JP5230022B2 - Anti-interferon alpha monoclonal antibody and method of use - Google Patents

Description

Detailed Description of the Invention

Cross reference to Related Applications This application claims the benefit of U.S. Provisional Patent Application 60 / 836,599 (Aug. 9, 2006 filed) (the entire contents of the disclosure of which is incorporated herein by reference).
The present invention relates to methods and compositions useful for the diagnosis and treatment of conditions that correlate with abnormal interferon-α (IFNα) expression levels in a subject.

BACKGROUND ART Human interferon (IFN) is a functionally related cytokine that regulates both innate and adaptive immune responses. They are divided into two groups, type I and type II, mainly on the basis of sequence homology. Type I IFN includes six types (IFN-α, IFN-β, IFN-ω, IFN-κ, IFN-ε, and IFN-λ). IFN-α, β, ω and κ act through the same receptor, IFNAR. IFN-λ binds to a separate receptor, IFNLR. The receptor for IFN-ε is unknown so far. Type II IFN consists of only one type (IFN-γ) and binds to the receptor IFNGR. Type I IFN is strongly induced upon viral infection, and type II IFN is mainly induced by immune responses and inflammatory stimuli, therefore IFN-γ is often referred to as “immune IFN”. Of the many type I IFNs, the best studied include IFN-α, IFN-β, and IFN-ω. Of these, IFN-α is the most complex and includes at least 15 distinct protein subtypes (showing more than 75% sequence homology) (Diaz, 1995, Semin Virol, 6: 143-149; Weissmann et al. 1986, Prog Nucl Acid Res Mol Biol 33: 251; J Interferon Res 1993, 13: 443-444; Roberts et al. 1998, J Interferon Cytokine Res 18: 805-816). Besides having structural similarity, the IFN-α genes and their products show functional similarities. For example, they can be triggered by dsRNA or virus and interact with the same receptor, IFNα / β receptor IFNAR (Mogensen et al. 1999, J Interferons and other Regulatory Cytokines, John Wiley & Sons). IFNα also suppresses apoptosis, promotes survival and differentiation of antigen-activated T helper cells, and promotes maturation of functionally effective monocyte-derived dendritic cells.

Many cell types produce IFNα when exposed to viruses and dsRNA. Specialized white blood cells (called interferon-α producing cells (“IPC”)) produce IFNα in response to a wider variety of stimuli (eg, viruses, bacteria and protozoa). Some in vitro experiments show that the various IFN-α subtypes vary in varying degrees by distinct IFN-α-secreting cell lines or in a virus type-specific manner after infection of human peripheral blood mononuclear cells (PBMC). It has been shown that these patterns and these patterns are often closely related to subtype-dependent differences in antiproliferative, antiviral and antitumor activity. However, the physiological significance of the individual subtypes and their coordinated or antagonistic activity against each remains unclear.
IFN-α has been suggested as a mediator of pathologies observed in several autoimmune diseases. Furthermore, it can develop autoimmune diseases in patients treated with IFN-α for cancer and viral diseases. Increased expression of IFN-α has been observed in symptomatic localized tissues of patients with insulin-dependent diabetes mellitus (IDDM or type I diabetes), psoriasis, Crohn's disease and peritoneal disease. Overexpression of IFN-α was observed in systemic lupus erythematosus (SLE), IDDM and AIDS. In the case of SLE (characterized by large amounts of autoreactive B and T cells), IFN-α expression is observed not only in tissue lesions but also in the blood circulation of affected individuals. Furthermore, serum levels of IFN-α tend to correlate with disease activity indicators. This is thought to result from the cyclic induction of normally quiescent monocytes into strong antigen-presenting dendritic cells (DCs), triggered by upregulation of INF-α by plasmacytoid DCs (pDCs) It is done. Indeed, we have previously identified that SLE can be distinguished by “signatures” of non-regulated genes required for granulocyte production and IFN induction, and these signatures return to normal with high-dose glucocorticoid infusions. Presented by Microarray (US patent application 11 / 228,586, the contents of which are hereby incorporated by reference).

Systemic lupus erythematosus (SLE) is a systemic rheumatic autoimmune disease, particularly intense and characterized by high incidence of redness in children. Autoimmune diseases such as SLE often act with a permanent repetition of relapse and remission. These repetitions are often limited by the treatment phase with the general treatment plan administered to calm the SLE stage. Treatment options for SLE approved by the FDA include corticosteroids, nonsteroidal immunosuppressants, antimalarials, and nonsteroidal anti-inflammatory drugs. These agents do not affect the immune effector response that is specific to SLE lesions, but rather impairs the integrity of all immune effector responses. Since these treatments have moderate to severe side effects, including bone atrophy, weight gain, acne, anemia, sterility, severe diarrhea, hair loss and nausea, SLE is a treatment It is a representative one that does not satisfy the desire for. Furthermore, no new treatments for SLE have been approved in the last 40 years.
Recently, it has been shown that SLE and IFNα production are not closely linked (Shi et al. 1987, Br J Dermatol 117 (2): 155-159). IFNα is present at high levels in SLE serum (Crow et al. 2004, Curr Opin Rheumatol 16 (5): 541-547) and plasmacytoid DC (pDC) (the main source of IFNα) Accumulate in the skin (Farkas et al. 2000, Am J Pathol 159 (1): 237-243). Furthermore, some of the patients treated with IFNα have been observed to develop lupus (Okanoue et al. 1996, J Hepatol 25 (3): 283-291; Tothova et al. 2002, Neoplasma 49 (2): 91-94; and Raanani et al. 2002, Acta Haematol 107 (3): 133-144), as well as lupus patients with IFNα antibodies have been shown to exhibit a milder form of the disease ( Von Wussow et al. 1988, Rheumatol Int 8 (5): 225-230). IFNα may act through the differentiation of monocytes into functional dendritic cells (DC), which in turn mediate the progression of SLE (V. Pascual et al. 2003, Curr Opin Rheumatol 15 (5): 548-556). A proposed approach for the treatment of SLE is neutralization of IFNα (see PCT / US02 / 00343 (Banchereau et al.), The contents of which are hereby incorporated by reference) .

Monoclonal antibodies have been generated that can block the biological activity of human IFN-α, but none have been reported to date to neutralize all 15 known subtypes, most of which are naturally obtained Cannot neutralize leukocyte IFN containing IFNα. PBL Biomedical Laboratories offers 10 mouse monoclonal antibodies that bind to a number of human IFNα gene subtypes (see the World Wide Web at interferonsource.com/relativespecificity.html) . However, each PBL antibody binds to an IFNα protein subtype (IFNα protein subtype D) encoded by human IFNα gene subtype 1 and from 1 to 12 other IFNα subtypes. US Patent Publication 2003 / 0166228A1 discloses a monoclonal antibody (referred to as 9F3) obtained from immunization of mice with leukocyte IFNα (including all of the IFNα protein subtypes). 9F3 MAb is encoded by seven human IFNα gene subtypes 1, 2, 4, 5, 8, 10, and 21 (encoding IFNα protein subtypes D, A, 4, G, B2, C, and F, respectively) It binds to and neutralizes the antiviral activity of a protein that does not neutralize the antiviral activity of human IFNβ. The publication does not disclose whether the 9F3 antibody binds to the other 8 gene subtypes and inactivates them, or whether it binds to one or both of IFNα protein subtypes 4a and 4b. Not done. The PCT publication proposes the use of the monoclonal antibodies for the treatment of diseases associated with increased expression of IFNα, particularly autoimmune diseases (eg insulin dependent diabetes mellitus and SLE). However, it is unclear whether the 9F3 antibody can sufficiently neutralize the biological activity of the IFNα protein subtype found in SLE serum.
Because IFNα is a multifunctional mediator of immune responses and has beneficial antiviral activity, complete inhibition or marked down-regulation of all IFNα subtypes is not an optimal therapeutic approach. Accordingly, there is a need for agents that selectively neutralize IFNα subtypes that are closely related to symptoms. The present invention satisfies this need and provides related advantages as well.

SUMMARY OF THE INVENTION The present invention provides monoclonal antibodies and derivatives thereof that neutralize specific IFNα subtypes. The antibodies of the present invention are useful in the alleviation and treatment of symptoms associated with increased expression of IFNα, such as SLE, psoriasis, type I diabetes, AIDS, host-graft disease, and other autoimmune diseases. In one aspect, the invention relates to at least two interferon alpha (“IFNα”) protein subtypes, such as subtypes A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b and WA. An antibody that selectively neutralizes the biological activity of the protein, but does not significantly neutralize at least one biological activity of IFNα protein subtype D, wherein the biological activity is activation of MxA promoter or antiviral activity It is. Said antibody preferably binds essentially the same or the same IFNα epitope as an anti-IFNα antibody produced by a hybridoma having ATCC accession number PTA-7778, or binds essentially the same or the same IFNα epitope Compete with antibodies. Preferably, the antibody is a monoclonal antibody. In certain embodiments, the antibody does not significantly neutralize IFNα protein subtype D or 1. In one embodiment, the monoclonal antibody is ACO-2. Preferably, the antibodies of the present invention inactivate the ability of serum isolated from systemic lupus erythematosus (SLE) patients to stimulate differentiation of monocytes into dendritic cells.
In another aspect, an anti-interferon alpha (“IFNα”) monoclonal antibody produced by a hybridoma having ATCC accession number PTA-7778 is provided.
The antibodies, derivatives or fragments thereof of the present invention can be derived from mice, rats, humans or other mammals, or fragments thereof, or humanized or chimeric forms. The antibodies of the present invention include mouse monoclonal antibodies (eg, ACO-2) and humanized, chimeric or fragments thereof. The invention further provides antibodies that bind essentially the same IFNα epitope as murine monoclonal antibody ACO-2. The present invention further provides host cells, hybridomas, compositions, pharmaceutical compositions and kits comprising the antibodies of the present invention.
An antibody, derivative or fragment thereof of the invention is for the treatment of a disease or condition associated with overexpression of IFNα, including but not limited to SLE, psoriasis, AIDS, type I diabetes and autoimmune thyroiditis. And in the manufacture of a medicament for treating such diseases and conditions. The antibodies of the present invention can also be used to identify or purify various IFNα subtypes.
The present invention also provides antibodies having the above-described specificities, such as one or more interferon alpha (“IFNα”) protein subtypes (A, 2, B2, C, F, G, H2, I, J1, K, 4a 4b and WA), including host cells and hybridoma cell lines that produce antibodies that specifically bind, but do not neutralize, for example, the biological activity of INFα protein subtype D. The antibodies and hybridoma cell lines can be combined with a carrier (eg, a pharmaceutically acceptable carrier) for use in diagnostic and therapeutic methods. The antibodies are useful for the detection of specific IFNα subtypes, as well as the diagnosis, prognosis, treatment and / or alleviation of symptoms of IFNα-related diseases. Examples of such symptoms include, but are not limited to, SLE, psoriasis, type I diabetes, host versus graft (GVH) disease, AIDS, autoimmune thyroiditis and other autoimmune diseases. The antibodies of the present invention are also useful for in vitro or in vivo neutralization and / or isolation of these IFNα subtypes.

DETAILED DESCRIPTION OF THE INVENTION Although the construction and use of various embodiments of the present invention will be discussed in detail below, the present invention provides many applicable innovative concepts that can be embodied in a wide variety of individual situations. Will be understood to provide. The individual embodiments discussed herein are merely illustrative of individual ways to make and use the invention, and do not limit the scope of the invention.
In order to facilitate understanding of the present invention, a number of terms are defined below. Terms defined herein have meanings as commonly understood by a person of ordinary skill in the areas to which the invention pertains. For example, the original articles “a”, “an”, and “the” are not intended to be applied to a singular entity only, and the individual examples include generic classes used for illustration. The terminology herein is used to describe specific embodiments of the invention, but the invention is not limited by their use, except as described in the claims. For example, the term “a cell” includes a plurality of cells (including mixtures of cells). All numerical designations (including ranges), such as pH, temperature, time, concentration, and molecular weight are approximate numbers that vary from (+) or (-) by increments of 0.1. It will be appreciated that all numerical designations are preceded (but not always explicitly) by the term “about”. It will also be understood that the reagents described herein are merely exemplary (but not always explicitly indicated) and equivalents of the same are known in the art.

  As used herein, the term “antibody” applies to all classes and subclasses of intact immunoglobulins. The term “antibody” also includes monoclonal antibodies, antibody fragments and antibody fragment clones. “Antibody fragments” comprise a portion of an intact antibody that contains the antigen-binding or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab ′, F (ab ′) 2, and Fv fragments (single chain antibody molecules), multispecific antibodies formed from antibody fragments, Fd fragments (including VH and CH domains) ), Fv fragment (including antibody single arm VL and VH domains), dAb fragment (Ward et al. 1989, Nature 341: 544-546) (including VH domains), and isolated complementarity determining regions (CDR) is included. “Single-chain Fv” or “scFv” antibody fragments comprise the VH and VL domains of antibody, wherein these domains are present in a single polypeptide chain. In general, scFv polypeptides include a polypeptide linker between the VH and VL domains, which allows the scFv to form the desired structure for antigen binding. For a review of scFv see: Pluckthun (1994), “The Pharmacology of Monoclonal Antibodies”, Vol 113, Roseburg and Moore eds., Springer-Verlag. New York. pp. 269-315; Dall'Acqua and Carter 1998, Curr Opin Struc Biol 8: 443-450; Hudson 1999, Curr Opin Immunol 11: 548-557; Bird et al. 1988, Science 242: 423-426; and Hudson er al. 1988, Proc Natl Acad Sci USA 85: 5879-5883. Any of the antibody fragments described above can be obtained using conventional techniques known to those of skill in the art, and the fragments are screened for binding specificity and neutralizing activity in the same manner as intact antibodies. . The antibody can be isolated from any suitable biological source (eg, murine, rabbit, rat, human, sheep, dog, etc.). “Naturally occurring” or “natural” antibodies are heterotetrameric glycoproteins, typically having a molecular weight of about 150-200 kD. Heterotetramers contain two identical light (L) chains and two identical heavy (H) chains. Each light chain is covalently linked to the heavy chain by a disulfide bond.

As used herein, the term “antibody derivative” is used to encompass a molecule that binds to an epitope and is a modification or derivative of a natural monoclonal antibody of the invention. Derivatives include, but are not limited to, for example, bispecific, multispecific, heterospecific, trispecific, tetraspecific, multispecific antibodies, chimeric, recombinant and humanized antibodies.
As used herein, “antibody variant” applies to an antibody isotype selected from antibodies produced in species other than mice, or antibodies designated ACO-1 to ACO-6 and ACO-8. The “Antibody variants” also include antibodies that contain post-translational modifications to the linear polypeptide sequence of the antibody or fragment. The above further encompasses fully human antibodies.
As used herein, “monoclonal antibody” applies to antibodies (including antibody fragments) obtained from a substantially homogeneous antibody population. That is, the individual antibodies within a population are identical except for mutations that may occur in nature (which may be present in small amounts), so long as they exhibit the desired biological activity, the above also applies to the present invention. It is a part of. Monoclonal antibodies are highly specific and are directed against a single epitope. Monoclonal antibodies can be synthesized by hybridomas (in bioreactors, as ascites) or produced by recombinant methods (eg, in vitro translation, in bacterial, yeast, plant, insect and / or animal cells). Thus, the modifier “monoclonal” indicates the character of the antibody as obtained from a substantially homogeneous antibody population, and should not be construed as requiring production of the antibody by any particular method. For example, monoclonal antibodies used in accordance with the present invention may be produced by the hybridoma method originally described by Kohler et al. (Nature (1975) 256: 495) or by recombinant methods (see, eg, US Pat. No. 4,816,567). )). “Monoclonal antibodies” include human monoclonal antibodies, humanized monoclonal antibodies, recombinant human antibodies, antibody fragment clones (Fv clones) containing antigen recognition and binding sites isolated from phage antibody libraries, and derivatives thereof. Including but not limited to (see: Clackson et al. 1991, Nature 352: 624-628; and Marks et al. 1991, J Mol Biol 222: 581-597). Monoclonal antibodies also include “chimeric” antibodies (immunoglobulins), in which case, for example, a portion of the heavy and / or light chain is derived from a specific species or belongs to a specific antibody class or subclass. Identical or homologous to the corresponding sequence in, while the remaining chain or part thereof is an antibody from another species or an antibody belonging to another antibody class or subclass, as well as the correspondence in such an antibody fragment Identical to or homologous to the sequences to be obtained (provided they exhibit the desired biological activity) (US 4,816,567; Morrison et al. 1984, Proc Natl Acad Sci USA 81: 6851-6855).

As used herein, the term “human monoclonal antibody” applies to antibodies exhibiting a single binding specificity which have variable and constant regions derived from human germline immunoglobulin sequences.
As used herein, the term “human antibody” applies to antibodies having variable and constant regions derived from human germline immunoglobulin sequences. The human antibodies of the present invention contain amino acid residues that are not encoded by human germline immunoglobulin sequences (eg, mutations introduced by random or position-directed mutagenesis in vitro or by somatic mutation in vivo). Can be included. However, as used herein, the term “human antibody” includes an antibody in which a CDR sequence derived from the germline of another mammalian species (eg, a mouse) is grafted onto a human framework sequence. Not intended. Thus, as used herein, the term “human antibody” refers to substantially any part of a protein (eg, CDR, framework, CL, CH domain (eg, CH ₁ , CH ₂ , CH ₃ ), hinge, VL, VH) is substantially non-immunogenic for humans and applies to antibodies with very little sequence variation or variation. Similarly, antibodies identified as primates (monkeys, baboons, chimpanzees, etc.), rodents (mouse, rats, rabbits, guinea pigs, hamsters, etc.) and other mammals are identified in such species, subgenus, genus. Refers to antibodies specific to the subfamily and family. As described above, the chimeric antibody can also include any combination of the above. Such changes or variations optionally and preferably maintain or reduce immunogenicity in humans or other species compared to unmodified antibodies. Thus, human antibodies are separate from chimeric or humanized antibodies. Human antibodies can be produced by non-human animals or prokaryotic or eukaryotic cells capable of expressing functionally rearranged human immunoglobulin (eg, heavy and / or light chain) genes. Further, when the human antibody is a single chain antibody, it can also include a linker peptide that is not found in natural human antibodies. For example, the Fv fragment can also include a linker peptide, such as 2 to about 8 glycine or other amino acid residues (this linker peptide links the variable region of the heavy chain and the variable region of the light chain). . Such linker peptides are considered to be of human origin.

