄ alkyl substituted with phenyl or _C 4 -C ₆ cycloalkyl,
A compound wherein R 6 is hydrogen, C ₁ -C ₄ alkyl, or C ₅ -C ₆ heterocycloalkyl, and R 7 is H.

The compounds of the present invention include, but are not limited to, the following exemplary compounds.

  The present invention includes various salts of the compounds defined by Formula I, such as pharmaceutically acceptable salts. The compounds according to the invention have sufficiently acidic, sufficiently basic, or both functional groups so that they react with a large number of organic and inorganic bases and / or organic and inorganic acids and are pharmaceutically acceptable. Form a salt.

As used herein, the term “pharmaceutically acceptable salt” refers to a salt of a compound of formula I that is substantially non-toxic to living organisms. Exemplary pharmaceutically acceptable salts include those salts prepared by reaction of the compounds of the present invention with pharmaceutically acceptable minerals, organic acids, organic or inorganic bases. Such salts are known as acid addition and base addition salts.

  Acids commonly used to form acid addition salts are inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, phosphoric acid and / or p-toluenesulfonic acid, methanesulfonic acid, oxalic acid , P-bromophenylsulfonic acid, carbonic acid, succinic acid, citric acid, benzoic acid, acetic acid and other organic acids. Examples of such pharmaceutically acceptable salts include sulfate, pyrosulfate, bisulfate, sulfite, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate, bromide, Iodide, acetate, propionate, decanoate, caprylate, acrylate, formate, hydrochloride, dihydrochloride, isobutyrate, caprylate, heptanoic acid, propiolate, oxalate, malon Acid salt, succinate, suberate, sebacate, fumarate, maleate, butyne-1,4-dioate, hexyne-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate Acid salt, hydroxybenzoate, methoxybenzoate, phthalate, xylenesulfonic acid, phenylacetic acid, phenylpropionate, phenylbutyrate, citrate, lactate, γ-hydroxy Butyrate, glycolate, tartrate, methanesulfonate, propanesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, and the like mandelate. Preferred pharmaceutically acceptable acid addition salts are salts formed with inorganic acids such as hydrochloric acid and hydrobromic acid, and salts formed with organic acids such as maleic acid and methanesulfonic acid.

  Salts of amine groups also constitute quaternary ammonium salts where the amino nitrogen has a suitable organic group such as an alkyl, low alkenyl, substituted low alkenyl, low alkynyl, substituted low alkynyl or aralkyl moiety.

  Base addition salts include those derived from inorganic bases, such as ammonium or alkaline earth metal hydroxides, carbonates, bicarbonates, and the like. Thus, bases useful for preparing the salts of the present invention include sodium hydroxide, potassium hydroxide, ammonium hydroxide, potassium carbonate, sodium carbonate, sodium bicarbonate, potassium bicarbonate, calcium hydroxide, calcium carbonate and the like. is there.

  Those skilled in the art will recognize that the specific counterion that forms part of the salts of the invention is usually not a critical attribute unless the entire salt is pharmacologically acceptable and the counterion does not give the entire salt an undesirable quality. Recognize that. The present invention further includes pharmaceutically acceptable solvates of compounds of Formula I. Many compounds of formula I combine with solvents such as water, methanol, ethanol and acetonitrile to form pharmaceutically acceptable solvates such as the corresponding hydrates, methanolates, ethanolates and acetononitriles. be able to.

  The compounds of the present invention may have multiple asymmetric (chiral) centers. As a result of these chiral centers, the compounds of the present invention occur not only as diastereomers and mixtures of diastereomers, but also as racemates, mixtures of optical isomers, and individual optical isomers. All asymmetric forms, individual isomers and combinations thereof are within the scope of the invention.

  Those skilled in the art will readily appreciate that if the stereochemistry of a compound of formula I is critical to its activity, the relative stereochemistry of the compound is established early during synthesis to avoid problems with subsequent stereoisomer separation. To understand. Thereafter, further molecular manipulations use stereospecific methods to maintain the desired chirality.

II. Preparation of compounds of formula I

As is well known in the art, the compounds of the invention can be prepared in a number of standard ways. Accordingly, compounds of formula I are described, for example, in Grimmett, (Grimmett, MR, Comprehensive Heterocyclic Chemistry: The Structure, Reaction, Synthesis and Usage. Hec. Of Hec. , Vol. 5, Pergamon Press. Oxford, 1984, pp. 457-498; Grimmett, MR, Imidazole and Benzimidazole Synthesis, Academic Press, Academic Press, San Diego CA, 19). It can be prepared by a synthetic method.

  In one embodiment of the invention, a compound of formula I is prepared by solution or solid phase synthesis by reacting a dione of formula II with aldehyde (III) in the presence of ammonium acetate in acetic acid (eg, Krieg et al., Natureforsch. 1967, 22b, 132; Sarshar et al., Tetrahedron Lett. 1996, 37, 835-838; Bian et al., Synthesis communications, 2003, 33, 3477-3482; Hong Xu et al., J. Chem. Trans, 2003, 11, 12260-2268; Hong Xu et al., Inorg. Chem. Commun., 2003, 6, 766-768; Bian et al., Polyhedron, 2002, 21, 313-31. ;. Chao et al, J.Chem.Soc, Dalton Trans, see 2001,12,1920-1926).

Compounds of formula (II) and (III) are either commercially available or prepared by standard methods well known to those skilled in the art. Compounds of formula (II) are described, for example, by Fischer et al. (J. Am. Chem. Soc. 1961, 83, 4208-4210); Guijarro et al. (J. Am. Chem. Soc. 1999, 121, 4155-4157); Chi et al. (Synth. Comm. 1994, 24 (15), 2119-2122) and Armesto et al. (Synthesis, 1988, 799-801); Yamada et al. (Bull. Soc. Chem. Jpn., 1990, 63 (9), 2710-2712); Hiort et al. (J. Am. Chem. Soc. 1993, 115, 3448-3454; and Tetrahedron Letters, 2004, 45 (33), 6361-6363). In synthetic synthesis Can be prepared. Compounds of formula (III) can be prepared by general synthetic methods as described by Vilsmeier et al. (Chem. Ber. 1958, 91, 850-861 and Synthesis, 1985, 8, 641-645). it can. For example, a compound of formula (III) can be prepared by reacting a compound of formula (IV) with POCl ₃ of dimethylformamide (DMF) as shown below.

  Separation and purification of the product (1) is usually based on their nature of forming water soluble salts. When the reaction medium is diluted with water, impurities are extracted from the resulting solution with a nonpolar solvent, the aqueous layer is basified, and the separated imidazo [4,5-d] phenanthroline (1) is filtered, Recrystallized from a suitable solvent.

Testing compounds of formula I

As mentioned above, compounds of formula I intended for use in the methods of the invention can chelate transition metals and inhibit the growth of cancer cells. Further, in one embodiment of the invention, the compound of formula I can increase the expression of transition metal regulated tumor suppressor genes such as KLF4 in cancer cells. In a further embodiment of the invention, the compound of formula I induces apoptosis in cancer cells and exerts a cytotoxic effect on the cancer cells.

  The ability of candidate compounds of Formula I to chelate transition metals and inhibit neoplastic proliferation in vitro and in vivo can be tested by standard methods well known in the art. Similarly, the ability of compounds to increase tumor suppressor gene expression and / or induce apoptosis in cancer cells can also be tested by standard methods. Exemplary methods for testing candidate compounds of Formula I are provided below and in the Examples included herein. One skilled in the art will appreciate that other methods for testing compounds are well known in the art and are also suitable for testing candidate compounds.

  Compounds of Formula I that demonstrate inhibitory activity may be further tested in vitro and / or in vivo with various well-known chemotherapeutic agents to evaluate their potential use in combination therapy.

  Metal chelate complexes of compounds of formula I are also contemplated by the present invention. Such chelate complexes can also be tested using the methods described below.

A. Metal chelation ability

According to the present invention, the compounds of formula I can chelate transition metal ions in the cellular environment. In one example, the compound of formula I can chelate iron, zinc, copper, ruthenium and cobalt ions. In a further example, the compound of formula I can chelate the first transition metal ion. In a further example, the compound of formula I can chelate iron, zinc and copper ions. In another embodiment of the present invention, the compound of formula I can chelate zinc ions. In another example, the compound of formula I can chelate copper ions.

  The metal chelating properties of the compounds of formula I are not limited to these, but include X-ray crystallography, NMR spectroscopy, fluorescence spectroscopy, atomic absorption spectroscopy (AAS), electron paramagnetic resonance spectroscopy, high performance liquid chromatography (HPLC). Can be determined by a variety of methods well known in the art, including complex liquid chromatography / mass spectrometry, and potentiometric titration.

For example, peracetic acid (PAA) is rapidly degraded in the presence of metal ions such as manganese, iron or copper. The efficiency of a chelate compound to stabilize a PAA solution in the presence of a metal ion can be evaluated to determine the metal chelating ability of the compound. That is, an aqueous solution containing metal ions can be prepared, an appropriate amount of a candidate compound of formula I can be added to the solution, and then the pH and temperature can be adjusted. And, after the stability of the PAA solution containing the compound of formula I, iodine reduction titration follows. Other tests to determine metal chelation ability use metal ion selective electrodes,
Includes measurement of non-chelating metal ions and chelate compounds in solutions containing metal ions. That is, a solution containing a metal is titrated with a solution containing a chelate compound and then measured with a metal selective electrode to determine the amount of non-chelate metal ions, thereby increasing the metal chelating ability of the compound of formula I. appear.

  The metal chelation properties of compounds of formula I can also be assessed spectrophotometrically using an in vitro 4 (2-viridylazo) resorcinol (PAR) metal binding assay. PAR is a commercially available dye, Mg, Al, Ca, Sr, Ba, Sc, Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, Ga, having a maximum absorbance of about 500 nm. Y, Zr, Nb, Ru, Rh, Pd, Ag, Cd, In, Sn, Hf, Ta, Os, Ir, Pt, Au, Hg, Tl, Pb, Bi, Th, U, Np and specific pH values It acts as a tridentate or bidentate ligand forming a soluble or insoluble colored complex with the lanthanide cation. To determine the nature of the metal chelation of the compound of formula I, the resulting PAR-metal ion complex formed in the presence of the metal ion can be measured spectrophotometrically at about 500 nm, and the compound of formula I A PAR-metal ion complex formed in a sample containing, for example, a control sample such as a sample containing a well-known chelating agent and / or a sample containing no compound of formula I but containing a control medium it can.

  The ability of a compound of formula I to chelate a transition metal in the cellular environment is determined by the use of a specific fluorescent indicator such as, for example, cinquin or Phen Green SK, in the presence or absence of intracellular zinc, It can be assessed by methods well known in the art, such as measuring possible iron or copper reserves (eg, Zalewski et al., Biochem J. 1993, 296 (Pt2), 403-8; and Petrat et al., Biol Chem. 2002, 383 (3-4), 489-502). Furthermore, the metal chelating ability of compounds of formula I in the cellular environment is described, for example, by Gower et al., Anal. Biochem. 1989, 180, 126-130; Ollinger and Roberg, J. et al. Biol. Chem. 1997, 272, 23707-23711; Flatmark and Tangeras, Proteins of Iron Metabolism, Brown, Aisen, Fielding and Crichton, eds. (New York, USA: Grune & Stratton), 1976, pp. 349-358; Kozlov et al., Free Radic, Biol. Med. 1992, 13, 9-16; Cammac and Cooper, Methods Enzymol, 1993, 227, 353-384. Yegorov et al., Free Radic. Biol. Med. 1993, 15, 565-574; Cairo et al. Biol. Chem. 1995, 270, 700-703; and Nielsen et al., Int. J. et al. Biochem. Intracellular chelates using methods such as high performance liquid chromatography (HPLC), spectrophotometric detection, electron spin resonance (ESR) or atomic absorption spectroscopy, as described by 1993, 25, 223-232. By measuring the retention of possible metal ions, it can be evaluated in various biological samples such as cell extracts, isolated cells, tissues or body fluids.

  The ability of a compound of formula I to chelate a metal in a cellular environment can be achieved in the presence of a candidate compound and various concentrations of metal ions, cell growth, changes in gene expression associated with metal regulation, cytotoxicity, enzymatic assays, or the art An indirect evaluation can also be made by evaluating other measurable evaluation items well known in the art. For example, the ability of a compound of formula I to chelate a metal can be evaluated in cultured cells or animals by manipulating cellular metal pools in the presence and absence of candidate compounds and measuring changes in cell growth. Can do.

  Alternatively, or in addition to measuring changes in cell growth, well-known metal-regulated genes or changes in gene expression of metal-regulated proteins such as metallothionein and metal transcription factor-1 are well-known standards in the art. Can be determined using the protocol. As is well known in the art, metallothionein (MT) protein expression is tightly controlled by intracellular zinc concentration. Binding of zinc to the metal transcription factor (MTF-1) allows MTF-1 to bind to the metal response element (MRE) at the MT promoter, which in turn initiates MT-gene transcription. Thereby, the ability of a compound of formula I to modulate the expression of MT or MTF-1 can be judged as an indication of the metal chelating ability of the compound. Other metal regulated genes well known in the art include, for example, genes encoding iron regulatory proteins (IRPs), ferritin, or transferrin receptors that are regulated at the iron level (eg, Eisenstein and Bremings, J NutR 1998, 128 (12): 2295-2295; and Martini et al., J. NutR 2002, 132 (4): 693-696), and encodes zinc transport protein-1 that is regulated at the zinc level. There are genes (see, for example, Kindermann et al., J. NutR 2004, 134 (1): 57-62; and Langmade et al., J. Biol. Chem. 2000, 275 (44): 34803-24809).

B. In vitro test

i) Inhibition of cancer cell growth

Candidate compounds of formula I can first be measured in vitro for their ability to inhibit the growth of cancer cells using standard methods.

In general, the ability of a candidate compound of formula I to inhibit the growth of cancer cells can be measured as follows. The cells of a particular test cancer cell line have an appropriate density (eg, ⁴ ) And various concentrations of candidate compounds are added. After an appropriate incubation time (usually about 48 to 74 hours), for example, measurement of tetrazolium salt (or modified tetrazolium salt) cleavage, or resazurin reduction test (Fields & Lancaster (1993) Am. Biotechnol. Lab. 11: 48-50 O'Brien et al. (2000) Eur J. Biochem. 267: 5421-5426 and US Pat. No. 5,501,959), sulforhodamine assay (Rubinstein et al. (1990) J. Natl. Cancer Inst. 82: 113- 118), natural red pigment test (Kitano et al. (1991) Euro. J. Clin. Investg. 21: 53-58; West et al. (1992) J. Investigative Derm. 99: 95-100) or Cell survival is assessed, such as with an XTT assay. Inhibition of cell proliferation can be achieved by cell survival in treated cultures, eg, cultures that have not been pretreated with a candidate compound, cultures that have been pretreated with a control medium, and / or pretreated with a control compound (usually a well-known treatment). As determined by comparison of cell survival in one or more control cultures.

  Other assays known in the art (tetrazolium-based assays) that measure metabolic activity are for assessing the effect of candidate compounds on cell proliferation if proliferating cells are metabolically more active than quiescent cells. Can also be used.

  Candidate compounds can also be tested in vitro for their ability to inhibit anchorage-independent growth of tumor cells. Anchorage-independent growth is well known in the art as a good indicator of tumorigenicity. In general, anchorage-independent growth is assessed by plating cells from the appropriate cancer cell line on soft agar and determining the number of colonies formed after a sharp culture period. The growth of cells treated with the candidate compound is then compared to cells treated with the appropriate control (as described above).

  Various cancer cell lines suitable for testing compounds of Formula I are commercially available, eg, American Type Culture Collection (ATCC; Manassas, Va.), Currently supplying more than 700 different human cancer cell lines and DCTD Tumor Deposition (NCI-Frederick, Frederick, MD) supplies a variety of mammalian cell lines including the human cancer cell lines used in the NCI-NIH screen.

  Examples of suitable human cancer cell lines used to test compounds of Formula I include, but are not limited to, HT-1376, HT-1197, and Hs195. B bladder cancer cell lines, CaCo, COLO320, HCT-116, LoVo, NCI-H498, NCI-H548 and SNU-C2B and other colon and colorectal adenocarcinoma and cancer cell lines, HuTu80 duodenal cancer cell line, Hs740T AGS, Hs746T, NCI-N87, NCI-SNU-1 and RF-48 gastric adenocarcinoma and cancer cell lines, NCI-H661 and NCI-H1581 large cell lung cancer cell lines, MDA PCa 2b, LNCaP-FGC and 22RvI prostate adenocarcinoma and cancer cell lines, raji, Namalwa and HS Sultan Burkitts lymphoma (non-Hodgkin) cell line, U-937 histiocytic lymphoma cell line, Jurkat acute lymphoblastic leukemia (T-ALL) cells Stock, Karpas 299 T thin There are lymphoma cell lines, plasma cell leukemia cell line, and NCI-H630 and SW837 adenocarcinoma and carcinoma cell lines rectum of L-363. Drug resistant cancer cell lines can also be used to determine the ability of a compound of the invention to inhibit the growth and / or proliferation of drug resistant or multi-drug resistant neoplastic cells.

The differential neoplastic selectivity of candidate compounds of formula I can also be tested, ie, compounds that demonstrate some level of selective action on neoplastic (or cancer) cells compared to normal proliferative cells It is the ability. An exemplary method for assessing the sensitivity difference between normal and cancer cells to compounds is described by Vassilev et al. (Anti-Cancer Drug Design (2001) 16: 7). This method involves a comparison of IC ₉₀ values, ie, the molar concentration of test compound required to cause 90% growth inhibition of logarithmic proliferating cells. Thus, the IC ₉₀ value of a candidate compound can be evaluated and compared in various cancer cell lines (cell lines as described above) and normal cells (HUVEC and / or WI38 cells). IC ₉₀ values can be measured by various standard methods well known in the art. Cancer cell selectivity is calculated as the ratio of the average IC ₉₀ for all normal cell lines and the average IC ₉₀ for all cancer cell lines. Compounds with an IC90 rate (normal / cancer)> 4 are believed to be selective for cancer cells (L. T. Vassilev et al., Anti-Cancer Drug Design, 2001, 16: 7-17).

  In one embodiment of the invention, the compound of formula I selectively inhibits the growth of one or more leukemia cells, prostate cancer cells, non-small cell lung cancer cells and colon cancer cells. Candidate compound selectivity is assessed using human cancer cell lines used in the NCI-NIH therapeutic drug program in vitro screen. The cancer cell lines used in this screen are displayed in Table 1 above.

According to an embodiment of the present invention, compounds, compound, breast cancer, central nervous system cancer, melanoma, at least 10% lower average GI ₅₀ than the average GI ₅₀ for inhibition of cell lines from each of ovarian and renal cancer Inhibiting the growth of cultured cell lines from selected cancers having (ie, prostate cancer, colon cancer, non-small cell lung cancer and / or leukemia) exhibit selective inhibition of the selected cancer. In one example, the mean GI ₅₀ for prostate cancer cells, colon cancer cells, non-small cell lung cancer cells and / or leukemia cells is a culture from each of breast cancer, central nervous system cancer, melanoma, ovarian cancer and kidney cancer. At least 15% lower than the average GI ₅₀ for cell line inhibition. In another example, the average GI ₅₀ for prostate cancer cells, colon cancer cells, non-small cell lung cancer cells and / or leukemia cells is from each of breast cancer, central nervous system cancer, melanoma, ovarian cancer and kidney cancer. At least 20% lower than the average GI ₅₀ for inhibition of cultured cell lines.

Methods for calculating GI ₅₀ are well known in the art (see, for example, Boyd, MR, et al., In Cytotoxic Anticancer Drugs: Models and Concepts for Drug Discovery and Development. C. Flert. Baker, L. H., Eds .; Kluwer Academic: Hingham, MA, 1992 and Monks, A. et al. (1991) JCI, J. Natl. Cancer Inst. 83, 757-766; reference). As described in the art, GI ₅₀ is a rename of the GI ₅₀ value (concentration causing 50% growth inhibition) that emphasizes the correction in the calculation of GI ₅₀ for cell counts at zero time. Thus, GI ₅₀ is the concentration of the following candidate compound:
100 × (T-TO) (C-TO) = 50
The optical density of the test well after 48 hours exposure to the test drug is T, the optical density at zero time is TO, and the control optical density is C.

