JP5258084B2 - Method for detecting protein-protein interaction - Google Patents

Description

  The present invention relates to a method for detecting protein-protein interactions.

  Recently, a system has been developed that detects the interaction of two proteins of interest using the complementarity of fragments of split luciferase. In order to detect protein-protein interactions, as a method of utilizing complementarity, generally, each fragment of the split reporter protein is fused with the target protein, and both fragments are significant by themselves. Do not retain activity. When the proteins of interest interact, the two inactive reporter protein fragments complement each other to restore activity and provide a readout signal to indirectly track the protein-protein interaction.

Methods utilizing such complementarity have been used for various reporter proteins, including dihydrofolate reductase, β-lactamase green fluorescent protein. Several types of luciferases have also been used, such as Renilla luciferase, firefly luciferase, red luminescent click luciferase, and green luminescent click luciferase. Such split fragments of luciferase each have specificity and can only restore strong luminescence when placed adjacent to another fragment from the same species of luciferase.
Kim, SB, Ozawa, T., Watanabe, S., Umezawa, Y., 2004.Proc. Natl. Acad. Sci. USA. 101, 11542-11547

  The inventor has used the same luciferin substrate, not only the N-terminal fragment of red luminescent click luciferase (TlucN; SEQ ID NO: 4), but also wild type firefly luciferase (FlucN; SEQ ID NO: 3) and green luminescent click luciferase (GlucN). A mutant C-terminal fragment of red-emitting click beetle luciferase (TlucC (mut); SEQ ID NO: 1) capable of complementing an N-terminal fragment from another species of luciferase, such as SEQ ID NO: 2);

  One embodiment of the present invention is a protein characterized in that it comprises a TlucC (mut) domain. The TlucC (mut) domain has amino acid SEQ ID NO: 1.

  Another embodiment is a complex comprising a protein having a TlucC (mut) domain and a protein having a GlucN domain having amino acid sequence number 2, a FlucN domain having amino acid sequence number 3, or a TlucN domain having amino acid sequence number 4. It is. These proteins have the ability to bind to each other.

  Another embodiment is a method of detecting a protein having a GlucN domain, a FlucN domain, or a TlucN domain. This method is characterized in that the protein interacts with a protein containing a TlucC (mut) domain to form a complex. In this complex, the domains can complement each other and emit specific light. By detecting the emitted light, a protein containing a GlucN domain, a FlucN domain, or a TlucN domain can be detected.

  Another embodiment is a method of detecting a protein comprising a TlucC (mut) domain. This method is characterized in that the protein interacts with a protein containing a GlucN domain, a FlucN domain, or a TlucN domain to form a complex. In this complex, the domains can complement each other and emit specific light. By detecting this emitted light, a protein containing a TlucC (mut) domain can be detected.

  Another embodiment includes a first protein comprising a TlucC (mut) domain and a GlucN domain having amino acid SEQ ID NO: 2, a FlucN domain having amino acid SEQ ID NO: 3, or a second having a TlucN domain having amino acid SEQ ID NO: 4. This is a method for detecting a complex with a protein. This method is characterized by detecting light emitted from the complex.

  Another embodiment is a method of detecting binding between a first protein comprising a TlucC (mut) domain and a second protein comprising a GlucN domain, a FlucN domain, or TlucN. This method is characterized by comprising the steps of causing these proteins to interact to form a complex, and detecting the light emitted from the complex.

  Another embodiment is a method for detecting the binding between a first protein and a second protein having binding ability to each other. The method comprises the steps of fusing a TlucC (mut) domain to a first protein, fusing a GlucN domain, FlucN domain, or TlucN to a second protein, and a second fused to the fused first protein. And a step of allowing a protein to interact with each other to form a complex, and detecting light emitted from the complex.

  Another embodiment is a method for selecting a binding protein of a first protein from a second protein and a third protein. The first protein is fused to a TlucC (mut) domain, and each of the second protein and the third protein has a GlucN domain having amino acid sequence number 2, a FlucN domain having amino acid sequence number 3, or an amino acid sequence number Fusion to a different domain selected from the group consisting of TlucN domains having 4. The method interacts a first protein with a second protein and a third protein, detects the emitted light, and determines which complex of the protein emits the light. It is characterized by.