  If the antibody is obtained from a system using human immunoglobulin sequences, for example by immunizing a transgenic mouse carrying a human immunoglobulin gene or by screening a human immunoglobulin gene library, The human antibody is “derived” from a particular germline sequence. A human antibody “derived from” a human germline immunoglobulin sequence can be identified as such by comparing the amino acid sequence of said human antibody to the amino acid sequence of a human germline immunoglobulin. The human antibody selected is typically at least 90% identical in amino acid sequence to the amino acid sequence encoded by the human germline immunoglobulin gene and is derived from other species of germline immunoglobulin amino acids. It contains amino acid residues that qualify the human antibody as human when compared to a sequence (eg, a mouse or rat germline sequence). In certain instances, a human antibody can be at least 95%, or at least 96%, 97%, 98%, or 99% identical in amino acid sequence to the amino acid sequence encoded by a germline immunoglobulin gene. Typically, a human antibody derived from a particular human germline sequence will show no more than 10 amino acid differences from the amino acid sequence encoded by the human germline immunoglobulin gene. In certain instances, human antibodies may show no more than 5 amino acid differences from the amino acid sequence encoded by germline immunoglobulin genes, or no more than 4, 3, 2 or even 1 amino acid.

As used herein, the term “humanized” refers to a chimeric immunoglobulin, immunoglobulin chain or fragment thereof (eg, Fv, Fab, Fab ′, F (ab ′)) having a sequence derived from a non-human immunoglobulin. ₂ or other antigen-binding sequence of an antibody) to apply to the use of the portion of a non-human (eg mouse or rat) antibody used in the human immunoglobulin backbone. In general, humanized antibodies are non-human species (donors) in which one or more of the complementarity determining regions (CDRs) or all residues of the recipient have the desired specificity, affinity and ability. Antibody) (eg, mouse, rat, or rabbit) human immunoglobulin (recipient antibody) substituted by one or more CDR residues. For example, Fv framework region (FR) residues of a human immunoglobulin are replaced by corresponding non-human residues (or vice versa), i.e., the human immunoglobulin portion determines the antigen specificity. Transplanted into the area. Furthermore, humanized antibodies may comprise residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences. Modifications that are not part of the donor or recipient antibody are routinely and easily performed to further enhance and optimize antibody performance. In general, a humanized antibody will comprise substantially all of at least one, typically both variable domains (light and heavy chains) (in this case, all or substantially all of the CDR regions). All match the CDR region of a non-human immunoglobulin, and all or substantially all of the FR region is the FR region of a human immunoglobulin sequence). A humanized antibody can also comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.

As used herein, “recombinant human antibody” refers to any human antibody prepared, expressed, generated or isolated recombinantly, eg, from a transgenic or transchromosomal animal for human immunoglobulin genes. An isolated antibody, or an antibody isolated from a host cell transformed to express the antibody (eg, a cell transfected to express the antibody (usually a plasmacytoma)), a recombinant combinatorial human Antibodies isolated from antibody libraries and antibodies prepared, expressed, generated or isolated by any other method that may require splicing of human immunoglobulin gene sequences to other DNA sequences are included. Such recombinant human antibodies have variable and constant regions derived from human germline immunoglobulin sequences. In certain embodiments, however, such recombinant human antibodies can be subjected to in vitro mutagenesis (or in vivo somatic mutagenesis when animals transgenic for human Ig sequences are used), and thus The amino acid sequences of the VH and VL regions of a recombinant antibody, although derived and related to the human germline VH and VL sequences, may not be naturally present in the human antibody germline repertoire in vivo.
As used herein, the term “antigen binding site” or “binding portion” applies to the portion of an immunoglobulin molecule that participates in antigen binding. The antigen binding site is formed by the amino acid residues of the three variable (“V”) regions of the heavy (“H”) chain and the three variable regions of the light (“L”) chain at the N-terminus. Three highly dissimilar stretches in the heavy and light chain V regions are called “hypervariable regions” or “CDRs”, and the three are known as “framework regions” (FRs). It is sandwiched between preserved flanking stretches. Framework regions naturally correspond to amino acid sequences found between or adjacent to hypervariable regions of immunoglobulins. In an antibody molecule, the three hypervariable regions of the light chain (V _L 1, V _L 2 and V _L 3) and the three hypervariable regions of the heavy chain (V _H 1, V _H 2 and V _H 3) are tertiary In the original space, they are arranged relative to each other to form an antigen binding surface. The antigen binding surface is complementary to the three-dimensional surface of the antigen to be bound, and the three hypervariable regions of each heavy and light chain are called “complementarity determining regions” or “CDRs”.

As used herein, the term “biological activity” applies to the ability of one or more IFNα subtypes (or IFNβ) to activate the MxA promoter (and interferon-inducible promoter) or to exhibit antiviral activity. Is done. The EC ₅₀ and percent neutralization of the IFNα bioactivity of the antibody will vary according to the assay conditions and the type of IFNα bioactivity to be measured. For consistency, specific types of biological activity (ie, MxA promoter activation and antiviral activity) and assay conditions (ie, “RG assay” and “CPE assay”) are used. The RG assay can be performed using the conditions described herein. Percent neutralization of MxA promoter activation is determined using the amount of RGmax IFN and 2 μg / mL of antibody as described in the Examples (see Example 3). Antiviral (CPE) assays can be performed according to the methods described in the Examples.
As used herein, the term “bispecific molecule” applies to any substance, such as a protein, peptide, or protein or peptide complex, which has two different binding specificities. The term “multispecific molecule” or “heterospecific molecule” is intended to include any substance, such as a protein, peptide, or protein or peptide complex, which has three or more different binding specificities. Have.
When two antibodies recognize the same or sterically overlapping epitope, the one antibody binds “substantially the same epitope” as the reference antibody. Antibody binding can be measured or determined by standard antibody-antigen assays (eg, competitive assays, saturation assays), or standard immunoassays (eg, ELISA or RIA). The most widely used and rapid method for determining whether two antibodies bind to the same or sterically overlapping epitopes is a competitive assay, which includes a number of methods using either labeled antigens or labeled antibodies. Can be configured in different ways. Usually, the antigen is immobilized on a 96-well plate, and the ability of the unlabeled antibody to block the binding of the labeled antibody is measured using a radioactive label or an enzyme label. One example of a competitive ELISA assay is disclosed in US Pat. No. 5,512,457. Other assays that determine whether an antibody binds to the same epitope, or substantially or essentially the same epitope as an antibody, or to compete effectively for binding of an antibody to an antigen are also in the art. Well known. They are, for example, issued in US Pat. Nos. 6,342,219, 6,342,221, 6,524,583, 6,416,758 and US Patent Publication No. 2007/0065447, each of which is hereby incorporated by reference.

  As used herein, the term “composition” applies to the active agent and another carrier combination. The carrier can be, for example, a compound or composition that is inert (eg, a detectable agent or label) or active (eg, an adjuvant, diluent, binder, stabilizer, buffer, salt, frozen Dry solvents, preservatives, adjuvants, etc.). Carriers also include pharmaceutical excipients and added proteins, peptides, amino acids, lipids and carbohydrates (eg, sugars, monosaccharides, disaccharides, acid sugars, tetrasaccharides and oligosaccharides; derivatized sugars such as alditols, aldonic acids, esters And the like, as well as polysaccharides or sugar polymers), which may be present as a carrier or in combination, including 1-99.99% by weight or volume, alone or in combination. Exemplary protein excipients include serum albumin, such as human serum albumin (HAS), recombinant human albumin (rHA), gelatin, casein, and the like. Exemplary amino acid / antibody components (which may also function as a buffering capacity) include, for example, alanine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine. , Aspartame and so on. Carbohydrate excipients are also contemplated within the scope of the present invention, examples being monosaccharides such as fructose, maltose, galactose, glucose, D-mannose, sorbose, etc .; disaccharides such as lactose, sucrose, trehalose, cellobiose Polysaccharides such as raffinose, melezitose, maltodextrin, starch and the like; and alditols such as, but not limited to, mannitol, xylitol, maltitol, lactitol, xylitol sorbitol (glucitol) and myo-inositol. The term carrier further includes buffering agents or pH adjusting agents. Typically the buffer is a salt prepared from an organic acid or base. Typical buffering agents include salts of organic acid salts such as citric acid, ascorbic acid, gluconic acid, carbonic acid, tartaric acid, succinic acid, acetic acid or phthalic acid; tris, tromethamine hydrochloride or phosphate buffer . Other carriers include polymer excipients / additives, such as polyvinylpyrrolidone, ficoll (polymer sugar), dextran (eg cyclodextrin, eg 2-hydroxypropyl-.quadrature.-cyclodextrin) , Polyethylene glycol, fragrances, antibacterial agents, sweeteners, antioxidants, antibacterial agents, surfactants (eg polysorbates such as “TWEEN20” and “TWEEN80”), lipids (eg phospholipids, fatty acids), steroids (eg cholesterol) ), And chelating agents (eg, EDTA).

As used herein, the term “control” applies to another subject or sample used in an experiment for comparison purposes.
As used herein, the term “effective amount” is an amount sufficient to achieve a beneficial or desired result. An effective amount can be administered as one or more implementations, applications or dosages.
As used herein, the term “epitope” or “antigenic determinant” refers to a site on an antigen or antigen fragment that is recognized by an antibody or antigen receptor. T cell epitopes are short peptides derived from protein antigens presented by the appropriate major histocompatibility (MHC) protein. A B cell epitope is an antigenic determinant generally recognized by B cells and is usually a portion of a three-dimensional surface that is recognized by an antibody (which may be sequenced or Structural determinants may be included).
The antigenic determinant region and predicted epitope of IFNα can be identified by any method for determining the antigenic determinant region (eg, standard mapping and characterization techniques), and further purification thereof can be performed by any suitable technique. (The “epitope mapping” technique, the “epitope identification” technique and the like herein should be understood as a description of a technique applicable to epitope identification and / or purification). As one example of such a mapping / characterization method, the epitope of an ACO-2 antibody can be determined by epitope “footprinting” using exposed amine / carboxyl chemical modifications within the IFNα protein. One specific example of such a footprinting technique is the use of HXMS (hydrogen-deuterium exchange detected by mass spectrometry). Briefly, in HXMS, a hydrogen / deuterium exchange of the amide protons of the receptor and ligand protein is performed, followed by peptide-antigen binding and a back exchange of the amide protons of the receptor and ligand protein. The backbone amide group that participates in protein binding is protected from back-exchange and thus remains deuterated. Corresponding regions are identified at this point by proteolysis of the peptide, rapid microbore high performance liquid chromatography separation, and / or electrospray ionization mass spectrometry (see, eg, H. Ehring, Analytical Biochemistry 1999, 267 (2): 252-259 and / or JREngen & DL Smith 2001, Anal Chem 73: 256A-265A). Other methods for epitope mapping include, but are not limited to, nuclear magnetic resonance (NMR) epitope mapping, mass spectrometry, protease degradation techniques, and various phage display techniques. Examples of such techniques are described, for example, in US Patent Publication 2007/0065447, the entirety of which is incorporated herein by reference. Numerous other methods for epitope mapping are also known in the art, such as those described below: OMR Westwood & FC Hay, Epitope Mapping: A Practical Approach (Oxford Univ. Press, 2000) .

IgG antibodies can be cleaved into three fragments by papain digestion. Two of these fragments are typically the same antigen-binding fragment, referred to as “Fab” fragments, each having only one antigen-binding site and the rest being “Fc” fragments. The Fab fragment contains the amino-terminal halves of the light and heavy chains, which are held together by interchain disulfide bonds. The Fc fragment consists of the carboxy-terminal halves of two heavy chains that are disulfide bonded to each other by the remaining hinge region. Pepsin digestion of IgG antibodies cleaves in the same antibody body region as papain, but does not cleave on the carboxy terminus side of disulfide bonds, resulting in F (ab ′) ₂ fragments. F (ab ′) ₂ fragments have two antigen binding sites and are still capable of cross-linking antigen. Fab ′ fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 domain including one or more cysteines from the antibody hinge region. Fab′-SH is a name for Fab ′ in which a cysteine residue of a constant domain retains a free thiol group.
As used herein, the term “Fv” applies to the smallest antibody fragment that contains a complete antigen recognition and binding site. In double-chain Fv species, this region contains a dimer of one heavy chain and one light chain variable domain in a non-covalent state. In a single chain Fv species, one heavy chain and one light chain variable domain allow the light and heavy chains to bind in a structure similar to the “dimer” structure of a double chain Fv species, It can be covalently linked by a flexible peptide linker.
As used herein, the term “heteroantibody” refers to two or more antibodies, antibody-binding fragments (eg, Fabs), derivatives thereof, or antigens linked together and having at least two different antigen specificities. Applied to the combined area.

As used herein, the term “interferon alpha” (“IFNα”) applies to a protein family that includes some of the major effectors of innate immunity. There are at least 15 known isotypes of IFNα. The names of the IFNα protein subtypes and the corresponding coding genes are listed below.
IFNα gene corresponding to IFNα protein subtype
A 2a
2 2b
B2 8
C 10
D (Val ¹¹⁴ ) 1
F 21
G 5
H2 14
I 17
J1 7
K 6
4a 4a
4b 4b
WA 16
1 (Ala ¹¹⁴ ) 1

See: Pestka et al. (1997) “Interferon Stansardization and Designations” J Interferon Cytokine Res 17: Supplement 1, S9-S14. INFαB2 is also sometimes called IFNαB and should not be confused with IFNβ. Leukocyte-derived natural IFNα (leukocyte IFN), as well as these human IFNα recombinant protein subtypes, are available from PBL Biomedical Labs, Piscataway, NJ (interferonsource.com). Natural IFNα is a complex mixture of INFα. IFNβ was not detected in the natural IFNα preparation used herein. Methods for the detection and quantification of these interferons, such as ELISA and RIA, are known in the art (see: Staehelin et al. (1981) Methods in Enzaymology 79 (S. Pestka ed.) Academic Press, NY 589-595; Kelder et al. (1986) Methods in Enzaymology 119 (S. Pestka ed.) Academic Press, NY 589-595; Stewart (2003) supra; Bennett et al. (2003) J Exp Med 197 ( 6): 711-723; Baechler et al. (2003) Proc Natl Acad Sci USA 100 (5): 2610-2615).
As used herein, the term “IFNα producing cell” applies to specialized leukocytes required for IFNα production. IFNα is widely induced by double-stranded RNA (ds (RNA)), viruses, bacteria, protozoa, certain cell lines and unmethylated CpG-DNA (Romblom & Alm (2004) J Exp Med 194 (12) : F59-F63).
As used herein, the phrase “INFα-related condition or disease” applies to abnormal and detrimental diseases or preclinical conditions linked to elevated IFNα levels in the patient's serum. Examples of such include (but are not limited to): SLE, graft versus host disease (GVHD), type 1 diabetes, AIDS (caused by human immunodeficiency virus), autoimmune thyroiditis, Psoriasis and lupus. Methods for determining the level of IFNα are known in the art and are also described herein.

As used herein, the term “immune response” applies to the antigen-specific response of lymphocytes to foreign substances. Any substance that elicits an immune response is considered “immunogenic” and is referred to as an “immunogen”. All immunogens are antigens, however, not all antigens are immunogenic. The immune response may be humoral (via antibody activity) or cell-mediated (via T cell activation).
As used herein, “immunological binding” and “immunological binding properties” apply to non-covalent interaction types that occur between an immunoglobulin molecule and an antigen to which the molecule has specificity. Is done. The strength or affinity of an immunological binding interaction is expressed by the dissociation constant (K _d ) of the interaction, where a smaller K _d represents a stronger affinity. The immunological binding properties of the selected polypeptide can be quantified using methods well known in the art. One such method requires measurement of the rate of formation and dissociation of the antigen binding site / antigen complex, where these rates depend on the concentration of the complex partner, the affinity of the interaction, and both directions. It depends on geometric parameters that affect speed equally. Thus, both “on rate constant” (K _on ) and “off rate constant” (K _off ) can be determined by concentration calculations, and the actual association and dissociation rates are well known in the art. The ratio of K _off / K _on allows the cancellation of all parameters not related to affinity and is therefore equal to the dissociation constant K _d (see, eg, Coligan et al. Current Protocols in Immunology, Wiley, NY, 1999).

As used herein, the term “isolated” applies to an antibody that has been identified and separated and / or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that can interfere with the diagnostic or therapeutic use of the antibody, which can include enzymes, hormones and other proteinaceous or non-proteinaceous solutes. In a preferred embodiment, the antibody is purified (1) greater than 95% by weight of antibody, most preferably greater than 99% by weight, as determined by Lowry's method, or (2) a rotating cup sequencer. Purified to a degree sufficient to obtain at least 15 residues of the N-terminal or internal amino acid sequence, or (3) by Coomassie blue staining, preferably by SDS-PAGE under reducing or non-reducing conditions Purified to a homogeneous degree using silver staining. Isolated antibody includes the antibody present in situ within recombinant cells. This is because at least one component of the antibody's natural environment is not present. Ordinarily, however, isolated antibody will be prepared by at least one purification step. Monoclonal antibodies and variants and derivatives thereof are considered isolated antibodies.
As used herein, the term “isotype” applies to antibody classes based on the amino acid sequence of the constant domain of their heavy chains. There are five major isotypes of immunoglobulins, IgA, IgD, IgE, IgG and IgM, some of which can be further classified into subclasses, eg IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2.

“Lust” applies to several diseases or disorders. “Systemic lupus erythematosus” (SLE) is a form of the disease that can affect many parts of the body. Symptoms of SLE can be mild or severe and are outlined herein. “Disk-like lupus erythematosus” is a chronic skin disorder in which red and raised redness appears on the face, scalp or other places. The raised areas can become thick and desquamating and can also cause scar formation. Redness may persist for days or years and may recur. A small percentage of patients with discoid lupus will later develop SLE. “Subacute erythematous cutaneous lupus” is applied to skin disease layers that appear in body parts exposed to the sun. “Drug-induced lupus” is a form of lupus caused by certain medicines. Symptoms are similar to those of SLE (arthritis, redness, fever and chest pain), and symptoms typically disappear completely when the drug is stopped. The kidneys and brain are hardly involved. “Newborn lupus” is a rare disease that can occur in neonates of women with SLE, Sjogren's syndrome, or women who are completely disease-free. (Referred to as (SSB)). At birth, babies typically exhibit skin redness, liver damage, and a low blood count.
As used herein, the term “pharmaceutically acceptable carrier” refers to any standard pharmaceutical carrier, such as phosphate buffered saline, water, and emulsions, such as oil / water or water / oil emulsions. Liquid, and various types of wetting agents. The composition can also include stabilizers and preservatives and any of the carriers described above, along with any additional materials provided that they are acceptable for in vivo use. For examples of carriers, stabilizers and adjuvants see: Martin Remington's Pharmaceutical Sci. 18th Ed. Mack Publ Co., Easton, PA, 1995; “Physician's Desk Reference”, 58th ed. Medical Economics, Montvale, NJ, 2004.