For example, the following procedure currently used in NCI can be used to evaluate the GI ₅₀ of a candidate compound of formula I in selected cancer cell lines. That is, the cell suspension is diluted (5000 to 40,000 cells per well) and 100 μL of diluted cell suspension is added to a 96 well microtiter plate. For stabilization, the inoculum is allowed a pre-culture period of 24 hours at 37 ° C. A dilution of twice the desired test concentration of the candidate compound is added to the microtiter plate wells in 100 μL aliquots at zero time. Test compounds are usually evaluated in five 10-fold dilutions. In normal testing, the highest well concentration is usually 10E-4M, but this may be adjusted depending on the compound being tested. Cells are incubated with test compounds for 48 hours in 5% CO ₂ atmosphere and 100% humidity. The cells are then used in a sulforhodamine B assay (eg, Skehan, P. et al. (1990) JCICI, J. Natl. Cancer Inst. 82, 1107-1112 using a plate reader used to read the optical density. And Chen, SF, et al. (1990) Proc. Am. Assoc. Cancer Res. 31, A2644).

ii) Ability to increase the expression of transition metal regulated tumor suppressor genes

According to one embodiment of the invention, the compound of formula I increases the expression of transition metal regulated tumor suppressor genes in cancer cells. In another example, the compound of formula I increases the expression of a transition metal regulated tumor suppressor gene in cancer cells whose expression of the tumor suppressor gene is down-regulated. Increased or up-regulated expression of transition metal regulated tumor suppressor genes in cancer cells can be determined as a percentage increase in gene expression in untreated cells relative to treated cells. In one example, the compound of formula I increases the expression of the transition metal regulated tumor suppressor gene by about 10%. In another example, the compound of formula I increases the expression of the transition metal regulated tumor suppressor gene by about 20%. In other examples, compounds of Formula I can increase the expression of transition metal regulated tumor suppressor genes by about 25%, 50%, 75% or 100%.

  Increase or upregulation of transition metal-controlled tumor suppressor gene expression in cancer cells can also be judged as an increase or upregulation of “fold” gene expression in cancer cells, and gene expression in untreated cancer cells is “ 1 "and an individual" fold "increase in gene expression in treated cancer cells is shown relative to individual gene expression in untreated cancer cells. In one embodiment of the invention, the compound of Formula I can increase or upregulate the expression of a transition metal regulated tumor suppressor gene by about 1.5-fold. In another example, a compound of formula I can increase the expression of a transition metal regulated tumor suppressor gene by about 2-fold.

  In another embodiment of the invention, the transition metal regulated tumor suppressor gene is KLF4. The ability of candidate compounds to modulate the expression of tumor suppressor genes such as KLF-4 can be assessed by measuring changes in the level of KLF4 mRNA or protein. These assay methods are well known in the art.

  For example, candidate compounds can be introduced into selected cancer cell lines and the amount of mRNA transcribed from the associated tumor suppressor gene can be measured by standard methods such as Northern blot analysis, RT-PCR. Alternatively, the amount of tumor suppressor protein produced in the cells can be measured by standard methods such as Western blot analysis. The amount of mRNA or protein produced in cells treated with the candidate compound can then be compared to the amount produced in control cells, representing the degree of success that the compound inhibited the expression of tumor suppressor genes. Suitable control cells include, for example, untreated cells and / or cells treated with a control compound. Alternatively, candidate compounds can be screened for their ability to increase gene expression in selected cancer cell lines using standard methods for screening the expression of multiple genes (“expression profiling”). . Such methods are well known in the art, eg, high density microarrays containing 10-fold (eg, 19,000) human genes to identify appropriate functional groups of genes whose expression is affected by the compound. There are microarray analyzes such as assays.

  Expression profiling typically takes advantage of short DNA sequences or pre-made microarrays of oligonucleotides. Methods for constructing microarrays are well known in the art [see, eg, Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY. (See 1989 and the latest edition)]. Alternatively, the microarray can be customized, for example, to include sequences corresponding to well-known tumor suppressor genes. Pre-made microarrays include, for example, GeneChIP® (Affimetrix, Santa Clara, Calif.), Atlas® (BD Biosciences-CLONTECH, Palo Alto, Calif.), GEM Microarrays, GeneJet® array LifeSeq (R) (Incyte Genomics, Palo Alto, CA), MICROMAX (R) Human cDNA Microarray Systems (PerkinElmer Life Sciences, Boston, Mass.) And ResGen (R) Gene (R) Gene (R). Ala.) It is also commercially available against Kuno organism. For expression analysis, RNA is isolated from cells treated with candidate compounds and control cells. If necessary, RNA can be amplified by conventional methods to ensure a sufficient amount for analysis. The RNA is then mated to the microarray under appropriate conditions and a routine analysis of the microarray with a commercial scanner and software is performed to identify genes whose expression is altered in cells treated relative to control cells. Appropriate mating conditions can be readily determined by one skilled in the art using standard methods. Following identification of the other genes of interest, mRNA quantification and individual protein levels can also be evaluated to determine the extent of the compound's effect on the gene under study.

iii) Induction of apoptosis

In another embodiment according to the present invention, the compound of formula I can induce apoptosis in cancer cells. Methods for evaluating the ability of candidate compounds to induce apoptosis are well known in the art (see, eg, Current Protocols in Cell Biology, 2000 and latest editions, K. Morgan, ed., J. Wiley & Sons, New York, NY). ), Eg, DNA fragmentation analysis, flow cytometry using annexin V-FITC and propidium iodide staining method, DNA strand breakage by terminal deoxynucleotide transferase (TdT assay), analysis by fluorescent dye labeling and flow cytometry, flow Detection by cytometry, in situ detection by immunocytochemistry using terminal deoxynucleotide transferase (TdT) mediated dUTP nick end labeling (TUNEL) assay Poly (ADP-ribose) proteolytic cleavage or proteolysis of immunohistochemical or flow cytometric detection of polymerase (PARP), and / or cysteinyl - including the detection of activated aspartic proteases (caspases).

  For example, the effect of a compound of formula I on apoptosis can be assessed by culturing cells with a candidate compound for a period of time and performing cytometric analysis using the annexin V-FITC-propidium iodide method. Entering apoptosis results in a translocation of phosphatidylserine from the inner lobe to the extracellular side of the plasma membrane. Annexin V, a protein that binds phosphatidylserine with high affinity, can be used to detect this apoptosis-induced membrane change. The DNA binding dye propidium iodide (PI) easily enters and stains non-viable cells, but cannot cross the membrane of viable cells. Thus, cells that stain only with annexin V are considered early apoptotic, whereas cells stained with both annexin V and PI are considered late apoptotic. Cells stained with PI alone are considered non-viable, but if not stained indicate viable cells.

  Assays to study the potential mechanism of action of a compound may be performed as needed to provide information to help determine what conditions the compound will affect tumor growth . This type of information may be useful in determining the type of cancer for which treatment with the compound is effective. Examples of such assays include, but are not limited to, cell cycle analysis (eg, using flow cytometry methods), anti-angiogenesis assays (eg, various Matrigel assays such as code formation and Matrigel plug assays) and immunohistochemistry. There is a law.

C. In vivo testing

The ability of a candidate compound to inhibit tumor growth, proliferation and / or metastasis in vivo can be determined in an appropriate animal model using standard methods well known in the art (eg, Enna et al., Current Protocols in Pharmacology, J. Wiley & Sons, Inc., New York, NY). Exemplary procedures are provided below or in the examples.

  For example, the in vivo activity of candidate compounds can also be tested using a hollow fiber assay (Hollingshead, M. et al. (1995) Life Sciences 57: 131-141; and Decker et al. Eur. J. of Cancer. 40: 821-826 (2004)). In this assay, cells that grow on hollow fibers (vinylidene fluoride resin, PVDF) are transplanted into various body compartments of mice. A standard panel of 12 tumor cell lines can be used for hollow fiber screening of candidate compounds that show activity in vitro. These cell lines include NCI-H23, NCI-H522, MDA-MB-231, MDA-MB-435, SW-620, COLO205, LOX-IMVI, UACC-62, OVCAR3, OVCAR5, U251 and SF-295. May include.

In addition, alternative strains such as those raised in the in vitro section above can be used for special testing of compounds. Cell lines are cultured according to standard protocols, and fibers are prepared by flowing cells over PVDF fibers and sealing at 2 cm intervals. Samples generated from these seals are placed on tissue culture media and incubated at 5% CO ₂ and 37 ° C. for 24-28 hours prior to transplantation. A total of 3 different tumor lines are prepared for each experiment for 3 intraperitoneal transplants (one for each tumor line) and 3 subcutaneous transplants (one for each tumor line) for each mouse. On the day of transplantation, in order to grasp the zero-hour cell amount, the sample of each tumor cell line preparation is quantified with respect to the viable cell amount by, for example, a stable endpoint MTT assay. Mice are treated with experimental drugs from day 3 or 4, followed by fiber transplantation, continuing daily for 4 days. Each drug is administered by intraperitoneal injection at two dose levels. Fibers are collected from mice the day after the fourth compound treatment and used for stable endpoint MTT assays. The optical density of each sample is determined by spectrophotometry at 540 nm and the average of each treatment group is calculated. The percent final growth of each cell line in each treatment group is calculated and compared to the final growth rate in vehicle-treated controls. A reduction of 50% or more in the final growth rate in the treated sample is considered positive compared to the vehicle control sample. Each positive result is a score of 2, and totals all scores for any compound. The maximum possible score for one drug is 96 (12 cell lines x 2 sites x 2 dose levels x 2 [points]).

  Candidate compounds initially screened in the hollow fiber assay caused cell killing of any cell line at a total ip + sc score of 20 or higher, sc score of 8 or higher, or any dose level evaluated In some cases, it may be subsequently tested in a xenograft model. This scoring system has been validated by CTEP's DCTDC statisticians to show the level of detection expected to acquire the current “standard” drug in an activated state.

  Alternatively, compounds of formula I can be tested directly in a xenograft model. A xenograft model in which a human tumor is transplanted into an animal is a standard model for evaluating the anticancer activity of a candidate compound. Examples of human cancer xenograft models include, but are not limited to, human solid tumor xenografts implanted by subcutaneous injection or implantation, used in tumor growth assays, fat pad injections used in tumor growth assays Solid tumor allografts transplanted by, human solid tumor orthotopic xenografts transplanted directly into relevant tissue used in tumor growth assays, solid tumors or leukemia by intravenous injection used in survival assays Models of disseminated disease, experimental models of lymphoma and leukemia in mice used in survival assays, and experimental models of lung metastases in mice. In addition to transplanted human tumor cells, the xenograft model can further constitute transplanted human peripheral blood leukocytes that allow assessment of the anti-cancer immune response. In various xenograft models, the transplanted human tumor cells can be primary tumor cells or tumor cells derived from a cell line.

  There are several host animal options for xenograft models, including but not limited to the use of severe combined immunodeficiency (SCID) mice, athymic nude mice and athymic rats. Non-obese diabetic / severe combined immunodeficient mice (NOD / SCID) replace other host animals that can be used in various xenograft models for transplantation of blood cancer cells such as, for example, leukemia and / or lymphoma cells .

  Alternatively, the murine cancer model can be used to screen for anticancer compounds. Examples of suitable murine cancer models are well known in the art and include, but are not limited to, transplant models, mouse metastasis models, transgenic mice in which murine cancer cells are transplanted intravenously, subcutaneously, fat pad or orthotopic injection There are models, and knockout mouse models. The effects of candidate compounds can also be evaluated against spontaneous cancers in normal mice.

For example, candidate compounds may be used against solid tumors using mice implanted or injected subcutaneously with 30-60 mg tumor fragments or an appropriate number of tumor cells (eg, about 10 ⁶ to 10 ⁷ ) on day 0. And can be tested in vivo. Cancer-bearing animals are mixed before being used for various treatments and controls. For the treatment of advanced tumors, tumors are grown to the desired size and animals with tumors that are not fully grown are excluded. Selected animals are randomly distributed to receive treatment and controls. Non-cancer-bearing animals may be used for the same treatment as cancer-bearing animals because they allow the toxic effects to be separated from the specific effects on the tumor. Chemotherapy usually begins 3-22 days after transplantation depending on the type of tumor and the animals are observed daily. Candidate compounds can be administered to animals, for example, by bolus administration. Different groups of animals are weighed about 3-4 times a week until maximum weight loss is achieved, after which the groups are weighed at least once a week until the end of the study.

  Until the tumor reaches a predetermined size and / or weight, or until a predetermined time, or until the animal dies (if this occurs before the tumor reaches a predetermined size / weight) Measure approximately 2-3 times a week. The animals are then killed and histology, size and / or tumor growth are assessed.

  The effect of candidate compounds on drug resistant tumors can be assessed in vivo using drug resistant or multi-drug resistant cancer cells in xenograft experiments.

  In studies of the effect of candidate compounds on blood tumors such as lymphomas or leukemias, animals are transplanted or injected with a specific number of cells, and anti-tumor activity is judged by increasing the survival time of mice treated against controls. Assessment of disease burden in leukemia xenograft models is based on various indicators of leukemia, such as expression of cell surface markers or leukemia-specific genes using flow cytometry or polymerase chain reaction (PCR) from continuous blood samples. It can also be performed by measuring.

  To study the effect of candidate compounds on tumor metastasis, tumor cells are usually treated ex vivo with compounds and then injected into appropriate test animals. Thereafter, the expansion of the tumor cells from the injection site is observed for an appropriate period.

  The ability of a candidate compound to act in combination with other chemotherapeutic agents or to make a tumor sensitive to its effects can also be tested in the above model. In this case, the test animal is treated with both the chemotherapeutic agent and the candidate compound of formula I. Control animals include animals treated with chemotherapeutic agents alone, animals treated with candidate compounds only and / or untreated animals.

  In vivo toxic effects of compounds of formula I are standardized by, for example, measuring their effects on animal body weight during treatment and performing hematological profiles and liver enzyme analysis after animal death. Can be assessed using a manual method (survival assay).

Table 2: Examples of in vivo models of human cancer

  Further, if desired, the effect of the compound of formula I on the expression level of the transition metal regulated tumor suppressor gene is assessed in tumors from test animals, for example, by measuring changes in tumor suppressor mRNA or protein levels. be able to. The practice of these assays is well known in the art as described above.

  If necessary, one or more standard immunohistochemical tests are also performed on tissues isolated from the test animals to determine the effect of the compound on tumor growth, differentiation, apoptosis and / or angiogenesis. There is a case. Examples of such tests include, but are not limited to, the use of specific antibodies (eg, antibodies against Ki-67 to assess proliferation, antibodies to CD31 to assess angiogenesis, antibodies to NKl.1 indicating the presence of NK cells. , Antibodies to F4 / 80 indicating the presence of macrophages) and TUNEL assays to determine apoptosis.

D. Toxicity test

The compounds of formula I can also be subjected to toxicity tests if necessary. Toxicity testing for potential drugs is well known in the art (eg Hayes, AW, ed., (1994), Principles and Methods of Toxology, 3rd. Ed., Raven Press, NY; Maines). , M., ed., Current Protocols in Toxicology, John Wiley & Sons, Inc., NY).

  In vitro acute toxicity studies of compounds of formula I use mammalian cell lines (see, for example, Ekwall, B., Ann. NY Acad. Sci., (1983) 407: 64-77). Can be done. The selection of an appropriate cell line can be readily determined by one skilled in the art based on the potential application of the candidate compound. For example, these tests include treatment of human primary fibroblasts with a compound of formula I in the presence of a commercially available carrier. The cells are then tested at different times and treated for cell viability using standard viability assays such as trypan blue exclusion assay, XTT or MTT assay. Cells can also be tested for their ability to synthesize DNA using, for example, a thymidine contamination assay, eg, using a standard cell sorting assay in conjunction with a hemocytometer cell sorter (FACS), It can also be examined for kinetic changes in the cell cycle.

  In vivo toxicity testing can be performed by standard procedures such as, for example, injecting various concentrations of candidate compounds into appropriate animal models. The compound can be injected once or the administration can be repeated over several days. The toxic effects of the compounds can be assessed over an appropriate period by observing changes in animal mortality, behavior, appearance and body weight. At the end of the evaluation period, the animals are killed and the appearance and weight of the relevant organs can be determined. If necessary, additional assessments such as, for example, hematological profile, histology and liver enzyme analysis may be performed. An indication of the toxicity of the compound may be obtained during an in vivo anticancer test of the compound.

  The genotoxicity of the compounds of formula I can be determined, if necessary, by an Ames assay to screen for mutagenic effects, a mouse lymphoma assay to determine the ability of a test substance to induce gene mutations in mammalian cell lines, such as It can be assessed in vitro by standard methods such as an in vitro chromosomal aberration assay using, eg, Chinese hamster ovary cells (CHO) to determine DNA reconstitution or test substance damage. Other assays include sister chromatid assays that determine exchange between chromosomal arms induced by the test substance, and in vitro mouse micronucleus assays that determine damage to chromosomes or spindles. The genotoxicity of the compounds of formula I can also be assessed in vivo using an in vivo sister chromatid exchange assay, an in vivo micronucleus assay, or an in vivo chromosomal aberration assay, if necessary. The procedures for these assays and standard assays are well known in the art, see, for example, the OECD guidelines for testing chemicals and procedures developed by ISO.

IV. Use of compounds of formula I

The compounds of formula I can be used for the treatment, stabilization or prevention of cancer in a subject. In this context, the compounds have a cytotoxic or cytostatic effect, reducing tumor size, slowing or preventing tumor growth, extending disease-free survival from disappearance or excision of the tumor to its recurrence, initial tumor initiation Or prevent secondary (eg, metastasis), prolong progression time, reduce one or more adverse symptoms associated with a tumor, or prolong the overall survival time of a subject with cancer. According to one embodiment of the invention, the compound of formula I exerts a cytotoxic effect on cancer cells by inducing apoptosis in the cancer cells.

  Exemplary tumors include, but are not limited to, blood tumors such as leukemia, myeloma and lymphoma, carcinomas such as adenocarcinoma and squamous cell carcinoma, melanoma and sarcoma. Carcinomas and sarcomas are often referred to as “solid tumors”. Examples of commonly present solid tumors include, but are not limited to, brain, breast, neck, colon, head and neck, kidney, lung, ovary, pancreas, prostate, stomach and uterus cancer, non-small cell lung cancer and colorectal cancer. is there. Various forms of lymphoma can also cause the formation of solid tumors and are therefore often considered solid tumors.

  One embodiment of the present invention provides the use of a compound of formula I in the treatment of one or more prostate cancer, non-small cell lung cancer, colon cancer and leukemia. Furthermore, according to one embodiment of the present invention, the compounds of formula I can also be used in the treatment of cancer to increase the expression of transition metal regulated tumor suppressor genes in cancer cells. In a particular example, the compound of formula I treats, stabilizes or prevents the metal-controlled tumor suppressor gene KLF4 from treating cancers that function as tumor suppressors, including the gastrointestinal (GI) tract, bladder cancer and leukemia cancer. Use to do. Gastrointestinal cancers include gastric cancer, esophageal cancer, small intestine cancer, duodenal cancer, colon cancer, colorectal cancer, rectal cancer and anal cancer.

  In one embodiment, the present invention also provides the use of a compound of formula I for increasing the expression of a transition metal regulated tumor suppressor gene in cancer cells. In another embodiment, the present invention provides the use of a compound of formula I for increasing the expression of a KLF4 tumor suppressor gene in cancer cells.

  Thus, cancers that can be treated according to one embodiment of the present invention include, but are not limited to, leukemias and adenocarcinomas and carcinomas such as squamous cell carcinoma. Carcinomas, as mentioned above, are also often referred to as “solid tumors” and examples of commonly existing solid tumors that can be treated according to the present invention include, but are not limited to, anal cancer, bladder cancer, There are colorectal cancer, colorectal cancer, duodenal cancer, gastric cancer, lung (non-small cell) cancer, esophageal cancer, prostate cancer, rectal cancer and small intestine cancer. Thereby, one embodiment of the present invention includes leukemia, bladder cancer, lung (non-small cell) cancer, prostate cancer and, but not limited to, anal cancer, colon cancer, colorectal cancer, duodenal cancer, gastric cancer, There is provided the use of a compound of formula I in the treatment of cancer selected from the group of cancers of the gastrointestinal tract, including esophageal cancer, rectal cancer and small intestine cancer.

