JP5258213B2 - Cell mass that can form primitive organs composed of multiple cell types derived from somatic - Google Patents

Description

  The present invention relates to a method for producing a cell mass capable of forming a primitive organ like a plurality of cell types derived from somatic properties, and a cell mass produced by the method.

  Due to remarkable advances in medicine in recent years, opportunities for saving human lives are increasing more and more by removing the cause of diseases, for example, symptomatic treatment techniques such as surgical excision of cancer, or tissue / organ transplantation techniques. However, with excision of the affected area, the patient may suffer from a significant decrease in QOL after treatment. In addition, there are limits to treatments that rely on living transplantation, such as a lack of transplant donors and rejection. If it becomes possible to regenerate tissues, organs, organs, etc. lost due to surgical treatment or accidents, the QOL of the patient can be greatly improved. Regenerative medicine can also solve the problems of living transplantation. In that respect, expectations for regenerative medicine are high.

  Technologies that have been successful in regenerative medicine are centered on relatively simple tissues, mainly in terms of morphology and function, such as artificial skin, artificial bone, and artificial teeth. The reconstructed artificial skin or bone may be taken up by cells and provide signals necessary for tissue construction. However, the repertoire of the differentiation of artificial skin and artificial bone by regenerative medical technology has been limited. For example, allogeneic keratinocytes and dermal fibroblasts differentiate into structures as the epidermis and may be incorporated into surrounding organs, resulting in having a stratum corneum or basement membrane with barrier properties. It was not supposed to derive secondary inducers such as fat glands and sweat glands.

  Biological tissues usually self-replicate, send signals to differentiated cells, and supply differentiated cells to maintain the homeostasis of tissues, and various signals from such cells. Cells that have undergone differentiation or are already in a differentiated state and co-exist with cells that have somatic properties. For example, in the case of vertebrates, the interaction between mesenchymal cells and epithelial cells is essential in most tissue / organ formation. In the case of hair follicles, dermal papilla cells, which are mesenchymal cells, have stem cell properties, and cells that have somatic properties in the sense that keratinocytes, which are epithelial cells, differentiate into hair shafts (hair itself) It corresponds to.

  The difficulty in organ formation by regenerative medicine lies in achieving a coexistence state between cells having stem cell properties that remain in an undifferentiated state and cells that have undergone differentiation, as in an actual living tissue. In the prior art, even if the epithelial cells and the mesenchymal cells are co-cultured, they either differentiate together or both remain undifferentiated. The coexistence of differentiated and differentiated cells has not been reproduced.

None None

  An object of the present invention is to provide a cell mass capable of forming a primitive organ-like by combining and culturing a plurality of types of differentiated somatic cells.

This application includes the following inventions.
(1) A method for producing a cell mass capable of forming a primitive organ-like structure composed of a plurality of somatic cell types derived from somatic,
Preparing a culture solution containing the plural types of somatic cells,
After mixing the plural types of somatic cell cultures, a Wnt signal activator is added to the mixed cell cultures,
Entrusting the culture solution containing the Wnt signal activator to non-planar contact culture over a predetermined period of time,
Replacing the culture medium of the non-planar contact culture with a Wnt signal activator-free medium, and further culturing for a predetermined period;
Wherein at least one of the plurality of somatic cells remains undifferentiated.
(2) The method according to (1), wherein the plurality of types of somatic cells are a combination of epithelial somatic cells and mesenchymal somatic cells, and the mesenchymal somatic cells are maintained in an undifferentiated state.
(3) The method according to (2), wherein the epithelial somatic cells are keratinocytes, and the mesenchymal somatic cells are hair papilla cells.
(4) The method of (3), wherein a hair follicle having a hair follicle induction function is formed from the cell mass.
(5) The method according to any one of (1) to (4), wherein the Wnt signal activator is 6-bromoindirubin-3′-oxime (BIO).
(6) The method according to any one of (1) to (5), wherein the non-planar contact culture method is a hanging drop method.
(7) A cell mass that can form a primitive organ-like structure composed of a plurality of somatic cell types derived from somatic,
Preparing a culture solution containing the plural types of somatic cells,
After mixing the plural types of somatic cell cultures, a Wnt signal activator is added to the mixed cell cultures,
Entrusting the culture solution containing the Wnt signal activator to non-planar contact culture over a predetermined period of time,
Replacing the culture medium of the non-planar contact culture with a Wnt signal activator-free medium, and further culturing for a predetermined period;
A cell mass, wherein at least one of the plurality of somatic cells is maintained in an undifferentiated state.
(8) The cell mass according to (7), wherein the plurality of types of somatic cells are a combination of epithelial somatic cells and mesenchymal somatic cells, and the mesenchymal somatic cells are maintained in an undifferentiated state.
(9) The cell mass according to (8), wherein the epithelial somatic cells are keratinocytes, and the mesenchymal somatic cells are hair papilla cells.
(10) The cell mass according to (9), wherein a hair follicle having a hair follicle induction function is formed from the cell mass.
(11) The cell mass according to any one of (7) to (10), wherein the Wnt signal activator is 6-bromoindirubin-3′-oxime (BIO).
(12) The cell mass according to any one of (7) to (11), wherein the non-planar contact culture method is a hanging drop method.
(13) A method for screening a drug having a hair-growth effect by applying a candidate drug to the cell mass of any one of (9) to (12).
(14) The method according to (13), wherein the expression level of one or more genes selected from the group consisting of c-myc, BMP4, and IGFBP3 of the cell mass is used as an index.