  Another embodiment is a method for selecting a binding protein of a first protein from a second protein and a third protein. The method comprises the step of fusing a TlucC (mut) domain to a first protein and a GlucN domain having amino acid sequence number 2, a FlucN domain having amino acid sequence number 3, or a TlucN domain having amino acid sequence number 4 The method further includes the step of fusing each of the two domains selected from the above to the second protein and the third protein.

  A protein containing a TlucC (mut) domain forms a complex with a protein containing a GlucN domain having amino acid sequence number 2, a FlucN domain having amino acid sequence number 3, or a TlucN domain having amino acid sequence number 4. If possible, the TlucC (mut) domain may have an amino acid sequence in which one or several amino acids are substituted, deleted, or added in SEQ ID NO: 1.

  The present invention provides a modified complementation utilization method for detecting protein-protein interactions by using a red-emitting click beetle luciferase C-terminal mutant (TlucC (mut)).

  The wild-type C-terminal fragment (wtTlucC) of red luminescent click luciferase can only complement the N-terminal fragment derived from red luminescent click luciferase (TlucN) and not the N-terminal fragments from other species. However, as shown in the examples, TlucC (mut) is not only used for the N-terminal fragment of red luminescent beetle luciferase (TlucN), but also for wild-type firefly luciferase (FlucN) and green luminescent beetle luciferase ( It can also be complementary to N-terminal fragments from other types, such as GlucN). These three domains, GlucN domain, FlucN domain and TlucN domain, will be referred to herein as anti-TlucC (mut) domains.

 In addition, as shown in Example 4, the combination of the TlucC (mut) domain and the anti-TlucC (mut) domain allows the protein-containing complex to have a specific pattern of light, that is, TlucN and In the case of the combination, the light having a peak is emitted at about 600 nm, in the case of the combination with GlucN, about 530 nm, and in the case of the combination with FlucN, light having a peak at about 560 nm is emitted. Therefore, it can be identified from which complex the emitted light is based on the wavelength of the light to be detected. For example, the complex can be identified by detecting light having a wavelength of 600 nm in the case of a combination with TlucN, 530 nm in the case of a combination with GlucN, and 560 nm in the case of a combination with FlucN. Furthermore, if this characteristic is utilized, even if a plurality of complexes emit light at the same time, it is possible to identify which complex is emitting light.

  The light emitted from the complex can be detected not only by luminescence in the cell disruption solution, cell extract or cultured cells, but also by luminescence in the living body as shown in Example 5, but intradermal, subcutaneous, etc. Luminescence at cells near the body surface is easier to detect.

Utilizing this characteristic of TlucC (mut), for example, the following applications are possible.
(1) Using a protein having a TlucC (mut) domain, detecting a protein having an anti-TlucC (mut) domain and binding to the protein.
(2) Detecting a protein having a TlucC (mut) domain and binding to the protein using a protein having an anti-TlucC (mut) domain.
(3) Detecting a complex of a protein having a TlucC (mut) domain and a protein having an anti-TlucC (mut) domain and binding to the protein.
(4) Detecting the binding of a protein having a TlucC (mut) domain to a binding protein having an anti-TlucC (mut) domain.
(5) A binding protein of a protein having a TlucC (mut) domain is selected from the second protein and the third protein each having a different anti-TlucC (mut) domain.

  In embodiment (1), whether or not a protein having an anti-TlucC (mut) domain is present is determined by determining whether the protein binds to a protein having a TlucC (mut) domain and having an anti-TlucC (mut) domain. By detecting the light emitted when these proteins are bound and in close proximity so that both domains interact.

  In embodiment (2), whether there is a protein having a TlucC (mut) domain is determined by determining whether the protein binds to a protein having an anti-TlucC (mut) domain and having a TlucC (mut) domain. It can be investigated by detecting the light emitted when they are in close proximity so that these proteins bind and both domains interact.

  For example, when a gene encoding a target protein fused with an anti-TlucC (mut) domain is expressed in a cell, the expression is fused with the target protein when the TlucC (mut) domain is fused. Another gene encoding a protein that can be detected can be detected by co-expressing it in the cell. That is, when both of these two fusion proteins bind within the cell and are close enough to interact with each other, the domains complement each other and emit light specific to the combination of domains. By detecting this emitted light, the presence of the target protein can be detected.

