JP5190917B2 - Method for producing GPI-anchored protein with ceramide added - Google Patents

Description

  The present invention relates to a ceramide having a wide range of uses such as health foods and cosmetics, a method for producing the same, a ceramide-added GPI-anchored protein synthase that can add ceramide to a GPI-anchored protein, and a gene thereof.

Ceramide is a lipid widely distributed in animals, plants and microorganisms as a component of glycosphingolipids and sphingophospholipids, but even in human skin, it contains water between cells of the stratum corneum and cells of the skin. It acts as a barrier that protects the skin from dryness and dust and maintains the health of the epidermis. In recent years, it has attracted attention as a compounding agent for health foods and cosmetics together with hyaluronic acid and the like.
Here, ceramide refers to a product in which a fatty acid is added to sphingosine through an amide bond in a narrow sense. Is a general term for fatty acids added to the amide bond. That is, it includes dihydroceramide and phytoceramide.
These ceramides were conventionally separated from foods such as konjac potatoes, but it was difficult to efficiently separate high-purity ceramides, so yeast, fungi, etc. that produce ceramides at a high level were cultured, Attempts have been made to increase the production of ceramide by extracting ceramides (Patent Document 1, Patent Document 2). However, although these improved ceramide-producing bacteria are higher in production than the wild strains, their productivity was limited because they were improved by induction of mutation and selection.
In the budding yeast Saccharomyces cerevisiae, it is known that ceramide is added to the lipid part of a glycosylphosphatidylinositol (GPI) -anchored protein. Although it is known that this ceramide addition is performed in a process called GPI lipid remodeling, a specific step of lipid remodeling is finally becoming clear (Non-Patent Literature). 1). If it is possible to obtain an enzyme gene that participates in such lipid remodeling and ultimately adds ceramide, mass production from a transformant using the gene should be possible. The gene has not yet been acquired.
Bosson et al., 2006; Mol. Biol. Cell 17, 2636-2645. Ram et al., 1994; Yeast 10, 1019-1030. Martin-Yken, et al., 2001; Yeast 18, 827-840. Lorenzi et al., 1996; Proc. Natl. Acad. Sci. USA 93, 8956-8961. Tashima et al., 2006; Mol. Biol. Cell 17, 1410-1420. 9-504434 JP2006-67842

The present invention has been made to solve the above-mentioned problems, and the object of the present invention is to synthesize a ceramide-added GPI-anchored protein by adding ceramide to the lipid portion of the GPI-anchored protein. It is possible to provide a ceramide-added GPI-anchored protein synthase and its gene, and to provide a probe and a primer for detecting the gene.
It is also an object of the present invention to provide a method for producing a ceramide-added GPI-anchored protein using the enzyme and its gene, and to provide a ceramide cleaved from the obtained ceramide-added GPI-anchored protein. is there.
Furthermore, an object of the present invention is to provide a method for producing a GPI-anchored protein in which diacylglycerol having a saturated fatty acid as a ceramide-added GPI-anchored protein precursor is added with high purity.

  As a result of intensive studies to solve the above problems, the present inventors have found an enzyme and enzyme gene responsible for ceramide addition to GPI-anchored proteins in biological species including not only yeast but also mammals such as humans. Obtained and determined the base sequence and amino acid sequence.

The process will be described in detail below. The present inventors first searched for an enzyme gene that adds ceramide in the final stage of the lipid remodeling process for GPI-anchored proteins in budding yeast, and focused on the CWH43 gene of budding yeast in the process.
The CWH43 gene was first reported by Ram et al. As a mutation sensitive to the drug Calcofluor White (Non-patent Document 2), and was cloned in 2001 to establish the PKC1 signaling pathway involved in cell wall organization. Although it has been reported that it is a gene involved (Non-patent Document 3), there have been no reports on functions and properties such as enzyme activity of a protein that is a CWH43 gene product.
As a result of intensive studies, the present inventors have found that the CWH43 gene of this budding yeast is responsible for the function of converting the lipid portion of the GPI-anchored protein from a diacylglycerol type to a ceramide type. It was determined that the gene encodes a synthase (GIPC-AP synthase).
In addition, the present inventors have identified human and mouse-derived FRAG1 gene and C130090K23 gene (FLJ21511 gene) having high homology in the second half part (CWH43C) and the first half part (CWH43N) of the yeast CWH43 gene. Searched from the database, we found that the proteins encoded by both genes function as GIPC-AP synthase by forming a complex as α subunit and β subunit, respectively, and Cwh43C and Cwh43N proteins are similar in yeast cells. It was also confirmed that a simple subunit structure could be taken. The results show that GIPC-AP synthase in a wide range of biological species forms a complex composed of subunit structures having high homology with each of the α and β subunits.
Furthermore, in the above examination process, by using the cwh43 gene disrupted strain, it is possible to obtain a GPI-anchored protein in which diacylglycerol having a saturated fatty acid, which is a precursor of a ceramide-added GPI-anchored protein, is added with high purity. I found it.