  The term “leukemia” refers broadly to progressive, malignant diseases of hematopoietic organs. Leukemia is usually characterized as impaired proliferation and growth of white blood cells and precursors in the blood and bone marrow, but can also be referred to as other blood cell malignancies such as erythroleukemia that attacks immature red blood cells. Leukemia is generally (1) duration and nature of the disease-acute or chronic, (2) related cell types-myeloid (myeloid), lymphoid (lymphoid) or monocytic, and (3) Differentiated clinically based on an increased or non-increased abnormal cell count in blood-white blood or non-white blood (sub-white blood). Leukemia is, for example, acute non-lymphocytic leukemia, chronic lymphocytic leukemia, acute granulocytic leukemia, chronic granulocytic leukemia, acute myelocytic leukemia, adult T-cell leukemia, non-white blood leukemia, non-white blood leukemia, Basophilic leukemia, blastic leukemia, bovine leukemia, chronic myeloid leukemia, skin leukemia, fetal leukemia, eosinophilic leukemia, gross leukemia, hairy cell leukemia, hemoblastic leukemia, hemoblastic Leukemia, histiocytic leukemia, stem cell leukemia, acute monocytic leukemia, leukopenic leukemia, lymphoid leukemia, lymphoblastic leukemia, lymphocytic leukemia, lymphoblastic leukemia, lymphoid leukemia, lymphosarcoma cell Leukemia, mast cell leukemia, megakaryocytic leukemia, small myeloblastic leukemia, monocytic leukemia, myeloblastic leukemia, myeloid leukemia, myeloid granulocytic leukemia, myelomonocytic leukemia , Including Negeri leukemia, plasma cell leukemia, plasma cell leukemia, promyelocytic leukemia, leader cell leukemia, Schilling leukemia, stem cell leukemia, Ashiro blood leukemia, and undifferentiated cell leukemia.

  The term “carcinoma” refers to a malignant neoplasm composed of epithelial cells that readily infiltrate the surrounding tissue, causing metastasis. The term “carcinoma” also includes adenocarcinoma. Adenocarcinoma is a carcinoma derived from cells that make up organs with granular (secretory) properties, or from cells lining luminal organs such as the gastrointestinal tract and bronchial epithelium. Including.

  According to the invention, the compounds according to formula I can be used to treat the growth and progression of cancer cells, tumors and / or cancers of various stages and malignancy. Thus, the present invention provides for the treatment of interphase cancers and new, advanced and / or metastatic and / or high-grade malignancy, such as slowing disease progression, reducing metastasis, increasing patient survival, etc. Early, including early neoplasms that may be small, slow-growing, local and / or non-aggressive, not only for the treatment of late-stage cancer, including organisms, but for example to treat disease or cause cancer regression It is intended to be used in combination in the treatment of cancer.

  The present invention relates to recurrent, metastatic, locally advanced and aggressive cancers in which the compound comprises indolent cancer, locally relapsed, distal relapsed and / or refractory cancer (ie, cancer that has not responded to treatment). It is also intended to be used for the treatment of. Thus, "advanced" cancer includes locally advanced cancer and metastatic cancer and refers to overt disease in the patient, which is not suitable for local treatment such as surgery or radiation therapy. The term “metastatic cancer” refers to cancer that has spread from one part of the body to another. Advanced cancer is also unresectable, meaning it can spread to surrounding tissues and cannot be surgically eliminated.

  Those skilled in the art recognize that these categories overlap, for example, aggressive cancers are also usually metastatic. As used herein, “aggressive cancer” refers to a rapidly growing cancer. Those skilled in the art will recognize that for some cancers such as breast cancer or prostate cancer, the term “aggressive cancer” refers to an advanced cancer that has recurred within the first approximately two thirds of the range of relapse times for any cancer. To mention, for other cancer types such as small cell lung cancer (SCLC), almost all cases represent rapidly growing cancers that are considered aggressive. Thus, the term can cover a subsection of a particular cancer type or may include all other cancer types.

  The compounds can also be used to treat drug resistant cancers, including multidrug resistant tumors. As is well known in the art, cancer cell resistance to chemotherapy is one of the central issues in cancer management.

  Certain cancers, such as the prostate, can be treated with hormone therapy, i.e. treated with hormones or antihormonal agents that slow or stop the growth of certain cancers by blocking the body's natural hormones it can. The cancer may develop or be inherently resistant to hormone therapy. The present invention is further directed to the use of the compounds in the treatment of said “hormone resistant” or “hormone resistant” cancer.

  The present invention is also directed to the use of compounds as “sensitizers” that selectively inhibit the growth of cancer cells. In this case, the compound alone has no cytotoxic effect on the cancer cells, but provides a way to weaken the cancer cells, further enhances the benefits obtained from the application of conventional anti-cancer therapy, or otherwise, Increase the effectiveness of the treatment.

Accordingly, the present invention is directed to administering to a subject a therapeutically effective amount of one or more compounds in combination with one or more therapeutic modalities. The compound can be administered before, during or after treatment with anti-cancer therapy. “Anti-cancer therapy” refers to a compound, composition or treatment that prevents or delays the growth and / or metastasis of cancer cells. The treatment is not limited to these,
Includes chemotherapeutic drug treatment, radiation therapy, gene therapy, hormonal treatment, immunotherapy and antisense oligonucleotide therapy. Examples of useful chemotherapeutic agents include, but are not limited to, hydroxyurea, busulfan, cisplatin, carboplatin, chlorambucil, melphalan, cyclophosphamide, ifosfamide, danorubicin, doxorubicin, epirubicin, mitoxantrone, vincristine, vinblastine, Navelbine (registered trademark) (vinorelbine tartrate), etoposide, teniposide, paclitaxel, docetaxel, gemcitabine, cytosine, arabinoside, bleomycin, neocalcinostatin, suramin, taxol, mitomycin C and the like. The compounds of the present invention are also suitable for use in combination with standard combination therapy using two or more chemotherapeutic agents. Of course, treatments for use in the present invention also include new compounds or treatments that will be developed in the future.

  The compounds of formula I are also suitable for use in various applications aimed at chelating transition metals, for example therapeutic applications. Metal chelation is a metal overload, such as metal poisoning, metal toxicity, genetic disorders and / or iron overload associated with transfusion-dependent anemia, microbial infections, immune media diseases or disorders, skin diseases or disorders, nervous system diseases Or suitable for the treatment of diseases, cardiovascular diseases or disorders, aging-related diseases or disorders, or genetic diseases or disorders. In one embodiment of the invention, the compounds of formula I can be used in therapeutic applications such as, for example, chelating metal ions in vivo for the treatment of diseases or disorders other than cancer.

  Compounds of formula I can be used, for example, exfoliation, chemical degradation, discoloration, precipitation, microbial growth, emulsification instability, acid odor and / or odor, off-flavour, turbidity, devitrification, reduced texture, crystal formation, viscosity change, oxidation It can also be used in products or processes aimed at chelating transition metals to prevent or suppress other problems associated with unwanted metal ions such as. The use of chelating agents in these situations will improve product quality, consumer appeal, shelf life or value, increase processing efficiency, reduce equipment downtime, or reduce processing costs. Thus, the present invention is not limited to such as food and beverage products, cleaning products, personal care products, pharmaceuticals, diagnostic applications, paper pulp applications, water treatment applications, metal processing applications, textile products Application in agriculture, agricultural and agricultural applications, rubber processing, photography application, printing ink, oil field application, mining application, gas scenting, construction application, electrical application Or the use of a compound of formula I for chelating metal ions in various applications, including descaling and prevention.

V. Pharmaceutical composition

The compounds of the invention are usually prepared prior to administration. Accordingly, the present invention provides a pharmaceutical composition comprising one or more compounds of formula I and a pharmaceutically acceptable carrier, diluent or excipient. The pharmaceutical composition is prepared by well known methods using well known and readily available ingredients. Pharmaceutical compositions consisting of one or more compounds of formula I in combination with well-known cancer chemotherapy are also an object of the present invention.

  A compound of general formula I or a pharmaceutical composition comprising these compounds is a dosage unit formulation containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants and solvents, and is oral, topical, parenteral, inhalation and It may be administered by spray or rectally. In the normal course of therapy, the active compound is incorporated into an acceptable solvent to form a composition for topical administration, such as a hydrophobic or hydrophilic cream or lotion, or a syrup, elixir, Tablets, troches, candies, hard or soft capsules, pills, suppositories, oily or aqueous suspensions, dispersible powders or granules, emulsions, injections or solutions suitable for oral, rectal or parenteral administration Is taken in. As used herein, the term parenteral includes subcutaneous injections, intradermal, intraarticular, intravenous, intramuscular, intravascular, intrasternal, intrathecal injection or infusion methods.

  The present invention also provides pharmaceutical compositions consisting of one or more compounds of formula I and solvents such as artificial membrane vesicles (including liposomes, lipid micelles, etc.), microparticles or microcapsules.

  Oral compositions may be prepared in either individual or liquid dosage forms. Liquid dosage forms can be prepared by methods of making pharmaceutical compositions well known in the art, and the compositions can be formulated with sweeteners, dressings to provide pharmaceutically refined and palatable formulations. One or more agents selected from the group consisting of fragrances, colorants and preservatives may be included. The elixir is prepared using a hydroalcoholic (eg, ethanol) solvent with a fragrant flavoring and a suitable sweetener such as sugar and saccharin. The suspension can be prepared with an aqueous solvent using acacia, tragacanth, methylcellulose and the like.

  Individual dosage forms, such as tablets, contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients that are suitable for the manufacture of tablets. These excipients include, for example, inert diluents such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate, granulating and disintegrating agents such as corn starch or alginic acid, such as starch, gelatin or acacia. Binding agents and smoothing agents such as magnesium stearate, stearic acid or talc, and other conventional ingredients such as dicalcium phosphate, magnesium aluminum silicate, calcium sulfate, starch, lactose, methylcellulose and functionally similar It may be a substance. The tablets may be uncoated or coated by well known methods that delay disintegration and absorption in the gastrointestinal tract and provide a sustained action over a longer period. For example, a time delay material such as glyceryl monostearate or glyceryl distearate may be employed.

  Oral formulations also exist as hard gelatin capsules in which the active ingredient is mixed with an inert solid diluent such as calcium carbonate, calcium phosphate or kaolin, where the active ingredient is water or, for example, peanut oil, It also exists as a soft gelatin capsule tablet mixed with an oily solvent such as liquid paraffin or olive oil. Soft gelatin capsules are prepared by mechanically encapsulating a slurry of the compound with an acceptable vegetable oil, light liquid petrolatum or other inert oil.

  Aqueous suspensions contain the active materials in admixture with excipients suitable for the manufacture of aqueous suspensions. The excipient is a suspending agent such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia, and the dispersing or wetting agent is eg lecithin or Condensates of alkylene oxides with fatty acids, such as polyoxyethylene acid, or condensates of alkylene oxides with long-chain aliphatic alcohols, such as heptadecaethyleneoxycetanol, or fatty acids and polyoxyethylene sorbitol monooleate Condensates of ethylene oxide with partial esters derived from hexitol, such as fatty acids and eg polyethylene sorbitol monooleate Such as condensation products of ethylene oxide with partial esters with hexitol anhydrides derived from the like, may be phospholipid secreted naturally. Aqueous suspensions are, for example, one or more preservatives such as ethyl or n-propyl-p-hydroxybenzoate, one or more colorants, one or more flavoring agents or one such as saccharose or saccharin. One or more sweeteners may also be included.

  Oily suspensions may be prepared, for example, by suspending in a vegetable oil, such as peanut oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent, such as beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and flavoring agents may be added to provide a palatable oral preparation. These compositions may be preserved by the addition of an anti-oxidant such as ascorbic acid.

  Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are already exemplified by those already mentioned above. Additional excipients may also be present, such as sweeteners, flavorings and colorants.

  The pharmaceutical composition of the present invention may be in the form of an oil-in-water emulsion. The oily phase may be a vegetable oil, for example olive oil or peanut oil, or a mineral oil, for example liquid paraffin or mixtures of these. Suitable emulsifiers include, for example, naturally occurring gums such as gum acacia or gum tragacanth, such as soy, lecithin, and naturally secreted phospholipids such as esters or partial esters derived from fatty acids and hexitol, sorbitan monooleate, etc. It may be an anhydride and a condensate of said partial ester with ethylene oxide, for example polyoxyethylene sorbitan monooleate. The emulsion may contain sweetening and flavoring agents.

  The pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleagenous suspension. This suspension may be prepared by known techniques using suitable dispersing or wetting agents thereof and may be the suspending agents described above. A sterile injectable preparation may be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Good. Among the acceptable solvents and solvents that may be employed are water, Ringer's solution and physiological saline solution. In addition, sterile fixed oils are conventionally employed as a solvent or suspending agent. For this purpose any bland fixed oil may be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid are used in injectable formulations. Adjuvants such as local anesthetics, preservatives and buffering agents can also be included in the injection or suspension.

  The compounds of general formula I may be administered together or in the form of suppositories for rectal administration of the drug alone. These compositions can be prepared by mixing the drug with a suitable nonirritating excipient that is in a solid form at room temperature but liquid at the rectal temperature, thereby melting the rectum and discharge. Such materials include cocoa butter and polyethylene glycols.

  Other pharmaceutical compositions and methods for preparing pharmaceutical compositions are well known in the art, see, for example, “Remington, The Science and Practice of Pharmacy” (formerly “Remington's Pharmaceutical Sciences”), Gennaro, A. et al. Lippincott, Williams & Wilkins, Philadelphia, PA (2000).

VI. Administration of compounds of formula I

The compound of formula I may be administered to a subject in a variety of ways depending on the cancer being treated; for example, the compound is a dosage unit formulation, oral, topical, parenteral, inhalation or spray, or rectally. May be administered. In one example, the compound is administered systemically to the subject, for example, by bolus injection or infusion into the subject's bloodstream, or by oral administration. When used in conjunction with one or more well-known chemotherapeutic agents, the compound can be administered before, after, or simultaneously with the administration of the chemotherapeutic agent. One or more chemotherapeutic agents may be administered systemically, for example, by bolus injection, infusion or oral administration.

  The compounds of formula I may be used as part of neoadjuvant therapy (or primary therapy) or as part of adjuvant therapy. The present invention relates to highly advanced and / or malignant neoplasms (ie, overt disease that is not suitable for local treatment such as surgery or radiation therapy), metastatic disease, locally advanced disease and / or refractory tumor ( That is, it is aimed at the use of compounds of formula I at various stages in tumor growth and progression, including the treatment of cancer or tumor therapy that does not respond to therapy.

  “Primary therapy” refers to the initial treatment after an initial diagnosis of cancer in a subject. Exemplary primary therapies may involve surgery, extensive chemotherapy and radiation therapy. “Adjuvant therapy” refers to treatment following primary therapy and treatment administered to a subject at risk of recurrence. Adjunct systemic therapy usually begins immediately after primary therapy to delay recurrence, prolong survival, and cure the subject.

  It is intended that the compounds of the present invention can be used alone or in combination with one or more other chemotherapeutic agents as part of primary therapy or adjuvant therapy. Since the combination of a compound of formula I and a standard chemotherapeutic agent may act to improve the efficacy of the chemotherapeutic agent, it can be used to improve standard cancer therapy. This application can be important in the treatment of drug resistant cancers that do not respond to standard treatment. Drug-resistant cancers can arise, for example, from heterogeneity of tumor cell populations, changes due to response to chemotherapy, and an increased likelihood of malignancy. Such changes are often more pronounced at advanced stages of the disease.

  The dose to be administered does not follow defined limits, but is usually an effective amount. It is equivalent on a molar basis to the pharmacologically active free form produced from a dosage formulation with the metabolic release of the active free drug that achieves its intended pharmacological and physiological effect. The composition may be prepared in unit dosage form. The term “unit dose form” refers to physical discontinuous units suitable as unit doses for human subjects and other mammals, each unit together with suitable pharmaceutical excipients to obtain the desired therapeutic effect. Contains a predetermined amount of calculated active substance. An example of a range of compounds in each dosage unit would be about 0.05 to about 100 mg, or more usually about 1.0 to about 50 mg.

  The daily dosage of the compounds of the invention is usually in the range of about 0.01 to about 100 mg / kg body weight, in single or divided doses. It will be appreciated, however, that the actual amount of compound administered will include the condition being treated, the method of administration chosen, the compound actually administered, the age, weight and response of the individual patient, and the severity of the patient's symptoms. Determined by the physician in view of the relevant circumstances. The above dose ranges are presented by way of example only and are in no way intended to limit the scope of the invention. In some cases, dose levels below the lower limit of the range may be sufficient, while in other cases, higher volumes are administered over the course of the day, for example by dividing the higher amount into several smaller amounts first. May be used without causing harmful side effects.

VII. Clinical trials in cancer patients

Those skilled in the art will submit for standard GLP animal toxicity and pharmacokinetic studies following the proven efficacy of compounds of formula I in vitro and in animal models, and then further evaluate their effects in the treatment of cancer And recognize that they can enter clinical trials to obtain regulatory approval for therapeutic use. As is well known in the art, clinical trials are conducted through the phases of the trial, which are first, second, third and fourth phases.

  First, selected compounds of formula I are evaluated in a Phase 1 study, which is usually an open-label study. Phase 1 studies are usually used to determine the best mode of administration (eg, pills or injections), frequency of administration, and compound toxicity. Phase I trials frequently include laboratory tests such as blood tests and biopsies to assess the effects of compounds of formula I in the patient's body. In a phase 1 trial, a small group of cancer patients is treated with a specific dose of a compound of formula I. During the study, the dose is usually increased from group to group to determine the maximum tolerated dose (MTD) and dose limiting toxicity (DLT) associated with the compound. This process determines the appropriate dose to use in the next phase II study.

  Phase II trials can be conducted to further evaluate the efficacy and safety of the compounds of the present invention. In a phase 2 study, these compounds are administered to a group of patients with either one particular cancer type or associated cancer, using doses that are considered effective in the phase 1 study. .

  Phase 3 trials focus on determining how similar or different a compound is to the standard or most widely accepted treatment. In phase 3 trials, patients are randomly assigned to one of two or more “treatment groups”. In a trial with two treatment groups, for example, one treatment group receives standard treatment (control group) and the other treatment group receives treatment with a compound according to the invention (trial group).

  A phase 4 study is used to further evaluate the long-term safety and efficacy of the compound. Phase 4 studies are less common than first, second, and third phase studies, and are performed after the compound has received standard usage approval.

A. Patient eligibility for clinical trials

Participant eligibility criteria range from general (eg, age, sex, type of cancer) to specific (eg, type and number of pre-treatments, tumor characteristics, blood cell count, organ function). Eligibility criteria may vary from study phase to study phase. For example, in phase 1 and 2 trials, patients are often excluded by criteria because they may be at risk from treatment during the trial due to abnormal organ function or other factors. Phase 2 and 3 trials often include additional criteria regarding the type and stage of the disease and the number and type of prior treatments.

  Phase 1 cancer trials usually consist of 15-30 participants for whom other treatment options are not effective. Phase II trials usually consist of up to 100 participants who have already undergone chemotherapy, surgery or radiation treatment, but the treatment has not been effective. Participation in phase II trials is often limited based on treatment received in the past. Phase 3 trials usually consist of hundreds or thousands of participants. This large number of participants is necessary to determine if there is a real difference between the effectiveness of the compound according to the invention and the standard treatment. The third phase covers a wide range of illness levels and may comprise a range from newly diagnosed patients to patients with a wide range of diseases.

  Those of ordinary skill in the art must plan clinical trials as comprehensively as possible while ensuring that the diversity of the study population does not make it impossible to determine whether a treatment may be more effective in a narrower population Recognize that. In Phase III trials in particular, the more diverse the population under study, the better the results can be applied to the general population. Selection of appropriate participants in each phase of a clinical trial is considered within the scope of those skilled in the art.

B. Evaluation of patients before treatment

Several measurements well known in the art can be used to first classify patients prior to the start of the study. Patients can be initially evaluated using, for example, the US East Coastal Cancer Group (ECOG) index of cancer status (PS). ECOG PS is a widely accepted standard for assessing patient disease progression as measured by patient dysfunction, ECOG PS0 indicates no dysfunction, ECOG PS1 and 2 are The patient's dysfunction is increasing gradually, indicating that it is still ambulatory, and ECOG PS3 and 4 show progressive impairment and inability to move.

  The patient's overall quality of life can be assessed using, for example, the McGill Quality of Life Questionnaire (MQOL) (Cohen et al. (1995) Palative Medicine, 9: 207-219). MQOL measures physical symptoms, physical, mental and existential health, support, or overall quality of life. Use the Distress Symptom Scale (SDS) developed by McCorkle and Young ((1978) Cancer Nursing, 1: 373-378) to assess symptoms such as nausea, grumpy, appetite, insomnia, motility and fatigue be able to.

  Patients can also be categorized by their disease type and / or stage and / or tumor size.

C. Pharmacokinetic monitoring

In order to meet the criteria of the first phase, the distribution of the compound is observed, for example, by chemically analyzing samples such as blood and urine collected at regular intervals. For example, samples can be obtained at regular intervals up to about 72 hours after the start of infusion. In one example, the samples are 0, 0.33, 0.67, 1, 1.25, 1.5, 2, 4, 6, 8, 12, 24, 48 and 72 after the start of each injection of compound. Obtained in time.

  If the analysis is not performed immediately, the sample can be stored on dry ice after collection, then moved and stored frozen at -70 ° C. until analysis is performed. Samples can be prepared for analysis using standard methods well known in the art, and the amount of in situ compounds can be determined, for example, by high performance liquid chromatography (HPLC).