As used herein, the terms “selectively neutralize” and “selective neutralization” selectively neutralize at least 40% of the biological activity of one or more “IFNα” protein subtypes. Applied to isolated and purified antibodies (eg, but not limited to monoclonal antibodies) that do not significantly neutralize at least one biological activity of another IFNα protein subtype, in which case the biological activity Is activation of the MxA promoter or antiviral activity. Since the functions of the various IFNα subtypes differ, it is advantageous to selectively neutralize specific forms of IFNα and control specific functions. Although one or more antibodies of the present invention are specific for IFNα, they are also “selective” for one or more subtypes and not for other subtypes. To selectively neutralize one or more IFNα protein subtypes, such as A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b, for example antigens on the D subtype One or more antigenic epitopes on IFNα that do not significantly cross-react with sex epitopes have been identified, isolated, characterized and purified as disclosed herein.
As used herein, the phrase “not significantly neutralizing” applies to antibodies that neutralize less than 40% of the biological activity of a specified IFNα subtype (or the biological activity of IFNβ), where: Biological activity is measured by MxA reporter gene assay (RG assay) or cytopathic effect assay (CPE assay) according to the conditions described herein. In some embodiments, the antibodies of the invention neutralize more than 35%, 30%, 25%, 20%, 15%, 10%, 5%, 2% of the biological activity of a particular IFNα subtype. No significant neutralization without or even exceeding 1%.
As used herein, the term “subject” applies to vertebrates, preferably mammals, more preferably humans. Mammals include, but are not limited to, rodents, monkeys, humans, domestic animals, horses, dogs, and cats.

  Traditional treatment of SLE is symptomatic and induces systemic immunosuppression. These include glucocorticoids, cyclophosphamide, azathioprine and mycophenolate mofetil. Their effectiveness is only partial and undesirable side effects such as increased susceptibility are common. Therefore, neutralizing IFNα specifically in SLE patients is a promising idea for controlling the pathology of this disease. Since disordered mass production of IFNα by pDC plays an important role in the persistent repetition of the disease, neutralizing the biological activity of IFNα with specific MAb sequestrations results in an effective immune response against pathogens. Target-induced therapeutics are provided that do not impair the patient's ability to launch. Desirable candidate MAbs for IFNα may require special properties including: (i) the ability to act on most or all of the human IFNα subtypes that are closely involved in the pathogenesis of SLE; (ii) such Ability to block the biological activity of the IFNα subtype; (iii) inability to block IFNβ or IFNAR; and / or (iv) high affinity. Neutralization of IFNα but not IFNAR can also provide safer and more specific therapeutic agents. Because this approach will not affect the antiviral effect of the IFNβ signaling pathway using the same receptor as IFNα. To this end, the present invention also provides a series of monoclonal antibodies (MAbs) that can neutralize human IFNα. For example, two of these anti-IFNαMAbs can neutralize the biological activity of 13 recombinant IFNα subtypes along with the biological activity of the complex IFN mixture produced upon viral infection. In one aspect, the invention provides seven MAbs that neutralize human IFNα to varying degrees, three of which significantly neutralize up to 13 recombinant IFNα subtypes and complex IFNα mixtures ( Both leukocyte IFN and influenza-infected PBMC production supernatant available on the market). Two of the MAbs, ACO-1 and ACO-2, also consistently block the biological activity of SLE patient sera that exhibit IFNα signature by microassay. ACO-1 and ACO-2 do not significantly neutralize the biological activity of IFNα protein subtypes D and 1, but neutralize the IFNα biological activity of SLE serum, so these subtypes are important for the pathogenesis of SLE The probability of having significant significance is extremely low. Accordingly, it is desirable to treat SLE with antibodies such as, for example, humanized or non-antigenic (eg, deimmunized) variants of ACO-1 and ACO-2. The antibody blocks the biological activity of the IFNα subtype associated with SLE, but does not block the biological activity of IFNα protein subtypes (D and 1) that are not significantly associated with SLE.

  The present invention also includes at least two selected from the group consisting of interferon alpha (“IFNα”) protein subtypes A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b and WA. Providing an antibody that selectively neutralizes the biological activity of the protein subtype, but does not significantly neutralize at least one biological activity of IFNα protein subtype D, wherein the biological activity is, for example, activation of the MxA promoter And / or antiviral activity. In another aspect, the invention provides at least one selected from interferon alpha (“IFNα”) protein subtypes A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b and WA. Provided is a method for treating a disease or condition associated with abnormal expression of one protein subtype in a subject without neutralizing the antiviral activity of IFNα protein subtype D, the method comprising: Administering one or more effective amounts of the antibody to the subject. Examples of such antibodies include antibodies designated ACO-1, ACO-2, ACO-3, ACO-4, ACO-5, ACO-6, and the same or essentially the same as any of the foregoing antibodies Antibodies that recognize the same IFNα epitope or antibodies that compete with antibodies that recognize essentially the same or the same IFNα epitope as any of the foregoing antibodies include, but are not limited to. Preferably, the antibody is a monoclonal antibody. The ATCC deposit numbers of the hybridoma cell lines producing these monoclonal antibodies are listed below. Accordingly, the present invention further provides hybridoma cell lines that express ACO-1, ACO-2, ACO-3, ACO-4, ACO-5, ACO-6 and ACO-8 antibodies. In one aspect, the antibody binds essentially the same IFNα epitope as an anti-IFNα antibody produced by a hybridoma having ATCC accession number PTA-7778. In another aspect, the antibody binds to the same IFNα epitope as an anti-IFNα antibody produced by a hybridoma having ATCC accession number PTA-7778. In yet another aspect, the antibody competes with an antibody that binds essentially the same or the same IFNα epitope as an anti-IFNα antibody produced by a hybridoma having ATCC accession number PTA-7778.

In one aspect, the invention provides an antibody that binds essentially the same IFNα epitope as an antibody selected from the group consisting of ACO-1, ACO-2, ACO-3, ACO-4, ACO-5, and ACO-6 I will provide a. In another aspect, the invention competes for essentially the same IFNα epitope as an antibody selected from the group consisting of ACO-1, ACO-2, ACO-3, ACO-4, ACO-5 and ACO-6 An antibody is provided. In yet another aspect, the invention provides an antibody that binds to the same IFNα epitope as an antibody selected from the group consisting of ACO-1, ACO-2, ACO-3, ACO-4, ACO-5 and ACO-6. provide. In another aspect, the invention competes with an antibody that binds to the same IFNα epitope as an antibody selected from the group consisting of ACO-1, ACO-2, ACO-3, ACO-4, ACO-5 and ACO-6. An antibody is provided. The present invention provides cell lines, such as hybridomas, that express such antibodies.
In another embodiment, the present invention provides at least three selected from the group consisting of IFNα protein subtypes A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b and WA, Neutralizes biological activity of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 IFNα protein subtype, but at least one of IFNα protein subtype D The antibody provides an antibody that does not neutralize biological activity, wherein the biological activity is activation of the MxA promoter or antiviral activity.
Monoclonal antibodies are provided that do not neutralize at least one biological activity of IFNα protein subtype 1, wherein the biological activity is activation of the MxA promoter and / or antiviral activity.
In another aspect, the present invention selectively neutralizes the biological activity of IFNα protein subtypes A, 2, B2, C, F, G, H2, I, K, 4a, 4b and WA, The biological activity of subtypes D and 1 provides monoclonal antibodies that are not significantly neutralized, wherein the biological activity is activation of the MxA promoter and / or antiviral activity. Other embodiments include ACO-1 and ACO-2.
In yet another aspect, the present invention selectively neutralizes the biological activity of IFNα protein subtypes A, 2, B2, C, I, K, and 4a, but IFNα protein subtypes D, F, G, The biological activity of 4b and 1 provides a monoclonal antibody that does not significantly neutralize, where the biological activity is activation of the MxA promoter and / or antiviral activity. One such embodiment is the ACO-3 antibody and its derivatives produced by ACO-3 cells.

In yet another aspect, the present invention selectively neutralizes the biological activity of IFNα protein subtypes A, 2, B2 and C, while the biological activity of IFNα protein subtypes D, 4b and 1 is significantly moderate. An unmatched antibody is provided, wherein the biological activity is activation of the MxA promoter and / or antiviral activity. One such embodiment is the ACO-4 antibody and its derivatives produced by ACO-4 cells and their derivatives.
In another aspect, the antibodies of the invention selectively neutralize the biological activity of IFNα4a, but do not selectively neutralize the biological activity of IFNα4b, wherein the biological activity is due to activation of the MxA promoter. is there. Examples of these antibodies are antibodies designated ACO-3 and ACO-4 and derivatives thereof, for example produced by ACO-3 and ACO-4 cells and derivatives thereof, respectively.
In yet another aspect, the present invention selectively neutralizes the biological activity of IFNα protein subtypes A, 2, G, I, K, WA and 1, but the biological activity of IFNα protein subtypes B and D. Provides monoclonal antibodies that do not significantly neutralize, wherein the biological activity is activation of the MxA promoter and / or antiviral activity. One such embodiment is ACO-5 antibodies and derivatives thereof, for example produced by ACO-5 cells and derivatives thereof.
In a further added embodiment, the present invention selectively neutralizes the biological activity of IFNα protein subtypes 2 and C, whereas the biological activity of IFNα protein subtypes A, B2, C, D, F and 1 is Monoclonal antibodies are provided that do not neutralize, wherein the biological activity is activation of the MxA promoter. An example is the ACO-6 antibody and its derivatives produced by ACO-6 cells and their derivatives.
In yet another aspect, the present invention selectively neutralizes the biological activity of IFNα protein subtypes A, 2, B2, D, F, I, 4a, 4b and 1, but IFNα protein subtype C, The biological activity of H2, K and WA provides a monoclonal antibody that does not significantly neutralize, where the biological activity is activation of the MxA promoter. An example is the ACO-8 antibody and its derivatives produced by ACO-8 cells and their derivatives.
In another aspect, the invention provides an anti-interferon alpha (“IFNα”) monoclonal antibody produced by a hybridoma having ATCC accession number PTA-7778.

In another aspect, the present invention is selected from the group consisting of interferon alpha (“IFNα”) protein subtypes A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b and WA. A submaximal effective concentration of less than about 350 ng / mL for subtypes, more preferably less than about 300 ng / mL, and / or less than about 400 ng / mL for subtype K, more preferably less than about 375 ng / mL ( An antibody that selectively neutralizes the biological activity of at least two IFNα protein subtypes at half maximal effective concentration (EC ₅₀ ) is provided. The half maximal effective concentration can be determined using any available method, preferably the RG bioassay described herein.
The antibody molecules of the invention can have a high binding affinity for the IFNα protein subtype (eg, nanomolar binding). Affinity can be measured using any suitable method known in the art, including the Biacore assay described in the Examples herein. Preferably, affinity is measured using recombinant IFNα-A as described in the examples herein. The antibody molecules of the invention can have a binding affinity for IFNα-A of less than about 5 × 10 ⁻⁹ M. Alternatively, an antibody molecule of the invention can have a binding affinity for IFNα-A of less than about 1.5 × 10 ⁻⁹ M. Thus, in certain embodiments, an antibody molecule of the invention has a binding affinity between about ⁹ × ^{10 −9} M and about 4 × ^{10 −10} M. In another embodiment, the antibody molecule of the present invention may have a binding affinity of between about 5x10 ^-9 M to about 1.5 × 10 ^-9 M.
Monoclonal antibodies of the invention also include humanized antibodies, human antibodies, chimeric antibodies, antibody fragments such as Fab fragments, F (ab ′) ₂ fragments, Fab ′ fragments or any other fragment known to those skilled in the art. It is.
In yet another embodiment, the present invention provides a method of generating a hybridoma cell line. In the method, for example, a mammal is immunized with a composition containing recombinant IFNα subtypes A, B2 and F, and a spleen cell derived from the mammal is fused with a myeloma cell line to produce a hybridoma. Selectively neutralizes one or more IFNα protein subtypes selected from the group consisting of subtypes 2, C, G, I, J1, K, 4a, 4b, WA and 1, but IFNα protein subtype D By identifying hybridoma cell lines that produce monoclonal antibodies that do not selectively neutralize.

As used herein, the term “neutralize” refers to at least one biological activity of an IFNα protein subtype as measured by an RG, CPE or monocyte differentiation assay as defined herein. Applies to antibody's ability to inhibit 40%. For example, the antibody is at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% of the biological activity of the IFNα protein subtype. % Neutralize. Biological activity of IFNα includes transcriptional activation of the MxA promoter (see eg, “RG” assay below), antiviral activity (eg, cytopathic effect (“CPE”) assay), and monocytes. The ability of SLE serum to differentiate into dendritic cells is included. Methods for determining% neutralization using RG and CPE assays are described herein.
As used herein, the phrase “not neutralizing” or “not significantly neutralizing” applies to the antibody neutralizing less than 40% of the biological activity of the IFNα protein subtype. In some cases, the neutralizing effect of the added antibody is measured by RG, CPE or monocyte differentiation assay. For example, the antibody is less than 35%, or less than 30%, or less than 25%, or less than 20%, or less than 15%, or less than 10%, or less than 8%, or less than 5% of biological activity, or Neutralize less than 3% or not even less than 1%.
An antibody of the invention can be an antibody variant, derivative or fragment. In one aspect, the antibody is isolated. In another aspect, the antibody is mixed with a suitable carrier. Antibodies can be isolated from any species (mouse, rat, monkey) or produced recombinantly. Examples of mouse monoclonal antibodies are antibodies designated ACO-1, ACO-2, ACO-3, ACO-4, ACO-5, ACO-6 and ACO-8. Also provided by the present invention (alone, in combination with a carrier or in culture) are hybridoma cell lines that produce these monoclonal antibodies.
Also provided by the present invention are polypeptides (including but not limited to immunoglobulin chains and CDRs) comprising antibodies, variants, derivatives or fragments thereof. Said polypeptide preferably binds to, inhibits and / or neutralizes IFNα as described above with the same or similar affinity and / or ability.
The present invention further provides anti-idiotype antibodies that react with either antibodies ACO-1 to ACO-6 or ACO-8. An anti-idiotype antibody is an antibody made against the unique determinants of a single antibody. Anti-idiotype antibodies are useful for detecting bound antibodies in immunoassays and other applications. Anti-idiotypic antibodies of the present invention include or are derived from any mammal (eg, but not limited to humans, mice, rabbits, rats, rodents, primates, etc.) Can do.

One or more of the above antibodies can be further combined with a carrier, a pharmaceutically acceptable carrier, or a medical device suitable for using the antibody or related composition in a diagnostic or therapeutic method. The carrier can be a liquid phase carrier or a solid phase carrier, such as beads, gels, or carrier molecules (eg, liposomes). The composition can optionally further comprise at least one further compound, protein or composition. Additional examples of “carriers” include therapeutically active agents, such as other peptides or proteins (eg, Fab ′ fragments, J-chains, other antibodies, toxins, etc.). For example, an anti-IFNα antibody, variant, derivative or fragment thereof of the present invention may comprise one or more molecular entities such as another antibody (eg to generate a bispecific or multispecific antibody), cytotoxin, cellular ligand Alternatively, it can be operably linked to an antigen (eg, by chemical binding, genetic fusion, non-covalent bonding or other methods). Thus, the present invention encompasses a wide variety of antibody conjugates, bispecific and multispecific molecules, and fusion proteins, regardless of whether they target the same epitope as the antibodies of the present invention.
Examples of additional carriers are organic molecules (also called modifying agents) or activating agents, which are covalently attached directly or indirectly to the antibodies of the invention. The binding of the molecule can improve pharmacokinetic properties (eg, in vivo serum half-life). Examples of organic molecules include, but are not limited to, hydrophilic polymer groups, fatty acid groups, or fatty acid ester groups. As used herein, the term “fatty acid” applies to, for example, monocarboxylic acids and dicarboxylic acids. As used herein, the term “hydrophilic polymer group” applies to organic polymers that are more soluble in water than in, for example, octane.

Hydrophilic polymers suitable for improving the antibodies of the present invention may be linear or branched, such as polyalkane glycols (eg, polyethylene glycol (PEG), monomethoxy-polyethylene glycol (mPEG), polypropylene glycol (PPG )), Carbohydrates (eg dextran, cellulose, oligosaccharides, polysaccharides etc.), polymers of hydrophilic amino acids (eg polylysine, polyarginine, polyaspartate etc.), polyalkane oxides (eg polyethylene oxide, polypropylene oxide etc.) and Polyvinyl pyrrolidone is included. Suitable hydrophilic polymers used with the antibodies of the invention can have a molecular weight of, for example, about 800 to about 150,000 daltons as a separate molecular entity. The hydrophilic polymer groups can be substituted with 1 to about 6 alkyl, fatty acid, or fatty acid ester groups. A hydrophilic polymer substituted with a fatty acid or fatty acid ester group can be prepared by using an appropriate method. For example, polymers containing amino groups are conjugated with fatty acids or carboxylates of fatty acid esters, and carboxylates activated on fatty acids or fatty acid esters (eg, activated with N, N-carbonyldiimidazole) are polymer hydroxyls. Can be conjugated with a group.
Fatty acids and fatty acid esters suitable for improving the antibodies of the present invention may be saturated or may contain one or more units of unsaturation. Examples of such include n-dodecanoate, cis-δ-9-octadecanoate, all cis-δ-5,8,11,14-eicosatetranoate, octanedioic acid, tetradecandioic acid, Examples include but are not limited to octadecanedioic acid, docosanedioic acid and the like. Suitable fatty acid esters include monoesters of dicarboxylic acids containing linear or molecular lower alkyl groups. A lower alkyl group can contain 1 to about 12, preferably 1 to about 6 carbon atoms.