The present invention has been completed based on these findings, and is as follows.
(1) DNA encoding a protein complex having a ceramide-added GPI-anchored protein synthase activity comprising an α subunit and a β subunit,
The DNA encoding the α subunit includes a DNA encoding a protein having the α subunit activity of the ceramide-added GPI-anchored protein synthase of any of the following (A) to (G):
(A) DNA encoding the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27,
(B) a DNA encoding an amino acid sequence in which 1 to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27;
(C) DNA consisting of the base sequence shown in SEQ ID NO: 5, SEQ ID NO: 9 or SEQ ID NO: 26,
(D) DNA consisting of a base sequence in which one to several bases are deleted, substituted or added in the base sequence shown in SEQ ID NO: 5, SEQ ID NO: 9 or SEQ ID NO: 26;
(E) DNA that hybridizes under stringent conditions with DNA consisting of the complementary sequence of SEQ ID NO: 5, SEQ ID NO: 9 or SEQ ID NO: 26,
(F) DNA having 70% or more homology to both SEQ ID NO: 9 and SEQ ID NO: 26;
(G) DNA having 30% or more homology with any of SEQ ID NO: 5, SEQ ID NO: 9 and SEQ ID NO: 26;
The DNA encoding the β subunit includes DNA encoding a protein having the β subunit activity of the ceramide-added GPI-anchored protein synthase of any of the following (H) to (N): Characterized by the above DNA,
(H) DNA encoding the amino acid sequence shown in SEQ ID NO: 4, SEQ ID NO: 8 or SEQ ID NO: 25,
(I) DNA encoding an amino acid sequence in which one to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 4, SEQ ID NO: 8 or SEQ ID NO: 25,
(J) DNA consisting of the base sequence shown in SEQ ID NO: 3, SEQ ID NO: 7 or SEQ ID NO: 24,
(K) a DNA comprising a base sequence in which one to several bases are deleted, substituted or added in the base sequence shown in SEQ ID NO: 3, SEQ ID NO: 7 or SEQ ID NO: 24;
(L) DNA that hybridizes under stringent conditions with DNA consisting of a complementary sequence of SEQ ID NO: 3, SEQ ID NO: 7 or SEQ ID NO: 24,
(M) DNA having 70% or more homology to both SEQ ID NO: 7 and SEQ ID NO: 24;
(N) DNA having a homology of 30% or more in any of SEQ ID NO: 3, SEQ ID NO: 7 and SEQ ID NO: 24.
(2) The ceramide-added GPI-anchored protein synthase activity is an activity for synthesizing a GPI-anchored protein added with a ceramide (C-type ceramide) comprising a hydroxylated fatty acid chain and phytosphingosine. DNA which codes the protein complex as described in said (1).
(3) DNA encoding a protein that functions as the α subunit of the protein complex according to (1) or (2), and encoding a protein having ceramide-added GPI-anchored protein synthase activity alone DNA, which is any of the following (A) to (G):
(A) DNA encoding the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27,
(B) a DNA encoding an amino acid sequence in which 1 to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27;
(C) DNA consisting of the base sequence shown in SEQ ID NO: 5, SEQ ID NO: 9 or SEQ ID NO: 26,
(D) DNA consisting of a base sequence in which one to several bases are deleted, substituted or added in the base sequence shown in SEQ ID NO: 5, SEQ ID NO: 9 or SEQ ID NO: 26;
(E) DNA that hybridizes under stringent conditions with DNA consisting of the complementary sequence of SEQ ID NO: 5, SEQ ID NO: 9 or SEQ ID NO: 26,
(F) DNA having 70% or more homology to both SEQ ID NO: 9 and SEQ ID NO: 26;
(G) DNA having a homology of 30% or more in any of SEQ ID NO: 5, SEQ ID NO: 9 and SEQ ID NO: 26.
(4) A recombinant vector containing the DNA according to any one of (1) to (3).
(5) A transformant transformed with the recombinant vector according to (4).
(6) The transformant according to (5) above, wherein the transformant is a transformed yeast obtained by transforming yeast as a host.
(7) A protein complex having a ceramide-added GPI-anchored protein synthase activity, wherein the transformant according to (5) or (6) is cultured to obtain an expression product of the DNA Or the manufacturing method of the alpha subunit.
(8) A protein complex having ceramide-added GPI-anchored protein synthase activity or an α subunit thereof, which is obtained by the production method according to (7).
(9) The ceramide-added GPI-anchored protein synthase activity is an activity for synthesizing a GPI-anchored protein added with a ceramide (C-type ceramide) comprising a hydroxylated fatty acid chain and phytosphingosine. The protein complex having ceramide-added GPI-anchored protein synthase activity or the α subunit thereof according to (8).
(10) A protein complex having a ceramide-added GPI-anchored protein synthase activity comprising an α subunit and a β subunit, and the α subunit is any one of the following amino acids (A) to (D) A protein complex comprising a sequence, wherein the β subunit includes any one of the following amino acid sequences (E) to (H):
(A) the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27,
(B) an amino acid sequence in which one to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27;
(C) an amino acid sequence having 70% or more homology with any of the amino acid sequences shown in SEQ ID NO: 10 and SEQ ID NO: 27;
(D) an amino acid sequence having 30% or more homology with any of the amino acid sequences shown in SEQ ID NO: 6, SEQ ID NO: 10 and SEQ ID NO: 27;
(E) the amino acid sequence shown in SEQ ID NO: 4, SEQ ID NO: 8 or SEQ ID NO: 25 (F) In the amino acid sequence shown in SEQ ID NO: 4, SEQ ID NO: 8 or SEQ ID NO: 25, 1 to several amino acids are deleted, Substituted or added amino acid sequence,
(G) an amino acid sequence having 70% or more homology with any of the amino acid sequences shown in SEQ ID NO: 8 and SEQ ID NO: 25;
(H) An amino acid sequence having 30% or more homology with any of the amino acid sequences shown in SEQ ID NO: 4, SEQ ID NO: 8 and SEQ ID NO: 25.
(11) The ceramide-added GPI-anchored protein synthase activity is an activity for synthesizing a GPI-anchored protein added with a ceramide (C-type ceramide) comprising a hydroxylated fatty acid chain and phytosphingosine. The protein complex according to (10) above.
(12) A protein comprising the amino acid sequence of any of the following (A) to (D), which functions as an α subunit of the protein complex according to (10) or (11), and alone A protein having ceramide-added GPI-anchored protein synthase activity,
(A) the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27,
(B) an amino acid sequence in which one to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27;
(C) an amino acid sequence having 70% or more homology with any of the amino acid sequences shown in SEQ ID NO: 10 and SEQ ID NO: 27;
(D) An amino acid sequence having 30% or more homology with any of the amino acid sequences shown in SEQ ID NO: 6, SEQ ID NO: 10 and SEQ ID NO: 27.
(13) A protein comprising any one of the following amino acid sequences (A) to (D) that functions as a β subunit of the protein complex according to (10) or (11), and having a ceramide-added GPI: A protein having an activity of enhancing anchor type protein synthase activity,
(A) a protein comprising the amino acid sequence shown in SEQ ID NO: 4, SEQ ID NO: 8 or SEQ ID NO: 25,
(B) An amino acid sequence in which one to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 4, SEQ ID NO: 8 or SEQ ID NO: 25.
(C) an amino acid sequence having 70% or more homology with any of the amino acid sequences shown in SEQ ID NO: 8 and SEQ ID NO: 25,
(D) An amino acid sequence having 30% or more homology with any of the amino acid sequences shown in SEQ ID NO: 4, SEQ ID NO: 8 and SEQ ID NO: 25.
(14) A ceramide-added GPI anchor, wherein the transformant according to (5) or (6) is cultured and ceramide is added to the GPI-anchored protein produced by the transformant. Type protein production method.
(15) The protein complex having the ceramide-added GPI anchor type protein synthase activity or the protein having the α subunit function thereof according to any one of the above (10) to (12) acts on the GPI anchor type protein A method for producing a GPI-anchored protein to which ceramide is added, characterized by comprising:
(16) The GPI-anchored protein is characterized by allowing a protein containing any one of the following amino acid sequences (A) to (C) and having a ceramide-added GPI-anchored protein synthase activity to act: A method for producing a GPI-anchored protein to which ceramide is added,
(A) a protein comprising the amino acid sequence represented by SEQ ID NO: 2,
(B) an amino acid sequence which is a part of the amino acid sequence shown in SEQ ID NO: 2 and comprises at least the amino acid sequence at positions 218 to 953;
(C) An amino acid sequence in which one to several amino acids are deleted, substituted or added in the amino acid sequence of (A) or (B).
(17) A protein having a ceramide-added GPI-anchored protein synthase activity obtained as an expression product of any of the following DNAs (A) to (E) is allowed to act on a GPI-anchored protein: A method for producing a GPI-anchored protein to which ceramide is added,
(A) DNA encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 2,
(B) DNA encoding an amino acid sequence which is a part of the amino acid sequence shown in SEQ ID NO: 2 and comprises at least the amino acid sequence at positions 218 to 953;
(C) DNA consisting of the base sequence represented by SEQ ID NO: 1,
(D) DNA that is a part of the base sequence shown in SEQ ID NO: 1 and comprises at least the 652-2859 base sequence,
(E) A DNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence of the base sequence (C) or (D).
(18) Transforming a host cell producing a GPI-anchored protein using a DNA encoding a protein having a ceramide-added GPI-anchored protein synthase activity of any one of the following (A) to (E): Culturing the transformed cell, a method for producing a GPI-anchored protein to which ceramide is added,
(A) DNA encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 2,
(B) DNA encoding an amino acid sequence which is a part of the amino acid sequence shown in SEQ ID NO: 2 and comprises at least the amino acid sequence at positions 218 to 953;
(C) DNA consisting of the base sequence represented by SEQ ID NO: 1,
(D) DNA that is a part of the base sequence shown in SEQ ID NO: 1 and comprises at least the 652-2859 base sequence,
(E) A DNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence of the base sequence (C) or (D).
(19) The method for producing a GPI-anchored protein to which ceramide is added according to (17), wherein the transformant is a transformed yeast obtained by transforming a yeast host.
(20) The protein having the α subunit activity of the ceramide-added GPI-anchored protein synthase described in (12) above and having the ceramide-added GPI-anchored protein synthase activity alone, and (13) A ceramide-added GPI-anchored protein synthase β-subunit activity and a protein having an activity to enhance the ceramide-added GPI-anchored protein synthase activity simultaneously with the GPI-anchored protein or its production cell A method for producing a GPI-anchored protein to which ceramide is added, characterized in that the method is allowed to act.
(21) Any of (14) to (20), wherein the ceramide-added GPI-anchored protein is a GPI-anchored protein to which a ceramide (C-type ceramide) comprising a hydroxylated fatty acid chain and phytosphingosine is added. A method for producing a ceramide-added GPI-anchored protein according to claim 1.
(22) When producing the ceramide-added GPI-anchored protein, a GPI-anchored protein-producing yeast cell is used to produce the ceramide-added GPI-anchored protein on the surface of the yeast cell or in the culture medium The method for producing a ceramide-added GPI-anchored protein according to any one of (14) to (21), which is characterized in that
(23) A GPI-anchored protein to which ceramide is added, which is obtained by the production method according to any one of (14) to (22).
(24) The protein according to (23), wherein the GPI-anchored protein to which ceramide is added is a GPI-anchored protein to which ceramide (C-type ceramide) comprising a hydroxylated fatty acid chain and phytosphingosine is added. .
(25) A method for producing ceramide, characterized in that the protein and sugar chain moiety are cleaved and removed from the GPI-anchored protein to which ceramide has been added according to (23) or (24), by an enzyme or by chemical treatment. .
(26) The ceramide according to (25), wherein phospholipase C or phospholipase D is used when cleaving and removing the protein and sugar chain part from the GPI-anchored protein to which ceramide is added. Production method.
(27) A ceramide-added GPI-anchored protein composition is obtained using the production method according to the above (14) to (22), and then the protein and sugar chain portion are enzymatically or from the ceramide-added GPI-anchored protein or A method for producing a C-type ceramide-containing ceramide composition by cutting and removing by chemical treatment.
(28) A C-type ceramide-containing ceramide composition obtained by the method for producing a ceramide composition according to (27).
(29) In the genomic DNA of Saccharomyces cerevisiae, a ceramide-added GPI-anchored protein is synthesized by introducing a mutation into the ceramide-added GPI-anchored protein synthase gene or suppressing the expression of the gene. A method for producing a GPI-anchored protein to which diacylglycerol having a saturated fatty acid is added with high purity using a budding yeast, characterized by inhibiting or suppressing.
(30) The method for producing a GPI-anchored protein to which diacylglycerol having a saturated fatty acid is added according to (29) above, wherein a budding yeast cwh43 gene disruption strain is used as the budding yeast.
(31) A polynucleotide comprising a partial sequence of the base sequence shown in SEQ ID NO: 5, SEQ ID NO: 9 or SEQ ID NO: 26, or a complementary sequence thereof, comprising a ceramide-added GPI-anchored protein synthase and / or an α subunit thereof A polynucleotide which can be a probe or primer for detecting DNA to be encoded.
(32) The polynucleotide according to (31) above, comprising the base sequence shown in SEQ ID NO: 12, 15, 16, 18, 19, or SEQ ID NO: 23 or a complementary sequence thereof.
(33) A polynucleotide comprising a partial sequence of the base sequence shown in SEQ ID NO: 3, SEQ ID NO: 7 or SEQ ID NO: 24, or a complementary sequence thereof, comprising a ceramide-added GPI-anchored protein synthase and / or a β subunit thereof A polynucleotide which can be a probe or primer for detecting DNA to be encoded.
(34) The polynucleotide according to (33) above, comprising the base sequence represented by SEQ ID NO: 11, 13, 14, 17, 18, 19, or SEQ ID NO: 21 or a complementary sequence thereof.
(35) A probe or primer for detecting DNA encoding a ceramide-added GPI-anchored protein synthase and / or an α subunit thereof, comprising the polynucleotide according to (31) or (32).
(36) A probe or primer for detecting DNA encoding the ceramide-added GPI-anchored protein synthase and / or its β subunit, comprising the polynucleotide according to (33) or (34).
(37) DNA encoding ceramide-added GPI-anchored protein synthase and / or its α subunit and / or its use, characterized by using the probe or primer described in (35) and / or (36) A method for screening DNA encoding a β subunit.

