JP5305066B2 - Method of generating corneal endothelial cells from tissue stem cells / tissue progenitor cells - Google Patents

Description

  The present invention relates to the generation of corneal endothelial cells for use in transplantation therapy from autologous tissues other than corneal endothelium. In particular, the present invention relates to the generation of corneal endothelial cells from autologous tissue-derived tissue stem / progenitor cells.

  The eyeball is the main part of the sensory organ that controls vision. The shape of the eyeball is supported by a thick and strong membranous tissue called cornea and sclera. The cornea is located in front of the eyeball, is transparent, and covers a part commonly called the black eye. The sclera is opaque and covers a portion generally called white eyes and most of the back of the eyeball that cannot be seen from the outside. On the posterior surface of the cornea, there is an iris (a pupil is open at the center of the iris) corresponding to the squeezing of the camera, and a lens corresponding to the lens. That is, the cornea is positioned in front of a passage through which light passes when the living body obtains visual information. Therefore, the turbidity of the cornea due to damage or the like has a significant effect on visual function.

The cornea histologically has a structure composed of three layers of the corneal epithelium, the corneal stroma, and the corneal endothelium from the outer surface side. As described above, the transparency of the cornea, which is important for visual function, is maintained by the action of the corneal endothelium. A space called an anterior chamber (anterior chamber) exists between the cornea and the iris, and the anterior chamber is filled with a kind of lymph fluid called anterior chamber water. The corneal endothelium keeps the corneal thickness constant by taking up substances necessary for the survival of the cells that form the cornea (glucose, oxygen, etc.) from the anterior chamber water and discharging excess water in the cornea to the anterior chamber. And maintaining the transparency of the cornea. These functions of the corneal endothelium are controlled by a pump function (Na ⁺ / K ⁺ ATPase) and a barrier function (tight junction protein (ZO-1)).

When the function of the corneal endothelium is impaired due to a decrease in corneal endothelial cells or the like, the water discharging ability of the corneal endothelium is reduced, and edema occurs in the corneal stroma. This leads to a decrease in the transparency of the cornea and thus a loss of visual acuity. Such a condition is called “bullous keratopathy”. Bullous keratopathy can occur, for example, when the normal corneal endothelial cell density of about 3,000 cells / mm ² is reduced to 500 cells / mm ² or less.

  The corneal endothelium is known not to grow in adults. That is, when corneal endothelial cells are reduced by some injury, the corneal endothelial cell layer cannot self-regenerate. Therefore, severe corneal endothelium damage such as the above bullous keratopathy can be treated only by transplantation.

  Patients with corneal endothelium injury are currently treated with full-thickness corneal transplants. Full-thickness corneal transplantation is an established technique, and eye bank was established in Japan about 40 years ago, and transplantation activities started. However, the eye bank in Japan still has a small number of donors, and about 20,000 patients need corneal transplantation in Japan every year, whereas about 1/10 patients can actually undergo transplantation treatment. It is said that there are only about 2,000 people. In addition to the serious donor shortage problem, corneal transplantation using a donor cornea (transplant) has a problem of rejection and its long-term treatment results are not good.

Various attempts have been made to solve the above-mentioned problems of full-thickness corneal transplantation.
One such attempt is DSEK (Descemet Stripping Endotherial Keratoplasty). In this method, corneal endothelium (including part of the corneal stroma) obtained from a human imported eye bank or the like is collected and transplanted to a diseased eye. Since only the corneal endothelium is transplanted, it is considered that there is less rejection compared to full-thickness corneal transplantation.

  In addition, as a known technique related to regenerative medicine for corneal endothelium, attempts to use cultured corneal endothelial cells have been reported. So far, after isolating corneal endothelial cells from human imported eyebank cornea and proliferating them by culture, rabbit corneal endothelial injury model (Non-patent Documents 1 and 2) or monkey corneal endothelial disorder model (Non-patent Document) The method of transplantation is reported in 3), and in both cases, improvement in transparency and corneal thickness has been observed. With these techniques, it is possible to produce a large number of cultured corneal endothelium from one human imported eye bank cornea, which may solve the problem of donor shortage.