  According to the present invention, it is possible to provide a cell mass capable of forming a primitive organ-like structure composed of a plurality of types of somatic cell types.

  The somatic cell as used in the present invention refers to a cell that has been differentiated into cells that constitute various organs of a living body, and refers to a cell that is opposite to an undifferentiated stem cell. In the present invention, two or more somatic cells are used, preferably a combination of an epithelial cell line and a mesenchymal cell, a combination of an endothelial cell and a mesenchymal cell, or an epithelial line It may be various, such as a combination of cells, mesenchymal cells and endothelial cells.

  The organ that can be formed by the cell mass according to the present invention is not particularly limited. For example, hair follicle, lung, kidney, liver, pancreas, spleen, heart, gallbladder, small intestine, colon, large intestine, joint, bone Various organs such as teeth, blood vessels, lymphatic vessels, cornea, cartilage, olfactory organ, auditory organ, and the like.

  For example, when hair follicles are desired to be formed, for example, keratinized epidermal cells derived from the head may be used as epithelial cell lines, and hair papilla cells may be used as mesenchymal cells. The term “epithelial cell” as used herein refers to a cell that constitutes the most part of the epidermis or epithelium of the skin and that originates from a single layer of basal cells in contact with the dermis. As epithelial cells, epithelial cells derived from neonates (or fetuses), mature skin, for example cells derived from the epidermis of resting hair or epidermis of growing hair, a culture of cells in the form of keratinocytes It may be. Such cells can be prepared from the skin of the desired donor animal by methods well known to those skilled in the art. “Papilla cells” are cells located at the bottom of the hair follicle as mesenchymal cells and send activation signals to the hair follicle epithelial stem cells for the self-renewal of hair follicles. Say. The “follicle papilla cells” are prepared by, for example, treating a dermal tissue fraction obtained by removing epidermal tissue from skin tissue to prepare a cell suspension, and then cryopreserving the cell suspension. It can be prepared by killing epithelial cells.

For example, the reconstruction of the olfactory organ can be prepared as follows. An existing tissue site of a group of olfactory epithelial cells of a mammal such as a mouse is taken out. The tissue is digested by collagenase treatment, centrifuged, and precipitated cells are prepared. Subsequently, the cell suspension is put into a cell culture dish coated with collagen 1 or 4, and the suspension is quickly sucked out in about 5 minutes in order to preferentially adhere olfactory epithelial cells excellent in adhesiveness. The epithelial cells remaining in the dish can be transferred to cell culture. Further, most of the remaining cells become epithelial cells. Although the mesenchymal cells are present in the remaining suspension, the suspension is placed in a culture dish coated with fibronectin or gelatin for 4 hours or longer in an appropriate atmosphere such as 37 ° C. and 95% CO _2. By allowing it to stand under, mesenchymal cells can be subjected to cell culture. The epithelial and mesenchymal cells prepared as described above can be used for the construction of a new olfactory organ by the same method as the reconstruction of the hair follicle organ.

  Furthermore, for example, for the reconstruction of kidney glomeruli, preparation can be performed as follows. The existing tissue site of the kidney of a mammal such as a mouse is removed. The tissue is digested by collagenase treatment and centrifuged, and coarse particles are removed with a 100 um mesh. Subsequently, glomeruli are collected on a 40 um mesh and made into a cell suspension by trypsin treatment. A cell suspension is put into a cell culture dish coated with collagen 1 or 4, and epithelial cells are preferentially adhered. By this treatment, most of the cells become epithelial cells derived from glomeruli.

  On the other hand, in the case of the kidney, mesenchymal cells that existed at the time of development are dead in the living body. Therefore, in the present invention, the following method can be employed to induce the epithelial-mesenchymal interaction required for tissue reconstruction again. The above-mentioned kidney-derived cells are used as epithelial cells. Furthermore, as a replacement for the lost mesenchymal cells, the genus hair papilla cells or bone marrow derived mesenchymal stem cells are used. The epithelial and mesenchymal cells as described above can be used for the construction of a new kidney organ by the same method as the reconstruction of the hair follicle organ.

  The origin of the cells according to the present invention may originate from various mammals depending on the purpose, and is not limited to humans, chimpanzees, other primates, livestock animals such as dogs, cats, livestock animals such as cows and pigs. , Horses, sheep, goats, laboratory animals such as rabbits, rats, mice, guinea pigs, more preferably nude mice, SCID mice, nude rats and the like. The combination may be the same type or a different type, but the same type is preferred.

The culture medium effective for culturing somatic cells according to the present invention is not particularly limited, and those conventionally used in cell culture can be used. For example, for mesenchymal cells, preferably a serum-containing medium such as DMEM, MEM, F12, or Chang medium can be used. In this case, the serum concentration is 0-30%, preferably 10%, and bFGF (basic fibroblast growth factor) and EGF (epidermal growth factor), 2 mM L-glutamine are added as indispensable factors.
In the case of epithelial cells, media optimized for serum-free keratinocytes, such as Epilife (registered trademark), HuMedia (registered trademark) (both from Kurabo Industries) and Invitrogen SFM (Invitrogen) are preferred. Keratinocytes are sometimes prepared by the Green method (Cell 1975 NOV; 6 (3): 331-43, Serial cultivation of strain of human epidermal keratinocytes: the formation of keratinizing colonies from single cells. Rheinwalf JG, Green H.) In this case, however, the serum-containing medium used in the mesenchymal system can be used for the culture. Examples of antibiotics that can be commonly used for culturing epithelial cells and mesenchymal cells include penicillin G, kanamycin, streptomycin, and amphotericin B.