GPI anchor added with high-purity ceramide from transformed cells using the gene of the present invention or by allowing the ceramide-added GPI-anchored protein synthase complex of the present invention or its α subunit to act on yeast cells or the like Type protein can be obtained.
When yeast is used as a ceramide-added GPI-anchored protein-producing cell such as a transformed host cell, the protein portion of the obtained ceramide-added GPI-anchored protein is almost a mannan protein. Therefore, it can be used as a functional food by purifying it while it is bound. For mannan, interferon-inducing activity (Acta Virology, 1970; 14: 1-7), macrophage migration inhibitory activity (Jpn. J. Microbiol., 1975; 19: 355-362), enhanced TNFα production (Microbiol. Immunol ., 2002; 46: 503-512), and other bioactive functions have been reported.
If the protein portion is removed by nitrous acid treatment or phospholipase or the like, high-purity ceramide can be easily obtained and can be used for cosmetics, functional foods, and the like. In particular, when a ceramide-added GPI-anchored protein synthase complex derived from a mammal such as human is used, a highly polar ceramide (C-type ceramide) having a structure in which a hydroxylated fatty acid is amide-bonded to phytosphingosine. Therefore, higher moisture retention can be expected.
In addition, by preparing a GPI-anchored protein using yeast cells in which the ceramide addition step such as cwh43 gene disruption strain is inhibited, a GPI-anchored protein to which diacylglycerol having a saturated fatty acid is added with high purity can be obtained. This lipid part can be applied to oil and fat modifiers and foods.

1. Yeast-derived GIPC-AP synthase and findings related to its gene One of the types of post-translational modification of proteins is modification by a glycolipid phosphatidylinositol (GPI). Some of the proteins present on the cell surface are tethered to the cell membrane by GPI. Such a protein is called a GPI-anchored protein because GPI acts like a cocoon.
GPI synthesis begins with the endoplasmic reticulum (ER), and glucosamine, mannose, ethanolamine phosphate, acyl groups, etc. are added in sequence to the phospholipid phosphatidylinositol (PI) to form a complete precursor. The complete precursor is transferred to the C-terminus of the polypeptide by a transamidase complex. Thereafter, deacylation occurs, and the lipid part is further converted. In the GPI biosynthetic pathway, the phosphatidylinositol (PI) structure of the GPI-anchored protein after GPI was added to the protein was converted to a lysophosphatidylinositol (lysoPI) structure, and a saturated fatty acid was further added. The process of converting to the ceramide type via the diacylglycerol type (pG1) is called a lipid remodeling process.
Prior to the present invention, the present inventors removed the unsaturated fatty acid at the sn-2 position from the PI of the “two-legged structure” during the lipid remodeling process of GPI, and the fatty acid was 1 at the sn-1 position. In addition to “Per1 protein”, which is an enzyme for lyso-PI with a “single-legged structure” added only to the mosquito, it is an enzyme that has a pG1-type structure by adding a long saturated fatty acid to lyso-PI at the sn-2 position The function of a certain “Gup1 protein” was clarified, and the first half of the lipid remodeling process of the GPI-anchored protein was elucidated (Japanese Patent Application No. 2006-220491).
However, only the last ceramide addition process mechanism of the lipid remodeling process remained unclear (FIG. 12).
In the present invention, by providing this ceramide-added GPI-anchored protein synthase Cwh43 protein (SEQ ID NO: 2) and its CWH43 gene (SEQ ID NO: 1), the entire GPI biosynthetic pathway up to the ceramide type can be obtained. As a result, it was clarified that the epoch-making result of elucidating the whole picture of “lipid remodeling process of GPI-anchored protein” was obtained.

2. GIPC-AP synthase and its gene-related knowledge in mammals, etc. On the other hand, in mammals such as humans and mice, ceramides that are abundantly present between cells in the stratum corneum and skin cells of the skin are GPI anchor type. Whether or not it constitutes the lipid part of a protein has also been unknown.
When the present inventors searched for DNA having high homology with the CWH43 gene from human and mouse DNA databases, the mouse C130090K23 gene and the human FLJ21511 gene were higher than the latter half of the CWH43 gene (CWH43C). In addition to having homology (the homology between the mouse C130090K23 gene and the CWH43C gene is 38% at the nucleotide sequence level), the mouse and human FRAG1 genes have high homology to the first half of the CWH43 gene (CWH43N) (The homology between the mouse FRAG1 gene and the CWH43N gene is 33% at the nucleotide sequence level). As the knowledge about the conventional FRAG1 gene, it is a gene that has a function of activating the fibroblast growth factor receptor and is involved in the signal transduction mechanism (Non-patent Document 4), and the GPI anchor type for the human FRAG1 gene There is only a report (Non-Patent Document 5) that it is involved in the processing of the fatty acid chain of proteins, and its specific function has not been analyzed. Regarding the mouse C130090K23 gene and the corresponding human FLJ21511 gene, The situation was not even estimated. In the first place, in both cases of mice and humans, the FRAG1 gene, the C130090K23 gene, and the FLJ21511 gene are present on different chromosomes, and there are no factors to consider by linking both genes.

Based on the high homology between the two genes, the second half of the yeast CWH43 gene (CWH43C) and the first half (CWH43N), the proteins encoded by both genes form a subunit structure. The hypothesis of exhibiting ceramide-added GPI-anchored protein synthase activity was established and experimentally proved by Examples described later.
That is, when the mouse-derived C130090K23 gene having homology with the latter half of the CWH43 gene (CWH43C) is expressed in yeast cells lacking the yeast cwh43 gene, the yeast CWH43 gene is complemented to synthesize a ceramide-added GPI-anchored protein. It was confirmed that the ceramide-added GPI-anchored protein synthase activity alone.
In addition, when the mouse-derived FRAG1 gene having homology to CWH43N is expressed in yeast cells simultaneously with the C130090K23 gene, the amount of GPI-anchored protein to which ceramide is added increases, in particular, phytosphingosine. It was found that the increase in the addition of ceramide (C-type ceramide) in which hydroxylated fatty acid was amide-bonded was conspicuous. As a result of the coprecipitation test on the FRAG1 gene expression product (FRAG1) and the C130090K23 gene expression product (C130090K23), it was confirmed that both coprecipitates rapidly.
Judging from these results comprehensively, in mammalian systems, C130090K23 (FLJ21511) and FRAG1 form complexes as α and β subunits in cells to act as ceramide-type GPI-anchored protein synthases. It is clear that FRAG1 of the β subunit plays a role of enhancing the activity of ceramide-added GPI-anchored protein synthase by C130090K23 of the α subunit.
Furthermore, a clear coprecipitation reaction was also observed in the coprecipitation test of yeast-derived Cwh43C and Cwh43N proteins corresponding to the α and β subunits, respectively. The Cwh43C and Cwh43N proteins also function as α and β subunits. In addition, the α and β subunit structures and mechanisms observed in ceramide-added GPI-anchored protein synthase complexes in mammals are widely and universally strong in organisms. It is suggested.

3. GIPC-AP synthase in the present invention
Based on the above knowledge obtained in the present invention, a protein having ceramide-added GPI-anchored protein synthase activity and DNA encoding the protein will be described below.
Here, "ceramide added GPI-anchored proteins (G lycosyl- i nositol p hophoryl c eramide- a nchored p rotein) ", and also referred to as taking the initials "GIPC-AP", "ceramide added GPI-anchored proteins “Synthase” is also referred to as “GIPC-AP synthase”. In that case, the protein having the “GIPC-AP” synthase activity and the protein complex may be collectively referred to as “GIPC-AP synthase”.
Among the two subunit structures in the ceramide-added GPI-anchored protein synthase complex, a subunit that is homologous to the C-terminal side (Cwh43C) of Cwh43 derived from yeast and has IPC synthase activity is an α subunit. A subunit having homology with the N-terminal side (Cwh43N) of Cwh43 and having an effect of enhancing GIPC-AP synthase activity is referred to as a β subunit.