  As an application example of such a system, it can be used to examine protein expression and promoter specificity.

  In embodiment (3), the complex of a protein having a TlucC (mut) domain and a protein having an anti-TlucC (mut) domain emits light of a specific wavelength and is thus released in the assay system. By examining the light, the presence of the complex can be detected.

  In embodiment (4), when a protein having a TlucC (mut) domain binds to a protein having an anti-TlucC (mut) domain, these proteins form a complex. By examining as described in (3), the binding can be detected.

  In embodiment (5), the binding protein of a protein having a TlucC (mut) domain can be selected from two or three proteins each having a different anti-TlucC (mut) domain. That is, since different wavelengths of light are emitted depending on the type of anti-TlucC (mut) domain, it is possible to determine which complex has been formed by detecting the emitted light and its wavelength, and further to the TlucC (mut) domain. Binding proteins for proteins having can be identified and selected.

  This embodiment can be applied in a wide range. For example, if the properties of a protein having a TlucC (mut) domain change depending on the state in the cell, and this property changes the binding partner of the protein, the state of the cell may be different from that of a protein having a TlucC (mut) domain, Other proteins having a TlucC (mut) domain can be detected by introducing them into a cell and examining the binding partner of the protein having a TlucC (mut) domain. If the complex is detected in real time, such as by luminescence, changes in protein properties can also be detected in real time.

  In all of the above embodiments, the method for producing the fusion protein is not limited, but production by chemical synthesis or molecular biological synthesis is preferred, and molecular biological synthesis is most preferred. For example, when a gene encoding a fusion protein is inserted into an expression vector and the expression vector is introduced into a cell, the fusion protein can be expressed in the cell.

  The method for detecting the light emitted from the complex of the fusion protein is not particularly limited, and the most suitable method for the light emitted from the substrate can be used.

<Example 1> Complement of TlucN, GlucN or FlucN by TlucC (mut) Using FKBP and FRB, which are interactive proteins capable of binding in the presence of rapamycin, TlucN, GlucN, or FlucN is converted to TlucC (mut ) Can be complemented.

To construct pTlucN-FKBP, pGlucN-FKBP, pFlucN-FKBP, and pFRB-TlucC (mut), TlucN, GlucN, FlucN, FKBP, FRB, and TlucC (mut) cDNAs were synthesized by standard PCR. A Kozak sequence and a restriction enzyme site were added. The primer sequences used to generate these cDNAs are as follows.
(TlucN-1) 5'AAGCTTGCCATGGTAAAGCGTGAGAAAAATGTC3 '(SEQ ID NO: 5)
(TlucN-2) 5'GGATCCTCCGCCTCCTCCGCCGTCGTCGATGGCCTC3 '(SEQ ID NO: 6)
(GlucN-1) 5'AAGCTTGCCATGGAGAGAGAGAAGAAC3 '(SEQ ID NO: 7)
(GlucN-2) 5'GGATCCTCCGCCTCCTCCTACCATAGGTCCCCAGAT3 '(SEQ ID NO: 8)
(FlucN-1) 5'AAGCTTGCCATGGAAGACGCCAAAAACATAAAGAAAGGC3 '(SEQ ID NO: 9)
(FlucN-2) 5'GGATCCTCCGCCTCCTCCATCCTTGTCAATCAAGGCGTTGGT3 '(SEQ ID NO: 10)
(FKBP-1) 5'GGATCCATGGGCGTGCAGGTGGAG3 '(SEQ ID NO: 11)
(FKBP-2) 5'CTCGAGCGTTCCAGTTTTAGAAGCTC3 '(SEQ ID NO: 12)
(FRB-1) 5'GGATCCATGGTAGCCATCCTCTGG3 '(SEQ ID NO: 13)
(FRB-2) 5'CTCGAGCGTGATATCCGTCTGAACAC3 '(SEQ ID NO: 14)
(TlucC-1) 5'CTCGAGTGGAGGCGGCGGAAGCAAGGGTTATGTCAAT3 '(SEQ ID NO: 15)
(TlucC-2) 5'CCGCGGGCCCACACCGCCGGCCTTCACCAA3 '(SEQ ID NO: 16)
(TlucC (mut) -1) 5'CTCGAGTGGAGGCGGCGGAAGCAAGGGTTATGTCAAT3 '(SEQ ID NO: 17)
(TlucC (mut) -2) 5'CCGCGGGCCCACACCGCCGGCCTTCACCAA3 '(SEQ ID NO: 18)