In yet another aspect, the present invention provides a transgenic non-human animal, such as a transgenic mouse (also referred to herein as a “human MAb mouse”), wherein said mouse is a It expresses a fully human monoclonal antibody, similar to an antibody, that neutralizes at least one IFNα protein subtype. In a specific embodiment, the transgenic non-human animal is a transgenic mouse, which comprises a human heavy chain transgene and a human light chain transgene encoding all or part of an anti-alpha V antibody of the invention. Have To produce human antibodies, transgenic non-human animals can be immunized with purified or concentrated preparations of INFα protein subtypes A, B and F. Examples of transgenic non-human animals are, for example, transgenic mice that can generate various isotypes (eg, IgG, IgA and / or IgM) of human monoclonal antibodies against IFNα via VDJ recombination and isotype switching. It can be. Isotype switching can occur, for example, by classical or non-classical isotype switching.
Accordingly, in another embodiment, the present invention provides a transgenic non-human animal expressing a human antibody, as described above, eg, an isolated cell derived from a transgenic mouse or a cell isolated from said animal. Subsequently, the isolated B cells can be immortalized by fusion with immortalized cells to provide a source of human antibodies (eg, hybridomas). These hybridomas are also included within the scope of the present invention.
The invention further provides at least one IFNα-related condition known in the art and / or described herein in a cell, tissue, organ, animal and / or patient and / or before, after, or At least one antibody method or composition is provided for diagnosis during that time. It is also used for prognosis or to monitor disease progression.

Also provided is a composition comprising at least one anti-IFNα antibody, variant, derivative or fragment thereof of the present invention, said composition being known in the art and / or described herein. To modulate or alleviate IFNα associated symptoms in cells, tissues, organs, animals and / or patients and / or before, after, or during related symptoms, or treat at least one IFNα related symptoms In order to be administered in an effective amount. Compositions include, for example, pharmaceutical and diagnostic compositions / kits, which include, for example, a pharmaceutically acceptable carrier and at least one anti-IFNα antibody, variant, derivative or fragment thereof of the invention. As noted above, the composition can further include another antibody or therapeutic agent that also provides a variety of therapeutic methods adapted to provide maximum therapeutic benefit.
Alternatively, the compositions of the invention can be administered together with other therapeutic agents and cytotoxic agents, whether combined with them or administered in the same formulation. They may be administered with such agents simultaneously (eg, in one composition or separately) or may be administered before or after administration of such agents. Such agents can include corticosteroids, nonsteroidal immunosuppressants, antimalarials, and nonsteroidal anti-inflammatory drugs. The composition can be combined with the administration of another therapy, such as corticosteroids, nonsteroidal immunosuppressants, antimalarials, and nonsteroidal anti-inflammatory drugs.

In another aspect, the present invention is selected from the group consisting of interferon alpha (“IFNα”) protein subtypes A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b and WA. A method of selectively neutralizing the biological activity of at least two IFNα protein subtypes without selectively neutralizing at least one biological activity of IFNα protein subtype D, wherein The activity is activation of the MxA promoter or antiviral activity. The method involves contacting a sample suspected of containing the subtype with a monoclonal antibody that selectively neutralizes the subtype. Examples of such antibodies include, but are not limited to, antibodies designated ACO-1, ACO-2, ACO-3, ACO-4, ACO-5 and ACO-6.
Various therapies are provided by the present invention. For example, the specification includes at least one selected from the group consisting of interferon alpha (“IFNα”) protein subtypes A, 2, B2, C, F, G, H2, I, K, 4a, 4b and WA. Disclosed is a method for alleviating symptoms associated with abnormal expression of two IFNα protein subtypes in a subject without binding to IFNα protein subtypes D and 1, wherein the method selectively neutralizes the subtypes By administering an effective amount of the antibody to the subject. Examples of such antibodies are provided above.
The present invention relates to at least one IFNα protein selected from the group consisting of interferon alpha (“IFNα”) protein subtypes A, 2, B2, C, F, G, H2, I, K, 4a, 4b and WA. Provided is a method for treating a disease or symptom resulting from abnormal expression of a subtype in a subject without binding to IFNα protein subtypes D and 1, the method comprising an antibody that selectively neutralizes the subtype By administering to the subject an effective amount of Examples of such antibodies are provided above. Further provided is a method of immunizing a mammal by administering a composition comprising recombinant IFNα subtype A, B2 and F. In another embodiment, the immunization method comprises administering to the mammal a composition consisting essentially of IFNα subtypes A, B2 and F, a pharmaceutically acceptable carrier, and optionally one or more adjuvants. . In yet another aspect, immunization results in antibodies that neutralize IFNα protein subtypes A, B2, and F but not IFNα protein subtypes D and 1. In yet another aspect, the methods and compositions neutralize IFNα4a but not IFNα4b (eg, ACO-3).
For use in vivo, the antibodies and compositions of the invention are administered or delivered to a patient (eg, a human subject) at a therapeutically effective dose to neutralize the selected IFNα subtype. Furthermore, by administering or delivering an effective amount of an antibody or composition of the present invention, an IFNα related symptom, such as SLE, diabetes, psoriasis or AIDS symptom, can be routed to an antibody-based clinical product. Can be used to treat or alleviate a subject. Many clinical products are known in the art, such as injection or infusion.

Dosage Form The dosage unit for using the antibodies of the invention can be a single compound or a mixture thereof with other compounds. The compounds may be mixed together and can form ionic bonds or even covalent bonds. One or more antibodies of the present invention can be administered in an oral, intravenous (bolus or infusion), intraperitoneal, subcutaneous, or intramuscular fashion, all using dosage forms well known to those of the pharmaceutical industry. . Depending on the specific location or method of delivery, various dosage forms such as tablets, capsules, pills, powders, granules, elixirs, tinctures, suspensions, syrups, and emulsions are used herein. The antibodies of the invention can be provided to patients in need of treatment comprising neutralization of certain described IFNα subtypes. Although antibodies are generally hydrophilic, they can be administered in any of the known salt forms.
The antibody is typically based on the intended mode of administration, and further in accordance with normal pharmaceutical practice with appropriate pharmaceutical salts, buffers, swelling agents, excipients and / or carriers (herein As a mixture with a pharmaceutically acceptable carrier or carrier substance). Depending on the best location for administration, the antibody may be formulated to provide maximal and / or routine administration for a particular form, eg for oral, rectal, topical, intravenous injection or parenteral administration. Antibodies such as humanized forms of ACO-1, ACO-2, ACO-3, ACO-4, ACO-5, ACO-6 and ACO-8 can be administered alone in a pharmaceutically acceptable carrier. Good but can also be combined. The carrier may be a solid or a liquid depending on the type and / or location of administration selected.

Techniques and compositions for making useful dosage forms using the present invention are described in one or more of the following references: Ansel, Introduction to Pharmaceutical Dosage Forms 2 nd Edition (1976); Remington's Pharmaceutical Sciences , 17th ed. (Mack Publishing Company, Easton, PA 1985); Advances in Pharmaceutical Sciences (David Ganderton, Trevor Jones, Eds, 1992); Advances in Pharmaceutical Sciences Vol 7. (David Ganderton, Trevor Jones, James McGinity, Eds, 1995); Aqueous Polymeric Coatings for Pharmaceutical Dosage Forms (Drugs and the Pharmaceutical Sciences, Series 36 (James McGinity, Ed. 1989); Pharmaceutical Particulate Carriers: Therapeutic Applications: Drugs and Pharmaceutical Sciences, Vol 61 (Alain Rolland, Ed. 1993) Drug Delivery to the Gastrointestinal Tract (Ellis Horwood Books in the Biological Sciences. Series in Pharmaceutical Technology; JG Hardy, SS Davis, Clive G. Wilson, Eds.); Modern Pharmaceutics Drugs and the Pharmaceutical Scien The relevant parts of the literature such as ces, Vol 40 (Gilbert S. Banker, Christopher T. Rhodes, Eds) are hereby incorporated by reference.
The antibodies of the invention can be administered in the form of liposome delivery systems, such as small unilamellar thin film vesicles, large unilamellar thin film vesicles and multilamellar vesicles (whether charged or uncharged). Liposomes can include one or more phospholipids (eg, cholesterol), stearylamine and / or phosphatidylcholine, mixtures thereof, and the like.
The antibodies can also be conjugated to one or more soluble, biodegradable, biotolerable polymers as drug carriers or as prodrugs. Such polymers include: polyvinyl pyrrolidone, pyran copolymers, polyhydroxylpropyl methacrylamide-phenol, polyhydroxyethyl aspartate-midephenol, or polyethylene oxide-polylysine substituted with palmitoyl residues, mixtures of the foregoing, etc. . Furthermore, the antibody can be conjugated with one or more biodegradable polymers to achieve controlled release of the antibody. Biodegradable polymers used in the present invention include: polylactic acid, polyglycolic acid, copolymers of polylactic acid and polyglycolic acid, polyepsilon caprolactone, polyhydroxybutyric acid, polyorthoesters, polyacetals, polydihydropyrans , Polycyanoacylates, and hydrogel cross-linked or amphiphilic block copolymers, mixtures of the foregoing, and the like.

For direct delivery to the nasal passage, sinus, mouth, throat, esophagus, trachea, lung, and alveoli, the antibody can also be delivered as an intranasal form by using an appropriate intranasal vehicle. it can. For skin and transdermal delivery, the antibody can be delivered using lotions, creams, oils, elixirs, serum, transdermal skin patches, etc., as is well known to those skilled in the art. Parenteral and intravenous forms can also be adapted to pharmaceutically acceptable salts and / or minerals and other, so that they can be adapted to the type of injection or delivery selected (eg, buffered solution, isotonic solution). Substances can be included. Examples of dosage forms useful for antibody administration may include the following forms.
Injectable solutions : Parenteral compositions suitable for administration by injection are prepared by stirring 1.5% by weight of active ingredient in deionized water and mixing, for example, with up to 10% by volume propylene glycol and water. The solution is made isotonic with sodium chloride and further sterilized using, for example, ultrafiltration. Sterile injectable solutions are prepared by incorporating the required amount of the active compound into a suitable solvent, optionally containing the other ingredients listed above, followed by filter sterilization. Generally, dispersions are prepared by incorporating a variety of sterile active ingredients into a sterile vehicle having a basic dispersion medium. In the case of sterile powders for preparing sterile injectable solutions, methods useful for the preparation of dry powders include vacuum drying, spray freezing, vacuum drying under heat, and freeze drying techniques, Depending on the technique, the active ingredient plus any desired ingredient to be added is obtained from the solution previously filter sterilized. The antibodies of the invention can be delivered as microparticles or nanoparticles in injectable form or by pulmonary or other delivery.
Suspension : In one embodiment, the aqueous suspension is a finely divided active ingredient, each 5 mL, eg 0.001-1,000 mg, 200 mg sodium carboxymethylcellulose, 5 mg sodium benzoate, 1.0 g sorbitol solution, And saline (0.01, 0.1, 1, 5 or 10 mL) can be prepared for administration.
An effective dose of the antibody can include an amount that upon reconstitution results in a concentration of about 1.0 μg / mL to about 1000 mg / mL in a wet / dry system. However, lower and higher concentrations are also effective and depend on the intended delivery vehicle. For example, solution formulations will differ from transdermal patches, lungs, transmucosal methods, or osmotic or micropump methods.

Provided herein are formulations comprising the antibodies of the invention. The formulations of the present invention can be prepared by a process comprising mixing in an aqueous diluent a preservative selected from the group consisting of at least one antibody of the present invention and the following: phenol, m-cresol, p-cresol, o-cresol, chlorocresol, benzyl alcohol, alkylparabens (methyl, ethyl, propyl, butyl, etc.), benzalkonium chloride, benzoethonium chloride, sodium dehydroacetate and thimerosal or mixtures thereof. Mixing of the antibody and preservative in the aqueous diluent is performed using conventional dissolution and mixing methods. For example, at least one weighed antibody in a buffer solution is mixed with the desired preservative in a sufficient amount of buffer solution to provide the desired concentration of antibody and preservative. Variations on this method will be known to those skilled in the art. For example, the order in which the ingredients are added, whether to use another additive, the preparation temperature and pH of the formulation are all factors that can be optimized for the concentration and method of administration used.
The formulation contains one or more preservatives or stabilizers such as phenol, m-cresol, p-cresol, o-cresol, chlorocresol, benzyl alcohol, phenylmercury nitrite, phenoxyethanol, formaldehyde, chlorobutanol, magnesium chloride (Eg hexahydrate), alkylparabens (methyl, ethyl, propyl, butyl, etc.), benzalkonium chloride, benzoethonium chloride, sodium dehydroacetate and thimerosal or mixtures thereof can be included in the aqueous diluent. . Any suitable concentration or mixture as known in the art can be used, for example 0.001-5% or any range or value therein, such as but not limited to: 0.001, 0.003 , 0.005, 0.009, 0.01, 0.02, 0.03, 0.05, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8 , 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.3, 4.5, 4.6 , 4.7, 4.8, 4.9, or any range or value within it. Non-limiting examples include: no preservative or with preservative, eg 0.1-2% m-cresol (eg 0.2, 0.3, 0.4, 0.5, 0.9, 1.0%), 0.1-3% Benzyl alcohol (eg, 0.5, 0.9, 1.1, 1.5, 1.9, 2.0, 2.5%), 0.001-0.5% thimerosal (eg, 0.005, 0.01), 0.001-2.0% phenol (eg, 0.05, 0.25, 0.28, 0.5, 0.9, 1.0%), 0.0005-1.0% alkyl parabens (eg 0.00075, 0.0009, 0.001, 0.002, 0.005, 0.0075, 0.009, 0.01, 0.02, 0.05, 0.075, 0.09, 0.1, 0.2, 0.3, 0.5, 0.75, 0.9 , And 1.0%).

The compositions and formulations can be provided to patients as clear solutions or as dual vials (including lyophilized antibody vials reconstituted with a second vial containing an aqueous diluent). Single solution vials or dual vials that require reconstitution can be reused many times and are sufficient for single-cycle or multi-cycle patient treatment and are therefore more convenient than previously available treatment regimens Can be provided. Approval devices containing these single vial systems include pen injector devices for solution delivery, such as BD Pens, BD Autojectore, HumaJect ^™ , NovoPen ^™ , B-DTMPen, AutoPen ^™ and OptiPen ^™ , Genotropin ^™ Genotronorm Pen ^™ , Humatro Pen ^™ , Reco-Pen ^™ , Roferon Pen ^™ , Biojector ^™ , Iject ^™ , J-tip Needle-Free Injector ^™ , Intraject ^™ , Medi-Ject, for example Becton Dickensen (Franklin Lakes, NJ (available at bectondickenson.com); Disetronic (Burgdorf, Switzerland (available at disetronic.com.)); Bioject (Portland, Oregon (available at bioject.com)); National Medical Products, Weston Medical (Peterborough, UK (available at Weston-medical.com)) and Medi-Ject Corp (Mineapolis, Minn (available at Mediject.com)).
The present invention provides a product comprising packaging material and at least one vial, said vial comprising at least an antibody solution of the present invention, optionally with a buffer and / or preservative formulated in an aqueous diluent, In such cases, the packaging material may have such a solution for 1, 2, 3, 4, 5, 6, 9, 12, 18, 20, 24, 30, 36, 40, 48, 54, 60, 72 hours or You can have a sticky note indicating that it can be held for a longer period of time. The present invention further comprises a product comprising packaging material, a first vial and a second vial, said first vial comprising at least one lyophilized antibody of the present invention, wherein the second vial is a formulated buffer. Containing the aqueous diluent of the agent or preservative, the packaging will instruct the patient to reconstitute the antibody with the aqueous diluent to create a solution that can be maintained for 24 hours or longer. Includes sticky notes.

Kit : The present invention also includes a pharmaceutical kit useful, for example, in the treatment of disease, wherein the kit can be provided to be diluted or resuspended into a therapeutically effective amount of the antibody. One or more containers can be included. Such kits may further include various common one or more kit components, such as one or more pharmaceutically acceptable carriers, containers containing liquids, additional containers, if desired, which will be apparent to those skilled in the art. Etc. can be included. Printed instructions (as an insert or as a sticky note) may also be included in the kit, indicating the amount of ingredient to be administered, administration guidelines, and / or guidelines for mixing the ingredients. Although identified materials and conditions are important to the practice of the present invention, it will be understood that unidentified materials and conditions are not excluded unless they interfere with the recognition of the benefits of the present invention.
Antibody : Antibodies of the present invention include monoclonal antibodies. They may also be fragments, antibody derivatives or antibody variants having an IFNα neutralizing function. They may be chimeric, humanized or fully human antibodies. Functional fragments of antibodies include, but are not limited to, Fab, Fab ′, Fab2, Fab′2, and single chain variant regions. Antibodies can be used in cell culture, eg, bacteria, yeast, plants or plant cells, insects or insect cells, nucleophilic cells, or various animals (bovine, rabbit, goat, mouse, rat, hamster, guinea pig, sheep, dog, cat. , Monkeys, chimpanzees, baboons and the like). As long as the fragment or derivative retains the binding specificity or neutralizing ability as the antibody of the present invention, the above can be used. Antibodies can be tested for specificity under a set of conditions by comparing binding with the appropriate antigen to binding with an irrelevant antigen or antigen mixture. This is considered to be specific if the antibody binds at least 2, 5, 7 and even 10 times more strongly with the appropriate antigen than with an irrelevant antigen or antigen mixture. Specific assays for determining specificity, such as ELISA, are described below.
Antibodies are also characterized by their ability to neutralize one or more biological activities of the IFNα protein subtype. Said ability is, for example, but not limited to the ability of SLE serum to cause transcriptional activation of the MxA promoter or another promoter induced by IFNα, antiviral activity, differentiation of monocytes into dendritic cells .