4). CWH43-related GIPC-AP synthase derived from Saccharomyces cerevisiae and its gene The enzyme protein (Cwh43 protein) encoded by the CWH43 gene derived from Saccharomyces cerevisiae is a GPI-anchored phosphatidylinositol structure in the lipid remodeling process. It has a function of adding ceramide to a protein to synthesize a ceramide-added GPI-anchored protein (GIPC-AP). The base sequence of the gene is shown in SEQ ID NO: 1, and the amino acid sequence of the enzyme protein encoded by the gene is shown in SEQ ID NO: 2.
In addition, the Cwh43 protein of this budding yeast is only a partial protein on the C-terminal side (positions 218 to 953 of the amino acid sequence of SEQ ID NO: 2) and has a GIPC-AP synthase activity. As long as it contains at least the amino acid sequence at positions 218 to 953 (SEQ ID NO: 6), it has the same function as the Cwh43 protein.
In addition, one or several amino acids are deleted from the protein having high homology with the Cwh43 protein and the C-terminal partial protein thereof, that is, the partial amino acid sequence comprising SEQ ID NO: 2 or at least positions 218 to 953 thereof. A protein having a substituted or added amino acid sequence and having similar GIPC-AP synthase activity is also used as a GIPC-AP synthase in the present invention. Such modified proteins such as deletions, substitutions and additions can also be obtained by chemical or enzymatic treatment, and site mutation methods or mutation introduction methods using restriction enzymes using the genes encoding the proteins. Etc. can be synthesized by a conventional genetic recombination technique.
Similarly, since a part of the CWH43 gene consisting of SEQ ID NO: 1 and containing a base sequence at least at positions 652 to 2859 is a gene having a function equivalent to that of the CWH43 gene, SEQ ID NO: 1 or its The GIPC-AP synthesis of the present invention also applies to DNA consisting of a partial base sequence containing at least the 652-2859-position base sequence and DNA hybridizing under stringent conditions with a DNA consisting of a complementary sequence of those base sequences. It can be used as DNA encoding a protein having enzyme activity. Here, “hybridizes under stringent conditions” typically means Sambrook et al., 1989 (Molecular cloning: a laboratory manual; Cold Spring Harbor Lab, Cold Spring Harbor, NY, 2nd ed Have a high degree of homology (identity) that can be detected when Southern hybridization under high stringency conditions is applied, usually 85-90% or more. In fact, it can be obtained by PCR and / or Southern hybridization from commercially available or appropriately prepared cDNA libraries of various organisms.
The “homology” in the present invention is a conversion value indicating “identity” in the Lipman-Pearson calculation method (Lipman and Pearson, 1985; Science 227, 1435-1441). In addition, the term “hybridizes with DNA consisting of a base sequence represented by a specific sequence number” includes the case of a complementary sequence together with the base sequence.

These budding yeast-derived CWH43-related GIPC-AP synthases can be produced from host cells such as yeast transformed with the following DNA.
(A) DNA encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 2.
Here, SEQ ID NO: 2 corresponds to the amino acid sequence of Cwh43 protein.
(B) DNA encoding an amino acid sequence which is a part of the amino acid sequence shown in SEQ ID NO: 2 and includes at least the amino acid sequence at positions 218 to 953.
Here, the amino acid sequence including the amino acid sequence at positions 218 to 953 of SEQ ID NO: 2 corresponds to the Cwh43C protein shown in SEQ ID NO: 5, and GIPC-AP synthase activity has been confirmed.
(C) DNA consisting of the base sequence shown in SEQ ID NO: 1.
Here, SEQ ID NO: 1 corresponds to the base sequence of the CWH43 gene.
(D) DNA that is a part of the base sequence represented by SEQ ID NO: 1 and contains at least the 652-2859 base sequence.
The base sequence at positions 652 to 2859 of SEQ ID NO: 1 corresponds to the CWH43C gene shown in SEQ ID NO: 3.
(E) A DNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence of the base sequence (C) or (D).
The resulting GIPC-AP synthase can be isolated and purified by disrupting transformed cells and applying the usual protein purification method after extraction. It can be used for GIPC-AP synthesis. Further, GIPC-AP can be directly synthesized from the transformed cells by acting on the GPI-anchored protein inherent in the transformed cells.

5. Genes encoding the α and β subunits of the GIPC-AP synthase complex. Among the GIPC-AP synthase complexes, the gene encoding the protein having the α subunit function of the GIPC-AP synthase complex is: Typical examples derived from mammals include mouse C130090K23 (NM_181323) gene (SEQ ID NO: 9) and human FLJ21511 (NM_025087) gene (SEQ ID NO: 26). Both have high homology to the latter half of the CWH43 gene (CWH43C) (the homology between the mouse C130090K23 gene and the CWH43C gene is 38% at the nucleotide sequence level and 28.9% at the amino acid sequence level). there were.). Since the homology between mouse and human, which is a distant species among mammals, was 82.3% at the base sequence level (81.3% at the amino acid sequence level), either of SEQ ID NO: 9 and SEQ ID NO: 26 DNA having a base sequence having 70% or more homology, preferably 80% or more homology, more preferably 85% or more homology, particularly GIPC -There is a high probability of having a function as a gene encoding a protein having the α subunit function of the AP synthase complex. In addition, the sequence having high homology to the three of the CWH43C gene base sequence (SEQ ID NO: 5) together with SEQ ID NO: 9 and SEQ ID NO: 26 is almost certainly the α subunit of the same GIPC-AP synthase complex. Function can be expected. Specifically, DNA having a homology of 30% or more, preferably 40% or more with respect to any of the nucleotide sequences of SEQ ID NOs: 5, 9, and 26 is also included.
The function of the obtained DNA can be confirmed by in vitro translation in wheat germ, Escherichia coli lysate systems, or expression in a transformed yeast host, etc., but the obtained DNA is connected to a budding yeast expression vector. It can also be confirmed by introducing it into a cwh43 gene-disrupted strain and examining the transformant for Calcofluor White sensitivity and temperature sensitivity.
The cwh43-disrupted strain is a yeast cell strain that lacks a cell wall derived from a commercially available budding yeast, and exhibits sensitivity and high-temperature sensitivity to Calcofluor White, a drug that detects cell wall defects. This recovery test can be carried out by culturing budding yeast cells on a nutrient medium containing Calcofluor White or by culturing on a nutrient medium at a high temperature (for example, 39 ° C.).
Similarly, typical genes encoding the protein having the β subunit function of the GIPC-AP synthase complex include human FRAG1 (GenBank Acc. No. NM — 014489) gene (SEQ ID NO: 24) and mouse Frag1 (NM — 145583). ) Gene (SEQ ID NO: 7), both of which have high homology to the first half of the CWH43 gene (CWH43N) (the homology between the mouse FRAG1 gene and the CWH43N gene is 33% at the nucleotide sequence level) The amino acid sequence level was 25.3%.) Since homology between mouse and human was 67.9% at the nucleotide sequence level (94.4% at the amino acid sequence level), at least 70% or more for both SEQ ID NO: 7 and SEQ ID NO: 24 A DNA having a β subunit function of the GIPC-AP synthase complex, as long as the DNA has a base sequence having a homology of 80% or more, preferably 85% or more, more preferably 85% or more. Therefore, it is included in the DNA encoding the β subunit in the present invention. In addition, the sequence having high homology to the three of the CWH43N gene base sequence (SEQ ID NO: 3) together with SEQ ID NO: 7 and SEQ ID NO: 24 is almost certainly the β subunit of the same GIPC-AP synthase complex. Function can be expected. Specifically, DNA having homology of 30% or more, preferably 40% or more with respect to any of the nucleotide sequences of SEQ ID NOs: 3, 7 and 24 is also included as the DNA of the present invention.