  Pharmacokinetic data can be generated and analyzed in cooperation with skilled clinical pharmacologists and used, for example, to determine clearance, half-life and maximum plasma concentration.

D. Observe patient outcome

The endpoint of a clinical trial is a measurable outcome that indicates the effectiveness of the compound under evaluation. Evaluation items are established before the start of the study and vary depending on the type and phase of the clinical study. Examples of endpoints include, for example, tumor response rate (usually expressed as a percentage, the percentage of study participants that get smaller by a certain amount), disease free survival (usually measured in months, Survival of participants without onset or recurrence), overall survival (participant survival, usually measured from the start of the clinical trial to the time of death). With regard to advanced and / or metastatic cancer, disease stability (eg, the proportion of study participants with stable disease, such as tumor growth and / or metastasis stopped) can be used as an endpoint. Other endpoints are toxicity and quality of life.

  Tumor response rate is a representative endpoint for Phase II trials. However, even if treatment reduces the participant's tumor and extends disease-free survival, it may not extend overall survival. In such cases, side effects and failure to extend overall survival may outweigh the benefits of longer disease-free survival. Alternatively, participants' improved quality of life during the tumor-free period may exceed other factors. Therefore, response rates are often an appropriate indicator of treatment efficacy in phase II trials because tumor response rates are often primary and may not benefit long-term survival for participants. Although, participants' survival and quality of life are usually used as endpoints in phase III trials.

VIII. kit

The present invention further provides a therapeutic kit comprising one or more compounds of formula I. In one embodiment, the therapeutic kit is for use in the treatment of cancer. The contents of the kit can be lyophilized and the kit can further include a suitable solvent for reconstituting the lyophilized components. The individual components of the kit may be packaged in a separate container and accompanied by a notice in a form prescribed by a government agency that regulates the manufacture, use and sale of the drug or biological product. The notice can reflect the approval by the manufacturing institution for use or sale for administration to humans or animals.

  When the components of the kit are in one or more solutions, the solution can be an aqueous solution, such as, for example, a sterile solution. For in vivo use, the compounds may be prepared into pharmaceutically acceptable injectable compositions. In this case, the container means itself is an inhalant, syringe, pipette, which may apply the formulation to the site of infection of the subject, such as the lung, inject into the subject, or be applied or mixed with other components of the kit. It may be an eye dropper container or other similar device.

  Also contemplated by the present invention are pharmaceutical kits or packs comprising one or more compounds of the present invention in combination with one or more standard chemotherapeutic agents for combination therapy applications.

  It has also been demonstrated herein that compounds of formula I can chelate transition metal ions. Thus, the present invention further provides a kit comprising one or more compounds of formula I for the chelation of transition metal ions.

  The invention will be described with reference to specific examples. Of course, the following examples are intended to illustrate embodiments of the invention and are not intended to limit the invention in any way.

Example

Compound preparation

An exemplary compound of formula (I) was prepared according to the scheme shown below.

  In a typical procedure, 1 mmol (1 eqiv.) Of phenanthroline quinone was refluxed in equimolar amounts of 10 mmol (10 eqiv.) Of the corresponding acetic aldehyde and ammonium in glacial acetic acid. The reaction process was monitored by TLC until the reagent was completely consumed. After completion of the reaction, the reaction mixture was cooled to room temperature, diluted with water, and impurities were extracted from the resulting solution with dichloromethane (DCM). The aqueous layer was basified and the separated precipitate of 2-indolylimidazo [4,5-d] phenanthroline was filtered and recrystallized from a suitable solvent. If necessary, 2-indolylimidazo [4,5-d] phenanthroline in which R7 is H was treated with R7X in which R7 is other than H to obtain Compound (I).

Indole-3-carboxaldehyde of formula (III) was prepared according to the following scheme.

In a typical experimental procedure, 11 mmol (1.1 equiv.) Of POCl ₃ was magnetically stirred with indole (10 mmol, 1.0 equiv.) At 5-10 ° C. in 15-20 ml of dimethylformamide (DMF). Added dropwise to the solution. The mixture was stirred for 0.5 h at room temperature and 0.5 h at 60 ° C., cooled to room temperature and poured onto 100 g of ice. The resulting solution was basified with NaHCO ₃ to pH> 7, the mixture was stirred at 60 ° C. for 1 hour, the separated precipitate was filtered and recrystallized from a suitable solvent.

Melting points are recorded using a MEL-TEMP capillary melting point and are not corrected. ¹ H-NMR was performed on a 500 MHz Bruker instrument at room temperature using a suitable deuterated solvent.

Example 1: Preparation of Compound 2

A suspension of phenanthroquinoline (0.42 g) and 5-bromoindole-3-carboxaldehyde (0.45 g) was refluxed in acetic acid (15 ml) for 1 hour in the presence of ammonium acetate (1.54 g). did. The yellow precipitate formed was filtered, washed with ethanol and crystallized with DMF.
Yield 0.70g. (85%). Melting point> 400 ° C.
A solution of 0.200 g of compound 2 (0.483 mmol) in DMF was treated with HCL (g) until no precipitation was seen. The solution was then filtered, washed with dichloromethane and hexane and dried in vacuo. The resulting desired HCl salt was water soluble.

Example 2: Preparation of compound 3

A mixture of phenanthroquinoline (1.05 g) and 2-methylindole-3-carboxaldehyde (0.80 g) was refluxed with acetic acid (20 ml) in the presence of ammonium acetate (3.85 g) for 2 hours. The cooled red solution was poured into water (150 ml). Impurities were extracted with DCM (3 × 50 ml) and discarded. The aqueous layer was neutralized with NaOH (100 ml of a 10% solution) to make a basic solution of excess Na ₂ CO ₃ . The separated precipitate was filtered, washed with water and refluxed in EtOH (30 ml) for 10 minutes. The crystalline product (Compound 3) was filtered and washed with EtOH, DCM and hexane. Yield 0.92g (57%).

Example 3: Preparation of compound 4

  A mixture of phenanthroquinoline (0.105 g) and 5-fluoroindole-3-carboxaldehyde (0.082 g) was refluxed in acetic acid (3 ml) in the presence of ammonium acetate (0.39 g) for 0.5 h. did. The separated precipitate was filtered, washed with aqueous 50% ethanol and EtOH and drained under vacuum. Yield 0.15 g (85%).

Example 4: Preparation of compound 5

0.96 g POCl ₃ was added dropwise to 2-methyl-5-chloroindole (1.0 g) at 10 ° C. in 20 mL DMF. The mixture was stirred at 50 ° C. for 1 h, after cooling, diluted with saturated NaHCO ₃ . The suspension was heated at 60 ° C. for 15 minutes, and after cooling, the precipitate of 2-methyl-5-chloroindole-3-carboxaldehyde was filtered. Yield 1.14 g (99%). An analytical sample was crystallized from EtOH.
A mixture of phenanthroquinoline (0.210 g) and 2-methyl-5-chloroindole-3-carboxaldehyde (0.203 g) was added in acetic acid (5 mL) in the presence of ammonium acetate (0.77 g). Reflux for 5 hours. The separated precipitate of compound 5 was filtered and washed with AcOH, EtOH + H ₂ O and EtOH + EtOAc. Yield 0.230g (60%).

Example 5: Preparation of compound 6

A mixture of phenanthroquinoline (0.104 g) and 2-methyl-5-OCH ₃ indole- ₃ -carboxaldehyde (0.095 g) was dissolved in acetic acid (5 ml) in the presence of ammonium acetate (0.38 g). Refluxed for 2.5 hours. The solution was diluted with DCM and extracted with water. The aqueous layer was washed with DCM (2 × 40 ml), basified and extracted with EtOA. The extract was concentrated and treated with EtOH to give a crystalline product (Compound 6), which was filtered and washed with hexane.

Example 6: Preparation of compound 7

1.69 g POCl ₃ was added dropwise to a solution of 2-methyl-5-fluoroindole (1.49 g) at 10 ° C. in 20 mL DMF. The mixture was stirred at 50 ° C. for 1 h, after cooling, diluted with saturated NaHCO ₃ . The suspension was heated at 60 ° C. for 15 minutes, and after cooling, the precipitate of 2-methyl-5-fluoroindole-3-carboxaldehyde was filtered. Yield 1.14 g (99%).
A mixture of phenanthroquinoline (0.210 g) and 2-methyl-5-fluoroindole-3-carboxaldehyde (0.177 g) was added in acetic acid (5 ml) in the presence of ammonium acetate (0.77 g). Reflux for 5 hours, pour into 1% HCl and extract with DCM. The aqueous layer was basified with Na ₂ CO ₃ and the precipitate of compound 7 was filtered and crystallized from EtOH. Production of genuine products 0.19g (52%).

Example 7: Preparation of compound 8

A mixture of compound 6 (0.150 g) and HBR (4 mL) in 2 mL AcOH was refluxed for 3.5 hours. The suspension was diluted with water, made alkaline with a saturated solution of Na ₂ CO ₃ , extracted with EtOAc, and then the solvent was removed in vacuo. The residue was crystallized from toluene-EtOH and DMF. Yield 0.03g (21%).

Example 8: Preparation of compound 9

1.7 g POCl ₃ was added dropwise to a solution of 2-phenylindole (1.93 g) at 10 ° C. in 20 mL DMF. The mixture was stirred at 50 ° C. for 1 h, after cooling, diluted with saturated NaHCO ₃ . The suspension was heated at 60 ° C. for 15 minutes, and after cooling, the precipitate of 2-phenylindole-3-carboxaldehyde was filtered. Yield 2.05g (93%).
A mixture of phenanthroquinoline (0.105 g) and 2-phenylindole-3-carboxaldehyde (0.111 g) was refluxed in 3 mL acetic acid for 1.5 hours in the presence of 0.39 g ammonium acetate. The red solution was poured into water (100 ml) and washed with DCM (3 × 40 ml). The aqueous layer was then neutralized with a saturated solution of Na ₂ CO ₃ and the resulting solid was filtered, washed with EtOH and crystallized from DMF: EtOH: H ₂ O = 1: 1: 1. 0.12 g of purified solid was obtained with a yield of 58%.

Example 9: Preparation of compound 10

1.7 mL POCl ₃ was added dropwise to a solution of 2 (4-fluorophenyl) -indole (2.11 g) at 10 ° C. in 20 mL DMF. The mixture was stirred at 50 ° C. for 1 h, after cooling, diluted with saturated NaHCO ₃ . The suspension was heated at 60 ° C. for 15 minutes, after cooling, the precipitate of 2 (4-fluorophenyl) -indole-3-carboxaldehyde was filtered and crystallized from EtOH. Yield 2.10 g (88%).
A mixture of phenanthroquinoline (0.105 g) and 2 (4-fluorophenyl) -indole-3-carboxaldehyde (0.120 g) was dissolved in acetic acid (3 mL) in the presence of ammonium acetate (0.38 g). Refluxed for 1.5 hours, diluted with DCM (50 ml) and treated with 50 ml of 5% HCl. The yellow separated precipitate was filtered, treated with aqueous Na ₂ CO ₃ and extracted with EtOAc to remove the solvent. The residue was treated with DCM. The separated solid of Compound 10 was filtered and washed with hexane. Yield 0.08g (37%).

Example 10: Preparation of compound 11

Phenylhydrazine (4.32 g) was added in 30 ml abs. To a solution of 4-acetylpyridine (4.76 g) in EtOH. Three drops of AcOH were added and the solution was stirred at room temperature. An exothermic reaction occurred and a white precipitate began to appear. The mixture was refluxed for 1 hour. After cooling, the separated precipitate of 4-acetylpyridine phenylhydrazone was filtered and dried. Yield 6.04g.
The mixture of hydrazone (3.10 g) and polyphosphoric acid (PPA) (18 g) was heated in a beaker while gradually raising the temperature and stirring with a thermometer. The mixture was maintained at 180-190 ° C. for 10 minutes, after cooling, diluted with aqueous Na ₂ CO ₃ and extracted with EtOAc. The organic layer was concentrated, filtered through silica gel and washed with EtOAc. The filtrate was evaporated and the residue of 4 (2-indolyl) pyridine was crystallized from toluene.

1.32 g POCl ₃ was added dropwise to a solution of indole 4 (2-indolyl) -pyridine (1.46 g) at 10 ° C. in 20 mL DMF. The mixture was stirred at 50 ° C. for 1 hour and cooled. TLC showed about 50% alteration, after which 0.7 g POCl ₃ was added and the mixture was stirred at 55-60 ° C. for 0.5 h. The mixture was cooled and treated with excess NaHCO ₃ . The suspension was heated at 60 ° C. for 1 hour and after cooling, the precipitate of 2 (4-pyridyl) indole-3-carboxaldehyde was filtered. Yield 0.98g (59%).
A mixture of phenanthroquinoline (0.210 g) and 2 (4-pyridyl) indole-3-carboxaldehyde (0.212 g) was prepared as follows: 1. in acetic acid (5 ml) in the presence of ammonium acetate (0.77 g). Refluxed for 5 hours. The precipitate was filtered, dissolved in EtOH, treated with 0.1 ml NH ₄ OH and the solvent was removed until almost dry. The residue was treated with EtOAc. The precipitate of compound 11 was filtered. Yield 0.25g (61%).

Example 11: Preparation of compound 12

12 mL of SOCl ₂ was added dropwise to a stirred suspension of 2-indolecarboxylic acid (5.44 g) in toluene while the outside of the flask was cooled. After 1 hour, the mixture was allowed to warm to room temperature and the mixture was stirred over the weekend. Toluene (100 ml) was added to the brown suspension and the resulting mixture was evaporated to dryness. The acid chloride was used without purification for the next conversion.

A solution of acid chloride (7.174 g) in 50 ml of DCM was added dropwise to a solution of piperidine (10.2 g) in DCM while cooling the outside of the flask. The mixture was stirred at room temperature for 1 hour and treated with saturated aqueous NaHCO ₃ solution. The organic layer was evaporated to a volume of 15 ml, filtered through silica gel, then washed with DCM + EtOAc, the solvent was evaporated to 15-20 ml and the separated crystals of 2-indolecarboxypiperidine were filtered and placed at room temperature for 1 hour. Thereafter, it was treated with hexane. Yield 5.37g.

  9.05 g of crystalline amide (ie, 2-indolecarboxypiperidine) was added to a stirred suspension of LiAlH4 (3.2 g) in 40 ml of THF while maintaining a temperature of 45-55 ° C. After all the amide was added, the suspension was stirred at reflux for 2 hours. The reaction was quenched with EtOAc and 6% NaOH, extracted with EtOAc, and the solvent was removed to give (2-indolemethyl) N-piperidine as an oil.

0.85 g POCl ₃ was added dropwise to a solution of indole [ie (2-indolemethyl) N-piperidine] (1.07 g) at 0 ° C. in 10 mL DMF. The mixture was stirred at room temperature for 2 hours, poured into water, basified with EtOAc and extracted. The organic layer was extracted with dilute HCl. The aqueous layer was separated with EtOAc, basified and extracted. The solvent was evaporated. The residue of 2 (N-piperidinemethylene) -indole-3-carboxaldehyde was crystallized from EtOH. Yield 0.30g (25%).

A mixture of phenanthroquinoline (0.105 g) and 2 (N-piperidinemethylene) -indole-3-carboxaldehyde (0.121 g) was dissolved in acetic acid (3 ml) in the presence of ammonium acetate (0.38 g). Refluxed for 1.5 hours, then poured into dilute HCl and the impurities were extracted with DCM. The aqueous layer was basified with EtOAc and extracted. The organic layer was dried over anhydrous Na ₂ SO ₄ , filtered and evaporated. The oily residue was treated with DCM. The separated crystalline compound 12 was filtered and washed with DCM: hexane-1: 1. Yield 0.060g (28%).

Other exemplary compounds were also prepared using procedures described in Applications or procedures well known to those skilled in the art.

Example 12: Inhibition activity of compound 3 in human cancer cell line with IN VITRO Compounds 2 and 3 S. As part of the in vitro anti-cancer screening work provided by the National Cancer Institute (NCI) DTP (Development and Treatment Program), they were evaluated for their growth inhibitory effects in a panel of 60 human cancer cell lines. These compounds show growth inhibitory activity against most human tumor cell lines including NSCLC, leukemia, colon cancer, prostate cancer, melanoma, ovarian cancer, kidney cancer, central nervous system cancer and breast cancer, with an average GI ₅₀ The (50% growth inhibition) value was less than 2 μM (FIG. 1).

Compound 3, which is one of the compounds of formula I, showed an inhibitory activity with a GI ₅₀ average value of 0.61 μM to 12.3 μM. Compound 3 was a very potent but selective inhibitor of colon, leukemia, non-small cell lung cancer and prostate cell lines (Figure 2). The leukemia cell lines MOLT-4 and CCRF-CEM were most inhibitory with GI ₅₀ values of 16 nM and 30 nM, respectively. Three leukemia cell lines (MOLT-4, K-562 and CCRF-CEM) had GI ₅₀ values in the nanomolar range. The fourth leukemia cell line with a GI ₅₀ value of 2.88 μM is actually a myeloma cell line and may be expected to function differently than other leukemia cell lines.

Example 13: IN VITRO Growth Inhibitory Activity of Formula I Compounds in HT-29 Colon Tumor Cells The ability of compounds of formula I to inhibit the growth of human colon tumor HT-29 cells was tested as follows. The HT-29 colon tumor cells used in this and subsequent examples were 2 mM L-glutamine (Gibco, Grand Island, NY), 10% fetal bovine serum (FBS) (Multicell, WISENT Inc., St- (Bruno, QC), growth medium supplemented with antibiotic-antimycotic (Multicell), maintained as a monolayer in a humidified incubator with 5% CO ₂ at 37 ° C. Cells were transferred onto 150 mm tissue culture plates and grown to subconfluence (70-80%) before use. The in vitro growth inhibitory activity of the compounds was evaluated by culturing the cells with various concentrations of the compounds shown in Table 1 for 6-7 days. The effect of these compounds in this cell proliferation assay was measured based on the ability of living cells to reduce the tetrazolium salt XTT to the orange compound of formazan (XTT Cell Proliferation Kit II, Roche Applied Science, Montreal, QC). The experimental results are shown in Table 3.

Table 3 Growth inhibitory activity of compounds of formula I

Example 14: Determining the role of metal chelation in the ability of Compound 3 to inhibit the growth of HT-29 colon tumor cells To determine whether metal chelation is involved in the growth inhibitory activity of compounds of formula I: Exogenous metals (100 μM ZnCl ₂ , FeCl ₂ .4H ₂ O, FeCl ₃ .4H ₂ O, MgCl ₂ ) are mixed with HT-29 cells simultaneously with control medium DMSO, Compound 3 (5 μM), or Compound 13 (25 μM). And cultured for 5 days. Compound 13 (see structure below) is not as powerful as compound 3 and is structurally closely related to compound 3, but lacks the essential chelate nitrogen in the phenanthroline ring. Growth inhibition of compound 13 is expected to occur by a different mechanism than compound 3.

この実験結果を図３に示す。亜鉛（１００μＭ）の添加によって、ＨＴ‐２９細胞の成長を阻害する化合物３の能力は完全に損なわれ、それは化合物３が亜鉛のキレート剤として機能することができ、余分の亜鉛は内因性金属を不可欠な酵素からキレートするこの化合物の能力を遮断する場合があるということを示す。余分の鉄およびマグネシウムは、化合物３の活性に対して影響がなかった。どの金属も負の対照、化合物１３の活性に対して影響せず、これらの金属は細胞の自力での成長に対しても効果を持たない。化合物３の活性に対する亜鉛の影響は、低濃度の化合物３（１〜２μＭ）、および１００μＭの亜鉛で最も明らかとなった。

The experimental results are shown in FIG. Addition of zinc (100 μM) completely abrogated Compound 3's ability to inhibit HT-29 cell growth, which allows Compound 3 to function as a chelator of zinc, with excess zinc depleting endogenous metals. Indicates that this compound may block the ability of this compound to chelate from essential enzymes. Extra iron and magnesium had no effect on the activity of compound 3. None of the metals has an effect on the activity of the negative control, compound 13, and these metals have no effect on the growth of the cells on their own. The effect of zinc on the activity of compound 3 was most apparent at low concentrations of compound 3 (1-2 μM) and 100 μM zinc.

Example 15: Effect of copper on the ability of various concentrations of compound 3 to inhibit the growth of HT-29 colon tumor cells To determine whether copper chelation is involved in the growth inhibitory activity of compounds of formula I. HT-29 cells were cultured for 5 days with up to 5 μM Compound 3 in the presence or absence of 25 μM CuSO4.5H ₂ O. As shown in FIG. 4, by adding 25 μM exogenous copper to HT-29 cells, the growth inhibitory activity of Compound 3 against HT-29 cells was impaired only by a low concentration of Compound 3 (less than 2 μM). . Conversely, at high concentrations of Compound 3 (> 2.5 μM), the activity of Compound 3 was significantly enhanced by the addition of exogenous copper. Copper had no effect on the growth inhibition by compound 13 or the growth of the cells on their own. Similar results were obtained with copper concentrations up to 100 μM. These results indicate that this compound can function as a copper chelator and can also form a cytotoxic chelate complex with copper.