  In any of the above reports, the corneal endothelium itself is used as a source of transplant material. However, since it is not realistic to collect corneal endothelial material from a patient who has corneal endothelial injury, a healthy allogeneic cornea (donor cornea) is used when considering clinical application. For this reason, the above-mentioned attempts cannot fundamentally solve the problem of donor shortage and the problem of rejection due to being from other families.

Sumide T. et al. , FASEB J. et al. 2006 Feb; 20 (2): 392-4. (Epub: 2005, Dec. 9). Mimura T. et al. Curr Eye Res. 2007 Jul-Aug; 32 (7-8): 617-23. Koizumi N. et al. et al. , Invest Ophthalmol Vis Sci. 2007 Oct; 48 (10): 4519-26.

  The number of patients targeted for corneal transplantation is estimated to be 1 million worldwide and tens of thousands in Japan, of which about 80% are bullous keratopathy patients caused by corneal endothelium damage. As described above, since the corneal endothelium cannot self-renew, transplantation is required for the treatment of corneal endothelium damage. However, the current full-thickness corneal transplantation has serious donor shortage problems and rejection problems. Furthermore, since various attempts made so far to solve these problems use the corneal endothelium as a source of transplant material, it is necessary to use a non-family material. Thus, these attempts cannot solve the problem of donor shortage and rejection.

  The present invention overcomes the above-mentioned donor deficiency and rejection problems by generating autologous cells that can be used for transplantation into corneal endothelial injury patients from a source other than the corneal endothelium, and is used to treat corneal endothelial injury. An object of the present invention is to provide an effective and readily available transplant material.

The present inventors can easily collect tissue stem cells / progenitor cells derived from living body tissues such as iris and skin, and a medium supplemented with transforming growth factor β ₂ (TGF-β ₂ ). It was found for the first time that these cells can be induced to differentiate into corneal endothelial cells by adhesion culture in the present invention, and the present invention has been completed.

Specifically, the present invention has the following features:
(1) A method for producing corneal endothelial cells,
(A) suspended cultured cells derived from mammalian tissues, a step to form a sphere; the cells constituting the and (b) said spheres or the spheres to adhere to the culture substrate, cultured in the presence of TGF-beta ₂ The method comprising the step of inducing differentiation into corneal endothelial cells.

(2) The method according to (1), further comprising the step of confirming that the cells constituting the sphere express a specific marker for tissue stem cells / progenitor cells.
(3) The method according to (1) or (2) above, further comprising the step of confirming that the cells constituting the sphere express a specific marker for neural crest stem cells.

(4) the concentration of TGF-beta ₂ in step (b) is at least 1 ng / mL, the method according to any one of the above (1) to (3).
(5) Any of (1) to (4) above, wherein the mammalian tissue is selected from the group consisting of iris parenchyma, corneal stroma, skin, epidermis, bone marrow, intestinal epithelium, myocardium, vascular endothelium and adipose tissue The method according to one.
(6) The method according to (5) above, wherein the mammalian tissue is iris substance.

  ADVANTAGE OF THE INVENTION According to this invention, it becomes possible to produce | generate the autologous cell which can be used for a transplant to a corneal-endothelial injury patient from sources other than a corneal endothelium, Thereby, the donor shortage and rejection reaction accompanying the treatment of corneal-endothelial injury. The problem can be avoided.

The present invention relates to a method for inducing differentiation of adult tissue-derived cells into corneal endothelial cells.
As shown in the Examples below, the present inventors have found that the TGF-beta ₂ can be specifically induced differentiation into corneal endothelial cells from tissue stem cells / progenitor cells.

In one embodiment, the method of the invention comprises:
(A) suspension-culturing cells derived from mammalian tissue to form spheres; and (b) adhering the spheres or cells constituting the spheres to a culture substrate, and transforming growth factor β ₂ (TGF- Inducing differentiation into corneal endothelial cells by culturing in the presence of β ₂ ).