6). Α and β subunits of the GIPC-AP synthase complex The protein corresponding to the gene encoding the α subunit of the GIPC-AP synthase, that is, the α subunit of the GIPC-AP synthase complex, For the same reason as described above, a protein having an amino acid sequence consisting of the following (A) to (D) has GIPC-AP synthase activity and is used as an α subunit of the GIPC-AP synthase complex. The function can be expected.
(A) The amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27.
Here, SEQ ID NO: 6 is the amino acid sequence corresponding to the budding yeast-derived Cwh43C protein, SEQ ID NO: 10 is the mouse C130090K23 protein, and SEQ ID NO: 27 is the human FLJ21511 protein.
(B) An amino acid sequence in which 1 to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27.
(C) An amino acid sequence having 70% or more homology, preferably 80% or more homology, more preferably 85% or more homology to any of the amino acid sequences shown in SEQ ID NO: 10 and SEQ ID NO: 27 .
(D) An amino acid sequence having homology of 30% or more, preferably 40% or more with respect to any of the amino acid sequences shown in SEQ ID NO: 6, SEQ ID NO: 10 and SEQ ID NO: 27.
The homology between SEQ ID NO: 10 and SEQ ID NO: 27 is 81.3%, SEQ ID NO: 6 and SEQ ID NO: 10 are 28.9% homologous, and SEQ ID NO: 6 and SEQ ID NO: 27 are homologous 28.3. %Met.
If the β subunit of the GIPC-AP synthase complex is a protein having an amino acid sequence consisting of the following (E) to (H), the GIPC-AP synthesis activity called GIPC-AP synthase activity enhancing action is similarly used. A function as a β subunit of the enzyme complex can be expected.
(E) The amino acid sequence shown in SEQ ID NO: 4, SEQ ID NO: 8 or SEQ ID NO: 25.
Here, SEQ ID NO: 4 is the budding yeast-derived Cwh43N protein, SEQ ID NO: 8 is the mouse FRAG1 protein, and SEQ ID NO: 25 is the amino acid sequence corresponding to the human FRAG1 protein.
(F) An amino acid sequence in which one to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 4, SEQ ID NO: 8 or SEQ ID NO: 25.
(G) Amino acid sequence having 70% or more homology, preferably 80% or more homology, more preferably 85% or more homology with any of the amino acid sequences shown in SEQ ID NO: 8 and SEQ ID NO: 25 .
(H) An amino acid sequence having homology of 30% or more, preferably 40% or more with respect to any of the amino acid sequences shown in SEQ ID NO: 4, SEQ ID NO: 8 and SEQ ID NO: 25.
The homology between SEQ ID NO: 8 and SEQ ID NO: 25 is 94.4%, SEQ ID NO: 4 and SEQ ID NO: 8 have a homology of 25.3%, and SEQ ID NO: 4 and SEQ ID NO: 25 have a homology of 17.9. %Met.

In order to synthesize these GIPC-AP synthase complex α subunit and β subunit, a transformation technique by a usual genetic recombination method can be applied. Typically, the α subunit and β subunit are combined. The gene can be obtained by ligating host cells with the same or separate expression vectors. For example, it can be obtained by producing in yeast cells by inserting the α subunit gene and the β subunit gene separately or linked into a yeast expression vector. Specifically, these genes are inserted between the TDH3 promoter and the TDH3 terminator in the budding yeast expression vector YEp352GAP. When such a plasmid is introduced into a yeast cell by the lithium acetate method or the like and grown on a nutrient medium, the yeast cell produces a GIPC-AP synthase complex or each subunit as a gene product.
The α and β subunits of the obtained GIPC-AP synthase complex can be purified and isolated, respectively, and used for the synthesis of GIPC-AP. It can be used as a solution or a microsomal membrane fraction. In addition, it can be used as a production cell such as yeast producing the α subunit and / or β subunit. That is, if a cell transformed with a gene encoding the α and β subunits of the GIPC-AP synthase complex or a gene encoding the α subunit is allowed to act on the GPI-anchored protein, Ceramide-added GPI-anchored proteins can be produced.
In particular, if a cell that produces a large amount of GPI-anchored protein in cells such as budding yeast is selected as a host, the transformed host cell adds a protein obtained by adding ceramide to the intracellular GPI-anchored protein in the cell membrane. Secreted in large quantities in the microdomain of In that case, the intracellular GPI-anchored protein may be naturally produced by the cell itself, but a gene encoding a preferred GPI-anchored protein or a gene encoding a GPI-anchored protein synthase, etc. It may be a cell transformed by.

7). GIPC-AP and GIPC-AP synthesis method The method for producing a ceramide-added GPI-anchored protein using the GIPC-AP synthase complex or its α subunit is as described above, and the GIPC-AP synthase complex or its α A ceramide-added GPI-anchored protein can be produced by allowing an expression product protein of a gene encoding a subunit to act on a GPI-anchored protein in a purified or unpurified state, and a GIPC-AP synthase complex or A ceramide-added GPI-anchored protein (GIPC-AP) can be produced by adding ceramide to an endogenous or foreign GPI-anchored protein by a transformed cell using the gene encoding the α subunit.
In that case, since the β subunit of the GIPC-AP synthase complex has an action of enhancing the GIPC-AP synthase activity, it acts on the GPI-anchored protein together with the GIPC-AP synthase α subunit. And the production amount of ceramide-added GPI anchor type protein increases. Using a transformed cell obtained by transforming a gene encoding the GIPC-AP synthase β subunit together with a gene encoding the GIPC-AP synthase α subunit, a ceramide-added GPI-anchored protein is produced by the transformed cell. It is preferable to do.

When a ceramide-added GPI-anchored protein is synthesized using the β subunit together with the GIPC-AP synthase α-subunit, C-type ceramide (hydroxylated fatty acid chain) is used as the ceramide added to the GPI-anchored protein. And the proportion of ceramide consisting of phytosphingosine). In particular, when yeast is selected as a host for transformed cells, a gene encoding a mammalian GIPC-AP synthase complex is expressed in the yeast cells, and ceramide is added to the endogenous GPI-anchored protein of yeast. For example, as shown in Example 6, C-type ceramide is remarkably added to the obtained ceramide-added GPI-anchored protein.
C-type ceramide is a GPI-anchored protein to which C-type ceramide is added because C-type ceramide is hydroxylated in both sphingosine and fatty acid chains and has high hydrophilicity, so that it can be expected to have an effect as a ceramide such as a higher moisturizing effect. Is highly useful. The ratio of the C-type ceramide addition type in the preferable all-ceramide addition GPI-anchored protein is at least 10% or more, more preferably 20% or more, and further preferably 50% or more.

The above 4. As described above, the DNA can be produced using any of the following DNAs (A) to (E) encoding a GIPC-AP synthase related to the budding yeast CWH43. Specifically, GIPC-AP synthase is first produced from a transformed host cell such as yeast, and the GIPC-AP synthase is isolated and purified, or acts on a GPI-anchored protein without purification. Or the transformed cells are cultured to directly produce a ceramide-added GPI-anchored protein.
(A) DNA encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 2.
Here, SEQ ID NO: 2 is the amino acid sequence of Cwh43 protein.
(B) DNA encoding an amino acid sequence which is a part of the amino acid sequence shown in SEQ ID NO: 2 and includes at least the amino acid sequence at positions 218 to 953.
Here, the amino acid sequence including the amino acid sequence at positions 218 to 953 of SEQ ID NO: 2 corresponds to the Cwh43C protein shown in SEQ ID NO: 5, and GIPC-AP synthase activity has been confirmed.
(C) DNA consisting of the base sequence shown in SEQ ID NO: 1.
Here, SEQ ID NO: 1 corresponds to the base sequence of the CWH43 gene.
(D) DNA that is a part of the base sequence represented by SEQ ID NO: 1 and comprises at least the 652-2859 base sequence.
The base sequence at positions 652 to 2859 of SEQ ID NO: 1 corresponds to the CWH43C gene shown in SEQ ID NO: 3.
(E) A DNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence of the base sequence (C) or (D).

  The obtained ceramide-added GPI-anchored protein can be purified by an ordinary protein purification method, for example, by the following method. A typical budding yeast GPI-anchored protein, such as Gas1p or Cwp2p, is pre-tagged, and the yeast lysate expressing the tagged GPI-anchored protein gene is mixed with beads that bind the antibody that recognizes the tag. By doing so, the tagged GPI-anchored protein can be adsorbed specifically to the beads.

8). 6. Ceramide production method and C-ceramide rich ceramide composition The ceramide-added GPI-anchored protein obtained in step 1 is subjected to enzyme treatment such as phospholipase C or phospholipase D, or chemical treatment of the protein and carbohydrate part, for example, nitrite treatment. Ceramide can be separated.
In this case, the ceramide-added GPI-anchored protein is not an isolated and purified ceramide-added GPI-anchored protein, but contains an unpurified ceramide-added GPI-anchored protein, such as a glycoprotein mixture adsorbed on ConA-Sepharose. It may be in the state.
The enzyme treatment conditions for phospholipase are, for example, 24 hours at 37 ° C in an appropriate enzyme buffer. The nitrite treatment conditions are first treated with pronase, etc. to digest the protein part, boiled, and dried. After that, nitrite treatment is preferably performed at 37 ° C for 3 hours.

As described above, when a ceramide-added GPI-anchored protein is synthesized using a β subunit together with a mammalian GIPC-AP synthase α-subunit, a C-type ceramide-type GPI-anchored protein is produced. When yeast is selected as a host for transformed cells, a gene encoding a mammalian GIPC-AP synthase complex is expressed in the yeast cells, and ceramide is added to the endogenous GPI-anchored protein of yeast. Since C-type ceramide is remarkably added, a C-type ceramide-rich ceramide composition can be obtained by separating ceramide from the ceramide-added GPI-anchored protein obtained by these production methods.
The proportion of C-type ceramide in the preferred total ceramide composition is at least 10% or more, more preferably 20% or more, still more preferably 50% or more.