  After confirming the sequences of these cDNAs, the TlucN, GlucN, and FlucN cDNAs were cleaved with HindIII and BamH1, respectively, and ligated with the pcDNA4 / V5-His vector cleaved with the same restriction enzymes, respectively, and pTlucN, pGlucN, and A pFlucN vector was constructed. Subsequently, FKBP cDNA was cleaved with BamH1 and Xho1 and ligated with the pTlucN vector, pGlucN vector, or pFlucN vector cleaved with the same restriction enzymes to complete the constructs of pTlucN-FKBP, pGlucN-FKBP, and pFlucN-FKB. .

  Similarly, TlucC and TlucC (mut) cDNAs were cut with Xho1 and Apa1 and ligated with pcDNA4 / V5-His vector cut with the same restriction enzymes to complete the constructs of pTlucC and pTlucC (mut) vectors, respectively. Subsequently, the FRB cDNA was cleaved with BamH1 and Xho1 and ligated with the pTlucN and pFRB-TlucC (mut) vectors cleaved with the same restriction enzymes to complete the pFRB-TlucC and pFRB-TlucC (mut) constructs, respectively. .

  To standardize the efficiency of transfection, pTK-Rluc (Promega) expressing Renilla luciferase (Rluc) was used as an internal control.

  COS-7 cells were seeded in a 12-well plate and <pTlucN-FKBP, pFRB-TlucC (mut), and pTK-Rluc>, <pGlucN-FKBP, pFRB-TlucC using LipofectAMINE 2000 (Gibco BRL). (Mut) and pTK-Rluc> and <pFlucN-FKBP, pFRB-TlucC (mut), and pTK-Rluc> were each transfected and transiently expressed. For each control experiment, pFRB-TlucC was used instead of pFRB-TlucC (mut). At 12-16 hours after transfection, cells were stimulated with rapamycin (final concentration: 100 nM) for 30 minutes and then washed once with PBS. Cells used as negative controls were not stimulated with rapamycin, but all other experimental procedures were performed.

80 μL of Dual-Luciferase assay kit (Promega) substrate solution was added to each well of the plate. After incubating at 37 ° C. for 3 minutes, the luminescence intensity from the cell lysate was recorded with a luminometer (Lumat LB9507) for 30 seconds. The measurement wavelength was 600 nm for TlucN, 530 nm for GlucN, and 560 nm for FlucN (refer to the results of Example 4 for this wavelength). After measuring the activity of the click beetle luciferase or the firefly luciferase (L _T ), a substrate specific for Renilla luciferase was added and incubated for 3 minutes, and the activity (L _R ) was measured for 30 seconds. The luciferase activity value obtained by complementation of TlucN, GlucN or FlucN and TlucC (mut) is normalized by the value obtained by Renilla luciferase, and the “RLU rate (Dual)” (ie, (L _T )) / (L _R )).

As shown in FIG. 2, with pTlucN-FKBP and pFRB-TlucC (mut), the signal obtained in the presence of rapamycin was 13 times that of the control without rapamycin. With pGlucN-FKBP and pFRB-TlucC (mut), the signal obtained in the presence of rapamycin was approximately 20 times that of the control without rapamycin. When pFlucN-FKBP and pFRB-TlucC (mut) were used, the signal obtained in the presence of rapamycin was about 3800 times that of the control without rapamycin.
Thus, although TlucC (wt) hardly binds to GlucN or FlucN other than TlucN, TlucC (mut) can be used to evaluate protein-protein interaction according to this example. Or could be an excellent complementary partner to FlucN.

<Example 2> Interaction between BAD and 14-3-3 In this example, the interaction between BAD protein or BAD derivative and 14-3-3 protein was expressed as a complementary pair of GlucN and TlucC (mut) (Fig. 3).

  To construct pBAD-TlucC (mut) and pGlucN-14-3-3, BAD and 14-3-3 cDNAs were synthesized by standard PCR to generate the Kozak sequence and the restriction enzyme sites shown in FIG. Added.