The present invention is characterized in that a Wnt signal activator is added to the mixture of the plurality of somatic cells and cultured. The Wnt signal refers to a series of actions that promote the nuclear translocation of β-catenin and exert a function as a transcription factor. This signal is caused by cell-cell interaction. For example, a protein called Wnt3A secreted from one cell acts on another cell, and β-catenin in the cell translocates to the nucleus and acts as a transcription factor. Is included. A series of flows causes the first phenomenon of organ construction, exemplified by epithelial-mesenchymal interactions. Wnt signal activates three pathways, β-catenin pathway, PCP pathway, and Ca ²⁺ pathway, thereby controlling various cell functions such as cell proliferation and differentiation, organ formation, and cell movement during early development. known. Although it is used in the culture of ES cells for the purpose of suppressing differentiation due to its undifferentiated state maintaining function of Wnt signal (for example, Noburo Sato et al., Nature Medicine Vol. 10, No. 1, Jan. 2004), nothing is known about its use and effect in somatic cell culture.

The Wnt signal activator is not particularly limited, and any Wnt signal activator may be used as long as it exhibits inhibitory activity for glycogen synthase kinase-3 (GSK-3). For example, a bis-indolo (indirubin) compound ( BIO) ((2′Z, 3′E) -6-bromoindirubin-3′-oxime), its acetoxime analog BIO-acetoxime (2′Z, 3′E) -6-bromoindirubin-3 ′ -Acetoxime), thiadiazolidine (TDZD) analog (4-benzyl-2-methyl-1,2,4-thiadiazolidine-3,5-dione), oxothiadiazolidine-3-thione analog (2 , 4-Dibenzyl-5-oxothiadiazolidine-3-thione), thienyl α-chloromethyl ketone compound (2-chloro-1- (4,4-dibromo-thi Phen-2-yl) -ethanone), phenyl α bromomethyl ketone compound (α-4-dibromoacetophenone), thiazole-containing urea compound (N- (4-methoxybenzyl) -N ′-(5-nitro-1,3) -Thiazol-2-yl) urea) and GSK-3β peptide inhibitors such as H-KEAPPAPPQSpP-NH ₂ .

  The addition amount of the Wnt signal activator is not particularly limited, and may be any amount that activates Wnt signal, in other words, inhibits GSK-3 and does not stop cell growth. Depending on the type of cell and the type of cell to be proliferated, and will be determined by those skilled in the art. For example, when BIO is used as a Wnt signal activator in hair papilla cells, the amount is, for example, about 0.1 μM to 10 μM, but it is not limited to such an amount.

  Another feature of the present invention is that the mixture of a plurality of somatic cells added with a Wnt signal activator is subjected to non-planar contact culture. Non-planar contact culture is a method of culturing cells on an interface having a spherical surface so that planar adherent cells do not adhere. An example of a non-planar contact culture method is the hanging drop method (Keller G. M. et al., Curr. Opin. Cell Biol., 7, 862-869 (1995)). In the hanging drop method, a drop of a culture solution containing cultured cells (generally about 25 to 35 μL) is spotted on the ceiling side of the lid of the culture dish, and the lid is carefully closed so that the culture solution does not fall or flow down. This is a method of culturing cells in a culture solution in an inverted droplet state by tension. By culturing in this way, it is possible to minimize the influence of the cells on contact with the flat surface in the case of flat surface culture. As another example of the non-planar contact culture method, a formation method (spheroid formation) using a hemispherical cell culture dish (for example, “Spheroid” sold by Sumitomo Bakelite) that has been surface-treated so as not to allow cell adhesion in advance. Method), and a floating method in which cells are aggregated in a floating state by culturing in a nitrocellulose medium.

  The temperature and time for non-planar contact culture can vary depending on the type of cells to be handled and the number of passages. For example, the culture is performed at 37 ° C. for 1 to 10 days, preferably 3 to 7 days. Replace the medium with a similar one.

  Finally, the medium is replaced with a culture solution that does not contain a Wnt signal activator to further culture the cells in a non-planar contact manner in the absence of Wnt signal. In this case as well, the culture time and temperature may vary depending on the type of cells to be handled and the number of passages. For example, the culture is performed at 37 ° C. for 1 to 10 days, preferably 3 to 7 days. Replace with something.

  According to the present invention, cells useful for, for example, hair follicle transplantation, organ transplantation, and micro-organs constituting organs that do not reach complete organs, such as cornea, kidney glomerulus, olfactory epithelium, partial cartilage transplantation, etc. It becomes possible to artificially create a lump efficiently. In addition, the artificially prepared cell mass can be used for drug evaluation, so that the drug action on the in vivo organ can be more accurately evaluated. In addition, organ-like tissues with a higher degree of completeness can be created by cell mass transplantation into immunodeficient animals such as nude mice and SCID mice. For example, by creating ectopically human hair follicles, mouse kidneys, etc. It is possible to create a model animal that enables drug evaluation and gene function evaluation. In particular, when creating a cell mass, it is possible to easily create a reconstructed organ with a reporter by introducing or modifying cells, and accurately grasp and investigate in vivo molecular behavior at the tissue and organ level. sell.