Example 16: Effect of exogenous metals on the ability of Compound 3 to inhibit the growth of HT-29 colon cancer cells with IN VITRO To determine whether metal chelation is involved in the growth inhibitory activity of Compound 3, various Concentrations of exogenous metals were cultured for 5 days with HT-29 cells simultaneously with various concentrations of Compound 3. The exogenous metals tested are ZnCl ₂ (zinc), CuSO ₄ . 5H ₂ O (copper), FeCl ₂ (iron II), FeCl ₃ . 4H ₂ O (iron III), MgCl ₂ (magnesium), and CaCl ₂ . 2H ₂ O (calcium). HT-29 cells (4 × 10 ³ / well) in a growth medium with a volume of 100 μL were seeded in a 96-well cell culture plate and cultured overnight at 37 ° C. The medium was removed and replaced with a total volume of 100 μL growth medium containing several concentrations of metal ions as shown in FIG. 5 along with Compound 3 or 0.1% DMSO vehicle control. After culturing the cells at 37 ° C. for 5 days, the cell viability is XTT (sodium 3 ′-[l (phenylamino-carbonyl) -3,4-tetrazolium] -bis (4-methoxy-6-nitro) benzenesulfonic acid. Hydrate). XTT labeling reagent (1 mg / mL) was mixed with an electron binding reagent according to the manufacturer's instructions, and 50 μL of the mixture was added directly to cells cultured in 100 μL of growth medium. The plate was further incubated at 37 ° C. for 4 hours, and the absorbance of each well was measured with a 460 nm multiwell spectrophotometer (Bio-Tek Instruments Inc.). Data were adjusted against blanks and expressed as% of cell growth compared to DMSO control.

  The result was that the growth inhibitory activity of Compound 3 was impaired by zinc (FIG. 5A), copper (FIG. 5B), and to a lesser extent, iron (II) (FIG. 5C), while iron (III) ( FIG. 5D), magnesium (FIG. 5E) and calcium (FIG. 5F) showed that they had essentially no effect on the activity of compound 3. Copper reduced the growth inhibitory activity of Compound 3 at low concentrations of Compound 3 (less than 2 μM) and enhanced the activity of Compound 3 at high concentrations of Compound 3 (> 2.5 μM). Any metal has an effect on the activity of compound 13, which is deficient in the chelate nitrogen essential in the phenanthroline ring (data not shown), a negative control structurally closely related to compound 3. There wasn't. These results indicate that compound 3 can function as a chelator of zinc, iron (II) and copper, and the presence of these extra metals makes Compound 3's ability to chelate endogenous metals from essential enzymes. Indicates that it may be blocked. Compound 3 is also considered to form a chelate complex with copper with a cytotoxicity.

Example 17: Effect of exogenous metals on the ability of compounds 5 and 7 to inhibit the growth of HT-29 colon cancer cells with IN VITRO To determine the ability of compounds 5 and 7 to chelate metals in cells, exogenous metals Was added to HT-29 cells simultaneously with various concentrations of compounds 5 and 7. That is, HT-29 cells were treated for 5 days with or without various concentrations of compounds 5 and 7, copper (25 μM CuSO ₄ .5H ₂ O) or zinc (100 μM ZnCl ₂ ). Cell viability was determined by XTT assay. The effect of copper and zinc on growth inhibition of HT-29 cells is shown in FIG. 6A for compound 5 and in FIG. 6B for compound 7. Similar to compound 3, the growth inhibitory activity of compounds 5 and 7 was impaired by zinc, but the activity was impaired only by low concentrations of compounds 5 and 7 by copper. The results show that compounds 5 and 7 function as zinc and copper chelators, and that the presence of these extra metals blocks the growth inhibitory effects of compounds 5 and 7.

Example 18: Selectivity of compounds 3 and 9 to cancer cells To determine whether the compound of formula I selectively inhibited the growth of cancer cells compared to the growth of normal cells, the proliferation IC for compounds 3 and 9 ₉₀ values were measured in normal and cancer cell lines. Normal cell lines used were PrEC (prostate), HMEC (breast), and WD8 (lung fibroblast) cell lines, and cancer cell lines were DU145 (prostate), MDA-MB-435 (breast), HT-29 ( Colon). IC ₉₀ values were also determined for the controls doxorubicin and etoposide. Cells were cultured as generally described in Example 13. Various concentrations of compounds were cultured with cells for 6-7 days and proliferating cell numbers were determined using the XTT assay. Cancer cell selectivity was calculated as the ratio of the average IC ₉₀ for all normal cells and the average IC ₉₀ for all cancer cell lines. Both compounds 3 and 9 have an IC ₉₀ rate of> 4 (normal / cancer), indicating that these compounds are selective for cancer cells.

Example 19: Ability of Compound 3 to Inhibit the Expression of Metallothionein 1A Gene in Cancer Cells To determine the ability of a compound of formula I to chelate zinc in cells, a zinc-regulated gene in human colon tumor HT-29 cells, The effect of the compound on the expression level of metallothionein 1A (MT1A) was determined. 1 × 10 ⁶ cells of HT-29 cells in a 10 mL volume of growth medium were seeded in 100 mm dishes and cultured overnight at 37 ° C. Growth medium containing 35 μM ZnCl ₂ , 1 μM or 4 μM TPEN (NNNN-tetralin (2-pyridyl-methyl) ethylenediamine), or 1 μM or 4 μM Compound 3, or 0.1% DMSO vehicle control And replaced. After 16 hours of culture, the cells were detached by trypsinization, collected by centrifugation, and washed once with PBS. Total RNA was extracted using TRIZOL (Invitrogen, Life Technologies, Carlsbad, Calif.) According to the manufacturer's instructions, and MT1A mRNA levels were measured by real-time PCR using comparative CT methods as follows: did. First strand cDNA is obtained using the Biometa Terathermal Thermal Cycler using the pd (N) 6 random hexamer (Amersham Biosciences, Piscataway, NJ) and Superscript® II reverse transcriptase kit (Invitrogen) according to the manufacturer's procedure. (Abgene, UK) from 200 ng of total RNA. Real-time PCR uses the 5 μL cDNA synthesized according to the above procedure and the individual TaqMan® gene expression assay (ABI) according to the ABI TaqMan® universal PCR master mix procedure, using the ABI Prism 7000 sequence. The detection system (Applied Biosystems Inc., ABI, Foster City, CA) was used.

  FIG. 7 shows that the addition of zinc (35 μM) to HT-29 cells increased the expression of the MT1A gene, while the addition of the specific zinc chelator TPEN decreased the expression of MT1A. It shows that Compound 3 was able to reduce MT1A expression by 50% or more and reduce the amount of unstable intracellular zinc. Thus, Compound 3 functions as a zinc chelator in cells.

Example 20: In VITRO ability of compound 3 to modulate KLF4 mRNA expression in HT-29 cells The ability of a compound of formula I to modulate the RNA level of a transition metal regulated tumor suppressor gene was determined in vitro as follows: It was judged. Compound 3 was tested to determine its ability to increase the expression of the zinc-regulated tumor suppressor KLF4 mRNA in colon tumor HT-29 cells. In the past, KLF4 expression has been thought to be induced by changes in intracellular zinc concentration. HT-29 cells are cultured for 16 hours with DMSO as vehicle control, 35 μM ZnCl ₂ , 1 μM or 4 μM Compound 3, or 1 μM or 4 μM TPEN, and mRNA is extracted from the cells as described in Example 19. did. The expression of KLF4 mRNA was also analyzed by real-time polymerase chain reaction using the comparative CT method as described in Example 19. Compound 3 induced KLF4 mRNA expression (approximately 8-fold) in HT-29 cells compared to HT-29 cells treated with vehicle alone (see FIG. 8).

Example 21: The ability of compound 3 to modulate KLF4 protein expression in HT-29 cells in IN VITRO The ability of a compound of formula I to modulate KLF4 protein expression was determined as follows. HT-29 cells were treated with vehicle control (DMSO), TPEN (4 μM), ZnCl ₂ (100 μM), or Compound 3 (2.5, 5, 7.5 and 10 μM) for 16 hours. Cells were lysed and Western blotting was performed with anti-KLF4 antibody or GAPDH antibody to ensure equivalent protein loading. As shown in FIG. 9, after 16 hours of treatment, Compound 3 was able to increase the level of KLF4 protein in HT-29 cells.

Example 22: Effect of Compound 3 on Expression of Cyclin-Dependent Kinase Inhibitor P21 The effect of the compound of formula I on the expression of genes regulated by KLF4 was determined as follows. Compound 3 was tested to determine its ability to increase the expression of cell cycle regulator p21 (cyclin dependent kinase inhibitor) in HT-29 colon tumor cells. The tumor suppressor KLF4 is thought to regulate cell cycle arrest by suppressing p21. HT-29 cells are cultured with DMSO (vehicle control), 35 μM ZnCl ₂ , 1 μM or 4 μM TPEN, or 0.5 μM, 1 μM, 4 μM, or 7.5 μM Compound 3 for 16 hours to extract mRNA from the cells did. p21 mRNA expression was analyzed by real-time polymerase chain reaction using the comparative CT method. This assay was performed using the method described in Example 19. Compound 3 induced 30-60-fold expression of p21 in HT-29 cells compared to HT-29 cells treated with vehicle alone (see FIG. 10).

Example 23: iN VITRO ability of compound 3 to block cell cycle progression in HT-29 and CCRF-CEM cells To test the ability of a compound of formula I to block cell cycle progression, compound 3 was used in human colon tumors. Cultured with HT-29 or human leukemia CCRF-CEM cells, flow cytometric analysis was used to determine alterations in the cell population at different stages of the cell cycle. HT-29 cells were maintained as described in Example 13. The CCRF-CEM cells used in this and subsequent examples were 2 mM L-glutamine (Gibco, Grand Island, NY), 10% fetal bovine serum (FBS) (Multicell, WISTENT Inc., St-Bruno, QC), growth medium supplemented with antibiotic-antifungal agent (Multicell) and maintained as a suspension cell in a humidified incubator at 37 ° C. with 5% CO ₂ .

The assay was performed as follows. For HT-29 cells, 1 × 10 ⁶ cells in a 10 mL volume of growth medium were seeded in 100 mm dishes. For CCRF-CEM cells, 3 × 10 ⁶ cells in a 10 mL volume of growth medium were seeded in a 25 cm ² flask. After 16 hours, several concentrations of Compound 3 (0.5 μM, 1 μM, or 5 μM for HT-29 cells, 0.25 μM, 0.5 μM, or 1 μM for CCRF-CEM cells) as shown in FIG. Alternatively, growth medium containing 0.1% DMSO vehicle control was added. After 24 hours, HT-29 cells were detached by trypsinization. Both cell types were each collected by centrifugation at 2000 rpm for 4 minutes, washed once with PBS and fixed with 70% ethanol at −20 ° C. for at least 4 hours. Fixed cells were centrifuged for 3 minutes at 1500 rpm, washed once with cold PBS containing 2% FNS, and 30 minutes at 37 ° C. with 3 mg / ml ribonuclease (Sigma) and 50 μg / ml propidium iodide (Sigma). Processed. The fluorescence of the stained cells was analyzed using a FACScan flow cytometer and CellQuest program (BD Biosciences, San Jose, CA). Data were evaluated using Modfit software (Verity software House, Topsham, ME). Values were determined by gate analysis of flow cytometry plots. FIGS. 11A and 11B are shown as a percentage of the total cell population after doublet removal.

The results show that treatment of both cell lines with compounds 3 (FIGS. 11A and 11B) increases the percentage of cells in the G ₁ phase in a dose-dependent manner and decreases the percentage of cells in the S and G ₂ / M phases, compound 3 showed that induced blocked in cell cycle progression in G ₁ phase.

Example 24: In VITRO ability of compound 3 to induce apoptosis in CCRF-CEM and MOLT4 leukemia cells The ability of compound 3 to alter cell populations at different stages of apoptosis is: Measured by determining the effect of Compound 3 in CCRF-CEM leukemia cell populations treated with 25 μM, 0.5 μM or 1 μM Compound 3 for 24 hours. CCRF-CEM cells were seeded and treated with the above concentrations of Compound 3 or 0.1% DMSO vehicle control as described in Example 23. After 24 hours, the cells were collected by centrifugation and resuspended in growth medium to approximately 1 × 10 ⁶ cells / ml. Cells were then stained for annexin V binding and PI staining using the annexin V-FITC apoptosis detection kit (ONCOGENE® research products, MA) following the manufacturer's RAPID annexin V binding procedure. The fluorescence of the stained cells was analyzed using a FACScan flow cytometer and CellQuest program (BD Biosciences, San Jose, CA). Data were evaluated using Modfit software (Verity software House, Topsham, ME) to obtain quadrant statistics. Cells stained with annexin V alone were considered early apoptotic, whereas cells stained with both annexin V and propidium iodide were considered late apoptotic. Cells stained with propidium iodide alone are non-viable cells, and those not stained are viable cells. MOLT-4 leukemia cells were treated similarly.

  Increasing the concentration of Compound 3 increased the number of early and late apoptotic cells and decreased viable cells (FIG. 12). Only high concentrations of Compound 3 (1.0 μM) showed an increase in non-viable cells. Similar results were obtained with MOLT4 leukemia cells (data not shown). Therefore, Compound 3 was able to induce cells undergoing apoptosis.

Example 25: Effect of Compound 3 on IN VIVO in Hollow Fiber Assay The in vivo effect of the compound according to Formula I was tested by determining the effect of Compound 3 on the hollow fiber assay. This assay is described by Decker et al., Eur. J. et al. of Cancer, 40: 821-826 (2004), as follows: 12 human tumor cell lines (chest; MDA-MB-231, MDA-MB-435, glioma; U251, SF-295, Ovarian; OVCAR3, OVCAR5, colon; COLO-205, SW-620, melanoma; LOX-IMVI, UACC-62, and lung; NCI-H23, NCI-H522) were transplanted into athymic mice. Cell cultures were cultured in RPMI-1640 containing 10% FBS and 2 mM glutamine. Cells were harvested by standard trypsinization, resuspended (2-10 × 10 ⁶ cells / ml) and cast into 1 mm ID polyvinylidene hollow fibers (500,000 Da. MW exclusion). Cultures attached to PVDF fibers were cultured at 37 ° C. in 5% CO ₂ for 24-48 hours prior to transplantation. Each mouse received a total of 6 grafts, 3 fibers in the peritoneum, 3 fibers in the subcutaneous compartment, 3 cell lines per mouse, 3 mice in each group, vehicle only There were 6 controls. The drugs were tested at two different doses and two modes of administration (IP and SC) in a 4-day treatment. Fibers were collected 6-8 days after implantation and cell viability was assessed by the MTT method, and a drug was considered effective if there was a 50% or greater reduction in growth compared to controls. Cell killing was assessed by a decrease in cell viability compared to the initial viability in the graft. Results were recorded based on the number of cell lines inhibited x 2 sites x 2 compound dose x factor 2 = 96 maximum. A compound with a total score of 20, SC score of 8 or net cell killing of one or more cell lines was considered positive.

The results obtained showed that, as shown in Table 5, Compound 3 had an IP score of 22 points, an SC score of 10 points = a total of 32 positive cell kills. These studies demonstrated that Compound 3 is effective in killing several tumor cells in vivo.

Example 26: Effect of Compound 3 on IN VIVO in a Colon Tumor Xenograft Model The ability of Compound 3 to inhibit colon tumor growth in vivo was tested as follows. Human colon adenocarcinoma HT-29 cells (3 × 10 ⁶ cells in 0.1 ml PBS) were injected intraperitoneally into CD-1 female nude mice (7 mice per treatment group, 6-7 weeks) did. Treatment of mice with vehicle or 50 mg / kg / d of Compound 3 is a 5 day, 5 day, 7 day cycle followed by a 2 day break, 5 days after inoculation (tumor size = 20-40 mm ³ ). Started. Tumor size was measured over the duration of the experiment using calipers and tumor weight was measured after the animals were killed. Compound 3 was able to inhibit tumor growth compared to vehicle treated control animals as measured by tumor size and weight (see FIGS. 13A and 13B).

Example 27: Effect of Compound 3 on IN VIVO in a Large Cell Lung Cancer Xenograft Model The ability of a compound of formula I to inhibit large cell lung tumor growth in vivo is as described below. Tested by judging the effect of Compound 3 in the model. Compound 3 was tested as a lipid-based formulation with a composition of distearoyl phosphatidylethanolamine-polyethylene glycol 2000 (DSPE-PEG / 5% mol) and egg phosphatidylcholine (ePC / 95% mol). The formulation was prepared as follows. Stock solutions of Compound 3 and lipid (ePC and DSPE-PEG) were prepared in DMF. Thereafter, a constant volume of Compound 3 and lipid stock solution was obtained at a lipid concentration of 25 mg / mL (ePC: DSPE-PEG = 95: 5 (mol%) and Compound 3: total lipid ratio = 1: 10 (w / w)). The mixture was stirred for 4 hours, thoroughly dried under nitrogen, and left under vacuum overnight, then HEPES buffered saline heated to 60 ° C. (HBS 0.01M, pH = 7. 4) was added to rehydrate the dry membrane, the solution was vortexed and stirred for 48 hours at room temperature and sonicated for 2 and a half hours, after which the formulation removed any free compound 3 Centrifuged at 1000 rpm for 5 minutes.

Human lung NCI-H460 cells (3 × 10 ⁶ cells in 0.1 ml PBS) were injected subcutaneously into the peritoneal cavity of CD-1 female nude mice (6-7 weeks, 7 mice per treatment group). . Treatment of mice with vehicle or Compound 3 was conducted during the experiment (35 days), with a 7 day cycle followed by 5 days followed by a 2 day break, 5 days after inoculation (tumor size = 20-40 mm ³ ). Started. Mice were treated at 80 mg / kg / d during the first week and then at 40 mg / kg / d until the end of the experiment. Tumor size was measured over the duration of the experiment using calipers and tumor weight was measured after the animals were killed. Compound 3 was able to inhibit tumor growth compared to vehicle treated control animals as measured by tumor size and weight (see FIGS. 14A and 14B).

Example 28: Effect of compounds 3, 5 and 7 on IN VIVO in a colon tumor xenograft model The ability of compounds 3, 5 and 7 to inhibit colon tumor cell growth in vivo is as described in Example 26. Were tested in a mouse xenograft model. The compounds were tested as lutrol preparations (ip administration), lipid-based preparation micelles (iv administration), or aqueous preparations (ip administration). Vehicle controls included lutrol control (ip administration), lipid micelle control (iv administration), and water control (ip administration). The Lutrol preparation contained 15% Lutrol and 10% DMSO. Lipid-based formulations and similar formulation compositions are described in Example 27 above.
The results (FIG. 15) showed that these compounds reduced the size (FIG. 15A) and weight (FIG. 15B) of tumors derived from HT-29 cells.

Example 29: Effects of compounds 3, 5 and 7 on IN VIVO in large cell lung cancer xenograft models The ability of compounds 3, 5 and 7 to inhibit large cell lung cancer cell growth in vivo is
Tested in a mouse xenograft model as described in Example 27. The compounds were tested as lutrol preparations (ip administration), lipid-based preparation micelles (iv administration), or aqueous preparations (ip administration). Vehicle controls included lutrol control (ip administration), lipid micelle control (iv administration), and water control (ip administration). The Lutrol preparation contained 15% Lutrol and 10% DMSO. Lipid-based formulations and similar formulation compositions are described in Example 27 above.
The results (FIG. 16) showed that compounds 3, 5 and 7 reduced the size (FIG. 16A) and weight (FIG. 16B) of tumors derived from NCI-H460 cells.

Example 30: Ability of Compound 3 to Modulate KLF4 Expression in IN VIVO The ability of Compound 3 to modulate KLF4 expression in HT-29 colon tumor xenografts was determined as follows. A group of 10 CD-1 female nude mice (6-7 weeks) were injected subcutaneously with human colon adenocarcinoma cells HT-29 cells (3 × 10 ⁶ cells in 0.1 ml PBS) in the lower center of the back. Treatment of mice with vehicle or 50 mg / kg / d of compound 3 was performed during the experiment (35 days), with a 5-day and 2-day cycle, 5 days after inoculation (tumor size = 20-40 mm ³ ). Started. After the treatment period, animals were killed, tumors were excised, and total RNA was extracted from 30 mg tumor tissue using the Rneasy mini kit (QIAGEN, Valencia, CA). KLF4 mRNA expression was analyzed by real-time polymerase chain reaction using the comparative CT method as described in Example 19. Compound 3 was approximately 1.5-fold compared to tumor xenografts treated with vehicle alone and induced KLF4 expression in tumor xenografts from all mice treated with compound 3 (FIG. 17).