(BAD-1) 5'GGATCCGCCACCATGGGAACCCAAAG 3 '(SEQ ID NO: 19)
(BAD-2) 5'GAATCCCCCTGGGAGGGGGTGGAGCCTC 3 '(SEQ ID NO: 20)
(14-3-3-1) 5'GGATCCGCCACCATGGATAAAAATGAG 3 '(SEQ ID NO: 21)
(14-3-3-2) 5'GAATTCCCATTTTCCCCTCCTTCTCCTGC 3 '(SEQ ID NO: 22)

  After confirming the sequences of these cDNAs, the BAD cDNA was cleaved with HindIII and BamH1 and ligated with the pTlucC (mut) vector cleaved with the same restriction enzymes to complete the BAD-TlucC (mut) construct. Similarly, 14-3-3 cDNA was cut with BamH1 and EcoR1 and ligated with pGlucN cut with the same restriction enzymes to complete the pGlucN-14-3-3 construct.

  COS-7 cells were seeded in 12-well plates, and transfected with p14-3-3-GlucN, pBAD-TlucC (mut), or pBCL-XL-GlucN as in Example 1, and transiently expressed I let you. 16-24 hours after transfection, cells were lysed with sample buffer (125 nM Tris pH 6.8, 10% glycerol, 4% SDS, 0.006% bromophenol blue, 1.8% β-mercaptoethanol). Anti-V5 antibody [5000-fold diluted 1% skim milk / TBST (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 0.05% Tween 20)] and alkaline phosphatase-labeled anti-mouse IgG antibody (4000-fold diluted 1%) Western blot was performed on the lysate using skim milk / TBST. Protein expression was analyzed with an image analyzer (LAS-1000plus, Fujifilm, Tokyo, Japan) using an ECL ™ kit (Amersham Biosciences, UK) (FIG. 4). As a result, expression from these constructs was confirmed.

  Next, constructs having cDNAs of BAD (S112A), BAD (S136A), and BAD (S155A) in which the serine at phosphorylation site S112, S136, or S155 was mutated to alanine were prepared (FIG. 3).

  BAD (S112A), BAD (S136A), BAD (S155A), and BAD (StripeA) cDNAs were synthesized by standard PCR to add Kozak sequences and restriction enzyme sites. After confirming the sequences of these cDNAs, BAD (S112A), BAD (S136A), BAD (S155A), and BAD (StrrippleA) were cleaved with HindIII and EcoR1 and bound to the pTlucC (mut) vector cleaved with the same restriction enzymes. PBAD (S112A) -TlucC (mut), pBAD (S136A) -TlucC (mut), pBAD (S155A) -TlucC (mut), and pBAD (StripeA) -TlucC (mut) constructs, respectively.

The sequences of the oligonucleotide pairs used in PCR to synthesize BAD (S112A), BAD (S136A), and BAD (S155A) are as follows:
(BAD (S112A) -1) 5 'GAGACTCGGAGTCGCCACAGTGCGTACCCAGCGGGGACCGAG 3' (SEQ ID NO: 23)
(BAD (S112A) -2) 5 'CTCGGTCCCCGCTGGGTACGCACTGTGGCGACTCCGAGTCTC 3' (SEQ ID NO: 24)
(BAD (S136A) -1) 5 'CGAGGACGCTCGCGTGCGGCTCCCCCCAATCTCTGGGCAGCG 3' (SEQ ID NO: 25)
(BAD (S136A) -2) 5 'CGCTGCCCAGAGATTGGGGGGAGCCGCACGCGAGCGTCCTCG 3' (SEQ ID NO: 26)
(BAD (S155A) -1) 5 'GAGCTCCGAAGGATGGCCGATGAGTTTGAGGGTTCCTTC 3' (SEQ ID NO: 27)
(BAD (S155A) -2) 5 'GAAGGAACCCTCAAACTCATCGGCCATCCTTCGGAGCTC 3' (SEQ ID NO: 28)

  An expression vector, p14-3-3-TlucN, and pBAD-TlucC (mut), pBAD (S112A) -TlucC, pBAD (S136A) (mut) -TlucC (mut), pBAD (S155A) -TlucC (mut), or Any one of pBAD (StripeA) -TlucC (mut) was co-introduced into COS-7 cells as described above. Cells were lysed 12-16 hours after transfection and luminescence was measured with a luminometer. The results are shown in FIG.