  In the cell mass according to the present invention, when the epithelial somatic cells are keratinocytes and the mesenchymal somatic cells are hair papilla cells, and a hair follicle having a hair follicle inducing function is formed, the cell mass has a hair-growing effect. It can be used for evaluation of the indicated drugs, for example for screening such drugs. For example, when a candidate drug for hair growth drug is applied to this cell mass and the growth of the cell mass becomes significant compared to the control, it is determined that the drug has a hair growth effect or a gene that promotes hair growth, for example, The presence or absence of a hair-growth effect can be determined using the increase in the expression of c-myc as an index or the suppression of the expression of genes that suppress hair growth, such as BMP4 and IGFBP3 genes, as an index.

Papilla cells Human-derived papilla cells were prepared from scalp tissue provided by a donor. After removing the dermis tissue, the hair follicle site present in the adipose tissue was collected using tweezers and ophthalmic scissors under a stereomicroscope. The collected hair follicles were transferred into a culture solution containing antibiotics, and the hair papilla cell site was visually separated and collected under the same microscope. The separated dermal papilla cells were cultured in a 10 cm round dish (manufactured by TRP) in a medium at 37 ° C. under 95% CO _{2 for} 1 week or longer and used for the subsequent experiment. The medium used was Advanced-DMEM (Invitrogen), 15% fetal bovine serum, 20 ng / ml bFGF, 10 ng / ml no EGF, 2 mM L-glutamine, penicillin / streptomycin amphotericin mixture (100-fold dilution), 3.5 ul. / 500 ml β-mercaptoethanol. Cells were subcultured as appropriate under the same conditions. At the time of subculture, cell detachment was performed with a 0.5% trypsin / EDTA solution, the cells were transferred to a new dish, and subculture was performed with a fresh medium having the same composition.

  When BIO (Calbiochem) was added, 10 mM was dissolved in DMSO (dimethylsulfoxide) and added so as to be 0.1 to 5 μM.

Keratinocytes Human normal neonatal foreskin-derived keratinocytes were prepared as follows. Foreskin tissue collected from the donor was treated overnight at 4 ° C. in PBS (−) in the presence of dispase enzyme. By this treatment, only the epidermis was collected in a sheet form, which was digested and prepared with 0.25% trypsin enzyme in the same manner as at the time of subculture, transferred to the collagen-treated culture dish, and cultured. Humedia KG2 (Kurabo) was used as the medium. Cells were subcultured as appropriate under the same conditions. At the time of subculture, cell detachment was performed with a 0.5% trypsin / EDTA solution, the cells were transferred to a new dish, and subculture was performed with a fresh medium having the same composition. The cells collected and cultured as described above were subjected to subsequent experiments.

  When BIO (Calbiochem) was added, 10 mM was dissolved in DMSO (dimethylsulfoxide) and added so as to be 0.1 to 5 μM.

Hanging drop culture medium configuration Advanced-DMEM (Invitrogen) 30%, 2 mM L-glutamine, penicillin / streptomycin mixture (Invitrogen) (100-fold dilution) 3.5 μl / 500 ml β-mercaptoethanol and Humdia KG-2 (Kurabo) Were mixed 1: 1.
When Bio (Calbiochem) was added, 10 mM was dissolved in DMSO (dimethylsulfoxide) and added so as to be 0.1 to 5 μM.

Preparation method Papilla cells were prepared with P3 (passage number 1 is expressed as P1) or more with or without Bio loading, and with epidermal keratinocytes within P3.
The cells were diluted with each medium after trypsin treatment so that the number of cells was 1 × 10 ⁵ .
When Bio (Calbiochem) was added, 10 mM was dissolved in DMSO (dimethylsulfoxide) and added so as to be 0.1 to 5 μM.
Each culture solution of 25 to 35 μl was dispensed and mixed on the 10 cm square square culture dish (lid) ceiling side, and water droplets on the dome of an appropriate size were prepared.
The lid was carefully closed to prevent the culture solution from dropping, and the cells were cultured at 37 ° C. in a 5% CO ₂ atmosphere.
Three days later, the medium was changed using the same medium as used above.
After further culturing for 4 days, a part was subjected to the following RT-PCR analysis (1). For the rest, all media was replaced with media in a Bio-free condition.
The same medium change was performed on the 3rd day, and the cell mass generated on the 7th day was collected and subjected to the following immunostaining.

Immunohistochemical fluorescence staining Each cell mass obtained by the hanging drop method was fixed with 0.1% paraformaldehyde for 5 minutes and subjected to subsequent staining. Some cell sputums were unfixed and embedded in an OCT solution, frozen sections were prepared with a cryostat, and immunohistochemical staining was performed.
Blocking was performed in PBS (−) containing 13% bovine serum albumin (BSA) for 6 hours.
Various primary antibodies shown in the following table were diluted to 1/200 with PBS (−) containing 13% bovine serum albumin (BSA), added to each sample, and reacted at 4 ° C. for 4 hours.
Washed 3 times with PBS (-) containing 0.02% Tween20.
The fluorescent secondary antibody (see EXCEL file) diluted to 1/200 with PBS (-) containing 13% bovine serum albumin (BSA) was added to each sample. The cell nucleus was stained blue with DAPI (4′-6-diamidino-2-phenylindole).
It observed with the fluorescence microscope (OLYMPUS).

Here, since the monoclonal antibody against vimentin specifically stains dermal papilla cells, and the CD49f polyclonal antibody specifically stains epidermal cells, the application of vimentin antibody and CD49f antibody to immune cell staining is applied to this experimental system. This makes it possible to evaluate the attributes of cells within the generated cell mass.