TGF-beta ₂ is produced by such fibroblasts, but serves to differentiate the embryonic stem cells such as cardiomyocytes are known (Singla DK. Et al., Biochem Biophys Res Commun. 2005,332 (1) : 135-41), it is not known at all to be involved in the differentiation of tissue stem cells / progenitor cells into corneal endothelial cells.

TGF-beta ₂ for use in the method of the present invention, it is desirable to have the amino acid sequences from mammalian cells will be derived. For example, in the case of differentiating the isolated cells from human tissues and corneal endothelial cells, it is desirable to use a human-derived TGF-β _2. TGF-beta ₂ may be those purified from animal tissues, recombinantly raised from such cell culture using a nucleotide sequence encoding, or one which is subsequently purified. Recombinant TGF-beta ₂ having the sequence of human origin, for example, are commercially available from R & D SYSTEMS Inc..

  By using the method of the present invention, a transplant material that can be used for the treatment of corneal endothelial injury can be prepared from autologous tissues other than the corneal endothelium. Thereby, said subject (donor shortage and rejection reaction) accompanying corneal transplantation can be avoided.

  In the present specification, “self-derived” means that a cell or tissue is derived from an individual to be transplanted. By using the autologous transplant material, the problem of rejection associated with transplantation treatment can be avoided. The use of autologous transplant material is also advantageous in that it prevents infection by exogenous pathogens.

  In the present invention, “sphere” has a meaning usually used in the art. The term refers to a suspended cell mass formed by cells cultured in a suitable medium on a non-adhesive culture substrate, such as a plastic culture vessel that is typically not coated for cell adhesion. Means.

  Cells that form spheres by sphere culture methods such as those exemplified below are known to have characteristics of tissue stem cells / progenitor cells such as neural stem cells.

  Methods for forming spheres from tissue-derived cells are well known in the art (eg, Yoshida et al., STEM CELLS, 2006, 24: 2714-2722; Wong et al., J. Cell Biol., 2006). 175 (6): 1005-1015, etc.). Specifically, for example, the collected animal tissue is treated with trypsin or collagenase to obtain a single cell suspension, and the obtained cells are treated with epidermal growth factor (EGF), basic fibroblast growth factor. Culture in Dulbecco's Modified Eagle Medium (DMEM) / F12 medium supplemented with (bFGF) and N2 supplement in an uncoated plastic dish for 5-14 days.

  In step (b) of the method of the present invention, cells are cultured on a culture substrate coated with heparan sulfate, dermatan sulfate, type I collagen, type III collagen, type IV collagen, type V collagen, laminin or the like. The cells are allowed to adhere to the substrate.

  In the present invention, the medium used for cell culture is not particularly limited as long as the target cell (tissue stem cell / progenitor cell or corneal endothelial cell) can grow normally, but the corneal endothelial cell finally produced is not limited. When the is used for transplantation in humans, it is desirable that the medium components have a clear origin or components that have been approved for use as pharmaceuticals.

Conditions such as temperature and CO ₂ concentration for cell culture are appropriately set according to the properties of the cells used, but generally 4 to 6% CO ₂ , 33 to 37 ° C., particularly about 5% CO ₂ and 37 ° C. And

  In this specification, the term “tissue stem cell / progenitor cell” is used in comparison with an embryonic stem cell (ES cell) having totipotency, and means an undifferentiated cell that specifically exists in any tissue. To do.

  In the process of embryonic development in mammals including humans, some cells of the neural tube formed from the ectoderm form a collection of cells called neural crest (neural crest). The cells contained in this neural crest will in the future form peripheral nerve neurons and glial cells and many connective tissues of the head. Recently, experiments using recombinant mice revealed that corneal endothelial cells were derived from neural crest (Gage et al., Invest. Ophthalmol. Vis. Sci., 2005, 46: 4200-4208). On the other hand, it has been reported that the neural crest is also a source of undifferentiated cells called mesenchymal stem cells (Takashima Y. et al., Cell. 2007, 129 (7): 1377-88).