  When a wild type pair of p14-3-3-GlucN and pBAD-TlucC (mut) was used, very strong luminescence intensity was observed. This reflected the fact that the 14-3-3 protein and the BAD protein interact strongly and intrinsically. However, the emission intensity of the pair of 14-3-3 and BAD (S112A) or BAD (S136A) BAD was half that of the wild type pair. BAD (S155A) decreases in intensity by a factor of 5, and BAD (StripeA) in which all of S136, S112, and S155 are mutated to alanine has an interaction between BAD (StripeA) and 14-3-3. There was very little.

  Next, Western blotting was performed on COS-7 cells using an anti-phosphorylated BAD antibody against phosphorylated BAD (Ser112), phosphorylated BAD (Ser136), or phosphorylated BAD (Ser155). BAD (S112A) , BAD (S136A) and BAD (S155A) did not confirm the phosphorylation of the 112th, 136th, and 155th amino acids, respectively, but BAD (wt) confirmed the phosphorylation of all three amino acids. did. As shown in FIG. 6, signals were observed with BAD (wt) -TlucC (mut), but BAD (S112A) -TlucC (mut), BAD (S136A) -TlucC (mut), and BAD (S155A)- In TlucC (mut), the expression level was the same as BAD (wt) -TlucC (mut), but no signal was detected. The same results were obtained using another cell line, HeLa cells (data not shown).

  Furthermore, the effect of various compounds on the BAD / 14-3-3 interaction was investigated. Forskolin and IBMX (3-isobutyl-1-methylxanthine) are known as phosphorylation stimulants. Further, DATS (Dialyl trisulfide) and oleic acid are known as dephosphorylated substances. In fact, here, COS-7 cells are cultured and, as described above, after introducing pBAD-TlucC (mut) and pGlucN-14-3-3 into the cells and before performing the luminescence assay, forskolin, IBMX, DATS Or cells were incubated for 60 minutes in medium supplemented with oleic acid (100 μM each). As shown in FIG. 7, forskolin and IBMX enhanced the luminescence signal, but decreased with DATS and oleic acid. This result indicates that the luminescent signal reflects the binding strength of the protein.

In the interaction this embodiment the <Example 3> BAD and _{BCL-X L,} with BAD and _{BCL-X L} as interacting protein.

To construct _{pGlucN-BCL-X L,} it was synthesized by standard PCR a cDNA of _{BCL-X L,} and add restriction enzyme sites and a Kozak sequence. After confirmation of the sequence of this cDNA, the _BCL-X L cDNA was cut with EcoR1 and Xho1, and ligated with pGlucN vector cleaved with the same restriction enzymes, to complete the _{pGlucN-BCL-X L} constructs.

  Expression vectors pBAD-TlucC (mut) and pGlucN-BCL-XL were co-introduced into COS-7 cells, and their luminescence signals were measured in the same manner as in Example 1. As a result, no ligand was present. A strong luminescence signal was observed (FIG. 8).

Then, to assess the ability of the _{BCL-X L} inhibitor in a antimycin (Antimycin) and HA 14-1. Here, the cells containing the BAD-TlucC (mut) and _{GlucN-BCL-X L,} were incubated with 30-60 minutes antimycin before luminescence assay or HA 14-1 (each 100 [mu] M). As shown in FIG. 8, the luminescence signal was remarkably reduced when either compound was used. Thus, again, it was shown that the luminescence signals from BAD-TlucC (mut) and GlucN-BCL-XL reflect their binding strength.

<Example 4> Spectrum of emitted light In this example, a spectrum of light emitted by GlucN, FlucN, or a combination of TlucN and TlucC (mut) is shown.

  COS-7 cultured cells were transfected with pGlucN-FKBP and pFRB-TlucC (mut) and incubated at 37 ° C. for 24 hours. Cells were then stimulated with rapamycin (1.0 μM) and incubated at 37 ° C. for an additional 10-12 hours. Thereafter, the medium was removed and a luciferin substrate solution was added. After 3 to 5 minutes, the cells were lysed and the spectrum was observed using a fluorescence spectrophotometer. As shown in FIG. 9, a peak (lmax) was observed at around 530 nm. Similarly, in the combination of pFlucN-FKBP and pFRB-TlucC (mut), the detected wavelength shows a peak (lmax) around 560 nm, and in the combination of pTlucN-FKBP and pFRB-TlucC (mut) The measured wavelength showed a peak (lmax) around 600 nm.