9. Method for producing ceramide-added GPI-anchored protein precursor A GPI-anchored type in which diacylglycerol having saturated fatty acid corresponding to a precursor of ceramide-added GPI-anchored protein is added with high purity by using cwh43 gene disrupted strain It is confirmed in Example 4 that the protein accumulates in a significant amount inside the yeast cell.
Therefore, diacylglycerol having saturated fatty acid was added with high purity by inhibiting the conversion step from glycerol-type GPI-anchored protein to ceramide-type in cells originally producing GPI-anchored protein such as budding yeast. GPI-anchored proteins can be produced.

10. Screening of GIPC-AP synthase gene 4. And 5. The GIPC-AP synthase gene described in 1 above can be obtained from a commercially available cDNA library or the like using a PCR method or the like, but the primer and probe for that purpose are derived from the budding yeast obtained according to the present invention. The nucleotide sequence shown in SEQ ID NO: 1 corresponding to the CWH43 gene or a partial sequence of its complementary sequence, the nucleotide sequence shown in SEQ ID NO: 5, 9 and 26 corresponding to the α subunit of the GIPC-AP synthase complex or its A partial sequence of a complementary sequence, a base sequence shown in SEQ ID NOs: 3, 7 and 24 corresponding to the same β subunit or a partial sequence of a complementary sequence thereof can be used.
Here, since SEQ ID NO: 5 is the gene sequence of CWH43C and SEQ ID NO: 3 is the gene sequence of CWH43N, when both are combined, it becomes almost SEQ ID NO: 1, so that the GIPC-AP synthetase gene detection in the present invention is eventually performed. Useful polynucleotides for
(1) A partial sequence of the base sequence shown in SEQ ID NOs: 5, 9 and 26 or a complementary sequence thereof, and used as a primer or probe for detecting a gene encoding GIPC-AP synthase and / or its α subunit And (2) a partial sequence of the nucleotide sequence shown in SEQ ID NOs: 3, 7 and 24 or a complementary sequence thereof, and encodes GIPC-AP synthase and / or its β subunit A primer for detecting a gene, a polynucleotide of a length that can be used as a probe,
It is.
The length of the primer that can be used for such screening (detection) is at least 10 bases or more, preferably 12 bases or more, more preferably 15 bases or more, and most preferably 20 bases or more. Similarly, the length as a probe is at least 15 bases or more, preferably 18 bases or more, more preferably 20 bases or more, and most preferably 30 bases or more.
For example, as the primer of (1) above, a polynucleotide comprising the nucleotide sequence shown in SEQ ID NOs: 12, 15, 16, 18, 19 and 23 is used. As the primer of (2), SEQ ID NOs: 11, 13 are used. , 14, 17, 18, 19 and 21 are used.

Examples are shown below, but the present invention is not limited thereto.
Experimental methods such as measurement methods used in the examples are as follows.
The method for isolating the DRM fraction was according to Bagnat et al., 2000, Proc Natl Acad Sci USA 97, 3254-3259. After disrupting the cells with glass beads so that the optical density at the wavelength of 600 nm is 30 (30 OD600), add Triton X-100 at a final concentration of 1% to the disrupted solution, and then use Optiprep Adjust by performing density gradient centrifugation. Thereafter, each fraction can be detected by SDS-PAGE and Western blotting using a Gas1p antibody.
The cwh43-disrupted strain is a yeast cell line that lacks a cell wall derived from a commercially available budding yeast, and exhibits sensitivity and high-temperature sensitivity to Calcofluor White, an agent that detects cell wall defects. Each of these recovery tests can be performed by culturing budding yeast cells on a nutrient medium containing Calcofluor White or by culturing on a nutrient medium at a high temperature (eg, 39 ° C.).

<Example 1>
[Preparation of budding yeast CWH43 gene and Cwh43 protein, mouse FRAG1 gene, FRAG1 protein, mouse C130090K23 gene, C130090K23 protein]
The CWH43 gene was obtained by PCR using Saccharomyces cerevisiae genomic DNA as a template. The primers used for PCR are as follows.
CWH43-BamHI-F 5'- aaaaggatccgcaaacaatcttgaaggct -3 '(SEQ ID NO: 11)
CWH43-SalI-stop-NheI-R 5'-aaaaagtcgacttagctagctaagtaataacgtggctcatca -3 '(SEQ ID NO: 12)
The DNA fragment obtained by the amplification was cleaved with restriction enzymes BamHI and SalI and inserted into a single-copy vector pRS316 for budding yeast (Sikorski and Hieter, 1989; Genetics 122, 19-27), and the nucleotide sequence was determined. The base sequence of the open reading frame part is as shown in SEQ ID NO: 1. A GPI7 gene terminator was inserted into this plasmid and introduced into yeast cells to express the CWH43 gene, and a protein having the amino acid sequence shown in SEQ ID NO: 2 was obtained. The Cwh43 protein produced in this way was confirmed to have a function, since it did not show the Calcofluor White sensitivity or high temperature sensitivity of the cwh43 disrupted strain (Fig. 5).
The mouse FRAG1 gene was obtained by PCR using plasmid DNA of NIH mammalian gene collection clone No. 3588752 as a template. The primers used for PCR are as follows.
EI-mmFRAG1-F24 5'- ggaattcatgtaccaggtcccactgac-3 '(SEQ ID NO: 13)
mmFRAG1-NotI-R33 5'- ataagaatgcggccgcgaatctcttttcctcaggctg -3 '(SEQ ID NO: 14)
The DNA fragment obtained by amplification is cleaved with restriction enzymes EcoRI and NotI, and an HA epitope tag is inserted immediately before the terminator of the multi-copy expression vector YEp352GAP II for budding yeast (Abe et al., 2003; Glycobiology 13, 87-95). The plasmid was inserted into the plasmid, and the nucleotide sequence was determined. The base sequence of the open reading frame part is as shown in SEQ ID NO: 7. This plasmid YEp352GAPII-FRAG1-HA was introduced into yeast cells to express the FRAG1 gene, and a protein having the amino acid sequence shown in SEQ ID NO: 8 was obtained.
The mouse C130090K23 gene was obtained by PCR using plasmid DNA of NIH mammalian gene collection clone No. 3584006 as a template. The primers used for PCR are as follows.
Sma-mmFLJ21511-F30 5'- tcccccgggatgccaggcctgtggagag -3 '(SEQ ID NO: 15)
mmFLJ21511-N * Sa-R27 5'- tgcggtcgactcagctagcaacgaagtatttgggtgtattca -3 '(SEQ ID NO: 16)
The DNA fragment obtained by the amplification was cleaved with restriction enzymes SmaI and SalI, inserted into a multicopy expression vector YEp352GAP II for budding yeast (Abe et al., 2003; Glycobiology 13, 87-95), and the nucleotide sequence was determined. . The base sequence of the open reading frame part is as shown in SEQ ID NO: 9. This plasmid was introduced into yeast cells to express the C130090K23 gene, and a protein having the amino acid sequence shown in SEQ ID NO: 10 was obtained. Furthermore, the HA tag amplified by PCR was introduced into the NheI site immediately before the stop codon of YEp352GAPII-C130090K23 to prepare the YEp352GAPII-C130090K23-HA plasmid. The C130090K23 protein produced in this way restored the Calcofluor White sensitivity of the cwh43-disrupted strain, confirming that it complements the function of CWH43 in the cwh43-disrupted strain (Figure 9).
In addition, Western analysis using HA antibody confirmed that FRAG1-HA protein and C130090K23-HA protein were expressed (FIG. 10A).

<Example 2>
[Analysis of the phenotype of cwh43 disrupted strains]
Using commercially available (acquired from EUROSCARF) budding yeast (Saccharomyces cerevisiae) CWH43 gene disruption strain (cwh43Δ), the sensitivity and temperature sensitivity of the drug Calcofluor White (CFW), which is an indicator of cell wall deficiency, were confirmed. The wild strain grew under all conditions, whereas the cwh43Δ strain was sensitive to CFW of 10 µg / mL or more, and was temperature sensitive at 39 ° C (Fig. 5). This suggests that cwh43Δ is abnormal in cell wall synthesis.
Subsequently, in order to investigate whether the CWH43 gene is involved in the synthesis of GPI-anchored protein, Western blotting of Gas1p, a typical GPI-anchored protein of yeast, was performed in wild, cwh43Δ, gup1Δ and per1Δ strains. . Here, GUP1 and PER1 genes have already been shown to be involved in lipid remodeling of GPI-anchored proteins (Bosson et al., 2006; Mol. Biol. Cell 17, 2636-2645 and Fujita et al. ., 2006; Mol. Biol. Cell 17, 5253-5264), used as a control. As reported, the expression of Gas1p was significantly decreased in the gup1Δ and per1Δ strains compared to the wild strain, but the cwh43Δ strain was almost the same as the wild strain (FIG. 1A). In addition, when the localization of the Gas1 protein mRFP-Gas1 fused with the fluorescent protein mRFP was observed with a fluorescence microscope, the cwh43Δ strain was also correctly localized on the cell surface as in the wild strain (Fig. 1B). . From these, it is considered that there is no defect in the localization and expression of Gas1p in the cwh43Δ strain.