  At present, in the technical field to which the present invention belongs, there are undifferentiated cells (neural crest stem cells) having properties of neural crest-derived cells and undifferentiated cells (mesenchymal stem cells) that can differentiate into mesenchymal tissues in adult tissues. It is generally recognized that In the present specification, neural crest stem cells or mesenchymal stem cells are included in the tissue stem cells / progenitor cells described above. Tissue stem cells / progenitor cells are known to be present in systemic tissues. For example, cells having the properties of neural crest stem cells or mesenchymal stem cells described above are iris stroma, corneal stroma, skin, epidermis, bone marrow, It has been shown to be present in numerous tissues such as intestinal epithelium, myocardium, vascular endothelium and adipose tissue (Yoshida S. et al., Stem Cells 2006, 24 (12): 2714-2722; Wong CE. et al., J. Cell Biol., 2006, 75 (6): 1005-1015; Fuchs E. et al., Cell, 2004, 116: 769-778; Splatling A. et al., Nature, 2001: 414. : 98-104; Tomita Y. et al., J. Cell Biol., 200 5, 170 (7): 1135-46; Ishikawa M. et al., Stem Cells Dev., 2004, 13 (4): 344-9; Boquest AC. Et al., Methods Mol Biol., 2006, 325: 35-46).

  Therefore, the method of the present invention can be performed using any of these tissues including tissue stem / progenitor cells, including neural crest stem cells or mesenchymal stem cells.

  In one embodiment of the method of the present invention, the mammalian tissue is selected from the group consisting of iris parenchyma, corneal stroma, skin, epidermis, bone marrow, intestinal epithelium, myocardium, vascular endothelium and adipose tissue. Preferably, the mammalian tissue is iris parenchyma.

  Each of the above tissues can be collected from a patient suffering from corneal endothelial injury, unlike the corneal endothelial tissue itself used in the prior art. Therefore, by using the method of the present invention, corneal endothelial cells for use in transplantation to corneal endothelial injury patients can be obtained from autologous tissue.

  In a preferred embodiment, the method of the present invention further includes the step of confirming that the cells constituting the sphere express a specific marker of tissue stem cells / progenitor cells and / or neural crest stem cells. Specific markers for tissue stem / progenitor cells are known in the art, and include, for example, ABCG2, Nestin and the like. Specific markers of neural crest stem cells are also known in the art, and include, for example, Sox2, Musashi1, Wnt1, Twist, Snail, Sox9 and the like. It is desirable to confirm the expression of a plurality of these markers, most preferably the expression of a combination of ABCG2 and Nestin, or Sox2 and Musashi1.

  The expression of these marker genes can be detected using a known technique such as immunostaining or Western blot using a specific antibody, or RT-PCR. Specific antibodies used for immunostaining and Western blotting include anti-ABCG2 antibody (manufactured by KAMIYA BIOMEDICAL COMPANY), anti-Sox2 antibody (manufactured by SANTA CRUZ BIOTECHNOLOGY), anti-Nestin antibody (manufactured by SANTA CRUZ BIOTECHNOLOGY anti-antibody) Commercially available products such as (NEUROMICS ANTIBODIES) can be used. The cDNA base sequences of these marker genes are known (for example, human ABCG2: GenBank accession number NM_004827; human Sox2: GenBank accession number: NM_003106). Therefore, specific primers can be designed with reference to these known base sequences and used in RT-PCR.

  For methods for analyzing gene expression, see Sambrook J. et al. et al. , 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, F .; M.M. et al. 1995, Current Protocols in Molecular Biology, John Wiley & Sons, New York, N .; Y. Shevach E .; M.M. and Strober W. , 1992, Current Protocols in Immunology, John Wiley & Sons, New York, NY, and the like.

  In a preferred embodiment, in addition to expression of a specific marker, cell proliferation ability is confirmed by a BrdU assay or the like. The method of BrdU assay is known, and specifically, for example, 5'-Bromo-2'-deoxyuridine Labeling & Detection Kit I (Roche) is used according to the manufacturer's instructions.