  The monoclonal antibodies of the present invention can be generated using conventional hybridoma technology known in the art and described in detail in the literature. For example, a hybridoma can be any suitable immortal cell line (eg, myeloma cell line (eg, NSO, NS1, NS2, AE-1, L.5,> 243, P3X63Ag8.653, Sp2SA3, Sp2MAI, Sp2SS1, Sp2SA5, U397, MLA144). , ACTIV, MOLT4, DA-1, JURKAT, WEHI, K-562, COS, RAJI, NIH3T3, HL-60, MLA144, NAMAIWA, NEURO2A, CHO, PerC.6, YB2 / O, etc. Non-limiting), heteromyeloma, fusion products thereof, or any cell or fusion cell derived therefrom, or any other suitable cell line known in the art (eg www.atcc.org, www.lifetech for example, .com.) and fused with antibody producing cells. Such antibody producing cells are, for example (but not limited to): isolated or cloned spleen, peripheral blood, lymph, tonsil or other immune or B cell containing cells, or heavy or light chain constant or variable Or any other cell that expresses a framework or CDR sequence (the sequence may be expressed as an endogenous or heterologous nucleic acid, or a recombinant or endogenous virus, bacterium, algae, prokaryotic cell, amphibian, insect, Reptile, mammal, rodent, horse, sheep, goat, sheep, primate, eukaryotic genomic DNA, cDNA, rDNA, mitochondrial DNA or RNA, chloroplast DNA or RNA, hnRNA, mRNA, tRNA, one Expressed as a single strand, double strand, triple strand, hybridizing strand, etc., or any combination thereof). Antibody-producing cells can also be obtained from the peripheral blood of humans or other suitable animals immunized with the antigen of interest, or preferably from the spleen or lymph nodes. Any other suitable host cell can also be used for expression of a heterologous or endogenous nucleic acid encoding an antibody of the invention, a particular fragment or variant thereof. Fusion cells (hybridomas) or recombinant cells can be isolated using selective culture conditions or other suitable known methods and cloned by limiting dilution or cell sorting or other known methods.

  Other suitable methods for producing or isolating antibodies with essential specificity, including but not limited to selecting recombinant antibodies from peptide or protein libraries, methods known in the art (See US Pat. No. 4,704,692; 5,723,323; 5,763,192; 5,814,476; 5,817,483; 5,824,514; 5,976,862), and the library can be used for display live such as bacteriophages, ribosomes, oligonucleotides, RNA, cDNA, etc. Rally (but not limited to), for example, various vendors (eg Cambridge Antibody Technologies (Cambridgeshire, UK), MorphoSys (Martinsreid / Planegg, Del.), Biovation (Aberdeen, Scotland, UK), BioInvent (Lund, Sweden) ), And Antititope (Canbridge, UK)). Another method is a method by immunization of a transgenic animal known in the art and / or capable of producing a human antibody repertoire, as described herein, wherein said transgenic animal is For example, SCID mice (Nguyen et al. 1977, Microbiol Immunol 41: 901-907; Sandhu et al 1966, Crit Rev Biotechnol 16: 95-118; Eren et al. 1998, Immunol 93: 154-161). Such techniques include (but are not limited to): ribosome displays (Hanes et al. 1997, Proc Natl Acad Sci USA, 94: 4937-4942; Hanes et al. 1998, Proc Natl Acad Sci USA, 95 : 14130-14135); single cell antibody production techniques (eg, sorted lymphocyte antibody method (“SLAM”) (US 5,627,052; Wen et al. 1987, J Immunol 17: 887-892; Babcook et al. Proc Natl Acad Sci) USA 1996, 93: 7843-7848); gel microdroplets and flow cytometry (Powell et al. 1990, Biotechnol 8: 333-337); One Cell System (Cambridge, Mass) (Gray et. Al. 1995, J Imm Meth 182: 155-163; Kenny et al. 1995, Bio / Technol 13: 787-790); B cell sorting (Steenbakkers et al. 1994, Molec Biol Reports 19: 125-134).

Antibody variants of the invention can also be produced by delivering a polynucleotide encoding the antibody of the invention to a suitable host cell, for example, transgenic animals or mammals that produce such antibodies in their milk (eg, goats). , Cattle, horses, sheep, etc.). These methods are known in the art and are further described, for example, in US 5,827,690; 5,849,992; 4,873,316; 5,849,992; 5,994,616; 5,565,362; and 5,304,489.
As used herein, the term “antibody variant” applies to post-translational modifications to the linear polypeptide sequence of an antibody or fragment. For example, US 6,602,684B1 describes methods for producing modified glycoforms of antibodies with enhanced Fc-mediated cytotoxicity (including intact antibodies, antibody fragments, or fusion proteins containing regions equivalent to the Fc region of immunoglobulins) and The glycoprotein so produced is described.
Antibody variants also deliver the polynucleotides of the invention to produce such antibodies, specific parts or variants in plant parts or cells cultured therefrom (eg tobacco, corn and cultivated plant cells). Can be produced by providing (but not limited to) duckweed. For example, Cramer et al. (Curr Top Microbiol Immunol 1999, 240: 95-118) and references cited therein, for example, produce transgenic tobacco leaves that express large amounts of recombinant protein using inducible promoters. Is described. Transgenic corn is used for the expression of mammalian proteins at commercial production levels, and they have biological activity equivalent to that produced in other recombinant systems or purified from natural sources ( See, for example, the following documents and references cited therein: Hood et al. Adv Exp Med Biol 1999, 464: 127-147). Antibody variants are also produced in large quantities from transgenic plants (including tobacco seeds and potato tubers) containing antibody fragments (eg, single chain antibodies (scFv)) (eg, the following references and references therein): (See Conrad et al. 1998, Plant Mol Biol 38: 101-109). Accordingly, the antibodies of the present invention can also be produced using transgenic plants according to known methods.
An antibody derivative modifies immunogenicity, for example by adding exogenous sequences, or reduces, enhances or modifies binding, affinity, on-rate, off-rate, avidity, half-life or any other suitable property Can be generated. Generally, some or all of the non-human or human CDR sequences are maintained, while the variable and constant region non-human sequences are replaced with human or other amino acids. In general, the CDR residues directly and most substantially affect antigen binding.

Monoclonal antibodies produced in mice (or other non-human animals) have the risk that humans will produce antibodies against the MAb of the animal in therapy. Non-human antibodies can reduce the effectiveness of animal MAbs and can also lead to allergic reactions. This problem can be avoided by constructing antibodies that are not recognized as foreign. Methods for constructing such antibodies are known in the art and are often based on transplantation of the CDR regions of animal MAbs into the immunoglobulin skeleton of the target host. The most common method is humanization, which is achieved by grafting animal antibody CDRs into a human immunoglobulin framework. In some cases, several amino acid residues of the animal antibody framework are maintained to preserve the integrity of the antigen binding site.
Humanization or manipulation of the antibodies of the present invention can be performed by any known method (eg, US 5,723,323; 5,976,862; 5,824,514; 5,817,483; 5,814,476; 5,763,192; 5,723,323; 5,766,886; 5,714,352; 6,204,023; 6,180,370; 5,693, 4,816,567, including but not limited to). Methods for computer modeling and humanization of antibodies based on variable regions are known to those skilled in the art (see, eg, Tsurushita et al. 2005, Humanized Antibodies and their Applications 36 (1): 69 -83, which is incorporated herein by reference).
In one humanization method, instead of transplanting the entire animal CDR into the human framework, only the specificity-determining residue (SDR) (the most important residue for antibody-ligand binding) is the human framework. (Kashniri et al 2005, Humanized Antibodies and their Applications 36 (1): 25-34, the contents of which are hereby incorporated by reference). In another approach to humanization, human framework sequences from the human germline gene set are selected in order of structural similarity of the human CDRs to the framework of the CDRs of the animal to be humanized (Hwang et al. 2005, Humanized Antibodies and their Applications 36 (1): 35-42, the contents of which are hereby incorporated by reference).

Framework shuffling is yet another approach that allows the identification of human frameworks that take advantage of the functional characteristics of the CDRs of mice or other animals without the need for rational design or structural information. In this method, a combinatorial Fab library is generated by in-frame fusion of corresponding human framework pools containing all known human germline heavy and light chain genes with the CDRs of animal MAbs. Subsequently, this Fab library can be screened for antigen binding. The light and heavy chains of the parental Mab can be successfully humanized in a further selection process (Dall'Acqua et al 2005, Humanized Antibodies and their Applications 36 (1): 43-60, see above for reference) Included in this specification).
In another approach (at least one FDA-approved antibody used successfully in humans using this approach has been successfully generated), a series of rodent antibodies from rodents to human forms using guided selection. A transition can be achieved by the use of human antibody panels and phage or ribosome libraries with characteristics similar to the starting rodent antibody (Osbourn et al 2005, Humanized Antibodies and their Applications 36 (1): 61-68, The contents of said documents are hereby incorporated by reference). In this approach, a human antibody panel or V region is screened for binding of the antigen of interest. The resulting antibody is completely human.
Techniques for making partially or fully human antibodies are known in the art, and any such technique can be used. According to one embodiment, fully human antibody sequences are generated in transgenic mice that have been engineered to express human heavy and light chain antibody genes. Various strains of such transgenic mice have been generated and they can produce various classes of antibodies. For sustained production of the desired antibody, a hybridoma cell line can be generated by fusing B cells of a transgenic mouse producing the desired antibody (see, eg, Russel et al 2000 (April), Infection and Immunity 1820-1826; Gallo et al. 2000, European J immune 30: 534-540; Green 1999, J immune Methods 231: 11-23; Yang et al 1999, J Leukocyte Biolgy 66: 401-410; Yang 1999, Cancer Res 59 (6): 1236-1243; Jakobovits 1998 Advanced Drug Delivery Reviews 31: 33-42; L. Green and Jakobovits 1998, J Exp Med 188 (3): 483-495; Jakobovits 1998, Exp Opin Invest Drugs 7 (4): 607-614; Tsuda et al. 1997, Genomics 42: 413-421; Sherman-Gold 1997, Genetic Engineering News 17 (14); Mendez et al. 1997, Nature Genetics 15 : 146-156; Jakobovits 1996, WEIR'S HANDBOOK OF EXPERIMENTAL IMMUNOLOGY, The England Immunology System Vol. IV, 194.1-194.7; Jakobovits 1995, Current Opinion in Biotechnology 6: 561-566; Mendez et al 1 995, Genomics 26: 294-307; Jakobovits 1993, Nature 362 (6417): 255-258; Jakobovits et al. 1993, Proc Natl Acad Sci USA 90 (6): 2551-2555; US Pat. No. 6,075,181).

Human monoclonal antibodies can also be produced by hybridomas comprising B cells obtained from non-human transgenic animals, eg, transgenic mice (which hybridomas are human heavy chain transgenes and light chains fused to immortalized cells). Having a genome containing the transgene). The antibodies of the present invention can also be modified to produce chimeric antibodies. A chimeric antibody is an antibody in which the various domains of the antibody heavy and light chains are encoded by DNA from more than one species (see, eg, US Pat. No. 4,816,567).
Any of the recombinant antibodies of the invention or fragments thereof can be used provided that they are interferon alpha (“IFNα”) protein subtypes A, 2, B2, C, F, G, H2, I, J1 Can react specifically with at least two protein subtypes selected from the group consisting of K, 4a, 4b and WA, but only if at least one biological activity of IFNα protein subtype D is not neutralized. It is done. The antibody can also neutralize IFNα as measured by known bioassays, such as the activation of the MxA promoter or antiviral activity. One such antibody specifically reacts with one or more IFNα subtypes A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b and WA, but the sub An antibody that does not react with type D, further comprising a CDR, derivative or portion thereof selected from:
V _H 1 having the amino acid sequence of SEQ ID NO: 4;
V _H 2 having the amino acid sequence of SEQ ID NO: 6;
V _H 3 having the amino acid sequence of SEQ ID NO: 8;
V _L 1 having the amino acid sequence of SEQ ID NO: 12;
V _L 2 having the amino acid sequence of SEQ ID NO: 14;
V _L 3 having the amino acid sequence of SEQ ID NO: 16; derivatives and combinations thereof

The antibody also has IFNα subtypes A, 2, B2, C, F, G, H2, I, J1, wherein one or more amino acids are deleted, added, substituted and / or inserted in these amino acid sequences. , K, 4a, 4b and WA and / or antibody fragments that specifically react with WA, and are also included within the scope of the present invention.
In the present invention, one or more deletions, substitutions, insertions or additions of one or more amino acids in the amino acid sequence are deleted, substituted, inserted and / or added at one or more locations in the immunoglobulin backbone. It applies to amino acid modifications and / or mutations. One or more deletions, substitutions, insertions and / or additions can occur simultaneously in the same amino acid sequence. Furthermore, the amino acid residues to be substituted, inserted or added may be natural or non-natural. Examples of natural amino acid residues include L-alanine, L-asparagine, L-aspartic acid, L-glutamine, L-glutamic acid, glycine, L-histidine, L-isoleucine, L-leucine, L-lysine, L -Methionine, L-phenylalanine, L-proline, L-serine, L-threonine, L-tryptophan, L-tyrosine, L-valine, L-cysteine and the like.
Examples of amino acid residues that can be substituted can be found, for example, in one or more of the following groups:
Group A: leucine, isoleucine, norleucine, valine, norvaline, alanine, 2-aminobutanoic acid, methionine, O-methylserine, t-butylalanine, cyclohexylalanine;
Group B: aspartic acid, glutamic acid, isoaspartic acid, isoglutamic acid, 2-aminoadipic acid, 2-aminosuberic acid;
Group C: asparagine, glutamine;
Group D: lysine, arginine, ornithine, 2,4-diaminobutanoic acid, 2,3-diaminopropionic acid;
Group E: proline, 3-hydroxyproline, 4-hydroxyproline;
Group F: serine, threonine, homoserine; and group G: phenylalanine, tyrosine.

The term “antibody derivative” further includes “linear antibodies”. Methods for making linear antibodies are known in the art and are described in the following literature: Zapata et al. 1995, Protein Eng 8 (10): 1057-1062. Briefly, a linear antibody contains a pair of tandem Fd segments (V _H -C _H 1 -V _H -C _H 1), which form a pair of antigen binding regions. Linear antibodies can be bispecific or monospecific.
The antibodies of the present invention can be recovered and purified from recombinant cell cultures by known methods, including but not limited to: protein A purification, ammonium sulfate or ethanol precipitation, acid extraction, anion or cation. Ion exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. High performance liquid chromatography ("HPLC") can also be used for purification.
The antibodies of the present invention include products purified in nature, chemically synthesized products, and from eukaryotic hosts (eg, yeast, higher plants, insects and mammalian cells) by recombinant techniques, and separately. Includes products produced from prokaryotic cells as described above.
In some aspects of the invention, it may be useful to label the antibody for detection or for therapy. Methods for conjugating antibodies to these substances are known in the art. For purposes of illustration only, the antibody can be labeled with a detectable moiety (eg, a radioactive atom, a chromophore, a fluorophore, etc.). Such labeled antibodies can be used for diagnostic techniques in vivo or in isolated test samples. The antibody can also be conjugated, for example, to a pharmaceutical substance (eg, a chemotherapeutic agent or a toxin). They can be linked to cytokines, ligands, and other antibodies. Suitable drugs for conjugation with antibodies to achieve anti-tumor effects include cytokines such as interleukin 2 (IL-2) and tumor necrosis factor (TFN); photosensitizers (used for photodynamic therapy) ), Aluminum (III) phthalocyanine tetrasulfonate, hematoporphyrin and phthalocyanine; radionuclides such as iodine-131 ( ¹³¹ I), yttrium-90 ( ⁹⁰ Y), bismuth- ²¹² ( ²¹² Bi), bismuth- ²¹³ ( ²¹³ ) Bi), technetium- ^99m ( ^99m Tc), rhenium-186 ( ¹⁸⁶ Re) and rhenium-188 ( ¹⁸⁸ Re); antibiotics such as doxorubicin, adriamycin, daunorubicin, methotrexate, daunomycin, neocarzinostatin and carboplatin; bacterial Plant and other toxins such as diphtheria toxin, Pseudomonas exotoxin A, Staphylococcus enterotoxin Element A, abrin A toxin, ricin A (deglycosylated ricin A and natural ricin A), TGF-α toxin, Chinese cobra (naja naja atra), and gelonin (plant toxin); Ribosome inactivating proteins from bacteria and fungi, such as restrictocin (ribosomal inactivating protein produced by Aspergillus restrictus), saporin (ribosomal inactivating protein from Saponaria officinalis) and RNase Tyrosine kinase inhibitors; ly207702 (difluorinated purine nucleosides); liposomes containing anti-cystic drugs (eg, antisense oligonucleotides, toxin-encoding plasmids, methotrexate, etc.); and other antibodies or antibody fragments such as F ( ab) Murrell.

For preparations comprising antibodies covalently linked to an organic molecule, they can be prepared by any suitable method, for example by reaction with one or more modifying agents. Examples of such include modification and activation groups. As used herein, “modifiers” are applied to suitable organic groups that contain activating groups (eg, hydrophilic polymers, fatty acids, fatty acid esters). Suitable examples of these are provided above. An “activating group” is a chemistry that can react with a group that exhibits a second chemistry under appropriate conditions, thereby forming a covalent bond between the modifying agent and the second chemistry group. Is a component or a functional group. Examples of such are electrophilic groups such as tosylate, mesylate, halo (eg chloro, bromo, fluoro, iodo), N-hydroxysuccinimidyl ester (NHS) and the like. Activating groups that can react with thiols include, for example, maleimide, iodoacetyl, acrylolyl, pyridyl disulfide, 5-thiol-2-nitrobenzoic acid thiol (TNB-thiol), and the like. Aldehyde functional groups can be coupled to amide- or hydrazide-containing molecules, and azide groups can react with trivalent phosphorus groups to form phosphamide or phosphimide linkages. Suitable methods for introducing activating groups into the molecule are known in the art (see, eg, Hermanson, 1996, Bioconjugate Techniques, Academic Press: San Diego, Calif). The activating group can be directly linked to an organic group (eg, hydrophilic polymer, fatty acid, fatty acid ester) or a linker component (eg, a divalent C ₁ -C ₁₂ group (one or more carbon atoms are heteroatoms such as oxygen Suitable linker components include, for example, tetraethylene glycol, and modifiers that include the linker component include, for example, mono-Boc-alkyl diamines (eg, Mono-Boc-ethylenediamine, mono-Boc-diaminohexane) is reacted with fatty acid in the presence of 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (EDC), and between the free amine and fatty acid carboxylate The Boc protecting group can be conjugated with another carboxylate as described. Removal from the product by treatment with trifluoroacetic acid (TFA) to expose the amine, or reaction with maleic anhydride to cyclize the resulting product to produce an activated maleimide derivative of fatty acid May be.
The modified antibody of the present invention can be produced by reacting a human antibody or antigen-binding fragment with a modifying agent. For example, by utilizing amine reactive modifiers, such as NHS esters of PEG, organic components can be conjugated to antibodies in a position non-specific manner. Modified human antibodies or antigen-binding fragments can also be prepared by reducing disulfide bonds (eg, intrachain disulfide bonds) of antibodies or antigen-binding fragments. Subsequently, the reduced antibody or antigen-binding fragment can be reacted with a thiol-reactive modifying agent to produce the modified antibody of the present invention. Modified human antibodies or antigen-binding fragments in which an organic moiety is bound to a specific position of an antibody of the invention can be prepared using an appropriate method, such as reverse proteolysis (see generally below). (Hermanson 1996, Bioconjugate Techniques, Academic Press: San Diego, Calif.).