Example 31: The ability of Compound 3 to modulate the expression of P21 in IN VIVO The ability of Compound 3 to modulate the expression of P21 in vivo is described in Example 26, as described in Example 26. Judged using the model. p21 mRNA expression was analyzed by real-time polymerase chain reaction using the comparative CT method as described in Example 30. Compound 3 induced p21 expression in tumor xenografts from all mice treated with Compound 3 compared to tumor xenografts treated with vehicle alone (FIG. 18).

Example 32: Ability of Compound 3 to Modulate Cyclin D1 Expression in IN VIVO The ability of Compound 3 to modulate cyclin D1 expression was determined by the HT-29 colon tumor xenograft model as described in Example 26. Judged using. Cyclin D1 mRNA expression was analyzed by real-time polymerase chain reaction as described in Example 30. Compound 3 consistently reduced cyclin D1 expression in tumor xenografts from mice treated with Compound 3 compared to tumor xenografts treated with vehicle alone (FIG. 19). The results of this experiment are shown in FIG. 20 together with the results described for the effect of Compound 3 in vivo on KLF4 and P21 expression as described in Examples 30 and 31.

Example 33: Subacute toxicity test of compounds To test the subacute toxicity of compounds of formula I, female mice were injected with compounds and evaluated for toxicity based on changes in mortality, behavior, appearance, and body weight. That is, ICR normal female mice (5 to 6 weeks old; n = 33) weighing about 0.020 kg were injected with various compounds or vehicle alone (lutrol (M68, fine powder)) of 100 mg / kg and 50 mg / kg. did. Groups of 3 ICR female mice were given a daily 250 μL intraperitoneal (ip) injection (100 mg / kg) of 4.0 mg / ml of each compound twice a day for 1 week (Group I). ), Or once daily 250 μL intraperitoneal (ip) injection of each compound at 2.0 mg / ml (50 mg / kg) for 1 week (control group).

  Compounds to be tested were prepared in sufficient amounts for one week at concentrations of 4.0 mg / ml and 2.0 mg / ml. That is, 50 mg of each compound is dissolved in 1.25 ml 100% DMSO, diluted with 6.25 ml Lutrol (30% in water) and 5 ml water, and a solution of 4 mg / ml compound in 15% Lutrol in water. Was prepared. Next, 4 ml of each preparation was further diluted with 4 ml of 15% trolol in water to obtain 2.0 mg / ml solution of each compound. For the vehicle control solution, 8 ml of 15% Lutrol in water was prepared. Compounds at concentrations of 4.0 mg / ml and 2.0 mg / ml and vehicle control were administered as described above. Toxicity was evaluated based on changes in mortality, behavior, appearance, and body weight, and is shown in Table 6.

Table 6: Subacute toxicity studies

Example 34: Intracellular localization of Compound 3 in HT-29 cells in IN VITRO Intracellular localization of the compound of formula I in cancer cells was determined as follows. Since compound 3 is fluorescent in nature, it was possible to examine its subcellular localization in cancer cells by fluorescence microscopy in HT-29 colon tumor cells. Cells were treated with 10 or 25 μM Compound 3 for 5 minutes (FIG. 21A) or 4 hours (FIGS. 21B and 21C), washed once with PBS, fixed with 3.7% formaldehyde / PBS for 10 minutes, and washed again 3 times. And put a site seal. Images were obtained with a Zeiss laser scanning fluorescence microscope with an excitation filter of 360-370 nm. The results are shown in FIGS. For FIGS. 21A and 21B, the fluorescence image was superimposed on the differential interference contrast image. 21B and C are the same image. Compound 3 entered the cells within 5 minutes of treatment and was evenly distributed to the nucleus and cytoplasm, but was excluded from the plasma membrane of HT-29 cells (FIG. 21A). By 4 hours of treatment, Compound 3 was mainly localized outside the cell nucleus (perinuclear region), but some was still located in the cell nucleus (FIGS. 21B and 21C).

Example 35: Ability of Compound 3 to Cleave DNA with IN VITRO Compound 3 was tested for its ability to cleave plasmid DNA in vitro in the presence of copper and the reducing agent ascorbic acid. The experiment consisted of 10 mM NaH ₂ PO ₄ / Na ₂ HPO ₄ buffer (pH 6.7), 1 μg supercoiled plasmid DNA, 100 μM ascorbic acid, 25 μM drug compound (or vehicle), and 10 μM CuSO ₄ . Performed in a total of 20 μL containing 5H ₂ O. The reaction mixture was incubated at 37 ° C. for 30 minutes and 1 μl of 0.1M EDTA was added to stop the reaction. DNA loading buffer was added and the reaction was run at 80V for 80 minutes in a 1% agarose gel containing ethidium bromide. Both compound 3 and the positive control 1,10-phenanthroline (OP) were able to cleave plasmid DNA, converting the supercoiled and open forms into low molecular weight DNA fragments. Non-chelate 13 and vehicle control DMSO failed to cleave the DNA (FIG. 22A). Neither Compound 3 nor OP was able to cleave NDA in the absence of copper or reducing agent.

In order to determine whether ions other than copper are sufficient, the DNA cleavage reaction was also performed in the presence of zinc or iron. The reaction was 25 μM CuSO ₄ . 5H ₂ O, ZnCl ₂ , or FeCl ₂ . Performed as above in the presence of 4H ₂ O. Both zinc and iron could be replaced with copper in the cleavage reaction with compound 3 (FIG. 22B). Note that only the copper in the presence of ascorbic acid can change the ratio of supercoiled DNA that opens the circular DNA.

  In order to determine the ratio of the compound and copper at which the compound 3 is effective, the reaction was performed as shown in FIG. 22A. As shown in FIG. 23, the compound 3 to copper ratio of 3: 1, 2.5: 1, 2: 1, 1.5: 1, and 1: 1 maintains a constant Cu concentration of 10 μM, It was obtained by changing the concentration of compound 3. The ratio of compound 3 to Cu of 1: 1.5, 1: 2, 1: 2.5, and 1: 3 was obtained by maintaining a constant concentration of 10 μM compound 3 and changing the copper concentration. It was. Compound 3 effectively cleaved DNA when the ratio was greater than 1.5: 1 with respect to copper and could not be cleaved at ratios of 1: 1, 1: 2, 1: 2.5. However, compound 3 could also be cleaved at a ratio of 1: 3 (FIG. 22C). These results provided an indication as to the type of copper-compound 3 complex formed and the most cytotoxic one.

  Other compounds of formula I, compounds 5, 7, 9 and 13, were also tested for their ability to cleave DNA at a 2.5: 1 ratio to copper (FIG. 23). The indicated compound 3: copper ratio, as well as the concentration of copper in the absence of compound 3, were used in the DNA cleavage assay as described above. Compounds 9 and 12 also appeared to be able to cleave DNA.

Example 36: IN VITRO Growth Inhibitory Activity of Formula I Compound in HT-29 Colon Tumor Cells The ability of the compound of formula I to inhibit the growth of human colon tumor HT-29 cells is as described in Example 13. Tested. The results of this experiment are shown in Table 7.

Example 37: Effect of compounds of formula I on IN VITRO and IN VIVO Metal transcription factor-1 (MTF-1) is a transcription factor that is constitutively expressed upon activation by zinc and binds to a metal responsive element By controlling the target gene. Activation of MTF-1 in the hypoxic microenvironment of rapidly proliferating tumor cells following hypoxia-induced oxidative stress and zinc release from intracellular stores is involved in tumor growth and progression. Kr (upsion) ppel-like factor 4 (KLF4) is a member of the Sp / KLF family transcription factor and regulates the target gene by binding to the DNA sequence of the GC box and CACCC box. KLF4 is a negative regulator of cell growth by mechanisms such as activation of p21 ^{waf1 / cip1} and suppression of cyclin D1 expression by disabling the positive regulator Sp1 that binds to the cyclin D1 promoter. The tumor suppressor role of KLF4 is found in T cell leukemia, digestive organs, bladder and prostate cancer. The ability to self-regulate by MTF-1, Sp1 and KLF4 is a positive regulator upstream of KLF4. A series of new small molecules that downregulate MTF-1 have been developed and their anti-tumor activity in vitro and in vivo has been screened. The compounds of formula I were selected from over 3000 imidazole-phenanthroline structures with ligand-based structural design as shown in FIG.

The effect of the compound of formula I on cell growth inhibition in vitro and in vivo was analyzed by the method described in the previous examples. As shown in Example 12, inhibition of cell growth by parenteral compound 3 was selected by the National Cancer Institute 60-culture cell line assay and leukemia, non-small cell cancer, colon cancer, kidney cancer and prostate cancer. This panel was particularly sensitive to compound 3. The average GI ₅₀ of all cultured cell lines tested was 0.62 μM as shown in FIG.

As shown in Example 25, cell growth inhibition by Compound 3 was screened in vivo by the National Cancer Institute Hollow Fiber Assay. A total score of at least 8 points under the skin or 20 points or more with cell killing of any cultured cell line was considered a significant active anticancer compound. Compound 3 showed 10 points under the skin and 32 total points with positive cell killing as shown in Table 5 above.
Tumor cell growth inhibition was seen in vitro in cancer cell proliferation assays and in vivo in hollow fiber assays and mouse tumor xenograft models by compounds of formula I in different cancer cell types.

Example 38: IN VITRO Ability of Formula I Compounds to Modulate Cell Growth Inhibition and KLF4 Gene Expression in Human Cancer Cell Lines Cell growth inhibition IC ₅₀ (μM) by compounds of formula I varies according to XTT cell proliferation assay Were tested for various cancer cell types. Low micromolar or submicromolar IC ₅₀ was seen in different cancer types, as shown in Table 8. The growth inhibitory effect of the compound of formula I shown below on melanoma cell line K-MEL-2 is described by Lorus Therapeutics Inc. Was reproducible.
IC ₅₀ values for compounds of formula I in breast cancer cell line MDA-MB-435 were 0.2 μM to 0.6 μM as shown in Table 8.

The gene expression level of KLF4 induced by compounds of formula I was also examined for various cancer cell types by RT-PCR. A fold change in KLF4 in compound-treated cells was shown relative to KLF4 expression in cells treated with a vehicle control of the individual cell type “1”. Increased KLF4 expression was seen in different cancer types as shown in Table 8. Gene expression studies revealed that the gene expression pattern of breast cancer cell line MDA-MB-435 is more similar to that of melanoma cell lines than other breast tumor lines (Ross et al. (2000) Nat Genet , 24 (3): 227-233). Furthermore, MDA-MB-435 xenografts transplanted into mammary fat pads of female SCID mice showed immunohistochemical staining consistent with the pigment system (Ellison G, Klinowska T, Westwood RF, Docter E, French). T, Fox
Fox JC (2002) MoI Pathol , 55 (5): 294-299). The breast cancer cell line MDA-MB-435 may be expected to function differently than other breast cancer cell lines.

Example 39: Effect of Compound of Formula I with IN VIVO in Large Cell Lung Cancer and Colon Tumor Xenograft Models Inhibition of tumor growth by a compound of Formula I in a mouse xenograft model is shown in FIG. Dosage and schedule studies for non-small cell lung cancer (H460) (FIG. 25A) and colon adenocarcinoma (HT-29) (FIG. 25B), minimal effective dose for non-small cell lung cancer (H460) (FIG. 25C), and non- Effect of optimized compound of formula I in small cell lung cancer (H460) (FIG. 25D).

Example 40: Effect of exogenous metal on the ability of Compound 3 to inhibit HT-29 cell growth with IN VITRO Zinc reduction induced cell growth inhibition is shown in FIG. The effect of metal ion supplementation on compound 3-mediated cell growth inhibition of HT-29 cells was examined by XTT cell proliferation assay. Cell growth inhibition was completely masked with zinc alone as shown in FIGS. 26A and 26B.

Example 41: The ability of Compound 3 and Compound 7 to block cell cycle progression in HT-29 cells in IN VITRO Cell cycle analysis was performed on HT-29 cells treated with Compound 3 as shown in FIG. 27A, or FIG. As assessed by flow cytometry in HT-29 cells treated with compound 7. Cell cycle arrest in the G1 / S phase was seen after treatment.

Example 42: In VITRO ability of compounds of formula I to chelate metals The metal chelation properties of compounds 3 and 7 are shown in FIG. In vitro 4 (2-viridylazo) resorcinol (PAR) metal binding assay showed that Zn and Cu ⁺² binding to PAR were weakened by compound 3, and chelating Zn and Cu ⁺² of compound 3 in vitro The nature to do was shown. The results are shown in FIGS. 28A (ZnCl ₂ ), 28B (CuCl ₂ ) and 28C (FeCl ₂ ). An in vitro 4 (2-viridylazo) resorcinol (PAR) zinc binding assay was performed as follows. Triple well 96 well plates (Sarstedt, Newton, NC) in 10 μL 80% acetonitrile-20% DMSO medium control with 10 μL volume of specified final concentration of ZnCl ₂ in 0.2 M Tris-HCl, pH 7.5. Incubate for 15 minutes at room temperature with or with the specified final concentration of the compound of formula I dissolved in 80% acetonitrile-20% DMSO. Subsequently, 80 μL of PAR at a final concentration of 200 μM in 0.2 M Tris-HCl, pH 7.5 was added and the PAR-Zn ⁺² complex was colored with a 500 nm multiwell spectrophotometer (Bio-Tek Instruments Inc.). It was measured.

Example 43: IN VITRO ability of compound 3 to modulate metal susceptibility gene expression in HT-29 cells Compared to individual metal-specific chelators, the change in metal susceptibility gene expression in HT-29 cells is , Examined by RT-PCR as shown in FIGS. 29A, 29B and 29C.
Compounds 3 and 7 for the expression of the zinc storage protein metallothionein 1A (MT1A) (FIG. 29A), copper transporter, Ctr1 (also known as SLC31A1) and iron transporter transferrin receptor 1 (TfR1) (FIG. 29C) The effect of treatment with was measured and compared to the well-known zinc chelator TPEN, copper chelator tetramine and iron chelator DFO, respectively. Despite the in vitro chelation of Cu ⁺² , the increase in copper susceptibility genes after treatment with compound 3 was transient. In contrast, a sustained decrease in zinc-sensitive genes showed intracellular zinc reduction as a significant result of treatment with Compound 3.

Example 44: Ability of compounds of formula I to modulate expression of MTF-1 and cyclin D1 in IN VIVO Zinc-sensitive transcription factor MTF-1 and cell cycle regulator cyclin D1 in HT-29 colon cancer xenograft tissue The correlation between expression is shown in FIG. Based on the presence of the putative MTF-1-binding DNA sequence in the cyclin D1 gene promoter region (shown in FIG. 30A), the expression levels of MTF-1 and cyclin D1 in xenograft tissues were RT- Investigated by PCR. A decrease in MTF-1 expression correlated with a decrease in cyclin D1 expression with Compound 3 as shown in FIG. 30B and Compound 7 as shown in FIG. 30C.

Example 45: Ability of Compound 3 to modulate MTF-1 and cyclin D1 expression with IN VITRO The correlation between gene expression of MTF-1 and cyclin D1 in HT-29 cells is shown in FIG. A time-dependent decrease in MTF-1 (FIG. 31A) and cyclin D1 (FIG. 31B) expression, as measured by RT-PCR, was seen after treatment with Compound 3. A decrease in cyclin D1 (FIG. 31D) expression was seen after MTF-1 gene knockdown by siRNA. MTF-1 levels after MTF-1 gene knockdown by siRNA are shown in FIG. 31C.
MTF-1 expression and activity was decreased by the compound of Formula I. Downregulation of MTF-1 correlated with decreased cyclin D1 expression.

Example 46: Ability of Compound 3 to Modulate KLF4 Binding Activity with IN VITRO The decrease in MTF-1 expression that causes induction of the tumor suppressor KLF4 is shown in FIG. Based on overlapping transcription factors that bind to sites on the KLF4 gene promoter region (shown in FIG. 32A), MTF-1 binding may help increase the binding of Sp1 and KLF4, other KLF4 inducers. Increased DNA binding activity of Sp1 (FIG. 32B) and KLF4 (FIG. 32C) from HT-29 nuclear extract was shown by electrophoretic mobility shift assay (EMSA).
Electrophoretic mobility shift assay (EMSA) was performed as follows. Nuclear extracts from HT-29 cells (10 ⁷ cells in a culture dish of 100mm in each experimental group) were prepared using nuclear extracts ions Kit (Panomics, Redwood City, CA) and.

The EMSA assay was performed using the KLF4 and Sp1 EMSA “Gelshift” kit (Panomics) according to the manufacturer's instructions. That is, 5 μg of nuclear extract was used for each binding reaction. After a 30 minute binding reaction, the samples were separated on a 6% polyacrylamide gel at 4 ° C. and 120 V and transferred to a BrightSTAR®-Plus positively charged nylon membrane. Probes labeled with biotin on the membrane were visualized using an ECL detection system (Panomics).
Reduction in MTF-1 activity helps induce KLF4 by the positive regulators SpI and KLF4 self-regulation.

Example 47: Ability of Compound 3 to modulate KLF4 binding to the cyclin D1 promoter with IN VITRO The decrease in KLF4 expression causing repression of cyclin D1 in HT-29 cells is shown in FIG. Based on overlapping transcription factors that bind to sites on the cyclin D1 gene promoter region (FIG. 33A), increased binding of the negative regulator KLF4 may replace the binding of the positive regulator Sp1. In vivo KLF4 and Sp1 binding to the cyclin D1 promoter was shown by chromatin immunoprecipitation assay (ChIP). Increased KLF4 binding and decreased Sp1 binding were seen after treatment with Compound 3.

Chromatin immunoprecipitation precipitation (ChIP) was performed as follows. Cell lysates from HT-29 cells (5.5 × 10 ⁵ cells in 3 15 cm culture plates in each experimental group) were prepared at the end of the specified experiment and ChIP assay was performed according to the manufacturer's instructions. Anti-KLF4 and anti-Sp1 antibodies (Santa Cruz Biotechnology Inc.) and ChIP-ITTM kit (Active Motif, Carlsbad, CA) were used. -231 to -92 region of the cyclin D1 promoter with 5 'primer (5'-CGGATACCAGGGGCAA-3') [SEQ ID NO: 1] and 3 primer (5'-GCTCCCAGGAACTTTGCA-3 ') [SEQ ID NO: 2] Primers containing were synthesized in Invitrogen.
Reduced KLF4 (negative regulator) binding to the cyclin D1 promoter inhibits Sp1 (positive regulator) binding and suppresses cyclin D1 expression.

Example 48: In VITRO ability of compound 3 to inhibit cell growth and modulate KLF4 expression in HT-29 cells The significance of KLF4 expression in HT-29 cell growth is shown in FIG. KLF4 gene expression measured by RT-PCR showed effective knockdown of the KLF4 gene by siRNA (FIG. 34A). Cell proliferation as measured by XTT assay showed a loss of compound 3-mediated cell growth inhibition after knockdown of the KLF4 gene by siRNA (FIG. 34B).

Small interfering RNA (siRNA) transfection was performed as follows. Predesignated MTF-1 siRNA (ID # 15734) (Ambion, Austin, TX) was used to degrade endogenous MTF-1 mRNA. Similarly, a predesignated KLF4 siRNA (ID # 115492) (Ambion, Austin, TX) was used to degrade endogenous KLF4 mRNA. A non-specific double-stranded RNA,
(5'R (CUAGGGGUAGACGAUGAGAG) d (TT) 3 ') [SEQ ID NO: 3] and (3'd (TT) R (GAUCCCAUUCCUCUUCUC) 5') [SEQ ID NO: 4]
Was synthesized in Qiagen (Cambridge, MA) based on the sequence of unrelated genes. HT-29 cells (3 × 10 ⁵ cells in a 35 mm culture dish) are prepared using the Lipofectamine® 2000 Transfection Reagent (Invitrogen) according to the manufacturer's instructions and at the specified concentration of siRNA or scrambled. The RNA control was transfected for 6 hours. At the end of the culture period, complete growth medium was added to the transfection medium and the cells were cultured at 37 ° C. for 24 hours prior to the designated experiment.

Example 49 Effect of Compound of Formula I on Growth of Human Lung Cell Carcinoma (H460) in CD-1 Nude Mice Tumor growth inhibition by a compound of formula I in a mouse xenograft model of human lung large cell carcinoma (H460) This was carried out as described in the above examples. The results are shown in FIG.