In a further embodiment of the method of the present invention, the concentration of TGF-beta ₂ of at least 0.2 ng / mL, at step (b) is preferably at least 1 ng / mL. The concentration of TGF-beta ₂ can, 0.2~400ng / mL, preferably 1~200ng / mL, more preferably be in the range of 5-100 ng / mL. Below this range, cell differentiation does not occur sufficiently. At concentrations exceeding this range, cytotoxicity can occur.

  In the present invention, the corneal endothelial cell means a cell having the same characteristics as a cell located in the innermost layer of the cornea of a living eyeball. Such characteristics can be confirmed, for example, by specific gene expression. Examples of genes specifically expressed in corneal endothelial cells include type VIII collagen and N-cadherin. Although it is preferable to confirm the expression of both of these, only the expression of type VIII collagen may be confirmed. The cDNA base sequences of these genes are known (for example, human type VIII collagen α1 (COL8A1): GenBank accession number NM_001850; human N-cadherin: GenBank accession number NM_001792). Methods for confirming specific gene expression are well known in the art as described above.

  Moreover, the corneal endothelial cell in the present invention is characterized by showing a cobblestone-like arrangement as an aggregate and forming a tight junction between the cells, like an in vivo corneal endothelial cell.

The present invention also relates to corneal endothelial cells produced by the method of the present invention.
Methods for preparing transplant materials that can be used to treat corneal endothelial disorders from corneal endothelial cells are well known (Sumide et al., Supra; Mimura et al., Supra; Koizumi et al., Supra). For example, corneal endothelial cells are isolated from a research imported eye bank cornea or animal cornea and cultured in a culture medium containing FBS, FGF2 or the like on a type I collagen sheet or a temperature-responsive culture dish. Endothelial cell sheets can be produced.

  Therefore, the present invention also relates to a transplant material such as a corneal endothelial cell sheet prepared from corneal endothelial cells obtained by the method of the present invention.

Furthermore, the present invention also includes a kit for generating corneal endothelial cells from cells derived from mammalian tissue. Such a kit at least comprising a TGF-beta ₂ and instructions for use.

  EXAMPLES The present invention will be specifically described below with reference to examples, but the present invention is not limited to these specific embodiments.

Isolation of tissue stem / progenitor cells Iris tissue was collected from rabbit or mouse eyeballs, and the iris epithelium was mechanically detached. The iris parenchyma was shredded with scissors and incubated in DMEM containing 0.1% collagenase at 37 ° C. for 25-45 minutes to confirm that the tissue pieces had dissolved. The resulting cell suspension is centrifuged (1,500 rpm, 5 minutes), the pellet is resuspended in DMEM, and filtered through a nylon mesh (Becton, Dickinson and Company, mesh size: 40 μm). Fragments were removed.

After centrifugation again (1,500 rpm, 5 minutes), the suspension is suspended in sphere culture medium (20 ng / mL bFGF, 20 ng / mL EGF, 1 × N2 supplement in DMEM / F12) at 1 × 10 ⁵ cells / mL. Then, floating culture was performed at 37 ° C. with 5% CO ₂ on a non-adhesive culture dish, and the medium was changed every 3 days. 7 to 10 days after cell seeding, it was confirmed that ball-shaped spheres were formed (primary sphere; FIG. 1a).

Furthermore, the spheres were separated by treatment with 0.25% trypsin / EDTA, suspended again in the sphere culture medium at 1 × 10 ⁵ cells / mL, and 5% CO ₂ at 37 ° C. on a non-adhesive culture dish. The suspension culture was performed, and the medium was changed every 3 days. Secondary spheres were formed by culturing for 7 to 10 days (secondary spheres; FIG. 1b). This suggests that the cells contained in the sphere have a self-replicating ability.

  Moreover, the above-mentioned using a genetically modified mouse (P0-Cre-EGFP mouse; Kanakubo S. et al., Genes Cells, 2006, 11: 8, 919-33) that specifically expresses GFP in neural crest-derived cells. When the spheres were prepared in the same manner as above, the iris parenchyma-derived spheres were GFP-positive, indicating that they were derived from the neural crest (FIGS. 1c and d).