  FIG. 1 is a black-and-white photograph showing the microscopic observation results. In the color version of the figure, staining with vimentin antibody in green and staining with CD49f antibody in red were identified, and it was understood that they were hair papilla cells and keratinocytes, respectively. Further, as shown in FIG. 2, it was confirmed that the hair papilla cells were aggregated in the central part of the cell cage. As a result of these figures, it was observed that the cells were regularly arranged after aggregation, and it was found that the epithelial cells and mesenchymal cells were regularly arranged by this experimental system. After the addition of BIO to produce a cell mass, it was observed that red-stained keratinocytes were regularly grown in branches in the cell mass cultured without BIO addition. Furthermore, FIG. 3 shows that when BIO is added to produce a cell mass, the central part where hair papilla is aggregated and the tip of the cell pod that spreads in a branch shape are positive for the proliferation marker Ki67. I knew that there was. As a result of the above, it was usual that somatic cells that were normally aggregated do not grow and become dormant. However, it can be said that the proliferation of cells in the cell mass due to the effect of BIO is a surprising finding.

  In addition, β-catenin monoclonal antibody was used for marking of stem cell nature. Since β-catenin is present in the vicinity of the cell membrane in a small amount in normal somatic cells, it can be detected only weakly by ordinary fluorescent immunoantibody staining. However, in cells having stem cell properties, β-catenin acts as a transcription factor in the nucleus, and its amount is also increasing. Furthermore, since it is accumulated in the nucleus, it can be confirmed that it is strongly localized even by fluorescent immunoantibody staining. In this experiment as well, it was confirmed that β-catenin was strongly stained and accumulated in a specific part of the cell mass, and thus staining with β-catenin antibody demonstrated stem cell properties in the cell mass. It can be said that it is suitable for the detection of the cell which has.

  FIG. 4 is a black-and-white photograph showing the results of microscopic observation by the β-catenin monoclonal antibody staining. The color version of the figure shows the stained site with β-catenin antibody in green and the keratinocytes in red. A β-catenin positive cell in a site that shines strongly in green was observed, indicating the stem cell nature of the cell. It should be noted that there was a portion where the central portion glowed yellow in the spherical part of the cell mass. This site indicates β-catenin positive and keratinocytes. β-catenin positive cells can be said to be cells having stem cell properties as described above. On the other hand, the keratinocytes (red) that grow in branches from the cell mass do not shine yellow, that is, cells that have stem and normal somatic properties (keratinocytes) coexist in the same cell mass. I can observe that. It is a situation that cannot be observed in a normal culture state, and the epithelial-mesenchymal interaction is reproduced as if in vivo, and undifferentiated and differentiated cell groups autonomously form cell clusters and grow Can be considered.

  The undifferentiated keratinocyte here refers to a cell having a stem cell-like ability that constantly produces keratinocytes that construct hair like hair matrix cells. On the other hand, a differentiated keratinocyte refers to a cell that has a limited number of times of proliferation and has been determined to have a so-called hair fate. At the same time, the cells surrounding the sphere that glows green in the color version of FIG. 4 are considered to be dermal papilla cells. In this cell cluster environment, the fact that the dermal papilla cells are β-catenin positive cells indicates that hair follicle formation and growth start in vivo. This is similar to the importance of the Wnt signal, which is an important point.

  Antibodies against cytokeratin 14 (K14) expressed in epidermal keratinocytes and outer root sheath cells were used for the purpose of confirming that these cells were not differentiated into hair shafts (red). AE13 monoclonal antibody (Lynch et al, J Cell Biol 103, 2593, 1986), which reacts specifically with hair keratin, recognizes 44K / 46K acidic hair keratin dimer, marking the state of differentiation into hair shafts Used for (green). Hair keratin is a hair follicle-specific structural protein that is rarely present in normal epidermal keratinocytes. FIG. 5 is a black and white photograph showing the microscopic observation results. In the color version of the figure, in the cell mass prepared with dermal papilla cells and epidermal keratinocytes, the portion stained with the AE13 antibody is not observed, but when stimulated with BIO, the staining is partially confirmed. In the cell mass prepared with the dermal papilla cells and the outer root sheath cells, the portion stained with the AE13 antibody in the absence of BIO stimulation could be confirmed, and the staining with the AE13 antibody was significantly enhanced by the stimulation of BIO. On the other hand, since no site stained with both K14 antibody (red) and AE13 antibody (green) is observed in all cell masses (a site that glows yellow), hair keratin from undifferentiated cells expressing cytokeratin 14 It is thought that the change to the cell which produces is produced.

  The Ber-EP4 antibody against human epithelial antigen that is specifically expressed in hair stage hair buds (Ogawa et al, Exp Dermatol 13, 401, 2004) was used for marking hair stage hair buds (green color). ). FIG. 6 is a black and white photograph showing the microscopic observation results. In the color version of the figure, the immunostaining (green) with the Ber-EP4 antibody was clearly observed when stimulated with BIO in a cell mass prepared with dermal papilla cells and outer root sheath cells. Since there is no site stained with both K14 antibody (red) and Ber-EP4 antibody (green) (a site that glows yellow), hair that expresses Ber-EP4 from undifferentiated cells that express cytokeratin 14 It is thought that a change to cells that differentiated into buds occurred.

RT-PCR analysis (1)
RNA was extracted from each sample using TRIZOL (Invitrogen). 200 ng of each RNA was reverse transcribed into cDNA in a 50 μl reaction system of RevTraACE (TOYOBO). 1 μl of the obtained sample was subjected to PCR reaction in a 50 μl system using the following primers. The enzyme used was a reaction protocol of KOD-DASH (TOYOBO), [95 ° C., 60 sec, (95 ° C., 30 sec; 63 ° C., 15 sec; 72 ° C., 30 sec), 40 cycles, 72 ° C., 60 sec].
10 μl of the reaction solution was electrophoresed at 100 V in 2% agarose gel (COSMOBIO) / TAE buffer. The DNA size marker used is a 100 bp ladder marker (TOYOBO).
The primers used were as follows, and the PCR results are shown in FIG.