Example 50: To determine the nature of the chelating compound 3 in with zinc ion chelated in vitro with IN VITRO zinc ions by the compound of the formula I, after preculture ZnCl ₂ with compound 3 different concentrations, Free zinc ions were measured by fluorescence spectroscopy using the zinc sensitive fluorescent dye Zinquin (FIG. 36). 2 μM ZnCl ₂ was incubated with the indicated concentrations of Compound 3 in phosphate buffered saline (PBS), followed by addition of 10 μM final concentration of Zinquin for 30 minutes. The fluorescence of Zinquin after zinc binding was measured in a Fluoroskan Ascent emission fluorescence spectrometer with an excitation wavelength of 364 nm and an emission wavelength of 485 nm.
There was a dose-dependent decrease in the fluorescence of Zinquin, indicating less zinc ion binding with Zinquin as a result of chelation of compound 3 with zinc ions. Similar experiments with FeCl ₂ and CuSO ₄ did not show Zinquin fluorescence, but showed Zinquin fluorescence specificity for zinc ions only.

Example 51: Chelation of intracellular zinc ions in HT-29 cells with IN VITRO after treatment with compounds of formula I To determine the chelating nature of compound 3 with intracellular zinc ions, 35 μM HT-29 cells with or without initial incorporation of ZnCl ₂ were treated with Compound 3, the well-known zinc chelator TPEN or vehicle control (DMSO), as described in the previous examples. Intracellular free zinc was determined by measuring the fluorescence of Zinquin as described in. HT-29 cells (4 × 10 ⁵ cells / group) were pretreated with 35 μM ZnCl ₂ for 20 minutes, after which the indicated concentrations of Compound 3 or TPEN and 10 μM Zinquin were added for 30 minutes at 37 ° C. Numbers were measured (FIG. 37A). For measurement of endogenous zinc ion chelation in HT-29 cells, HT-29 cells (1.5 × 10 ⁶ cells / group) were tested at 37 ° C. for 30 minutes at the indicated concentrations of Compound 3 and 10 μM Zinquin. The number of fluorescence was measured (FIG. 37B).
A dose-dependent decrease in both originally incorporated zinc and endogenous zinc levels was seen after treatment with Compound 3 or TPEN.

Example 52: Effect of Compound of Formula I on Zinc Chelation and Metallothionein 1A Gene Expression in HT-29 Cells with IN VITRO To confirm the reduction of intracellular zinc levels after treatment with Compound 3, zinc Changes in gene expression of the storage protein metallothionein 1A (MT1A) were measured as intracellular zinc status markers.

HT-29 cells were treated with 1 μM compound 3 for the indicated times as follows, and MT1A gene expression was measured as follows. Total RNA was extracted using the Trizol method and gene expression levels were measured by quantitative reverse transcription polymerase chain reaction (RT-PCR). MT1A gene expression was normalized with β-actin gene expression in the same sample. A fold change in MT1A was shown at each time point relative to the DMSO control MT1A level. A decrease in MT1A gene expression was clearly seen after 8 hours of treatment as shown in FIG. 38A.
To verify that MT1A gene expression reflected intracellular zinc levels, HT-29 cells were treated with 1 μM compound 3, 35 μM ZnCl ₂ or a combination of compound 3 and ZnCl ₂ for 16 hours (FIG. 38B). . MT1A gene expression was determined by RT-PCR as described above. MT1A gene expression increased in response to an increase in intracellular zinc ions in cells treated with ZnCl ₂ . The decrease in MT1A expression in response to intracellular zinc reduction after treatment with Compound 3 was reversed by the addition of zinc supplements (FIG. 38B).

Example 53: Effect of Compound of Formula I on Zinc Chelation and Expression of Kr (upsion) ppel-like Factor 4 (KLF4) Gene in HT-29 Cells with IN VITRO KLF4 Gene by Zinc Reduction after Treatment with Compound 3 Changes in expression were judged by RT-PCR as follows. HT-29 cells were treated with 1 μM Compound 3 for the indicated time (FIG. 39A), or HT-29 cells were treated with 1 μM Compound 3, 35 μM ZnCl ₂ or a combination of Compound 3 and ZnCl ₂ for 16 hours. (FIG. 39B). Total RNA was extracted and the gene expression level was judged by RT-PCR.
A time-dependent increase in KLF4 was seen after treatment of HT-29 cells with 1 μM Compound 3 for 4 hours, with a maximum increase at 16 hours (FIG. 39A). The increase in KLF4 gene expression was reversed by the addition of zinc supplements (FIG. 39B), indicating the significance of changes in KLF4 gene expression in response to intracellular zinc status.

Example 54: Effect of Compound of Formula I on Zinc Sensitive Metal Response Element (MRE) Binding Transcription Factor 1 (MTF1) Gene Expression and DNA Binding Activity in HT-29 Cells with IN VITRO The gene expression of MTF-1 is HT-29 cells were treated with 1 μM compound 3 for the indicated time and then examined by RT-PCR. A decrease in MTF-1 expression was seen after 8 hours of treatment with Compound 3 (FIG. 40A).

To verify changes in MTF-1 activity early in the culture, treatment with compound 3 for 4 hours by electrophoretic mobility shift assay (EMSA) as follows before MTF-1 gene expression was significantly reduced MTF-1 nuclear translocation and DNA binding activity were determined in nuclear extracts of HT-29 cells (FIG. 40B). HT-29 cells were treated with DMSO, 35 μM ZnCl ₂ (positive control) and 1 μM Compound 3 for 4 hours. Nucleoprotein was extracted and incubated with biotin-labeled MTF-1-conjugated oligonucleotide probe. The delayed motility of the labeled probe due to MTF-1 binding was seen as a band shift (FIG. 40B). Three shift bands (black arrows) were seen in lane 1 (DMSO), indicating the structural DNA binding pattern of MTF-1. In the group treated with zinc, two additional shift bands (white arrows) were seen (lane 3), indicating an increase in zinc-dependent MTF-1 activity. No zinc activation shift band was seen in compound 3 treated (lane 5), indicating that zinc-dependent MTF-1 activity was not increased by compound 3. Extra unlabeled probe is added in lanes 2, 4 and 6 that compete with labeled probe that binds to MTF-1 in the nuclear extract, and the specificity of the MTF-1 binding shift band in lanes 1, 3 and 5 respectively. Indicated.

Compared to the motility shift band seen in the positive control ZnCl ₂ treated group, no significant change in motility shift was seen in cells treated with compound 3, indicating a zinc-dependent MTF-1 It was confirmed that the activity did not increase after treatment with compound 3.

Example 55: Ability of Compound 3 to modulate the gene expression of Kr (upsion) ppel-like factor 5 (KLF5), a KLF4 antagonist in HT-29 cells KLF4 and 5 are KLF family transcription factors. Two similar members, KLF5 stimulates cell proliferation, while KLF4 inhibits cell growth (Ghaleb et al. (2005) Cell Res. 15 (2): 92-96). KLF4 and 5 bind to similar GC-rich DNA consensus sequences but show opposite transcriptional activity. KLF4 can automatically activate its own gene by binding to the GC-rich region in the KLF4 promoter, whereas KLF5 represses KLF4 transcription by binding to the same DNA element (Dang (2002) Nucleic Acids Res. 30 (13): 2736-2741).

  In order to verify the results of decreased MTF-1 expression / activity with respect to induction of KLF4, MTF-1 target siRNA was used to degrade MTF-1 mRNA and MTF-1, KLF4 and KLF5 gene expression as follows Measured by RT-PCR. HT-29 cells were transfected with 100 nM MTF-1 siRNA for 6 hours using Lipofectamine 2000 reagent. The transfection medium was replaced with a normal growth medium and cultured for 18 hours, and then total RNA was extracted and the gene expression level was judged by RT-PCR. After inhibiting MTF-1 translation by using MTF-1 gene-specific siRNA, a decrease in KLF5 gene expression was seen, but KLF4 expression increased (FIG. 41A).

  The decrease in KLF5 gene expression after treatment with Compound 3 over time was also determined as follows. HT-29 cells were treated with 1 μM compound 3 for the indicated times (FIG. 41B). Total RNA was extracted and the gene expression level was judged by RT-PCR. Consistent with the above results, a decrease in KLF5 gene expression was also seen in HT-29 cells after 4 hours of treatment with 1 μM compound 3 (FIG. 41B).

Example 56: In VITRO ability of compound 3 to modulate cell cycle regulatory protein P21 gene and protein expression in HT-29 cells The expression of p21 gene and protein was examined after treatment with compound 3. P21 gene expression in HT-29 cells treated with 1 μM compound 3 was determined at the indicated times as follows.
Total RNA was extracted and the gene expression level was judged by RT-PCR (FIG. 42A). The level of p21 protein in the cell lysate was measured by ELISA (FIG. 42B) as follows. HT-29 cells were treated with 1 μM compound 3 for the indicated time in the presence or absence of 20 μM MG-132 (proteasome inhibitor).

  A decrease in gene expression of p21 was seen by RT-PCR after 4 hours of treatment with Compound 3 (FIG. 42A), but a comparable increase in p21 protein expression was observed by Western blot analysis (data not shown) or It was not seen by any of the enzyme immunoassays (ELISA) (FIG. 42B). However, an increase in p21 protein levels was seen when HT-29 cells were cultured with compound 3 in the presence of the proteasome inhibitor MG-132, and despite the significant increase in p21 gene expression, p21 protein was rapidly It was shown that it was decomposed.

Example 57: In VITRO ability of Compound 3 to modulate the expression of the cell cycle regulatory protein cyclin D1 Cyclin D1 gene and protein expression after treatment with Compound 3 is as follows, as shown in FIGS. 43A and 43B, respectively: Judgment was made by RT-PCR and east blot. HT-29 cells were treated with 1 μM compound 3 for the indicated times. Total RNA was extracted and the gene expression level was judged by RT-PCR. Cyclin D1 protein expression in HT-29 cell lysates was determined by SDS-PAGE followed by eastern blotting.
A decrease in both cyclin D1 gene (FIG. 43A) and protein (FIG. 43B) levels was seen after 8 hours of treatment with Compound 3.

Example 58: In Vitro ability of Compound 3 to regulate the expression of tumor suppressor gene, early growth response protein-1 (EGR-1) Like Sp1, Egr-1 is also a transcription factor with a zinc finger DNA binding domain And recognizes a GC-rich sequence in the regulatory promoter region of the targeted gene (Al-Saraj et al. (2005) J. Cell Biochem. 94 (1): 153-167). Changes in Egr-1 gene expression were seen in HT-29 cells treated with Compound 3 by RT-PCR as follows (FIG. 44A). HT-29 cells were treated with 1 μM compound 3 for the indicated times. Total RNA was extracted and the gene expression level was judged by RT-PCR. To determine the effect of the zinc supplement, HT-29 cells were treated with 1 μM Compound 3, 35 μM ZnCl, or a combination of Compound 3 and ZnCl ₂ for 8 hours. Egr-1 gene expression was judged by RT-PCR (FIG. 44B).
A significant increase in Egr-1 gene expression was seen as early as 2 hours after treatment with Compound 3 as shown in FIG. 44A, and was reversible with the addition of zinc supplements as shown in FIG. 44B.

Example 59: In VITRO ability of compound 3 and compound 7 to regulate gene expression in HT-29 cells The gene expression pattern in response to compound 3 and compound 7 was verified by RT-PCR as follows (Fig. 45). HT-29 cells were treated with 1 μM compound 3 or compound 8 for 8 hours. Total RNA was extracted and the gene expression level was judged by RT-PCR. Similar expression of related genes was seen.

Example 60: Ability of Compound 3 to Modulate KLF4 and Cyclin D1 Gene Expression in an HT-29 Colon Cancer Xenograft Model To investigate the effect of compound 3 mediated changes on KLF4 and cyclin D1 expression in vivo, vehicle control The expression of individual genes in xenograft tissues of mice transplanted with HT-29 colon cancer cells treated with (lutrol) and compound 3 was analyzed by RT-PCR (FIG. 46). That is, KLF4 and cyclin D1 gene expression was measured in HT-29 xenograft tissue after 14 days of treatment with Compound 3 as follows. Mice implanted subcutaneously with HT-29 cells were treated with vehicle control (ip administration) or 100 mg / kg of compound 3 (ip administration) for 14 days (n = 6 for each group). Total RNA was extracted and the gene expression level was judged by RT-PCR. KLF4 and cyclin D1 gene expression was normalized with β-actin gene expression in the same sample. Fold changes in KLF4 and cyclin D1 were shown relative to the average of individual gene expression from 6 control mice treated with lutrol.
Consistent with the expression pattern in the HT-29 cultured cell line in vitro, an increase in KLF4 gene expression and a decrease in cyclin D1 gene expression were seen in vivo (FIG. 46).

Example 61: In VITRO Ability of Compound 3 to Chelate Zinc from Zinc Storage Protein Metallothionein Intracellular zinc is not loosely bound to the storage protein metallothionein (MT), which stores 7 or 8 zinc per molecule. It exists as a stable pool. The labile zinc pool provides zinc to enzymes or transcription factors that require reversible binding to zinc for full activation (Tapiero and Tew (2003) Biomed Pharmacother , 57 (9): 399-411). ). The efficiency of compound 3 to remove zinc from MT was investigated. MT-1 isolated from rabbit livers, mainly containing MT-1a and MT-2e with up to 7 zinc per molecule at> 95% MT, was purchased from Alexis Biochemicals (Lausen, Switzerland). The zinc content in MT was measured in vitro using a 4 (2-viridylazo) resorcinol (PAR) colorimetric zinc assay as described in the previous examples. The change in PAR absorbance after PAR-zinc ion complex formation was measured at 500 nm (Dinkova-Kostova et al. (2005) Biochemistry, 44 (18): 6889-6899). To determine chelation of zinc from MT-1 by compound 3 in vitro, a volume of 100 ml of 25 M MT-1 in 0.2 M Tris-HCl, pH 7.5 was added to a 96 well plate. Compound 3 (0.15-60 μM) in 80% acetonitrile / 20% DMSO was added to MT-1 for 15 minutes at room temperature. PAR (0.2 M Tris-HCl, 200 μM in pH 7.5) was added and the color of the PAR-zinc complex was measured with a 500 nm multiwell spectrophotometer as shown in FIG.

  A dose-dependent decrease in PAR absorbance of 25 μM MT was seen after in vitro treatment with increasing dose of compound 3 (FIG. 47), and zinc by compound 3 from an unstable zinc pool in the cell Removal was proven.

Example 62: Ability of Compound 3 to produce MTF-1 DNA binding activity in IN VITRO Inactivate DNA binding activity of metal response element (MRE) binding transcription factor (MTF-1), a transcription factor containing zinc fingers The efficiency of Compound 3 to be converted was examined. The reversible binding of zinc to the activated zinc finger of MTF-1 is required for nuclear translocation of MTF-1 and maximal binding of MTF-1 to MRE (Lichtlen and Schaffner (2001) Bioessays , 23 ( 11): 1010-1017).

HT-29 cells were treated with 35 μM ZnCl ₂ for 4 hours, and nuclear extracts from zinc-treated cells (zinc activated MTF-1) were treated with compound 3 in vitro and treated with MTF-1 DNA binding activity with the MRE sequence was tested by electrophoretic mobility shift assay (EMSA) (Panomics, Redwood City, CA). Inactivation of MTF-1 DNA binding by compound 4 in vitro is shown in FIG. 48A.
To examine the inactivation of MTF-1 by compound 3 in the cells, HT-29 cells were treated with compound 3 for 1-4 hours and the DNA binding activity of MTF-1 in nuclear extracts was tested with EMSA. A significant decrease in MTF-1 activity was seen 4 hours after treatment of HT-29 cells with Compound 3 (FIG. 48B).

Example 63: Ability of Compound 3 to modulate MTF-1 DNA binding activity in HT-29 cells To examine the decrease in MTF-1 binding to the promoter region of the MTF-1 targeting gene, the cell cycle control gene cyclin D1, HT -29 cells were treated with compound 3 for 16 hours and MTF-1 binding to the cyclin D1 promoter was tested by chromatin immunoprecipitation assay (ChIP) (Active Motif, Carlsbad, CA). At the end of 16 hours of treatment with Compound 3, cells were fixed with 1% formaldehyde to cross-linking transcription factors and their target chromatin. The chromatin complex was sheared and the chromatin bound with MTF-1 was destroyed by an antibody against MTF-1 (Santacruz Biotechnology Inc.). Crosslinking was reversed and MTF-1-related DNA was amplified by polymerase chain reaction using primers containing the -231 to -92 region of the cyclin D1 promoter. The 5 ′ primer (5′-CGGATACCAGGGGCAAS ′) [SEQ ID NO: 1] and the 3 ′ primer (5′-GCTCCCAGGAACTTTGCA-S ′) [SEQ ID NO: 2] were synthesized in Invitrogen. Increased MTF-1 binding to the cyclin D1 promoter was seen after treatment with 35 μM ZnCl ₂ as shown in FIG. 49, indicating that cyclin D1 is an MTF-1 targeting gene. Reduced MTF-1 binding to the cyclin D1 promoter following compound 3 compared to basal levels of MTF-1 binding, and compound 3 inhibited structural cyclin D1 gene transcription activation by MTF-1 Was shown (FIG. 49).

Example 64: Effect of Compound of Formula I on Zinc Chelation and Cyclin D1 Gene Expression in HT-29 Cells with IN VITRO Compound 3-mediated as shown in Examples 23 and 41, particularly related to the G1 / S phase In order to verify the cell cycle control pathway involved in cell cycle arrest, the expression of cyclin D1, the main cell cycle regulator of G1 / S phase progression, was examined. Cyclin D1 gene expression was significantly reduced after 16 hours of treatment of HT-29 cells with 1 μM compound 3 and reversed in the presence of 25 μM ZnCl ₂ as measured by RT-PCR. It was confirmed that the decrease in expression was the result of zinc reduction (FIG. 50A). Decreased protein expression of cyclin D1 was also confirmed by SDS-PAGE followed by Western blot (FIG. 50B). Furthermore, a decrease in the expression of cyclin E was confirmed by measuring the expression of other types of cyclins (FIG. 50B).

Example 65: Effect of a compound of formula I on MTF-1 gene expression in HT-29 cells on IN VITRO To assess cellular response to zinc depletion, gene expression of the zinc sensitive transcription factor MTF-1 was examined. . As measured by RT-PCR, a significant decrease in MTF-1 gene expression (FIG. 51) was seen after treatment of HT-29 cells with 1 μM compound 3 for 8 hours, which was restored by the addition of zinc supplements, It was confirmed that the decrease in MTF-1 expression due to treatment with Compound 3 was the result of zinc reduction.

HT-29 cells were treated with ZnCl ₂ and cyclin D1 gene expression was measured by RT-PCR. A fold change in gene expression was shown relative to the expression of the cyclin D1 gene in control cells. Decreased expression of the cyclin D1 gene was seen after treatment of cells with zinc as an activator of MTF-1 (FIG. 51B).
HT-29 cells treated with control or MTF-1 siRNA is a ZnCl _2, or treated with ZnCl ₂ without, to measure the expression of cyclin D1 gene by RT-PCR. A fold change in gene expression is shown for cyclin D1 gene expression in control cells without transfection in the control group, and for cyclin D1 gene expression in non-specific siRNA transfected cells in the transfection group. It was done. The zinc-dependent increase in cyclin D1 expression disappeared when the MTF-1 gene was degraded by siRNA prior to addition of compound 3 (FIG. 51C).

Example 66: IN VITRO ability of Compound 3 to modulate KLF4 expression in HT-29 cells by SIRNA-mediated MTF-1 knockdown To assess the significance of decreased MTF-1 expression on KLF4 induction, Compound 3 The KLF4 gene expression in response to treatment with was measured by RT-PCR in HT-29 cells transfected with MTF-1 siRNA. A fold change in KLF4 gene expression was shown for KLF4 expression in cells transfected with non-specific siRNA treated with vehicle control. The basic expression gene of KLF4 was significantly reduced after MTF-1 gene knockdown, indicating structural MTF-1-dependent KLF4 gene transcription (FIG. 52). However, KLF4 gene expression continues to increase after treatment with Compound 3 regardless of knockdown of MTF-1 gene by siRNA (FIG. 52) and depends on MTF-1 of KLF4 gene by treatment with Compound 3 Not activation was suggested.

Example 67: IN VITRO effect of compounds of formula I on expression of KLF4, KLF2 and KLF6 genes in H-460 non-small cell lung cancer cells Another potential tumor suppressor, KLF2 (lung KLF) (Wang et al. (2005) ONCOGENE , 22 (24): 3878-3885) and KLF6 (Ito et al. (2004) Cancer Res , 64 (11): 3838-3843) are expressed in H-460, a non-small cell carcinoma cell line. Evaluated. The expression of KLF2, 4 and 6 in control H-460 cells was measured by RT-PCR. Gene expression was shown for KLF4 expression of “1” (FIG. 53A). KLF4 expression was the highest, and only 0.05 and 0.3 times the expression of KLF2 and 6 was detected with respect to KLF4 expression of “1” (FIG. 53A).