  Next, the proliferation ability of the spheres was examined by BrdU assay as follows. 5'-Bromo-2'-deoxyuridine Labeling & Detection Kit I (Roche) was used. As a method, BrdU was added to the culture medium (10 μM), and the spheres were collected after incubation at 37 ° C. for 1 hour. Fresh frozen sections of spheres were prepared and immunostained with anti-BrdU antibody. The result is shown in FIG. It was shown that there are proliferating cells that take up BrdU in the sphere (FIG. 2a).

  Next, sphere undifferentiation was examined by immunostaining. For immunostaining, fresh frozen sections of spheres were prepared, and the sections were incubated with commercially available specific antibodies (anti-ABCG2: BXP-21, KAMIYA BIOMEDIC COMPANY; anti-Sox2: Y-17, SANTA CRUZ BIOTECHNOLOGY) Anti-βIII-tubulin: TUJ-1, manufactured by R & D SYSTEMS; anti-Nestin: Rat-401, SANTA CRUZ BIOTECHNOLOGY; anti-Musashi1: NEUROMICS ANTIBODIES) and labeled secondary antibody (respectively ALEXA-568 labeled) IgG, ALEXA-568 labeled anti-goat IgG, ALEXA-488 labeled anti-mouse IgG, ALEXA-568 labeled anti-rat IgG, ALEXA-594 labeled anti-rabbit IgG; performed by incubating MOLECULAR PROBES Co.) and, then observed under a fluorescence microscope. In each staining, nuclear staining was performed using HOECHST33342.

  In the rabbit iris parenchyma sphere, cells expressing stem cell markers ABCG2 and Sox2 were present, respectively (FIGS. 2b and c). Furthermore, when the iris parenchyma sphere was adherently cultured in a nerve induction medium (1 × N2 supplement in DMEM / F12) for about 7 days, cells expressing the neuronal marker βIII-tubulin were found. It was also shown that there are undifferentiated cells that can differentiate into nerves (FIG. 2d). Similarly, expression of stem cell markers Nestin, Musashi1 and Sox2 was also observed in mouse iris parenchymal spheres (FIGS. 2e-g).

From the above results , it was confirmed that the cells constituting the sphere formed from iris parenchymal tissue were tissue stem cells / progenitor cells having the properties of neural crest stem cells.

Induction of differentiation into corneal endothelial cells The spheres formed from rabbit iris parenchymal cells as described above were added to corneal endothelium-inducing medium (1-50 ng / mL TGF-β ₂ , 1 × N2 supplement in DMEM / F12). Then, adhesion culture was performed. TGF-beta ₂ has a sequence derived from the human TGF-beta _2, which is recombinantly produced, using the commercially available (R & D Ltd. SYSTEMS Inc.). Specifically, the spheres are removed from the sphere culture medium by centrifugation (500 rpm, 1 minute), added to the corneal endothelium induction medium at about 10 spheres / mL, and seeded on a plastic culture dish coated with type I collagen. Incubated for 9 days at 37 ° C., 5% CO ₂ (FIGS. 3a-c). After differentiation induction, cells migrated and proliferated from the periphery of the sphere, and polygonal paving stones characteristic of corneal endothelial cells appeared (FIGS. 3b and 3c).

  In order to verify the barrier function, which is one of corneal endothelial functions, immunostaining was performed for ZO-1, which is a tight junction protein (anti-ZO-1 antibody: 1A12, manufactured by ZYMED). The result is shown in FIG. It can be seen that ZO-1 is expressed between cells. This indicates that tight junctions are formed between the cells of the cobblestone-like cell layer formed from the iris parenchymal sphere, and thus can have a barrier function that is a main function of the corneal endothelium.

Cells after differentiation induction were collected, and marker expression was examined by quantitative RT-PCR. As a negative control, except that no addition of TGF-beta ₂ using cells cultured in the same manner as described above, was used as a positive control and corneal endothelial cells prepared from rabbit corneal endothelial tissue.