Preparation and isolation of proteins and polypeptides : Polypeptides and proteins are necessary components in the various methods of the present invention. For example, recombinant antibodies, variants, derivatives and fragments thereof may be obtained using commercially available automated peptide synthesizers such as those manufactured by Perkin Elmer / Applied Biosystems, model 430A or 431A (Foster City, CA, USA). Can be obtained by chemical synthesis. The synthesized protein or polypeptide can be precipitated and further purified, for example, by high performance liquid chromatography (HPLC). Alternatively, proteins and polypeptides can be obtained by known recombination methods described herein using the host cells and vector systems described above. They can also be prepared by enzymatic digestion or cleavage of naturally occurring proteins.
Proteins and peptides are isolated or isolated by standard methods including chromatography (eg, ion exchange, affinity and sizing column chromatography), centrifugation, differential solubility, or any other standard technique for protein purification. Can be purified. Alternatively, affinity tags such as hexa-His (Invtrogen), maltose binding domain (New England Biolabs), influenza coat sequence (Kolodziej et al. 1991, Methods Enzymol 194: 508-509), and glutathione-S-transferase Easy purification can be achieved by binding to the peptides of the invention and passing through an appropriate affinity column. Isolated peptides can also be physically characterized using techniques such as proteolysis, nuclear magnetic resonance, and X-ray crystallography.
It is well known that modifications can be made to any peptide to provide a peptide with altered properties. The peptides used in the present invention can be modified to include unnatural amino acids. Thus, the peptide contains D-amino acids, combinations of D- and L-amino acids, and various “designer” amino acids (eg, β-methyl amino acids, C-β-methyl amino acids, and N-α-methyl amino acids). And can transfer special properties to the peptide.
In yet another embodiment, peptide subunits that convey useful chemical and structural properties will be selected. For example, peptides containing D-amino acids can exhibit resistance in vivo to L-amino acid specific proteases. A modified compound having a D-amino acid can be synthesized using amino acids arranged in the reverse direction to produce the peptide of the present invention as a retro-inverso peptide. Furthermore, the present invention contemplates the use of peptidomimetics and peptidomimetic linkages (eg, ester linkages) for the preparation of peptides with more specific structural properties and for the preparation of peptides with novel properties. In another embodiment, reduced peptide bonds (i.e. R1-CH ₂ NH-R2, wherein R1 and R2 are amino acid residues or sequences) can be generated peptide comprising. The reduced peptide bond can be introduced as a two peptide subunit. Such molecules will be resistant to peptide bond hydrolysis (eg, protease activity). Such molecules will provide extended half-life in vivo due to the inherent functions and activities of peptides, such as resistance to metabolic degradation or protease activity. Furthermore, in certain systems, constrained peptides are known to exhibit enhanced functional activity (Hruby 1982, Life Sciences 31: 189-199 and Hruby et al. 1990, Biochem J 268: 249- 262), the present invention provides a method of generating a constrained peptide comprising a random sequence at all other positions.

Assay for IFNα biological activity :
Monocyte differentiation : The generation of activated T and B lymphocytes requires the recruitment and maturation of antigen presenting cells ("APC"). These APCs include B cells, monocytes / macrophages, and dendritic cells. SLE patient sera contain IFNα, which activates DC, and the activated activity can be blocked with polyclonal or monoclonal antibody preparations. Methods for detecting and quantifying this activity are described in the academic and patent literature (see, for example, paragraphs [0136] to [0150] of patent publication US2004 / 0067232A1).
Activation of MxA promoter: The ability of IFNα to activate the MxA promoter and the ability of the anti-IFNα monoclonal antibodies of the invention to block this activity can be measured using a reporter gene assay. In this assay, the MxA promoter is fused to a reporter gene such as chloramphenicol acetyltransferase (CAT) or luciferase (luc), preferably luciferase. Assays for CAT and luciferase are known to those skilled in the art. Preferably, the activity of the MxA promoter is measured in A549 cells stably transformed with the MxA promoter / reporter gene fusion construct. A549 cells are a lung cancer cell line available from ATCC (Product No. CC1-185). The MxA (also known as Mx1) promoter may be derived from human, mouse or rat. The sequence and structure of the human MxA promoter is disclosed in Genbank accession number X55639 (Chang et al. 1991, Arch Virol 117: 1-15; and Ronni et al 1998, J Interferon Cytokine Res, 18: 773-781) . Human MxA promoter / luciferase fusion constructs and luciferase assays are disclosed in US Patent Application 200040209800 and Rosmorduc et al. (J Gen Virol, 1999, 80: 1253-1262). Human MxA promoter / CAT fusion constructs and CAT assays are disclosed in Fernandez et al. (J Gen Virol, 2003, 84: 2073-2082) and Fray et al. (J Immunol Methods, 2001, 249: 235-244). The mouse MxA (Mx1) promoter is disclosed in Genbank accession number M21104 (Hug et al. 1988, Mol Cell Biol 8: 3065-3079; and Lleonart et al. 1990, Biotechnology 8: 1263-1267). The mouse MxA promoter / luciferase fusion construct and luciferase assay are disclosed in Canosi et al. (J Immunol Methods 1996, 199: 69-67).

Example
Materials and methods
Sources of human IFNα :
Recombinant IFN-α subtype protein was obtained from PBL Biomedical Laboratories (PBL). Specific activities determined by subtype and manufacturer included: IFNα-A (3.8 × 10 ⁸ U / mg); IFNα-2 (2.77 × 10 ⁸ U / mg); IFNα-B2 (4.63 × 10 ⁸ U) IFNα-C (2.31 × 10 ⁸ U / mg); IFNα-D (7.5 × 10 ⁷ U / mg); IFNα-F (3.6 × 10 ⁸ U / mg); IFNα-G (2.33 × 10 ⁸ U / mg) ^{); IFNα-H2 (1.05x10 8} U / mg); IFNα-I (1.4x10 8 U / mg); IFNα-J1 (2.6x10 8 U / mg); IFNα-K (1.48x10 8 U / mg); IFNα-1 (1.4 × 10 ⁸ U / mg); IFNα-4a (2.12 × 10 ⁸ U / mg); IFNα-4b (1.8 × 10 ⁸ U / mg); IFNα-WA (2.4 × 10 ⁸ U / mg); IFNβ ( 8.23 x 10 ⁷ U / mg). Leukocyte IFN (I-2396, Lot # 111K1603) was purchased from Sigma.
PBMC-flu supernatant (PBMC-flu), which contains a complex mixture of human IFNα subtypes, was transformed into influenza A / PR / 8/34 (H1N1) (Charles River Laboratories, Lot # 4XPR011022) was prepared in our laboratory by infecting with a virus titer of 1 HAU / pDC. Specifically, PBMC (peripheral blood monocyte cells) were obtained by centrifuging on Ficoll and collecting the PBMC-containing interface. FACS staining / analysis is performed to confirm the presence of plasmacytoid DCs, determine their percentage in PBMC, and further to Lin, CD3, CD14, CD16, CD19, CD56, CD123, HLA-DR and CD11c Staining was carried out with a specific fluorescent binding antibody (BD Pharmingen). The characteristics of pDC were determined to be CD14 negative, CD11c negative and CD123 positive. flu virus stock (special pathogen negative chicken supply; Influenza A / PR / 8/34 (H1N1) (Cat. # 490710; Lot # 4XPR011022), final HA titer per 0.05 mL: 1: 16,777,216; Charles River Laboratories, Conneticut , USA) was diluted to 1000 HAU / μL (haemagglutinin units / μL) with RPMI medium (RPMI + 10% FCS + L-glutamine). The volume of diluted virus required is at least 1 HAU / pDC, based on the percentage of pDC in purified PBMC (ie each well should contain 1 × 10 ⁶ PBMC, and if there is 0.3% pDC, each well Will contain 3000 pDC, in which case 4-5 μL of 1000 HAU / μL virus will be added to each well).
PBMC prepared from the buffy coat was centrifuged at 900 rpm for 10 minutes and resuspended in RPMI + 10% FCS + L-glutamine at 5,000 cells / μL (this would provide 1 × 10 ⁶ cells / well in a volume of 200 μL). Cells + flu virus were plated on 96-well U-bottom plates and incubated at 37 ° C + 5% CO ₂ for 24 hours. After 24 hours of incubation, the cells formed a pellet at the bottom of the well, forming a cluster. The supernatant was carefully collected by pipetting, avoiding the cell pellet at the bottom of the well. The combined supernatants were centrifuged in a 50 mL conical tube at 900 rpm for 10 minutes to precipitate all residual cells and other culture debris. PBMC-flu supernatant (containing a complex mixture of IFNα) was pooled and stored in 0.5 mL portions at −80 ° C. until use.

Cytopathic effect (CPE) inhibition assay :
CPE material : Dulbecco's Modified Eagle Medium (DMEM) “Complete”: phenol red-containing DMEM + 10% FCS + 2 mM L-glutamine + penicillin + streptomycin + β-2-mercaptoethanol (β-me), 96-well flat bottom tissue culture plate, A549 cells (ATCC CCL-185); these cells are ham F12K medium + 10% FCS + 2 mM L-glutamine + penicillin + streptomycin + 500-800 μg G418, 1 × PBS, 1 × trypsin, “Intron A” (IFNα-2b , Schering-Plough) control, test sample (SLE serum, recombinant IFNα subtype) +/- hybridoma supernatant or purchased polyclonal / monoclonal antibody preparation, EMC virus stock (murine brain myocardium acclimated to Vero cell tissue culture) Prepared from flame virus (EMCV); ATCC product number for this virus stock is VR-129B, Vero cells Product number of Te is CCL-81).
Crystal violet stock solution: 1.25 mg NaCl + 3.75 mg crystal violet + 775 mL formaldehyde / ethanol solution (prepared with 75 mL formaldehyde, 750 mL 95% ethanol and 1500 mL distilled water) for 20 minutes, followed by filtration through a 0.45 micron filter And stored for a period not exceeding 3 months. Crystal violet working solution was prepared by diluting the stock solution 1:10 with formaldehyde / ethanol solution. The crystal violet solution was stored at room temperature.
CPE method : A schematic of the cytopathic effect (CPE) inhibition assay is shown in FIG. CPE assays were performed in triplicate wells in 96 well flat bottom plates. For each assay type, it was useful to incorporate positive control wells containing various concentrations of Intron A (Schering-Plough) samples, and negative controls containing only cells plus media. Adherent A549 cells were harvested from the flask by removing the culture medium, washing once with PBS, and digesting with trypsin. Trypsin digestion was stopped by adding DMEM “complete” to the flask. Trypsin digested cells were collected from the flask, centrifuged, resuspended and counted. Their concentrations were adjusted to 600,000 cells / mL with complete DMEM. Well volumes for the assay were 150 μL (before virus addition) and 200 μL (after virus addition). 50 μL of volume was cells and 15,000 cells were added to each well (50 μL of 300,000 cells / mL cell suspension).
Virus inhibition assay with recombinant IFNα : 100 μL of various concentrations of IFNα solution (DMEM complete) were added to triplicate wells. 50 μL of cells were added and incubated for 5 hours at 37 ° C. + 5% CO ₂ . After the time, 50 μL of EMC virus diluted 50-fold from the stock was added and the incubation was continued for 48 hours at 37 ° C. + 5% CO ₂ .
Virus inhibition assay with SLE serum : 50 μL (eg undiluted) or 25 μL (eg 2 × diluted) SLE serum was added to triplicate wells. The volume is adjusted to 100 μL by adding DMEM without FCS (Note: whenever any type of serum sample is added to a well using this assay, DMEM without FCS was used) Subsequently, 50 μL of cells were added and incubated at 37 ° C. + 5% CO ₂ for 4 hours. After that time, 50 μL of EMC virus diluted 50-fold from stock was added and incubation continued at 37 ° C. + 5% CO ₂ for 48 hours (the 50-fold dilution was 48 hours for our preparation). Determined to be the lowest amount of stock that can kill all cells).
Virus inhibition assay with PBMC-flu supernatant: 50 μL (eg undiluted) or serial dilutions of PBMC-flu supernatant were added to triplicate wells. The volume of each well was adjusted to 100 μL by adding DMEM containing FCS, followed by the addition of 50 μL of cells and incubating at 37 ° C. + 5% CO ₂ for 4 hours. After the time, 50 μL of EMC virus diluted 50-fold from the stock was added and the incubation was continued for 48 hours at 37 ° C. + 5% CO ₂ .
To assay antibody-mediated blocking of viral inhibition by recombinant IFNα, SLE serum or PBMC-flu supernatant using commercially available Ab, mouse serum, or fusion supernatant, (i) 50 μL of commercially available polyclonal or monoclonal Either DMEM with Ab preparation (no FCS); (ii) 50 μL of mouse serum; or (iii) 50 μL of hybridoma supernatant was added to bring the total volume of each well to 100 μL at this point. The plate was incubated at 37 ° C. + 5% CO ₂ for 1.5-2 hours. 50 μL of cells were added to each well and incubated at 37 ° C. + 5% CO ₂ for 5 hours. After the time, 50 μL of EMC virus diluted 50-fold from the stock was added and the incubation was continued for 48 hours at 37 ° C. + 5% CO ₂ .
After an incubation time of 48 hours in the CPE assay, all cultures were carefully removed from the wells with a multichannel pipette. 50 μL of crystal violet was added and stained for 4-6 minutes. Crystal violet was carefully removed and 200 μL of distilled water was added and immediately removed. Plates were allowed to dry for at least 30 minutes, followed by reading at an OD of 570 nm in an ELISA plate reader.
To obtain a blocking percentage (based on the ability of the control antibody added to the experiment or the antibody contained in the hybridoma supernatant to inhibit IFNα-mediated anti-cell death), a “negative control” (IFNα recombinant, SLE serum, Alternatively, Prism4 for Macintosh with PBMC-flu supernatant + cells + virus) as 100% survival rate (0% cell death) and “positive control” (cell + virus only) as 0% survival rate (100% cell death) Data was normalized using 0.0, version 4.0A software (GraphPad Software, Inc., San Diego, Calif.) And a normalization algorithm, and all values were adjusted to percentages of the control.

Reporter gene (RG) assay :
Ingredients for RG : Dulbecco's Modified Eagle Medium (DMEM), phenol red or no supplement; Dulbecco's Modified Eagle Medium (DMEM) “Complete”, phenol red containing DMEM + 10% FCS + 2 mM L-glutamine + penicillin + streptomycin + 2-me ( β-me); Dulbecco's Modified Eagle Medium (DMEM) prepared to contain all of the above listed except FCS; ViewPlate-96, white, tissue culture treatment (PerkinElmer Life Sciences); 93D7 cells (type I IFN induction) A549 transfected to express luciferase driven by the sex MxA promoter); these cells are cultured in Ham F12K medium + 10% FCS + 2 mM L-glutamine + penicillin + streptomycin + 500-800 μg G418; 1 × PBS; 1x trypsin, “Intron A” (IFNα-2b, Schering-Plough) control; test sample (SLE serum, recombinant IFNα subtypes) +/- hybridoma supernatant or purchased polyclonal / monoclonal antibody preparations; Bright Light (TM) (Britelite ^TM) luminescence reporter gene assay kit (PerkinElmere Life Sciences).
RG method : A luciferase reporter gene assay was utilized to determine the ability of anti-IFNαMAbs to neutralize the biological activity of recombinant IFNα subtypes, leukocyte IFN and PBMC-flu. A schematic of the RG assay is shown in FIG. 93D7 cells (derived by stable transfection of an A549 cell line (CLL-185, ATCC) with an IFN-inducible construct (MxA promoter / luciferase fusion)) were obtained from Dr. Guenther Adolf (Boehringer-Ingelheim GmbH, Austria ) Courtesy of The MxA promoter / luc fusion vector was excised from pSP64-Mxp (PstI-PvuII) -rβglo (Lleonart et al. 1990, Biotechnology 8: 1263-1267) and inserted into the murine MxA promoter and IFN upstream of the luciferase coding sequence. Contains a 1.6 Kb BamHI fragment containing the response element.
The RG assay was performed in triplicate wells on opaque 96-well flat bottom plates (ViewPlates ™, white walls, clear bottom; PerkinElmer). For each assay type, it is preferred to incorporate positive control wells containing various concentrations of Intron A (Schering-Plough) samples and negative control wells containing only cell + culture.
Specifically, adherent 93D7 cells were harvested from the flask by removing the culture medium, washing once with PBS, and digesting with trypsin. Trypsin digestion was stopped by adding DMEM “complete” to the flask. Cells were collected from the flask, centrifuged, resuspended and counted. Their concentrations were adjusted to 600,000 cells / mL with complete DMEM.
Immunized mouse-derived serum, hybridoma supernatant, or purified anti-IFNαMAb is preincubated with recombinant IFN subtype, leukocyte IFN or PBMC-flu for 1.5 hours at 37 ° C. + 5% CO ₂ in a volume of 100 μL / well, Thereafter, 93D7 cells (50 μL of a cell suspension of 600,000 cells / mL = 30,000 cells) were added to each well and the incubation continued for another 5 hours. The final well volume for the assay was 150 μL. The assay is then developed using the Britelite ^™ luminescence reporter gene system (PerkinElmer) and read within 15 minutes after addition of the substrate with a Wallac Microbeta Trilux ^™ scintillation counter and luminescence counter. Went.
MxA induction assay with recombinant IFNα : The concentration of IFNα in solution (DMEM complete) was adjusted to include the amount to be added to each well in 100 μL. 100 μL of IFNα was placed in triplicate wells followed by 50 μL of cells and incubated for 5 hours at 37 ° C. + 5% CO ₂ .
MxA induction assay with SLE serum : 50 μL (eg undiluted) or 25 μL (eg 2 × diluted) SLE serum was added to wells in triplicate. The volume per well is adjusted to 100 μL by adding DMEM without FCS (Note: DMEM without FCS is added whenever any type of serum sample is added to the wells using this assay. Followed by addition of 50 μL of cells and incubation at 37 ° C. + 5% CO ₂ for 5 hours.
Assay of MxA-induced inhibition by PBMC-flu supernatant : 50 μL of PBMC-flu supernatant (eg undiluted) or serial dilutions were added to wells in triplicate. The volume of each well was adjusted to 100 μL by adding DMEM containing FCS, followed by the addition of 50 μL of cells and incubating at 37 ° C. + 5% CO ₂ for 5 hours.
Assay for inhibition of MxA induction by recombinant IFNα, SLE serum or PBMC-flu supernatant using commercial Ab, mouse serum or fusion supernatant : 50 μL of desired dilution of recombinant IFNα, SLE serum or PBMC-flu Was added to each well. (I) DMEM containing 50 μL of a commercially available polyclonal or monoclonal antibody preparation (without FCS); (ii) 50 μL of mouse serum; or (iii) 50 μL of hybridoma supernatant, added to each well, The total well volume was 100 μL. The plate was incubated for 1.5 hours at 37 ° C. + 5% CO ₂ . After the time, 50 μL of cells were added and the incubation was continued for 5 hours at 37 ° C. + 5% CO ₂ .
Britelite ^™ kit reagent / developing reagent (substrate vial, substrate buffer, uncolored DMEM) was set to room temperature 40 minutes prior to assay development. At 30 minutes pre-development, the assay plate was placed at room temperature. At 10 minutes pre-development, the lyophilized substrate was reconstituted with buffer (10 mL / vial).
After a 5 hour incubation period, all media was carefully removed from the wells using a multichannel pipette. The adhesive white block was then secured to the bottom of the ViewPlate ^™ . 90 μL of DMEM (without phenol red) was added to each well. Add 90 μL of reconstituted Britelite ^™ reagent to each well and repeat the squirt and pipette operation twice (however, the contents of the well may splash on the sides of the well or cause bubbles) Ensure complete mixing of reagents and culture medium. The operation was carried out quickly but as accurately as possible. The plate was sealed with a transparent adhesive sealing sheet. The luminescence intensity of the plate was read using a Wallac Microbeta Trilux ^™ within a time period of much longer than 1 minute but not longer than 15 minutes.
To obtain a percentage of inhibition (based on the ability of the incorporated control antibody or antibody contained in the hybridoma supernatant to abolish MxA-luciferase induction), a “positive control” (IFNα recombinant, SLE serum, or Prism software (GraphPad Software, Inc., San Diego, CA) and normalization algorithm with PBMC-flu supernatant + cells) as 100% IFNα activity and “negative control” (only cells in culture) as 0% IFNα activity Was used to normalize the data and adjust all values to a percentage of the control.