<Example 3>
[Analysis of membrane localization of GPI-anchored protein Gas1]
It is known that GPI-anchored proteins are usually present in a part of a membrane rich in sphingolipids and sterols called microdomains or lipid rafts in cell membranes. The fraction corresponding to the microdomain can be biochemically isolated as a fraction (DRM) that is not solubilized with the detergent Triton X-100 (1%). Bagnat et al. Show that microdomains exist in yeast and that GPI-anchored proteins exist in microdomains (Bagnat et al., 2000; Proc. Natl. Acad. Sci. USA 97, 3254). -3259).
The method for isolating the DRM fraction was according to Bagnat et al., 2000; Proc. Natl. Acad. Sci. USA 97, 3254-3259. 30 OD ₆₀₀ (corresponding to about 3 x 10 ⁸ cells) wild strain, cwh43Δ strain, gup1Δ strain, and per1Δ strain were disrupted with glass beads, and Triton X-100 with a final concentration of 1% was added to the disruption solution. Thereafter, density gradient centrifugation using Optiprep as a density gradient agent was performed. Subsequently, SDS-PAGE and Western blotting were performed on each fraction collected in order from the upper layer, and Gas1p, Pma1p, and Pho8p were detected using the prepared anti-Gas1p antibody and commercially available anti-Pma1p and Pho8p antibodies, respectively. . As a result of detection of Gas1p, a GPI-anchored protein, the wild type is the most abundant in the DRM fraction (fraction 2), whereas the gup1Δ and per1Δ strains are almost absent in the DRM fraction. And was present in the solubilized fraction (fractions 4-6) (Bosson et al., 2006; Mol. Biol. Cell 17, 2636-2645 and Fujita et al., 2006; Mol. Biol. Cell 17, 5253 -5264) (Figure 2). In contrast, Gas1p of the cwh43Δ strain was most abundant in the DRM fraction (fraction 2), as in the wild strain. Therefore, these results suggest that the localization of cwh43Δ strain to the microdomain of GPI-anchored protein Gas1p is not abnormal.

<Example 4>
[Analysis of lipid part of GPI-anchored protein]
The lipid portion to which inositol was added was cut out from the GPI-anchored protein and the structure was analyzed. The method followed Guillas et al., 2000; Methods Enzymol. 312, 506-515. 20 OD ₆₀₀ (approximately 2 × 10 ⁸ cells) each of wild strain, cwh43Δ strain, gup1Δ strain, per1Δ strain, gup1Δper1Δ double disruption strain, and GPI7 gene disruption strain (gpi7Δ) involved in GPI anchor biosynthesis [ ^2-3 H] inositol 50 μCi was taken up for 2 hours and washed with chloroform / methanol to completely remove lipids in the cells. After solubilizing the protein, the glycoprotein was concentrated by ConA-sepharose (GE Healthcare). After washing, the protein portion was digested by treatment with pronase (Roche) at 37 ° C for 16 hours and then boiled. After drying, the lipid portion of GPI was excised from the protein by nitrite treatment at 37 ° C for 3 hours, butanol extraction was performed, and drying was performed again. The extracted PI is suspended in 15 μL of chloroform / methanol (1: 1), applied to a silica 60 plate (Merck), and subjected to thin layer chromatography in a solvent system of chloroform / methanol / 0.25% KCl (55:45:10). Separated by doing. Detection was performed with a luminescence image analyzer (Bio-Rad Molecular Imager FX).
As a result, in the wild strain, diacylglycerol type PI (pG1) and inositol phosphoceramide / B type (IPC / B), inositol phosphoceramide / C type (saturated fatty acid having 26 carbon atoms in the sn-2 position) ( IPC / C) was detected as reported (Bosson et al., 2006; Mol. Biol. Cell 17, 2636-2645) (Figure 3). Lyso-form PI (lyso-PI) was detected as reported in the gup1Δ strain (Bosson et al., 2006; Mol. Biol. Cell 17, 2636-2645). In the per1Δ strain, only diacylglycerol-type PI (PI) with short fatty acids was detected as reported (Fujita et al., 2006; Mol. Biol. Cell 17, 5253-5264). Furthermore, PI was detected in the gup1Δper1Δ double disruption strain as in the per1Δ strain, and IPC / C was detected as reported (Fujita et al., 2006; Mol. Biol. Cell 17, 5253-5264). In addition, it has been reported that the Gpi7Δ strain lacks GPI remodeling and lacks IPC / C in the Gpi7Δ strain (Benachour et al., 1999; J. Biol. Chem. 274, 15251-15261). However, the results were as reported. On the other hand, in the cwh43Δ strain, a diacylglycerol type PI (pG1) having a saturated fatty acid having 26 carbon atoms at the sn-2 position and a lyso-form PI (lyso-PI) were detected. This indicates that CWH43 is involved in the conversion of the lipid moiety to the ceramide form, which is a later step in lipid remodeling.
It is known that when dihydrosphingosine (DHS) is incorporated into cells, it is metabolized to ceramide derivatives and added to GPI-anchored proteins.
To further confirm whether CWH43 is involved in lipid remodeling, we investigated the incorporation of tritium-labeled DHS ([3H] DHS) into proteins. The methods are described in Guillas et al., 2000; Methods Enzymol. 312, 506-515, Umemura et al., 2003; J. Biol. Chem. 287, 23639-23647 and Benachour et al., 1999; J. Biol. Chem. 274, 15251-15261. [ ³ H] DHS was incorporated into the wild strain, cwh43Δ strain, and gpi7Δ strain for 2 hours. Myriocin, an agent that inhibits DHS synthesis in vivo, was added to the label solution together to increase the efficiency of [ ³ H] DHS uptake. The cells were crushed with glass beads, and 1% SDS was added and boiled to solubilize the protein. Subsequently, glycoproteins were concentrated with ConA-sepharose (GE Healthcare) and separated by SDS-PAGE. Detection was performed with a luminescence image analyzer (Bio-Rad Molecular Imager FX).
That since the glycoprotein labeled with reported as ³ H was detected is ceramide added GPI-anchored proteins it has been shown in the wild strain. The amount of gpi7Δ strain decreased as reported (Benachour et al., 1999; J. Biol. Chem. 274, 15251-15261) (FIG. 4). In contrast, cwh43Δ did not detect any or very little of the labeled glycoprotein. This indicates that cwh43Δ did not undergo lipid remodeling of GPI anchor to ceramide.