β-actin was used as a control for the entire experiment.
Lef-1 is a downstream gene of Wnt signal, and as shown in FIG. 7, it was detected in this experimental system both in the presence and absence of BIO. When the gene expression of Lef-1 is observed, it means that the Wnt signal is acting on the cell. Therefore, in this experimental system, it can be understood that the Wnt signal is activated into the cell by the addition of BIO.

  SHH (Sonic Hedge Hog) is a gene involved in tissue formation, and as shown in FIG. 7, it was not detected in this experimental system in the presence or absence of BIO. SHH is a gene that is transcribed and expressed in response to Wnt and Lef-1 signals. This gene expression indicates that the Wnt signal acts on the cell and that the gene expression is linked in a manner similar to that occurring in vivo. At the same time, SHH is a protein responsible for intercellular signals between epithelial mesenchyme, suggesting that epithelial-mesenchymal interaction is occurring at the same time.

  STAT-3 (SIGNAL TRANSDUCER AND ACTIVATOR OF TRANSCRIPTION 3) is a hair follicle induction-related gene, and as shown in FIG. 7, it was significantly detected in the presence in the presence of BIO. STAT-3 is an intracellular signaling protein that is said to be involved in stem cell self-proliferation. The enhancement of the gene is an essential factor for self-proliferation and maintenance of universality in embryonic stem cells, and is one of the markers indicating the stem cell properties. At the same time, as in the paper Sano, S. et al., Nature Med. 11: 43-49, 2005 "Stat3 links activated keratinocytes and immunocytes required for development of psoriasis in a novel transgenic mouse model." STAT-3 transcription in this experimental system is a normal step in the later growth into hair follicles because it is a very important gene It is suggested. At the same time, the STAT-3 signal itself is not directly affected by BIO (Sato N, et al, Nat Med. 2004 Jan; 10 (1): 55-63. Epub 2003 Dec 21. "Maintenance of pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a pharmacological GSK-3-specific inhibitor "). That is, the enhancement of STAT-3 when BIO is added indicates that the stem cell maintenance system is born in the cell mass due to epithelial-mesenchymal interaction.

  TWIST-1 is a marker for embryonic mesenchymal stem cells, suggesting that dermal papilla cells have extremely high stem cell properties. Since TWIST-1 expression in somatic cells is limited to extremely rare cell types including myeloid mesenchymal stem cells, dermal papilla cells can be said to have high stem cell properties as somatic cells. In the RT-PCR experiment, RT-PCR is carried out using an equal amount of total RNA as a template. The expression seems to decrease in the presence of BIO because the number of hair papilla cells in the total number of cells is relatively decreased as can be observed from FIGS. In conclusion, the fact that cells expressing the TWIST-1 gene continue to exist, taking into account the amount of expression, means that hair papilla cells that can have stem cell ability continue to exist in this experiment. It suggests.

  The versican gene is a hair growth marker known to be strongly expressed in hair papilla cells during hair growth induction (Kishimoto et al. Proc. Natl. Acad. Sci. USA (1999), pp.7336-7341). In the RT-PCR experiment, RT-PCR is carried out using an equal amount of total RNA as a template. The expression seems to decrease in the presence of BIO because the number of hair papilla cells in the total number of cells is relatively decreased as can be observed from FIGS. In conclusion, the presence of cells that express the versican gene, even after taking into account the amount of expression, indicates that there are hair papilla cells that can induce hair growth in this experiment. Suggests.

  From the change in the expression level of various genes, it can be said that the undifferentiated state of epithelial and mesenchymal cells was maintained by the direct effect of BIO in the cell mass, and that the epithelial-mesenchymal interaction was simulated by the Wnt signal. In addition, since the appearance of stem cell properties unrelated to the Wnt signal such as STAT-3 is observed, the effect of BIO contributes to the creation of cell clusters having autonomous cell-cell interaction and proliferative ability. I can say that.

Wnt3A RT-PCR
The dermal papilla cells were loaded with Bio at P3 (passage number 1 is expressed as P1), and cells within P3 were prepared for keratinocytes.
The cells were diluted with each medium after trypsin treatment so that the number of cells was 3 × 10 ³ .
Bio (Calbiochem) was dissolved in DMSO (dimethylsulfoxide) at 10 mM and added to 0.1 to 5 μM.
Each culture solution of 25 to 35 μl was dispensed and mixed on the 10 cm square square culture dish (lid) ceiling side, and water droplets on the dome of an appropriate size were prepared.
The lid was carefully closed to prevent the culture solution from dropping, and the cells were cultured at 37 ° C. in a 5% CO ₂ atmosphere.
Three days later, the medium was changed using the same medium as used above. On day 7, a sample was collected and subjected to RT-PCR analysis (2) as described below (“0 day” in FIG. 8). Further, for the remaining similar cells, the medium was changed to a medium in the condition without Bio, differentiation was induced, and the sample collected on the third day was similarly subjected to RT-PCR analysis (2) as described below ( “3 days” in FIG.