For type VIII collagen, N-cadherin and VE-cadherin, real-time RT-PCR was performed using the following primers. GAPDH was used as an internal standard.
Type VIII collagen Forward: GGCGCCTACTATGGGATCAAG (SEQ ID NO: 1)
Reverse: GGGCTGGTATTTGTGGAATTTGTG (SEQ ID NO: 2)
N-cadherin Forward: CCTACATATGGCCCTTCCAACACA (SEQ ID NO: 3)
Reverse: GGGACTTCGCCATAATAGTCATG (SEQ ID NO: 4)
VE-cadherin Forward: GCAGCACTTCTCACTACTTCCT (SEQ ID NO: 5)
Reverse: GGGATCCGAGGCCAGTAC (SEQ ID NO: 6)
GAPDH
Forward: CGGTGCACGCCCATCAC (SEQ ID NO: 7)
Reverse: CCGTCACGCCACAGCTT (SEQ ID NO: 8)
PCR conditions are as follows: 50 ° C., 2 minutes; 95 ° C., 10 minutes; 95 ° C., 15 seconds, 60 ° C., 60 seconds (45 cycles).

  The results are shown in FIGS. Expression of corneal endothelium-specific markers VIII collagen and N-cadherin was detected, whereas vascular endothelial marker VE-cadherin was not expressed (FIGS. 4a-c).

  Here, type VIII collagen shows about 90-fold higher expression in corneal endothelial cells compared to corneal epithelial cells collected from living tissue in quantitative RT-PCR (FIG. 5). Thus, type VIII collagen is a specific marker for corneal endothelial cells.

In addition, the expression of Na ⁺ / K ⁺ ATPase was examined by RT-PCR and electrophoresis. The following primers were used. GAPDH was used as an internal standard.
Na ⁺ / K ⁺ ATPase Forward: GAGTGGAAGGAGTTCGTTGGA (SEQ ID NO: 9)
Reverse: TTGAGTTTCTGGACGTGCTGG (SEQ ID NO: 10)
GAPDH
Forward: GTGCCGAGTACGTGGTGGAATC (SEQ ID NO: 11)
Reverse: CCCTCGGATGCCCTCTTCA (SEQ ID NO: 12)

  PCR conditions are as follows: 94 ° C., 5 minutes; 94 ° C., 30 seconds, 60 ° C., 30 seconds, 72 ° C., 30 seconds (30 cycles); 72 ° C., 7 minutes.

The result is shown in FIG. Expression of Na ⁺ / K ⁺ ATPase, which is an index of pump function, was observed (FIG. 4d).

From the results above results, tissue stem cells / progenitor cells derived from iris real by performing a differentiation-inducing medium containing the TGF-beta _2, it has been shown to be capable of differentiating into the corneal endothelial cells. As described above, a corneal endothelial cell sheet for treatment of corneal endothelial injury can be produced from corneal endothelial cells by culturing under appropriate conditions. Therefore, this result clearly shows that it is possible to produce a transplant material that can be used to treat corneal endothelial injury from iris parenchyma.

  As mentioned above, tissue stem / progenitor cells including neural crest stem cells have been shown to be present in many tissues such as corneal stroma, skin, epidermis, bone marrow, intestinal epithelium, myocardium, vascular endothelium and adipose tissue (Yoshida S. et al., Supra; Wong CE et al., Supra; Fuchs E. et al., Supra; Splatling A. et al., Supra; Tomita Y. et al., Supra. Ishikawa M. et al., Supra; Boquest AC. Et al., Supra). Tissue stem cells / progenitor cells derived from these tissues can be differentiated into corneal endothelial cells in the same manner as the above-mentioned iris parenchymal cells, and therefore should be used as a source of transplant material for the treatment of corneal endothelial injury. Can do.

Using the same method as differentiation inducing TGF-beta ₂ specific effect Example 2 in the differentiation induction of corneal endothelial cells, Wnt3a (100ng / mL; R & D Ltd. SYSTEMS _{Inc.), TGF-β 2 (30ng} / mL R & D SYSTEMS) and BMP2 (20 ng / mL; R & D SYSTEMS) were examined for their ability to induce differentiation into corneal endothelial cells. These three types of factors are all known to be involved in cell differentiation.