<Example 5> Luminescence detection in cells subcutaneously present in mice In this example, light emitted by a combination of TlucN and Tluc (mut) can be detected even when emitted in vivo. It shows that.

  Here, expression vectors pGluc (wt), p14-3-3-GlucN, pBAD-TlucC (mut) or pBAD (StripeA) -TlucC (mut) were introduced into mice as follows.

  The product prepared in Example 2 was used as p14-3-3-GlucN, pBAD-TlucC (mut) or pBAD (StripeA) -TlucC (mut). pGluc (wt) was prepared as follows.

First, Gluc (wt) cDNA was synthesized by standard PCR and a restriction enzyme site was added. After confirming the sequences of these cDNAs, they were cleaved with HindIII and XhoI, and ligated with the pcDNA4 / V5-His vector cleaved with the same restriction enzymes to construct pGluc (wt). The PCR primers used here are shown below.
(Gluc (wt) -1) 5′AAGCTTATGGAGAGAGAGAAGAACGTGTACGGC 3 ′ (SEQ ID NO: 29)
(Gluc (wt) -2) 5´CTCGAGCGCAGCTTAGAAGCCTTCTCCATCAG 3´ (SEQ ID NO: 30)

Four 10 cm culture dishes were used for culturing COS7 cells. For each cultured cell, (1) pGluc (wt) alone, (2) pBAD-TlucC (mut) and p14-3-3-TlucN, (3) pBAD-TlucC (mut), p14-3-3 Cells were harvested after transfection with TlucN and Gluc (wt) (4) pBAD (StripeA) -TlucC (mut), p14-3-3-TlucN and pGluc (wt) and cultured at 37 ° C. for 18-24 hours And suspended in phosphate buffer. 1 × 10 ⁶ cells were transplanted into anesthetized BALB / C nude mice (4-week-old female mice, body weight about 15 g) at the locations shown in FIG. 10, and 15 minutes later, luciferin (3 mg / 100 μl PBS) was injected intraperitoneally. Ten minutes later, mice were imaged using a CCD camera (Versarray: 1300B, Prinston Instruments).

  As a result, as shown in FIG. 10, 530 nm light is detected from (1), (3) and (4) from Gluc (wt), and 600 nm light is (2) due to the binding of TlucC (mut) and TlucN. ) And (3). In (4), since BAD (StripeA) protein and 14-3-3 protein do not bind, neither TlucC (mut) nor TlucN binds, and no light was detected.

  Thus, even when a complex of a protein having a TlucC (mut) domain and a protein having an anti-TlucC (mut) domain emits light in vivo, not only can the light be detected from outside the body, but also each complex-specific Each complex can be identified by detecting light of a specific wavelength.

The principle of a bioluminescent probe based on protein complementarity is schematically shown. In one embodiment, (a) FlunN and TlucC (mut), (b) GlucN and TlucC (mut), (c) TlucC and TlucC (mut) are shown to be complementary. In one example, each luminescent probe construct used is shown. In one example, pBAD (wt) -TlucC (mut), pBAD (S112A) -TlucC (mut), pBAD (S136A) -TlucC (mut), pBAD (S155A) -TlucC (mut) in COS-7 cells. ), pBAD (StrippleA) -TlucC ( mut), it shows the expression from pGlucN-14-3-3, and _{pGlucN-BCL-X L.} In one example, the interaction between BAD or a BAD variant and 14-3-3 is shown. In one example, the 112th amino acid, 136th amino acid, and 155th amino acid in BAD (S112A), BAD (S136A), and BAD (S155A) are not phosphorylated, and these three amino acids are All show phosphorylation in BAD (wt). In one example, the effects of various phosphorylation stimulators and phosphorylation inhibitors on BAD / 14-3-3 interactions are shown. In one embodiment, a diagram illustrating interaction between BAD and _{BCL-X L,} and the effect of _{BCL-X L} inhibitors for the BAD / _{BCL-X L} interaction. In one Example, it is a figure which shows the spectral shift of the light which the combination of GlucN and TlucC (mut), FlucN and TlucC (mut), and TlucN and TlucC (mut) emit, respectively. In one Example, it is a figure which shows the detection of the light emission in the subcutaneous cell of a nude mouse. Em530nm and Em600nm represent the wavelength of the detected light. OPEN indicates the result of detection without reducing the wavelength.