RT-PCR analysis (2)
RNA was extracted from the sample using TRIZOL (Invitrogen). 200 ng of each RNA was reverse transcribed into cDNA in a 50 μl reaction system of RevTraACE (TOYOBO). 1 μl of the obtained sample was subjected to PCR reaction in a 50 μl system using the following primers. The enzyme used was a reaction protocol of KOD-DASH (TOYOBO), [94 ° C., 2 min, (94 ° C., 30 sec; 63 ° C., 10 sec; 72 ° C., 30 sec), 32 cycles, 72 ° C., 2 min].
Sense Primer (forward chain) caggaactacgtggagatcatg (SEQ ID NO: 13)
Anti-Sense Primer (reverse chain) ccatcccaccaaaactcgatgtc (SEQ ID NO: 14)
10 μl of the reaction solution was electrophoresed at 100 V in 2% agarose gel (COSMOBIO) / TAE buffer. The target band was detected after visualization with ethidium bromide.

  The result is shown in FIG. In the figure, the arrow indicates the Wnt3A band. Wnt3A is rarely expressed per se, is expressed mainly by epithelial cells, and is known to be a gene involved in organogenesis and epithelial cell-mesenchymal cell interactions. As shown in the figure, Wnt3A expression was not observed at all in cells in which Wnt signal was activated by culturing in the presence of BIO, but cell differentiation was induced by removing BIO thereafter. Expression of Wnt3A was observed in the cells. Therefore, in this experimental system, it was clarified that culturing in the presence of BIO and then culturing without BIO induces keratinocyte differentiation and further autonomous organ formation.

Wnt10B RT-PCR
The dermal papilla cells were prepared with P3 (passage number 1 is expressed as P1) without Bio loading, and the outer hair root sheath cells were prepared within P3.
The cells were diluted with each medium after trypsin treatment so that the number of cells was 3 × 10 ³ .
Bio (Calbiochem) was dissolved at 10 mM in DMSO (dimethylsulfoxide) and added to a concentration of 0.1 to 5 μM.
Each culture solution of 25 to 35 μl was dispensed and mixed on the 10 cm square square culture dish (lid) ceiling side, and water droplets on the dome of an appropriate size were prepared.
The lid was carefully closed to prevent the culture solution from dropping, and the cells were cultured at 37 ° C. in a 5% CO ₂ atmosphere.

  Three days later, the medium was changed using the same medium as used above. Seven days later, a sample was collected and subjected to RT-PCR analysis (3) as described below (“7 days” in FIG. 9). Furthermore, with respect to the remaining similar cells, the medium was changed to a medium without Bio to induce differentiation, and samples collected after 10 days and 14 days were similarly subjected to RT-PCR analysis (3) as described below (Fig. 9 “10 days” and “14 days”).

RT-PCR analysis (3)
RNA was extracted from the sample using TRIZOL (Invitrogen). 200 ng of each RNA was reverse transcribed into cDNA in a 50 μl reaction system of RevTraACE (TOYOBO). 4 μl of the obtained sample was subjected to quantitative PCR (LightCycler system, Roche) in a 20 μl system using the following primers. The reaction protocol of LightCycler FastStart DNA Master SYBR Green I (Roche) [95 ° C., 10 sec; 63 ° C., 10 sec; 72 ° C., 15 sec for 40 cycles] was used.
Sense Primer (forward chain) gaagttctctcgggatttcttggatcc (SEQ ID NO: 15)
Anti-Sense Primer (reverse chain) cggttgtgggtatcaatgaagatgg (SEQ ID NO: 16)

  The result is shown in FIG. All data were expressed as relative expression relative to the expression after 3 days when the cell mass was not loaded with BIO. It is known that Wnt10B is a gene that is expressed mainly by epithelial cells during the follicle morphogenesis and hair growth stages and is involved in the interaction between epithelial cells and mesenchymal cells. As shown in the figure, in the cells in which Wnt signal was activated by culturing in the presence of BIO, the expression of Wnt10B is the same as that of the control cultured in the absence of BIO as long as culturing in the presence of BIO. While only a slight degree was observed, Wnt10B expression increased over time in cells in which differentiation of the cells was induced by removing BIO thereafter. Therefore, in this experiment system, differentiation in hair follicle epithelial cells (outer hair root sheath cells) and further autonomous organ formation are induced by culturing in the presence of BIO and then removing BIO. Became clear.

Reactivity of cell mass to hair growth drug cyclosporine A Cyclosporine A, an immunosuppressant, is a drug with known side effects as hirsutism (Lutz et al, Skin Pharmacol 7, 101, 1994). et al, Lab Invest 60, 365, 1989) and hair growth promoting action (Taylor et al, J Invest Dermatol 100, 237, 1993).
The dermal papilla cells were prepared with P3 (passage number 1 is expressed as P1) without Bio loading, and the outer hair root sheath cells were prepared within P3.
The cells were diluted with each medium after trypsin treatment so that the number of cells was 3 × 10 ³ .
Each culture solution of 25 to 35 μl was dispensed and mixed on the 10 cm square square culture dish (lid) ceiling side, and water droplets on the dome of an appropriate size were prepared.
The lid was carefully closed to prevent the culture solution from dropping, and the cells were cultured at 37 ° C. in a 5% CO ₂ atmosphere.

Three days later, the medium was replaced with the same medium as used above containing cyclosporine A. Cyclosporine A (Novartis) was dissolved in ethanol at 10 mM and added to 0.1 to 10 μM.
Samples were collected 3 days after the addition of cyclosporine A and subjected to RT-PCR analysis (4) as described below.