Example: 1 Selection of immune and monoclonal antibody cell lines
The working path diagram for IFNα MAb production is shown in FIG. Groups of 5 6-8 week old Balb / c female mice (Harlan) were isolated from 5-10 μg each of natural leukocyte IFNα (I-2396, Lot #) in MPL ™ + TDM emulsion (Sigma # M6536). 111K1603, Sigma) and / or a recombinant protein cocktail (5-10 μg each of three recombinant IFNα subtypes A, B2 and F (obtained from PBL Biomedical Labortories (“PBL”))) and the schedule shown in Table 1 below Therefore, immunization was performed at intervals of 2 to 3 weeks. MPL ™ + TDM emulsion is from monophosphoryl-lipid A (MPL: detoxified endotoxin from S. Minnesota) and trehalose dicorynomycolate (TDM) in 2% oil (Squalene) -Tween 80-water emulsion Ribi adjuvant system consisting of. Antigen was administered by intraperitoneal (ip) or subcutaneous (sc) route. Pre-fusion screening of sera collected from mice was performed in three titers (1: 200, 1: 2000, and 1: 20,000) with a reporter gene (RG) assay (MxA-luciferase fusion by activation of type I IFN receptor) (Based on protein) and detected inhibition of IFNα biological activity. Serum was collected from mice by retroorbital bleed 7 days after the third booster and screened using the reporter gene (RG) assay described above for neutralization of PBMC-flu bioactivity. Mice with a titer of at least 1: 2000 for 50% neutralization were rested for 4 weeks, followed by spleen cell fusion after 3 days with murine myeloma Sp2 / 0-Ag14 (CRL-8287, ATCC) A final booster of 2.5 μg leukocyte IFN was performed. Fusion was performed in 50% PEG1500 (Roche) and 1 × HAT supplemented DMEM + 15% FCS was used for hybridoma selection. After 10-14 days, the culture supernatant was screened for neutralization of PBMC-flu. Based on the MxA / luc reporter gene (RG) bioassay described above for immunized mice, 17 can neutralize PBMC-flu supernatant by at least 50% at a titer of 1: 200, of these 14 was able to neutralize more than 50% at 1: 2000 dilution, and 3 of them continued to neutralize to a titer of 1: 20,000.

注記：プロトコル1、2及び3のマウスを融合物1から6の作製に用いた。融合は、１つのプロトコル内の2−3匹のマウスの細胞をプールして実施した。2匹のマウス（プロトコル6でIFNαで最初に免疫）をプールして融合物8を作製した。プロトコル5では、2匹のマウスをプールして融合物7を作製し、3匹をプールして融合物9を作製した。 Table 1: Selection of immune and monoclonal antibody cell lines

Note: Protocol 1, 2 and 3 mice were used to generate fusions 1-6. Fusion was performed by pooling 2-3 mouse cells within one protocol. Two mice (first immunized with IFNα in protocol 6) were pooled to create fusion 8. In protocol 5, two mice were pooled to make fusion 7, and three were pooled to make fusion 9.

Production and purification of monoclonal antibodies : As described above, mice were identified as fusion candidates based on their ability to neutralize complex mixtures of IFNα subtypes present in PBMC-flu. A series of 8 fusions were performed using spleen cells taken from mice with acceptable serum titers. Spleen cells were fused with the Sp2 / 0-Ag14 murine myeloma cell line (ATCC number CRL-1581, which was selected because it cannot express endogenous Ig chain) and plated on 96-well flat bottom tissue culture plates, 12-15 Supernatants were screened to detect a polyclonal response after day incubation via the RG assay protocol described above. Specifically, serum samples of immunized mice were preincubated with the supernatant from influenza-infected PBMC for 1 hour at 37 ° C., after which 93D7 cells were added and further incubated for 5 hours. At 5 hours, the assay was developed and read on a luminescence counter. A summary of the first 8 fusions is shown in Table 2 below. The supernatant of 8 fusions was screened from 3911 primary wells, 8 candidates (ACO-1 to ACO-8), each isolated from fusion 4, were PBMC-flu (diluted 640 times) Any visible reduction in mediated MxA / luc production activation was identified based on the ability to be consistently demonstrated in the RG bioassay described herein. Hybridoma cell lines were subcloned by limiting dilution. Hybridomas producing anti-IFNαMAbs were acclimated for growth on Gibco PFHM-II (Invitrogen) and cultured in Integra CELLine flasks (Becton Dickinson). Supernatants were collected from cell compartments every 5-7 days and frozen at -80 ° C. Subsequently, the MAb was purified from 50 mL batch supernatant by FPLC on a protein A column followed by dialysis against PBS. Purified MAb was aliquoted and stored at -80 ° C. ACO-1, 2, 3, 4, 5 and 8 were isotyped by ELISA as follows: IgG2a (ACO-1), IgG2b (ACO-2) and IgG1 (ACO-3, 4, 5, 6 and 8). All of these candidates were derived from fusions of spleen cells from mice initially immunized with leukocyte IFN or IFNαA, B2 and F recombinant proteins followed by a pre-fusion booster with leukocyte IFN. Fusion performed in mice receiving only the recombinant IFNα subtype failed to generate any candidates capable of neutralizing PBMC-flu.

Table 2: Summary of fusion

Example 2: Neutralization of commercial leukocyte IFNα or PBMC-flu supernatant bioactivity with ACO-1, ACO-2, ACO-3, ACO-4 and ACO-5 strongly binds to at least one IFNα subtype Anti-IFNαMAbs that were shown to neutralize this were selected to examine their ability to neutralize naturally occurring IFNα preparations (known to contain a wide variety of IFNα subtypes). . For these experiments, ACO-1 to 5 titers were examined in the RG bioassay against both commercial leukocyte IFN and PBMC-flu supernatant prepared as described above. ACO-1, 2 and 3 blocked leukocyte IFN bioactivity at least 50% at all three MAb doses tested (200, 20 and 2 ng) (Figure 3a), and ACO-4 was tested for 200 ng. When neutralization of slightly over 50% was achieved. Compared to the above, ACO-5's ability to counter leukocyte IFN was poor, blocking a maximum of less than 10% of the assay signal.
Comparative inhibition of various dilutions of PBMC-flu supernatant with a defined concentration of monoclonal antibody was performed using the RG assay described above. The absolute concentration of IFNα in the Flu / PBMC supernatant is unknown and thus the relative neutralizing capacity is determined in this experiment. However, when measuring the titers of 5 MAbs (2000, 200, 20 and 2 ng) against PBMC-flu, ACO-5 is at least 50% bioactive in all except the lowest amount of antibody tested. Neutralized (Figure 3b). ACO-1 showed maximum performance when tested with PBMC-flu, blocking at least 50% with all four MAb quantities measured. Variations in the neutralization of leukocyte IFN and PBMC-flu by ACO-5 can probably be attributed to differences in IFNα and / or their relative concentrations present in the two separate IFN sources used in our assay.

Example 3: Inhibition of biological activity of recombinant IFNα subtype by ACO-1, ACO-2, ACO-3, ACO-4, ACO-5, ACO-6 and ACO-8
IFNα neutralization candidates ACO-1 to 6 and ACO-8 were screened for neutralization of IFNβ along with neutralization of 15 recombinant FNα subtypes by traditional cytopathic effect (CPE) inhibition assay along with RG assay. Recombinant IFNα subtype protein was obtained from PBL Biomedical Laboratories (Piscataway, NJ) (info@interferonsource.com) (hereinafter “PBL”). The specific activity determined by the manufacturer is shown in Table 3.

Table 3: Recombinant human IFNα used for antibody characterization

The neutralization unit (U) provided by the manufacturer provides the ability of one subtype to neutralize the cytopathic effect produced by bovine vesicular stomatitis virus in bovine MDBK cells (certified as 1 U / mL). Assigned by the assay to be measured. The ability of IFNα in bioassays is influenced by many variables (including assay types, individually prepared batches, and small technical variations between laboratories), and internationally recognized standards for each subtype Given the fact that is not available, a single lot number was consistently used in these experiments. The manufacturer-defined unit of each recombinant that gave the maximum response (RG _max ) in the RG assay was determined. Subsequently, the titers of purified ACO-1, 2, 3, 4, 5, 6 and 8 were measured in the RG bioassay in the presence of these IFNα subtype amounts. IFNβ (specific activity = 8.23 × 10 ⁷ U / mg) was obtained from PBL.
A representative RG bioassay for titration of ACO-1 against RG _max values of 15 IFNα subtypes is shown in FIG. 4a. As noted in the figure legend, a numerical value was assigned for each ACO-1 titration for the indicated subtype based on the EC ₅₀ value determined for each subtype. ACO-1 was unable to neutralize IFNαD or IFNα1, but the other 13 subtypes could be neutralized at various antibody concentrations. EC ₅₀ results expressed in ng / mL for all ACO-1, 2, 3, 4, 5 and 8 IFNα neutralizing MAbs are provided in Table 4. Percentage neutralization is shown in Table 5. Thus, ACO-1 and 2 neutralize 12 subtypes (IFNαA, 2, B2, C, F, G, II2, I, J1, 4a, 4b and WA) at antibody concentrations below 300 ng / mL Seems to be similar in their ability to do. ACO-1 also neutralized IFNαK to the extent described above, but did not neutralize ACO-2. ACO-3 and ACO-4 are less than 300 ng / mL with 9 subtypes (IFNαA, 2, B2, C, I, J1, K, 4a and WA) and 6 subtypes (IFNαA, 2, B2, C, I , J1 and 4a) were neutralized respectively. ACO-8 neutralizes the 4 subtypes (IFNα2, 1, 4a and 4b), provided that the antibody concentration is constrained, while ACO-5 strongly potentiates only 3 subtypes (IFNαA, 2 and WA). Neutralized. Neither MAb was able to neutralize IFNβ (FIG. 4b).

Table 4: Neutralization of recombinant IFNα subtype by ACO-1, 2, 3, 4, 5 and 8 (EC ₅₀ ng / mL)

Table 5: Percentage neutralization of RG _max IFN levels with 2 microgram / mL of antibody

  The CPE assay was set up similar to the RG assay using untransfected A549 cells (ATCC # CCL-185, human lung cancer cell line) (ie, the assay was a standard 96-well flat bottom tissue culture plate). Implemented). 5 hours after the antibody and IFNα subtype preincubation (1 hour at 37 ° C.) and the addition of cells, mouse encephalomyocarditis virus (EMCV) was added and the cells were incubated for 48 hours. Stained with crystal violet for determination. For both RG and CPE assays, the amount of IFNα subtype used is the amount of pre-recombinant IFNα protein that provides maximum MxA-luciferase induction (RG assay) or maximum protection from cell death (CPE assay) in the assay. Determined by titration. The data shown in Table 6 shows the percentage of inhibition of biological activity in the CPE assay as shown by each ACO monoclonal antibody against the corresponding IFNα subtype (the corresponding gene encoding the subtype is shown in parentheses). Represents. For the CPE assay, the amount of each IFNα subtype used was determined by prior titration of recombinant IFNα protein that provided maximal protection from cell death (CPE). N / D = undecided. As shown in the table, ACO-1 and ACO-2 can block the most IFNα subtypes at over 90% levels under the assay conditions, while ACO-6 is the most limited In most cases, the results of the RG assay and the CPE assay are correlated with each other.

Table 6: Percentage neutralization of IFNα subtype activity by MAb in CPE assay

Example 4: Multiple complex analysis of ACO-1, ACO-2, ACO-3, ACO-4, ACO-5, and ACO-6 Performing multiple complex analysis and requiring spatially distinct binding domains It was determined whether or not. ACO antibodies were analyzed in a permutation combination for the ability of ACO antibodies to bind to IFNαA simultaneously by multiple complex analysis on the Luminex ^™ 100 system. Beads conjugated with unlabeled ACO antibody (capture) were incubated with the indicated concentrations of recombinant IFNα and subsequently exposed to PE-labeled ACO antibody (reporter). This examination revealed that ACO-5 can form multiple complexes with any of ACO-1, -2, -3 and -4 (see the shaded area in FIG. 5). Multiple complex formation also occurs when ACO-4 is used as the capture antibody and ACO-3 as the reporter antibody. Thus, ACO-5 binds to spatially distinct IFNα domains other than the IFNα domain bound by ACO-1, 2, 3 and 4. Similarly, ACO-3 and ACO-4 bind to spatially distinct domains of IFNαA. The results using ACO-6 were negative in all cases.

Example 5: Affinity determination for ACO-1, ACO-2, ACO-3, ACO-4, ACO-5 and ACO-6
Biacore 2000 and 3000 optical biosensors equipped with a CM5 sensor chip and equilibrated with 10 mM HEPES, 150 mM NaCl, 0.005% P20, 0.1 mg / mL BSA (pH 7.4, 25 ° C.) Thus, IFNα counter-kinetic analysis of ACO antibody was performed. For each of ACO-1 through 6, the antibody buffer was first exchanged from Tris-glycine buffer to 10 mM sodium acetate buffer (pH 5.0) using a rapid deionization column followed by standard A simple amine coupling reaction was used to immobilize on the three flow cell surfaces, while the fourth one was left unmodified to serve as a reference. The final MAb fixed density ranged from 500-1100RU (response unit). The binding response was monitored when IFNαA was run at a constant volume (0, 0.31, 0.93, 2.78, 8.33, 25.0 and 75.0 nM) on the antibody and reference flow cells at a rate of 50 μL / min. Ab / Ag complex binding was monitored for 4 minutes and dissociation was monitored for 12 minutes. The surface was regenerated with 1/1000 H ₃ PO ₄ (except ACO-5, which required 1/200 H ₃ PO ₄ ) at the end of each binding cycle. The assay was performed in triplicate. The results are shown in Table 7. K _D values of the five anti IFNαMAb was covered their capacity and inversely proportional to the range to block the biological activity of leukocyte IFN and PBMC-flu with breadth of INFα subtypes neutralized by each MAb. ACO-1 showed the lowest affinity (5.61 × 10 ⁻⁹ M), while ACO-5 showed 14 times higher affinity (4.00 × ^{10 −10} M). ACO-6 did not bind to IFNαA, and the binding rate was not obtained.

Table 7: Biacore kinetic analysis of ACO-1 to ACO-6 using IFNαA

Example 6: Solid phase binding of IFNα subtype by ACO-1, ACO-2, ACO-3, ACO-4, ACO-5 and ACO-6
To screen for MAb specificity, solid phase binding of all 15 IFNα subtypes was determined by ELISA assay. Briefly, ELISA plates (NUNC MaxiSorp ™) were coated overnight at 4 ° C. with 1 μg / mL recombinant IFNα protein subtype (50 μL / well). Coated plates were blocked with PBS + 1% BSA and incubated for 1 hour at 37 ° C. with 25 ng of ACO candidate MAb (50 μL) in PBS. The assay was developed by incubating with 50 μL / well of HRP-conjugated goat anti-mouse IgG (Jackson ImmunoResearch) for 30 minutes at room temperature followed by 15 minutes with 100 μL / well TMB substrate solution (Zymed). The reaction was stopped with 1N HCl (100 μL / well) and OD ₄₅₀ was read on an ELISA plate reader. The percentage binding was calculated by normalizing the background signal value with the maximum signal value (observed for IFNα-4a) throughout the assay. The results are shown in Table 8 and FIG. Both ACO-1 and ACO-2 bind to the same 12 IFNα subtypes they effectively neutralize in the RG bioassay, at least twice as strong as the subtype matched controls, IFNα subtypes B2, K , 4a, and 4b binding showed 20 times higher signal than the control. However, a difference between binding capacity and neutralizing capacity was observed between ACO-3, 4, 5 and 8. In the case of ACO-3 is, The EC ₅₀ values in the case of the neutralization of IFNαK 200 times higher than The EC ₅₀ values in the case of IFNarufabi2, despite the fact that 4-fold higher than in IFNarufa4a, subtypes B2 The ELISA signals for, K and 4a were the highest. No significant binding was detected with subtype J1 neutralized in the bioassay. The binding and neutralization profiles of ACO-4 and 5 showed an inverse relationship to each other. ACO-4 and 5 bind strongly to each of the subtypes (IFNα4a and 2 respectively), but ACO-4 binds to more subtypes than the above neutralizes, and ACO-5 binds to it. Many subtypes could not be neutralized (although with high EC ₅₀ values). A possible explanation is that there can be differences in accessibility to the specific epitopes recognized by these two MAbs in the aqueous phase (RG) and solid phase (ELISA). ACO-8 was unable to bind strongly to any of the IFNα subtypes examined and showed less than 20-fold binding to IFNαD, 1 and 4a. ACO-6 could not bind to any subtype.