  The expression of KLF2, 4 and 6 in vehicle controls or H-460 cells treated with 2.5 μM compound 3 or compound 7 was measured by RT-PCR. Gene expression was shown for individual gene expression in the group treated with vehicle control at “1”. Treatment with compound 3 or compound 7 also showed an increase in KLF4 as the most significantly altered gene (FIG. 53B).

Example 68: Effect of Compound 3 on IN VIVO and Modulation of MTF1, Cyclin D1 and KLF4 Expression in Colorectal Cancer Xenograft Model The tumor suppressive effect of Compound 3 was determined by athymus transplanted with Compound 3 treated HT-29 Evaluated in mice (FIG. 54A) and correlated with gene expression of MTF-1, KLF4 and cyclin D1 in HT-29 xenograft tissues (FIG. 54B). CD-1 athymic nude mice (4 mice per group) were injected subcutaneously with HT-29 cells (3 × 10 ⁶ cells in 0.1 mL PBS). From day 5 after tumor cell inoculation, mice were injected intraperitoneally with 200 μL of vehicle control or 100 mg / kg of compound 3, followed by 10 days apart, which was divided into two cycles (first cycle injection). Were carried out on the 5th to 9th days, and the second cycle injection was carried out on the 20th to 24th days). Tumor size was measured during the treatment using calipers (FIG. 54A). Mice were killed 34 days after tumor cell inoculation. Tumor tissue was excised, immediately frozen, and stored at −80 ° C. until RNA extraction and gene expression were analyzed by RT-PCR (FIG. 54B). A fold change in gene expression was shown relative to the mean value of 4 control mice injected with lutrol vehicle control.

  A significant decrease in tumor size was seen in mice treated with Compound 3 compared to mice injected with vehicle control (FIG. 54A). Analysis of gene expression in xenograft tissues also showed a significant increase in KLF4 and a decrease in gene expression of MTF-1 and cyclin D1 in mice treated with Compound 3 compared to the group injected with vehicle control (FIG. 54B). ).

Example 69: Ability of Compound 3 and Compound 7 to modulate the expression of MT1A, MTF1, cyclin D1 and KLF4 in HT-29 cells in IN VITRO MT1A (FIG. 55A), MTF-1 (FIG. 55B), cyclin D1 ( The ability of compounds of formula I to modulate gene expression of FIG. 55C) and KLF4 (FIG. 55D) was determined by RT-PCR. HT-29 cells were treated with 1 μM Compound 3 or Compound 7, 35 μM ZnCl ₂ , Compound 3 and ZnCl ₂ or Compound 7 and ZnCl ₂ for 8-16 hours. Individual gene expression was normalized with β-actin gene expression in the same sample. A fold change in gene expression was shown relative to the individual gene level of the DMSO control. As seen with 1 μM compound 3, decreased expression of MT1A, MTF-1 and cyclin D1 and increased expression of KLF4 were also detected in compound 7. MT1A (8 hours), MTF-1 (8 hours) after treatment with Compound 3 or Compound 7 (FIG. 55A) (FIG. 55B) to emphasize that the gene expression change is the result of intracellular zinc depletion And the decrease in cyclin D1 (8 hours) (FIG. 55C) and the increase in KLF4 (16 hours) (FIG. 55D) were reversed by the addition of zinc supplements.

Example 70: Chelation of Transition Metal Ions with Compound 3 and Compound 64 in IN VITRO The nature of metal chelation of compound 64 and the relative affinity for different metal ions was determined using the procedure described in the previous examples. It was evaluated with a 4 (2-viridylazo) resorcinol (PAR) colorimetric zinc assay and compared to the effect of Compound 3 in vitro. The indicated final concentrations of ZnCl ₂ (FIG. 56A), CuCl ₂ (FIG. 56B) or FeCl ₂ (FIG. 56C) were incubated with 80% acetonitrile-20% DMSO vehicle control or 200 μM compound of formula I. The color of the PAR-metal ion complex was measured with a 500 nm multiwell spectrophotometer.

The dose-dependent increase in the absorption of PAR-Zn ²⁺ (FIG. 56A) and PAR-Cu ²⁺ (FIG. 56B) after increasing doses of zinc or copper, respectively, is eliminated by the presence of Compound 3 and Compound 64 The chelating properties of compounds competing with PAR for binding to Zn ²⁺ and Cu ²⁺ were demonstrated. The dose-dependent coloration of PAR-Fe ²⁺ was less affected by the addition of compound (FIG. 56C), indicating that both compound 3 and compound 64 favored Zn ²⁺ and Cu ²⁺ over Fe ²⁺ .

Example 71: Ability of Compound 64 to modulate gene expression of MT1A, MTF-1, cyclin D1 and KLF4 in HT-29 cells MT1A (FIG. 57A), MTF-1 (FIG. 57B) in HT-29 cells ), The effects of Compound 3 and Compound 64 on gene expression of cyclin D1 (FIG. 57C) and KLF4 (FIG. 57D) were determined by RT-PCR. HT-29 cells were treated with 1 μM Compound 3 or Compound 64, 35 μM ZnCl ₂ , Compound 3 and ZnCl ₂ , or Compound 64 and ZnCl ₂ for 8-16 hours. Individual gene expression was normalized with β-actin gene expression in the same sample. A fold change in gene expression was shown relative to the individual gene level of the DMSO control.

  As seen with 1 μM compound 3, decreased expression of MT1A, MTF-1 and cyclin D1 and increased expression of KLF4 were also detected with compound 64. Reduction of MT1A (8 hours) (FIG. 57A), MTF-1 (8 hours) (FIG. 57B) and cyclin D1 (8 hours) (FIG. 57C) and KLF4 (1 hour) after treatment with Compound 3 or Compound 64 The increase in (Figure 57D) was reversed by the addition of zinc supplements.

  All patents, publication disclosures, and database registrations referenced herein, including published patent applications, are incorporated by special and individual reference to each such individual patent, publication, and database registration. Are specifically incorporated by reference as a whole to the same extent as indicated.

  Although the invention has been described with reference to certain specific embodiments, various modifications thereof can be made without departing from the spirit and scope of the invention, as summarized in the claims appended hereto. It will be clear to the skilled person.

These and other features of the present invention will become more apparent in the following detailed description with reference to the accompanying drawings.
Shown are the mean and median GI ₅₀ values for compound 2 and compound 3 growth in multiple cancer cell lines in vitro. Figure 3 shows the effect of Compound 3 on the growth of a number of cancer cell lines in vitro. Figure 3 represents the effect of metal ions on the ability of Compound 3 and Compound 13 to inhibit HT-29 cell growth in vitro. Figure 6 represents the effect of copper ions on the ability of Compound 3 to inhibit HT-29 cell growth in vitro. Figure 3 represents the effect of metal ions on the ability of Compound 3 to inhibit HT-29 cell growth in vitro. (A) Effect of zinc ion, (B) Effect of copper ion, (C) Effect of iron (II) ion, (D) Effect of iron (III) ion, (E) Effect of magnesium ion, and (F) The effect of calcium ions. FIG. 6 represents the effect of copper or zinc ions on the ability of Compound 5 (A) and Compound 7 (B) to inhibit HT-29 cell growth in vitro. FIG. 5 represents the effect of Compound 3 on the expression of metallothionein gene mRNA in HT-29 cells in vitro. FIG. 5 represents the effect of Compound 3 on the expression of KLF4 mRNA in HT-29 cells in vitro. FIG. 6 represents the effect of Compound 3 on the expression of KLF4 protein in HT-29 cells in vitro. FIG. 6 represents the effect of Compound 3 on p21 mRNA expression in HT-29 cells in vitro.

1 represents the ability of Compound 3 to block cell cycle progression in HT-29 cells (A) and CCRF-CEM cells (B) in vitro. Figure 2 shows the ability of Compound 3 to induce apoptosis in CCRF-CEM cells in vitro. 1 represents the ability of Compound 3 to reduce tumor size (A) and tumor weight (B) in a colon adenocarcinoma xenograft model. 1 represents the ability of Compound 3 to reduce tumor size (A) and tumor weight (B) in a large cell lung cancer xenograft model. 2 represents the ability of compounds 3, 5 and 7 to reduce tumor size (A) and tumor weight (B) in a colon adenocarcinoma xenograft model. 2 represents the ability of compounds 3, 5 and 7 to reduce tumor size (A) and tumor weight (B) in a lung cancer xenograft model. FIG. 6 represents the effect of Compound 3 on in vivo KLF4 mRNA levels in tumors from a colon adenocarcinoma xenograft model. FIG. 6 represents the effect of Compound 3 on in vivo p21 mRNA levels in tumors from a colon adenocarcinoma xenograft model. FIG. 6 represents the effect of Compound 3 on in vivo cyclin D1 mRNA levels in tumors from a colon adenocarcinoma xenograft model (A). 2 represents a comparison of the effect of Compound 3 on KLF4, p21 and cyclin D1 mRNA levels in a colon adenocarcinoma xenograft model.

2 represents the intracellular localization of Compound 3 in HT-29 cells in vitro. (A) Cells treated with compound 3 for 5 minutes, (B) and (C) cells treated for 4 hours. In (A) and (B), the differential interference contrast image is taken as a fluorescent image and (B) and (C) are the same image. The ability of compounds 3 and 13 to cleave DNA in the presence of (A) metal ions, (B) copper, zinc or iron (II) ions, and (C) various amounts of copper. Represents. Represents the ability of compounds 3, 5, 7, 9, 12, and 13 to cleave DNA. 2 shows the development of compounds of formula I Non-small cell lung cancer xenograft model (A) and The ability of compounds 3 and 7 to inhibit tumor growth in a colon adenocarcinoma xenograft model (B), The ability of Compound 7 to inhibit tumor growth in a non-small cell lung cancer xenograft model (C); and 1 represents the ability of compounds 7, 63, 64, 69, 72, 73, 74, 18 and 78 to inhibit tumor growth in a non-small cell lung cancer xenograft model (D). FIG. 6 represents the effect of metal ion supplementation on Compound 3-mediated cell growth inhibition, Zn ⁺² , Cu ⁺² and Fe ⁺² (A) and Fe ⁺³ , Ca ⁺² and Mg ⁺² (B). FIG. 6 represents cell cycle analysis in HT-29 cells treated with Compound 3 (A) and Compound 7 (B). Demonstrates the metal chelation properties of Compound 3 and Compound 7 in vitro in the presence of ZnCl ₂ (A), CuCl ₂ (B) and FeCl ₂ (C). Metal-sensitive gene, zinc-sensitive gene metallothionein 1A (A), copper-sensitive copper transporter 1 (B) and iron sensitivity in HT-29 cells treated with compound 3, compound 7 or individual metal-specific chelating agents Represents the change in the expression of transferrin receptor 1 (C). Figure 3 represents MTF-1 binding DNA sequence in the cyclin D1 gene promoter (A) and the expression levels of MTF-1 and cyclin D1 in HT-29 colon cancer xenograft tissues treated with compound 3 (B) and compound 7 (C).

MTF-1 (A) and cyclin D1 (B) expression after compound 3 treatment in HT-29 cells, as measured by RT-PCR, and MTF-1 expression after MTF-1 gene knockdown by siRNA (C) and Cyclin D1 expression (D). Fig. 5 represents the transcription factor binding site on the KLF4 gene promoter (A) and the DNA binding activity of SpI (B) and KLF4 (C) in HT-29 cells treated with compound 3. Figure 3 represents the transcription factor binding site on the cyclin D1 gene promoter (A) and in vivo KLF4 and SpI binding (B) to the cyclin D1 promoter after compound 3 treatment in HT-29 cells by chromatin immunoprecipitation assay. FIG. 4 represents the effect of Compound 3 in HT-29 cells on KLF4 gene expression (A) and cell proliferation (B) measured by RT-PCR and knockdown of KLF4 gene by siRNA. 1 represents the ability of compounds 7, 41, 42, 50, 52, 53, 54, 55 and 4 to inhibit tumor cell growth in a large cell lung cancer xenograft model. It represents the ability of Compound 3 to chelate zinc ions in vitro using the zinc sensitive dye Zinquin. (A) pre-incorporated with ZnCl ₂ (B) (endogenous zinc ion) represents the ability of Compound 3 to chelate zinc ions in vitro in HT-29 cells. FIG. 5 represents the effect of Compound 3 on the expression of the metal sensitivity gene, zinc sensitivity gene metallothionein 1A, in HT-29 cells in vitro (A) and after treatment with zinc supplement (B) in vitro. 2 represents the effect of Compound 3 on the expression of metal sensitive tumor suppressor KLF4 in HT-29 cells in vitro (A) and after treatment with zinc supplement (B) in vitro. FIG. 5 represents the effect of Compound 3 on the expression of zinc sensitive metal responsive element (MRE) binding transcription factor 1 (MTF-1) in HT-29 cells over time in vitro.

Effect of MTF-1 gene knockdown by siRNA treatment in HT-29 cells in vitro on expression of MTF-1, KLF5 and KLF4 (A), and of KLF5 in HT-29 cells in vitro over time The effect (B) of the compound 3 with respect to expression is represented. FIG. 5 represents the effect of Compound 3 on the expression of cell cycle regulatory protein p21 in HT-29 cells in vitro over time at mRNA level (A) and protein level (B). Figure 3 represents the effect of Compound 3 on mRNA level (A) and protein level (B) expression of cyclin D1 in HT-29 cells in vitro over time. 2 represents the effect of Compound 3 on the expression of tumor suppressor gene, early growth response protein (EGR-1) in HT-29 cells in vitro over time (A) and after treatment with zinc supplement (B). FIG. 5 represents the effects of Compound 3 and Compound 7 on gene expression levels of MT1A, MTF-1, KLF4, KLF5, p21, cyclin D1 and Erg-1 in HT-29 cells in vitro. 2 represents the in vivo effect of Compound 3 on gene expression levels of KLF4 and cyclin D1 in HT-29 colon cancer xenograft tissue from mice. 1 represents the ability of Compound 3 to chelate zinc from the zinc storage protein metallothionein 1 (MT-1) in vitro. Inactivation of zinc-activated MTF-1 DNA binding activity after treatment with compound 3 in vitro (A) and inactivation of DNA binding activity of MTF-1 by compound 3 in HT-29 cells in vitro Represents (B). FIG. 6 represents the ability of Compound 3 to reduce MTF-1 DNA binding activity in HT-29 cells to the cyclin D1 promoter region by chromatin immunoprecipitation assay (ChIP). 2 represents the effect of compound 3 and zinc supplement on cyclin D1 gene expression in HT-29 cells in vitro (A), and the effect of compound 3 on cyclin D1 and other cyclin protein levels (B).

Effect of Compound 3 and Zinc Supplement on MTF-1 Expression in HT-29 Cells in Vitro (A), Effect of Zinc Supplement on Cyclin D1 Expression (B), and Zinc Supplement on Cyclin D1 Expression The effect (C) of MTF-1 gene knockdown by a product and siRNA is represented. FIG. 5 represents the effect of MTF-1 gene knockdown by Compound 3 and siRNA on expression of KLF4 in HT-29 cells in vitro. Comparison of gene expression levels of KLF4, KLF2 and KLF6 in HT-29 cells in vitro (A) and effect of compound 3 and compound 7 on expression of KLF4, KLF2 and KLF6 in H-460 cancer cells in vitro ( B). Compound 3's ability to reduce tumor size in colon adenocarcinoma xenograft model (A) and effect on MTF-1, cyclin D1 and KLF4 mRNA levels in vivo in tumors from colon adenocarcinoma xenograft model (B ). FIG. 6 represents the effect of Compound 3, Compound 7 and zinc supplement on mRNA levels in HT-29 cells in vitro against MT1A (A), MTF-1 (B), cyclin D1 (C) and KLF4 (D). Demonstrates the metal chelation properties of Compound 3 and Compound 64 in vitro in the presence of ZnCl ₂ (A), CuCl ₂ (B) and FeCl ₂ (C). The effects of compound 3, compound 64 and zinc supplementation on mRNA levels in HT-29 cells in vitro for MT1A (A), MTF-1 (B), cyclin D1 (C) and KLF4 (D) Represent.

Claims (37)

Formula I

In the formula:
R1, R3, R4, R5 and R7 are hydrogen;
R2 is halogen, lower alkyl, cyano, aryl, nitro, alkoxy or hydroxyl, and
R6 is lower alkyl, halogen, cycloalkyl, aryl, or substituted aryl, and
Wherein lower alkyl is an alkyl group having 1 to 8 carbon atoms.
Or a salt thereof. In the formula:
R6 is lower alkyl, cycloalkyl or substituted aryl
The compound of claim 1. In the formula:
R2 is halogen, ethyl, isopropyl, t-butyl, cyano, phenyl, nitro, OCH ₃ Or is hydroxyl
The compound according to claim 1 or 2. In the formula:
R6 is CH ₃ , Isopropyl, t-butyl, adamantane, cyclopentane, or substituted phenyl
The compound according to any one of claims 1 to 3. In the formula:
R2 is halogen; and
R6 is lower alkyl
The compound according to any one of claims 1 to 3. In the formula:
R2 is halogen; and
R6 is C1-C4 alkyl
6. A compound according to claim 5. In the formula:
R6 is CH ₃ , Isopropyl, or t-butyl
7. A compound according to claim 5 or 6. In the formula:
R6 is CH ₃ Is
7. A compound according to claim 5 or 6. In the formula:
R2 is F or Br
The compound as described in any one of Claims 1-8. In the formula :
R2 is F
10. A compound according to claim 9. The compound is:

Or the compound of Claim 1 which is its salt. The compound is:

Or the compound of Claim 5 which is its salt. The compound is:

The compound according to claim 12, which is or a salt thereof. 14. A compound according to any one of claims 1 to 13, wherein the salt is an HCl salt. A pharmaceutical composition comprising the compound according to any one of claims 1 to 14, or a salt thereof, and a pharmaceutically acceptable carrier. 16. A pharmaceutical composition according to claim 15, wherein the composition comprises a liposome or lipid micelle formulation. 17. A pharmaceutical composition according to claim 15 or 16, wherein the composition is formulated for intravenous administration. Use of a compound according to any one of claims 1 to 14 or a salt thereof for the treatment of cancer in a subject in need of treatment for cancer (except for humans). Use of a compound according to any one of claims 1 to 14 or a salt thereof in the manufacture of a therapeutic agent for treating cancer. Use of the compound or a salt thereof according to any one of claims 1 to 14, for inhibiting the growth of cancer cells in a subject (excluding humans) in need of inhibiting the growth of cancer cells. Use of a compound according to any one of claims 1 to 14 or a salt thereof in the manufacture of a therapeutic agent for inhibiting the growth of cancer cells. Use of a compound according to any one of claims 1 to 14 or a salt thereof for inducing apoptosis in cancer cells of a subject (excluding humans). Use of a compound according to any one of claims 1 to 14 or a salt thereof in the manufacture of a therapeutic agent for inducing apoptosis in cancer cells. 24. Use according to any one of claims 18 to 23, wherein the cancer is a solid tumor. The use according to claim 24, wherein the solid tumor is non-small cell lung cancer, colon cancer, prostate cancer, breast cancer or melanoma. 24. Use according to any one of claims 18 to 23, wherein the cancer is non-small cell lung cancer, colon cancer, breast cancer, uterine cancer, leukemia, rectal cancer, melanoma, prostate cancer or CNS cancer. 24. Use according to any one of claims 18 to 23, wherein the cancer is leukemia. 24. Use according to any one of claims 18 to 23, wherein the cancer is non-small cell lung cancer. 24. Use according to any one of claims 18 to 23, wherein the cancer is colon cancer. Use of the compound or a salt thereof according to any one of claims 1 to 14, for increasing the expression of Krueppel-like factor (KLF4) in cancer cells of a subject (except human). Use of the compound or a salt thereof according to any one of claims 1 to 14 in the manufacture of a therapeutic agent for increasing the expression of Krueppel-like factor (KLF4) in cancer cells. 32. Use according to claim 30 or 31, wherein the cancer is leukemia, bladder cancer or gastrointestinal cancer. The use according to claim 32, wherein the gastrointestinal cancer is colorectal cancer or colorectal cancer. 34. Use according to any one of claims 18 to 33, wherein the compound is formulated as a liposome or lipid micelle formulation. 35. Use according to any one of claims 18 to 34, formulated for intravenous administration. Use of a compound according to any one of claims 1 to 14 or a salt thereof in a chelate transition metal ion in non-therapeutic applications. 37. Use according to claim 36, wherein the transition metal ion is a zinc ion, an iron ion or a copper ion.

Images