RT-PCR analysis (4)
RNA was extracted from the sample using the RNeasy kit (QIAGEN). Each RNA equivalent to 2000 ng was reverse transcribed into cDNA in a SuperScript II (Invitrogen) 20 μl reaction system. 1 μl of the obtained sample was subjected to quantitative PCR (LightCycler system, Roche) in a 20 μl system using the following primers. The reaction protocol of LightCycler FastStart DNA Master SYBR Green I (Roche) [95 ° C., 10 sec; 58 ° C., 10 sec; 72 ° C., 15 sec for 40 cycles] was used.

BMP4
Sense Primer (forward chain) gggcacctcatcacacgact (SEQ ID NO: 17)
Anti-Sense Primer (reverse chain) ggcccaattcccactccctt (SEQ ID NO: 18)

c-myc
Sense Primer (forward chain) ttctctccgtcctcggattctctg (SEQ ID NO: 19)
Anti-Sense Primer (reverse chain) cagcagaaggtgatccagactctgac (SEQ ID NO: 20)

IGFBP3
Sense Primer (forward chain) acagccagcgctacaaagtt (SEQ ID NO: 21)
Anti-Sense Primer (reverse chain) tagcagtgcacgtcctcctt (SEQ ID NO: 22)

  The result is shown in FIG. All data are expressed as relative expression relative to the absence of cyclosporine A. BMP4 is known to be a gene that is expressed mainly by dermal papilla cells and acts to suppress the epithelial cell-mesenchymal cell interaction during hair follicle morphogenesis and hair growth. (Hens et al, Development 134,1221, 2007). As shown in the figure, the expression level of BMP4 was significantly reduced to about 60%. In addition, c-myc is known to be a gene that is strongly expressed in the hair growth bulge region and the growing hair matrix cells and works positively on the proliferation of hair follicle epithelial cells (Bull JJ et al.). al, Invest Dermatol 116, 617, 2001). As shown in the figure, the expression of c-myc increased to nearly 1.5 times. Furthermore, IGFBP3 is known as a factor that suppresses hair growth (Weger et al, J Invest Dermatol 125, 847, 2005), and its expression has been shown to increase in the resting phase (Schlake et al., Gene Expr. Patterns 4, 141, 2004). As shown in the figure, the expression of IGFBP3 was significantly reduced to about 60%. Therefore, it is clear that genes related to hair growth and hair growth vary in this experimental system due to cyclosporine A, and it is clear that this experimental system can be used for evaluation of drugs that affect hair growth and hair growth. became.

It is an immuno-staining figure (1) of the cell mass produced by the method of this invention, and shows the staining of DP cell and NHEK cell. It is an immuno-staining figure (2) of the cell mass produced by the method of this invention, and shows the localization of the hair papilla cell in a cell mass. It is an immuno-staining figure (3) of the cell mass created by the method of this invention, and shows cell proliferation in a cell mass. It is an immuno-staining figure (4) of the cell mass produced by the method of this invention, and shows the staining of β-catenin and NHEK cells. It is an immuno-staining figure (5) of the cell mass produced by the method of this invention, and shows hair keratin expression in a cell mass. It is an immuno-staining figure (6) of the cell cluster created by the method of this invention, and shows the hair bud marker expression in a cell cluster. Expression of various genes in RNA derived from the cell mass of the present invention (1). Expression of Wnt3A gene in RNA derived from the cell mass of the present invention. Expression of Wnt10B gene in RNA derived from the cell mass of the present invention. Expression of various genes in RNA derived from the cell mass of the present invention (2).

Claims (10)

A method for producing a cell mass capable of forming a primitive organ like a plurality of somatic cell types derived from somatic,
Preparing a culture medium containing keratinocytes and dermal papilla cells, wherein the dermal papilla cells remain in an undifferentiated state ;
After mixing the culture broth, the Wnt signal activator was added to the mixed cell cultures,
Entrusting the culture solution containing the Wnt signal activator to non-planar contact culture over a predetermined period of time,
Replacing the culture medium of the non-planar contact culture with a Wnt signal activator-free medium, and further culturing for a predetermined period;
Ing include that method.   The method according to claim 1, wherein a hair follicle having a hair follicle induction function is formed from the cell mass. The method according to claim 1 or 2 , wherein the Wnt signal activator is 6-bromoindirubin-3'-oxime (BIO). The method according to any one of claims 1 to 3 , wherein the non-planar contact culture method is a hanging drop method. A cell mass that can form a primitive organ like a plurality of somatic cell types derived from somatic,
Preparing a culture medium containing keratinocytes and dermal papilla cells, wherein the dermal papilla cells remain in an undifferentiated state ;
After mixing the culture broth, the Wnt signal activator was added to the mixed cell cultures,
Entrusting the culture solution containing the Wnt signal activator to non-planar contact culture over a predetermined period of time,
Replacing the culture medium of the non-planar contact culture with a Wnt signal activator-free medium, and further culturing for a predetermined period;
Ru is prepared by a process comprising, cell mass. The cell mass according to claim 5 , wherein a hair follicle having a hair follicle induction function is formed from the cell mass. The cell mass according to claim 5 or 6 , wherein the Wnt signal activator is 6-bromoindirubin-3'-oxime (BIO). The cell cluster according to any one of claims 5 to 7 , wherein the non-planar contact culture method is a hanging drop method. A method for screening a drug having a hair-growth effect by applying a candidate drug to the cell mass according to any one of claims 6 to 8 . The method according to claim 9 , wherein the expression level of one or more genes selected from the group consisting of c-myc, BMP4 and IGFBP3 of the cell mass is used as an index.