Example 7: Inhibition of biological activity of SLE patient serum by ACO-1, 2 and 3 monoclonal antibodies A540 cells (CCL-185, ATCC) during encephalomyocarditis virus (EMCV) infection in SLE patient serum showing active symptoms Antiviral assays were used to determine the ability of anti-IFNαMAbs to neutralize protective activity against death. The antibodies (ACO-1, 2 and 3) showing neutralizing profiles of the most extensive IFNα subtype, leukocyte IFN and PBMC-flu were tested. SLE serum is obtained from active SLE patients (certified as SLE-43, 133,140 and BC) selected on the basis of IFN and granulocyte gene expression signatures characteristic of the patient's blood mononuclear cells It was. SLE sera were screened for protection against viral infection in a CPE bioassay prior to MAb neutralization testing. The RG assay was not used in these analyses because of the serum factor inhibition of cell binding to ViewPlates ^™ during the relatively short incubation time (5 hours) of the RG bioassay relative to the CPE assay (48 hours). is there. Vero cells (CCL-81, ATCC) are infected with EMCV (VR-129B, ATCC) and working virus stock is prepared from the supernatant. The assay was performed in triplicate by seeding A549 cells (50 μL per well, 15,000 cells / well) in flat-bottom 96-well plates treated for tissue culture, incubating overnight at 37 ° C. + CO ₂ . Subsequently, anti-IFNαMAb and SLE patient serum was added to the seeded and pre-incubated (100 μL / well), and after 4 hours, 50 μL diluted to the lowest concentration that could kill 100% of non-protected cells in 48 hours. Of EMCV was added. Incubation was continued for 48 hours, followed by staining with crystal violet and reading at OD ₅₇₀ in an ELISA plate reader. Controls were serum alone, culture medium only (-), and general neutralizing polyclonal antibodies (pAb, rabbit anti-human IFNα, PBL). The results shown in FIGS. 7a-d show the average of triplicates. Despite the lower affinity of the serum, ACO-1 and 2 were able to neutralize all four sera to some extent. ACO-3 failed to block SLE-43, 140 or BC. In some cases (IgG2b for SLE-43 and all three isotypes for SLE-BC), the corresponding isotype of control antibody is likely to be used in the assay to block serum. It is thought to have resulted from natural variability in other serum components that showed different cytotoxicity to individual cells in individual patients.

Example 8: Cross-reactivity of ACO-1 and ACO-2 with primate IFNα Endogenous IFNα is a humanized anti-IFNα monoclonal antibody to conduct preclinical safety / toxicity studies in preparation for human clinical studies. It is useful to identify animal models that react with. The ability of two candidate antibodies, murine anti-human IFNα antibodies ACO-1 and ACO-2, to neutralize primate IFNα was examined. Specifically, the ability of antibodies to block the induction of MxA-luciferase reporter gene in A549 cells when stimulated with purified macaque IFNα4b (156 pg / well) was tested. As shown in FIG. 8, antibodies ACO-1 and ACO-2 potently block the induction of reporter genes, while ACO-3 cannot block even at high concentrations (C). The homology between human and macaque IFNα is highly conserved. Furthermore, commercially available anti-human IFNα antibodies have been shown to cross-react with Reasus homologues and sinomogas homologues. These data suggest that primates provide an appropriate safety screening model.

Example 9: RT / PCR was performed using a sequence degenerate primer pool of ACO-1 heavy and light chains to amplify mRNA from hybridomas expressing ACO-1. Heavy chain variable region mRNA was amplified using a set of 6 degenerate primer pools (HA to HG), and light chain variable region mRNA was amplified using a set of 8 degenerate primer pools (LA to LI). . Amplification products were obtained from the following primer pools: HA, HB, HE, HF, LB, LC and LG. The PCR product is not amplified in pool LI, so the light chain is from the kappa cluster. Each product was cloned and the sequence of several of each clone was determined.
Two different heavy chain sequences were identified. Pools HA and HF amplified only one sequence encoding a truncated heavy chain with a stop codon at the end of framework region 3. Thus, this heavy chain will not form an antibody capable of binding to the antigen. Pools HB and HE amplified only one sequence that encodes the full-length mouse _Vh region as shown in FIG. 9, which differs from the HA and HF sequences. The full length heavy chain DNA sequence is SEQ ID NO: 1 and the full length amino acid sequence is SEQ ID NO: 2. DNA sequences encoding CDRV _H 1 (TACACCTTCACCAACTACTGGATGCAC; SEQ ID NO: 3), V _H 2 (GAGATTAATCCTAGCCACGGTCGTACTATCTACAATGAAAACTTCAAGAGC; SEQ ID NO: 5), and V _H 3 (GGGGGACTGGGACCCGCCTGGTTTGCTTAC; SEQ ID NO: 7) are shown in italics The amino acid sequences V _H 1 (YTFTNYWMH; SEQ ID NO: 4), V _H 2 (EINPSHGRTIYNENFKS; SEQ ID NO: 6), and V _H 3 (GGLGPAWFAY; SEQ ID NO: 8) are underlined.
Two light chain sequences were identified. Pools LB and LC amplified only one sequence found in several hybridomas, aligned with the well-described unusual truncated kappa light chain. Pool LG amplified a single sequence that was full length and differed from the sequences amplified in pools LB and LC. This light chain sequence is shown in FIG. The full length light chain DNA sequence is SEQ ID NO: 9 and the full length amino acid sequence is SEQ ID NO: 10. DNA sequences encoding CDRV _L 1 (AGTGCCGGCTCAAGTGTAGATTCCAGCTATTTGTAC; SEQ ID NO: 11), V _L 2 (AGCACATCCAACCTGGCTTCT; SEQ ID NO: 13), and V _L 3 (CATCAGTGGAGTAGTTACCCATTCACG; SEQ ID NO: 15) are shown in italics, while The amino acid sequences V _L 1 (SAGSSVDSSYLY; SEQ ID NO: 12), V _L 2 (STSNLAS; SEQ ID NO: 14), and V _L 3 (HQWSSYPFT; SEQ ID NO: 16) are underlined.
Analysis of the sequence obtained from hybridoma ACO-1 is summarized in Table 9. The variable regions show a high degree of homology (67% to 65%) with their closest human germline sequences, and the framework has a close homologue in the human germline database.

^aCDRの定義及び配列の番号付与はKabatにしたがう
^b生殖細胞系列のIDの表示の後に％相同性が示されている Table 9: Clone ACO-1

^a CDR definition and sequence numbering according to Kabat
^b % homology shown after germline ID display

Example 10: Humanization and characterization of monoclonal antibodies Humanized antibodies are generated by grafting murine complementarity determining regions into human antibody frameworks (CDR grafting) using methods known in the art (CDR grafting). See: Jones et al. 1986 Nature 321: 522-525; Reichmann et al. 1988, Nature 332: 323-329; Presta 1992, Curr Op Struct Biol 2: 593-596; and Clark 2000, Immunol Today. 21: 397-402). The humanized antibody can exhibit the same binding and functional parameters as the murine monoclonal antibodies described above.

Example 11: Treatment of SLE with humanized monoclonal antibodies Using microarray analysis known in the art and further described in Bennett et al. (2003, supra) and Baechler et al. (2003, supra). The IFNα signature will be monitored according to the method used. This new tool is useful for patient monitoring as well as patient segmentation (ie, positive INF signatures serve as criteria for inclusion in the treatment population). The use of this analysis also helps to determine which patients are properly treated with the compositions and methods of the invention. In one aspect, administration of an antibody of the invention will eliminate this signature. In one aspect, one of ordinary skill in the art can determine when the objectives of the methods of the invention have been met and when an effective amount of antibody has been delivered, when the IFNα signature is more than 50% effective. It is defined as the period necessary to be suppressed for a long period of time, for example, 4 weeks.
An effective amount will be infused, for example about 1 mg / kg, the second 2.5 mg / kg, the third 5 mg / kg, and the fourth (if necessary) 10 mg / kg. The “calculated optimal dose” for each patient is defined as the amount that can be safely administered and give at least 50% inhibition of the INFα signature for about 4 weeks.
Patients will be monitored weekly for INFα signatures. The dosing interval will be determined by the time to reappearance of the INFα signature. For example, if a dose of 1 mg / kg gives 50% or more signature reduction for only 2 weeks, the patient will receive a second dose of 2.5 mg / kg. If weekly monitoring shows a signature decrease of 50% or more for only 3 weeks, the patient will receive a third dose of 5 mg / kg. A maximum dose of 10 mg / kg will be tested for the goal of qualifying doses at which 50% or more inhibition of INFα signature is given for at least 4 weeks.
Efficacy can be measured by any acceptable method. Acceptable methods include PBMC microarray analysis (effectiveness is established based on the loss of interferon signature), PBMC flow cytometry (effectiveness is established by increasing T / B lymphocyte count). Including, but not limited to, reduced plasmacytosis and reduced presence of immature neutrophils, or serum cytokine multiplex complex analysis by luminescence analysis.
Biological deposit : ACO-1, ACO-3 and ACO-6 hybridoma cell lines have been deposited with the American Type Culture Collection (10801 University Blvd, Manassas, VA 20110-2209, USA) (ATCC) and listed in Table 10 below. The deposit number to enumerate was given. ACO-2 (labeled ACO2.21R) was deposited with the ATCC on August 9, 2006.

Table 10:

These deposits were implemented under the provisions of the Budapest Treaty (Budapest Convention) on the international recognition of the deposit of microorganisms in the patent procedure. The above guarantees the maintenance of a living deposited culture for 30 years from the date of deposit. The deposit will be available under the terms of the Budapest Treaty and by the ATCC with the consent of the Baylor Research Institute and the ATCC. The ATCC will provide permanent and unrestricted availability to the public of the offspring of the deposited culture upon issuance of the relevant US patent or upon publication of either a US or foreign patent application (whichever comes first). Warranted, and in addition to those who have determined that the Patent Committee has the right to comply with 35U.SC §122 and the subsequent Patent Committee Rules (including 37C.FR §1.14 for 866OG638 in particular) Ensure the availability of offspring.
The assignee of this application agrees that if the culture of the deposit is killed, lost or destroyed when cultured under appropriate conditions, the material will be immediately replaced with the same upon notification. did. The availability of deposits should not be construed as a person authorized to practice the present invention in violation of the rights granted by any government authority pursuant to the Patent Act.
It will be understood that the specific embodiments described herein are shown by way of illustration and not as limitations of the invention. The basic features of the invention can be utilized in various embodiments without departing from the scope of the invention. Those skilled in the art will recognize a number of equivalents to the specific methods described herein, or will be able to confirm this by experimentation that does not exceed routine experimentation. Such equivalents are considered to be within the scope of this invention and are covered by the claims.
All publications and patent applications mentioned in this specification are indicative of the level of skill of those having ordinary skill in the art to which this invention pertains. All publications and patent applications, and in particular their corresponding parts, are hereby incorporated by reference as if it were explicitly stated that each individual publication and patent application was specifically and individually incorporated herein by reference. Included in the description.
In the claims, terms indicating all transitions, such as “comprising”, “including”, “carrying”, “having”, “containing”, “involving” are understood to be open at both ends Should be understood to mean included without limitation. Only the transitional phrases “consisting of” and “consisting essentially of” would be restrictive or semi-restrictive phrases, respectively.
Any of the compositions and / or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. Although the compositions and methods of the present invention have been described in the context of a preferred embodiment, the inventive concepts in the compositions and / or methods of the present invention and in the process steps or series of steps described herein. Those skilled in the art will appreciate that variations may be applied without departing from the spirit and scope. More specifically, certain materials that are chemically and physically related can be substituted for the materials described herein, while achieving the same or similar results. It will be obvious. Any such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

  For a more complete understanding of the features and advantages of the present invention, reference is now made to the detailed description of the invention along with the accompanying figures in which:

Schematic diagrams of reporter gene (RG) assay and cytopathic inhibition assay (CPE) are shown. The black circle in the schematic diagram of the CPE assay represents intact live cells. White circles represent dead cells killed by viral infection. The black circles and cells in the schematic of the RG assay represent luciferase expression as well as “+”, while the white circles and cells represent lack of luciferase expression. A schematic diagram of the work process of IFNαMAb development is shown. Shows neutralization of hybrid IFN source by ACO-1, 2, 3, 4 and 5. (A) Neutralization of 600 pg leukocyte IFN (Sigma) by the indicated amount of each MAb was determined by RG bioassay. Percentage inhibition was calculated based on LCPS obtained in the presence / absence of leukocyte IFN and in the absence of any MAb. The value shows the average of three values. (B) Neutralization of PBMC-flu (640-fold dilution) with each MAb. The inhibition percentage was calculated as described above. The value shows the average of three values. FIG. 6 shows neutralization of 15 recombinant IFN-α subtypes by ACO-1. (A) Neutralization of the indicated IFN-α subtype by increasing concentrations of ACO-1 was determined by RG bioassay. The numbers assigned to each curve are LCPS values (luminescence counts / second) obtained in the absence of ACO-1 (indicated by white circles on the Y axis) and at the highest concentration of MAb tested (2000 ng / mL). ) Shows the center point (EC ₅₀ ) calculated from ND indicates that EC ₅₀ cannot be allocated. Data points were obtained from three values. (B) There is no neutralization of IFN-β by increasing concentrations of ACO-1, 2, 3, 4, 5 and 8. Data points were obtained from three values. The results of a multiplex complex analysis of monoclonal antibodies ACO-1, ACO-2, ACO-3, ACO-4, ACO-5 and ACO-6 are shown. The results of solid phase binding assay of IFNα with monoclonal antibodies ACO-1, ACO-2, ACO-3, ACO-4, ACO-5 and ACO-6 are shown. 2 shows neutralization of biological activity of SLE patient serum SLE-43 (a), SLE-133 (b), SLE-140 (c) and SLE-BD (d) as determined by CPE assay. Controls include serum only, culture medium only (-), and pan-neutralizing polyclonal antibodies (pAb, rabbit and anti-human IFNα, PBL). The value shows the average of three values. Figures 8A-C show the cross-reactivity of ACO-1 (A), ACO-2 (B) and ACO-3 (C) with 156 pg / well Macaque IFN. 2 shows the cDNA and amino acid sequence of ACO-1 heavy chain. DNA sequences encoding the CDR of V _H 1, V _H 2 and V _H 3 are shown in italics, while the underlined corresponding amino acid sequence is attached. 1 shows the cDNA and amino acid sequence of the light chain of ACO-1. DNA sequences encoding the CDR of V _L 1, V _L 2 and V _L 3 are shown in italics, while the underlined corresponding amino acid sequence is attached.

Claims (13)

ATCC is produced by the accession number PTA-7778 hybridoma deposited with the ATCC as, anti-interferon alpha ( "IFNα") anti-body. A humanized form of the antibody according to claim 1, humanized anti-interferon alpha antibody. Antibody
Biological organisms of at least two protein subtypes selected from the group consisting of interferon alpha (“IFNα”) protein subtypes A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b and WA Selectively neutralize activity,
Neutralizes less than 40% of at least one biological activity of INFα protein subtype D;
The biological activity is activation of an MxA promoter or antiviral activity ;
The antibody according to claim 1 or 2. The antibody of claim 1 or 2 , wherein the antibody selectively neutralizes the biological activity of the IFNα protein subtype at a ½ maximum effective concentration (EC ₅₀ ) selected from the group consisting of:
a ) <300 ng / mL of IFNα protein subtype A, 2, B2, C, F, G, H2, I, J1, 4a, 4b and WA; and
b ) IFNα protein subtype K of less than 3 75 ng / mL. Antibody, the IFNα neutralize at least 50% of the subtypes of bioactivity, the bioactivity Ru activation der of the MxA promoter, an antibody according to any one of claims 1 to 4. An antibody fragment of the antibody according to claim 1 or 2,
The antibody fragment is
Selectively biological activity of at least two IFNα protein subtypes selected from the group consisting of IFNα protein subtypes A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b and WA Neutralize,
Neutralizes less than 40% of the biological activity of INFα protein subtype D;
The biological activity is activation of an MxA promoter or antiviral activity;
Antibody fragment. Antibody fragments are Fab, Fab ′, F (ab ′) ₂ The antibody fragment according to claim 6, which is an Fv or scFv fragment. A host cell comprising a nucleic acid encoding the antibody or antibody fragment according to any one of claims 1 to 7 , wherein the host cell is a hybridoma. It was deposited with the ATCC as A TCC Accession No. PTA-7778, hybridoma. Diseases associated with abnormal expression of at least one IFNα protein subtype selected from the group consisting of IFNα protein subtypes A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b and WA or a pharmaceutical composition for the therapy symptoms,
Including an effective amount of an antibody or antibody fragment according to any one of claims 1 to 7,
Said pharmaceutical composition. Disease or condition is systemic lupus erythematosus (SLE), host versus graft disease (GVHD), I type diabetes, AIDS, lupus, psoriasis, and is selected from the group consisting of autoimmune thyroiditis, to claim 10 The pharmaceutical composition as described. At least one IFNα protein subtype selected from the group consisting of interferon alpha (“IFNα”) protein subtypes A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b and WA Use of the antibody or antibody fragment according to any one of claims 1 to 7 for the manufacture of a medicament for treating a disease or symptom associated with abnormal expression. 13. The disease or symptom is selected from the group consisting of systemic lupus erythematosus (SLE), host versus graft disease (GVHD), type I diabetes, AIDS, lupus, psoriasis, and autoimmune thyroiditis. Use of description.

Images