Claims (12)

  A protein containing a TlucC (mut) domain having amino acid sequence number 1. A first protein containing a TlucC (mut) domain having an amino acid sequence in which one or several amino acids are substituted, deleted or added in SEQ ID NO: 1, a GlucN domain having amino acid SEQ ID NO: 2, amino acid SEQ ID NO: 3 Binding a second protein having a binding ability to the first protein, which comprises a FlucN domain having the amino acid sequence or a TlucN domain having the amino acid sequence number 4.
Confirming whether the GlucN domain, the FlucN domain, and the TlucN domain of a second protein complement the TlucC (mut) domain of the first protein;
A method for confirming whether the GlucN domain, the FlucN domain, and the TlucN domain that the second protein has have complementary to the TlucC (mut) domain that the first protein has .   A complex comprising the protein of claim 1 and a protein comprising a GlucN domain having amino acid sequence number 2, a FlucN domain having amino acid sequence number 3, or a TlucN domain having amino acid sequence number 4. A method for detecting a protein having a GlucN domain having amino acid sequence number 2, a FlucN domain having amino acid sequence number 3, or a TlucN domain having amino acid sequence number 4,
And a step of allowing the protein to interact with the protein according to claim 1 having a binding ability to form a complex, and a step of detecting light emitted from the complex. how to. The protein detection method according to claim 4,
Interacting a protein having a GlucN domain having amino acid sequence number 2, a FlucN domain having amino acid sequence number 3 or a TlucN domain having amino acid sequence number 4 with the protein of claim 1 to form a complex;
Detecting the light emitted from the complex.   The method for detecting a complex according to claim 5, comprising the step of detecting light emitted from the complex. Detection of binding between the first protein of claim 1 and a GlucN domain having amino acid sequence number 2, a FlucN domain having amino acid sequence number 3, or a second protein having a TlucN domain having amino acid sequence number 4 A way to
Interacting a first protein and a second protein to form a complex;
Detecting the light emitted from the complex. A method for detecting the binding between a first protein and a second protein having binding ability to each other,
Fusing a TlucC (mut) domain having amino acid sequence number 1 to the first protein;
Fusing a GlucN domain having amino acid sequence number 2, a FlucN domain having amino acid sequence number 3 or a TlucN domain having amino acid sequence number 4 to a second protein;
Interacting the fused first protein and the fused second protein to form a complex;
Detecting light emitted from the complex;
A method characterized by comprising. A method for selecting a binding protein of a first protein from a second protein and a third protein, comprising:
The first protein is fused to a TlucC (mut) domain having amino acid sequence number 1, and each of the second protein and the third protein is a GlucN domain having amino acid sequence number 2, an amino acid sequence Fused to a different domain selected from the group consisting of a FlucN domain having number 3 or a TlucN domain having amino acid sequence number 4;
Interacting the first protein with the second protein and the third protein;
Detecting the emitted light and determining which complex of the protein emits the light; and
A method comprising the steps of: The method of claim 8, further comprising:
Fusing a TlucC (mut) domain having amino acid sequence number 1 to the first protein;
Each of two domains selected from the group consisting of a GlucN domain having amino acid sequence number 2, a FlucN domain having amino acid sequence number 3 or a TlucN domain having amino acid sequence number 4 is used as the second protein and the third Fusing to protein,
A method comprising the steps of:   A vector comprising a sequence encoding a TlucC (mut) domain having amino acid SEQ ID NO: 1.   A protein containing a TlucC (mut) domain may form a complex with a protein containing a GlucN domain having amino acid sequence number 2, a FlucN domain having amino acid sequence number 3 or a TlucN domain having amino acid sequence number 4 A method for examining whether or not the TlucC (mut) domain has an amino acid sequence in which one or several amino acids are substituted, deleted, or added in SEQ ID NO: 1.