Respectively (Wnt3a: w, TGF-β ₂ : t, BMP2: b) and Wnt3a and TGF-β ₂ were added simultaneously (w + t), Wnt3a was added for 3 days, and TGF-β ₂ was further added (w → t), Wnt3a, and the TGF-β ₂ and BMP2 were simultaneously added (w + t + b). For each cell sample, mRNA was extracted from the cells 9 days after the start of culture, and expression of type VIII collagen was examined.

The results are shown in FIG. In TGF-beta ₂ indicated by "t", it is observed induction of significantly higher VIII collagen expression alone added. On the other hand, when Wnt3a indicated by “w” alone or BMP2 indicated by “b” alone was added, expression induction of type VIII collagen was not observed. However, the addition of Wnt3a and / or BMP2 simultaneously with TGF-beta _2, it was possible to induce type VIII collagen expression. This is, TGF-beta ₂ have shown that the tissue stem cells / progenitor cells may specifically induced differentiation into corneal endothelial cells.

  Corneal endothelial cells produced by the method of the present invention are suitable transplant materials for the treatment of corneal transplant patients, and are useful in regenerative medicine.

It is a photograph showing the tissue stem cell / progenitor cell sphere derived from iris parenchyma. a and b are phase contrast microscopic images of spheres obtained from wild-type mice (a: primary sphere, b: secondary sphere). c and d are phase contrast microscopic images (c) and fluorescent microscopic images (d) of spheres obtained from P0-Cre-EGFP mice. It is the photograph showing the characteristic of a rabbit iris parenchymal origin sphere. a: BrdU assay, b: ABCG2 immunostained image, c: Sox2 immunostained image, d: βIII-tubulin immunostained image after adhesion culture in nerve induction medium. It is the photograph showing the characteristic of a mouse iris parenchymal origin sphere. e: Nestin immunostained image, f: Musashi1 immunostained image, g: Sox2 immunostained image. It is a photograph showing the differentiation induction to the corneal endothelial cell from an iris parenchymal origin sphere. a to c: Phase contrast microscopic images (a: 3 days after differentiation induction, b: 6 days after differentiation induction, c: 9 days after differentiation induction), d: ZO-1 immunostained image. It is a figure showing the gene expression analysis of the corneal endothelial cell obtained by the differentiation induction from an iris parenchymal origin sphere. a: Type VIII collagen, b: N-cadherin, c: VE-cadherin, d: Na ⁺ / K ⁺ ATPase. The data of a to c are expressed as a ratio with the amplification amount obtained for GAPDH. It is a graph showing that type VIII collagen is a specific marker of corneal endothelial cells. In quantitative RT-PCR, type VIII collagen is 90 times more in corneal endothelial tissue-derived cells ("vivo") compared to corneal epithelium ("corneal epithelium (vivo)"), cultured corneal endothelium ("vivo"). 125-fold higher mRNA expression was found in the “corneal endothelium”. TGF-beta ₂ is a graph showing that specifically induce differentiation into corneal endothelial cells from tissue stem cells / progenitor cells.

Sequence number 1-12: Primer

Claims (4)

A method for producing corneal endothelial cells, comprising:
(A) suspension culturing cells derived from mammalian iris parenchyma and forming spheres; and (b) adhering the spheres or cells constituting the spheres to a culture substrate coated with type I collagen. by culturing in the presence of TGF-beta _2, thereby inducing differentiation into corneal endothelial cells, the method described above.   The method according to claim 1, further comprising the step of confirming that the cells constituting the sphere express a specific marker of tissue stem / progenitor cells.   The method according to claim 1, further comprising the step of confirming that the cells constituting the sphere express a specific marker for neural crest stem cells. At least 1 ng / mL concentration of TGF-beta ₂ in step (b), the method according to any one of claims 1 to 3.

Images