<Example 5>
[Analysis of the functional domain of CWH43]
Since CWH43 is involved in lipid remodeling to GPI-anchored ceramide, the CWH43 protein is homologous to FRAG1 in order to clarify the domain of the Cwh43 protein involved in this function and to analogize the function of the mouse C130090K23 gene. A plasmid was constructed that was divided into the N-terminal side (CWH43N, 1-299, 299 amino acids) having C and the C-terminal side (CWH43C, 218-953, 737 amino acids) homologous to C130090K23 (FIG. 5A).
The CWH43N gene was obtained by PCR using the pRS316-CWH43-HA plasmid as a template. The primers used for PCR are as follows.
Xho-CWH43-PN-F14 5'- gatttctcgaggaataagtaac -3 '(SEQ ID NO: 17)
CWH43-N-NheStpXho-R15 5'- ccgctcgaggtcgacttagctagcactagagtctctaatttggaaaa-3 '(SEQ ID NO: 18)
The DNA fragment obtained by the amplification was cleaved with the restriction enzyme XhoI, replaced with the XhoI site fragment of the CWH43-HA expression single copy vector pRS316-CWH43-HA, and the nucleotide sequence was determined. The base sequence of the open reading frame part is as shown in SEQ ID NO: 3. The protein was introduced into the cell to express the CWH43N gene, and a protein having the amino acid sequence shown in SEQ ID NO: 4 was obtained.
The CWH43C gene was obtained by PCR using the CWH43 gene as a template. The primers used for PCR are as follows.
Xho-CWH43-P-C1-F11 5'- tttctcgaggaataagtaaccaggaatacagaaggtatccaccgccagttatgggtaataccagttttttccaaatt -3 '(SEQ ID NO: 19)
NheStpXho-R12 5'-ccgctcgaggtcgacttagctag-3 '(SEQ ID NO: 20)
The DNA fragment obtained by the amplification was cleaved with the restriction enzyme XhoI, the fragment of the XhoI site of the CWH43-HA expression single copy vector pRS316-CWH43-HA was replaced, and the nucleotide sequence was determined. The base sequence of the open reading frame part is as shown in SEQ ID NO: 5. The protein was introduced into the cell to express the CWH43C gene, and a protein having the amino acid sequence shown in SEQ ID NO: 6 was obtained.
The effect of the Cwh43N and Cwh43C proteins produced in this way on Calcofluor White sensitivity was examined. Cwh43N protein did not restore Calcofluor White sensitivity of cwh43 disrupted strains, but Cwh43C protein recovered. This indicates that Cwh43C protein complements the function of Cwh43.
Next, in order to investigate the functions of the CWH43 gene and its region in more detail, respective high expression systems were constructed. First, a plasmid in which the full length of the CWH43 gene was inserted was constructed. Using the plasmid pRS316-CWH43-HA containing CWH43 of Saccharomyces cerevisiae as a template, a CWH43 full-length open reading frame and a fragment with an HA tag inserted at its carboxyl terminus were obtained by PCR. The primers used for PCR are as follows.
Kpn-CWH43-F18 5'- ggggtaccatgctgatcatcaatgggaag -3 '(SEQ ID NO: 21)
HANheStpXba-R17 5'-gctctagattagctagcgtaatccggtac-3 '(SEQ ID NO: 22)
The DNA fragment obtained by the amplification is cleaved with restriction enzymes KpnI and XbaI, and inserted into a multicopy expression vector YEp352GAP II for budding yeast (Abe et al., 2003; Glycobiology 13, 87-95) (YEp352GAPII-CWH43-HA ) And the base sequence was determined. The base sequence of the open reading frame part is as shown in SEQ ID NO: 1. The protein was introduced into the cell to highly express the CWH43 gene, and a protein having the amino acid sequence shown in SEQ ID NO: 2 was obtained.
The CWH43N gene was obtained by PCR using plasmid pRS316-CWH43-N-HA containing CWH43N of Saccharomyces cerevisiae as a template. The primers used for PCR are as follows.
Kpn-CWH43-F18 5'- ggggtaccatgctgatcatcaatgggaag -3 '(SEQ ID NO: 21)
HANheStpXba-R17 5'-gctctagattagctagcgtaatccggtac-3 '(SEQ ID NO: 22)
The DNA fragment containing the open reading frame obtained by amplification and the HA tag inserted at its carboxyl terminus was cleaved with restriction enzymes KpnI and XbaI, and a multicopy expression vector for budding yeast, YEp352GAP II (Abe et al., 2003; Glycobiology 13, 87-95) (YEp352GAP II-CWH43-N-HA), and the nucleotide sequence was determined. The base sequence of the open reading frame part is as shown in SEQ ID NO: 3. The protein was introduced into the cell and the CWH43N gene was highly expressed, and a protein having the amino acid sequence shown in SEQ ID NO: 4 was obtained.
The CWH43C gene was obtained by PCR using the plasmid pRS316-CWH43-C-HA containing CWH43C of Saccharomyces cerevisiae as a template. The primers used for PCR are as follows.
Kpn-CWH43-C1-F19 5'- ggggtaccatgggtaataccagttttttccaa -3 '(SEQ ID NO: 23)
HANheStpXba-R17 5'-gctctagattagctagcgtaatccggtac-3 '(SEQ ID NO: 22)
The DNA fragment containing the open reading frame obtained by amplification and the HA tag inserted at its carboxyl terminus was cleaved with restriction enzymes KpnI and XbaI, and a multicopy expression vector for budding yeast, YEp352GAP II (Abe et al., 2003; Glycobiology 13, 87-95) (YEp352GAPII-CWH43-C-HA), and the nucleotide sequence was determined. The base sequence of the open reading frame part is as shown in SEQ ID NO: 5. The protein was introduced into the cells and the CWH43C gene was highly expressed to obtain a protein having the amino acid sequence shown in SEQ ID NO: 6.
The expression of Cwh43-HA protein, Cwh43N-HA protein and Cwh43C-HA protein was confirmed by Western blotting analysis using HA antibody (Fig. 6A).
Each plasmid was introduced into the cwh43Δ strain, and the lipid part of the GPI anchor was analyzed. The method is as described above. As a result, pG1 type, IPC / B type, and IPC / C type were detected in the wild type as described above (FIG. 6B). In addition, it has been reported that the Gpi7Δ strain is defective in GPI remodeling and does not have IPC / C (Benachour et al., 1999; J. Biol. Chem. 274, 15251-15261). ), As reported. As described above, pG1 and lyso-PI were detected in the strain in which only the vector was introduced into the cwh43Δ strain, but IPC / B was mainly detected in the strain into which the CWH43 gene was introduced, as in the wild strain. In the cwh43Δ strain, pG1 and lyso-PI were detected in the same manner as the strain in which the CWH43N gene was introduced. However, IPC / B was detected in the strain into which the CWH43C gene was introduced. Therefore, it was suggested that CWH43 has the function of converting the lipid part of GPI to ceramide only in the C-terminal domain. Furthermore, in the strain co-expressed with the CWH43N gene and the CWH43C gene, more IPC / B was detected compared to the single expression of the CWH43C gene, and it was clear that CWH43N enhanced the conversion of CWH43C into ceramide. Became.
In order to further confirm that the GPI anchor portion was converted to ceramide in the strain into which the CWH43C gene was introduced, [ ³ H] DHS was incorporated into the cells, and the labeled glycoprotein was detected. The method is as described above. The strain into which the vector was introduced into cwh43Δ was unable to detect ³ H-labeled protein, indicating that the lipid part of the GPI anchor was not converted to ceramide (Figure 7). In addition, ³ H label was detected in the strain introduced with CWH43 gene, indicating that ceramide-added GPI anchor protein was synthesized. On the other hand, in the strain into which the CWH43N gene was introduced, the incorporation of the label into the protein was not observed as in the case of the vector introduction strain, but in the strain into which the CWH43C gene was introduced, the incorporation of the ³ H label into the protein was observed. From these results, it is considered that CWH43C has a function of converting the lipid part of the GPI anchor into ceramide. In addition, in the strain co-expressed with CWH43N and CWH43C genes, the amount of label incorporation into the protein was higher than in the case of CWH43C gene expression alone, so CWH43N enhanced conversion to ceramide. It became clear.

<Example 6>
[Functional analysis of C130090K23]
The human FRAG1 (PGAP2) gene has been reported to be involved in the processing of the lipid part of GPI (Tashima et al., 2006; Mol. Biol. Cell 17, 1410-1420). CWH43 is a gene similar to FRAG1, but it is 700 amino acids longer than FRAG1, and only the N-terminal part is similar to FRAG1. On the other hand, the C-terminal part of CWH43 resembles FLJ21511 (human) and C130090K23 (mouse), which have unknown functions, and the gene is widely conserved across species. Based on the fact that CWH43C has the activity to convert the lipid part of the GPI anchor to ceramide, the function of mouse C130090K23 was analyzed.
The plasmid YEp352GAPII-C130090K23-HA with the C130090K23 gene inserted into YEp352GAP II and the plasmid YEp352GAPII-FRAG1-HA with the mouse FRAG1 gene inserted into YEp352GAP II were introduced into the cwh43Δ strain, and the C130090K23 protein and FRAG1 protein were expressed. (Figure 10A). The lipid part of the GPI anchor of the FRAG1 transgenic strain and the C130090K23 transgenic strain was analyzed. The method is as described above. In the strain in which the FRAG1 gene was introduced into the cwh43Δ strain, pG1 and lyso-PI were detected as in the strain in which only the vector was introduced, but IPC was detected in the strain into which the C130090K23 gene was introduced. Furthermore, in the strain that co-expressed the FRAG1 gene and the C130090K23 gene, IPC / C was detected in addition to IPC / B, and the amount thereof also increased (FIG. 10B). Therefore, the FRAG1 gene and the C130090K23 gene have functions similar to those of the yeast CWH43N and CWH43C genes, respectively.C130090K23 is involved in the reaction to convert the lipid part of GPI to ceramide, and FRAG1 is caused by C130090K23. It has been shown to enhance the conversion to ceramide.

<Example 7>
[Coprecipitation experiment of N-terminal domain of CWH43 and C-terminal domain of CWH43]
A DNA fragment in which a FLAG tag was inserted into the C-terminal side of the CWH43N gene was constructed, and a pRS315-CWH43-N-FLAG plasmid was prepared. For expression of CWH43C-HA, the pRS316-CWH43-C-HA plasmid in which an HA tag was inserted into the C-terminal side of the CWH43C gene was used. An immunoprecipitation experiment was performed using a budding yeast strain into which the CWH43N-FLAG expression plasmid and the CWH43C-HA expression plasmid were introduced. The method was based on Rayner and Munro, 1998; J. Biol. Chem. 273, 26836-26843.
Yeast cells cultured until the logarithmic growth phase were incubated with zymolyase in Tris-Sorb buffer (1 M sorbitol, 50 mM Tris-HCl, pH 7.4) to be spheroplasted. Thereafter, spheroplasts were suspended and crushed in TNPI buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, protease inhibitors). Further, digitonin at a final concentration of 1% was added to solubilize. The insoluble fraction was removed by centrifugation to obtain a sample for immunoprecipitation. Anti-FLAG M2 affinity agarose (Sigma) or anti-HA agarose beads (Roche Diagnostics) was added, and the mixture was incubated overnight and immunoprecipitated. After washing the beads with TNPI buffer, the protein was eluted by using 3xFLAG peptide or HA peptide. The detection was confirmed by Western blotting after SDS-PAGE.
Cwh43C-HA protein co-precipitated with Cwh43N-FLAG protein, and Cwh43N-FLAG protein co-precipitated with Cwh43C-HA protein (Figure 8). From this, it was shown that Cwh43N-FLAG protein and Cwh43C-HA protein formed a complex.

<Example 8>
[Coprecipitation experiment of mouse FRAG1 protein and C130090K23 protein]
A DNA fragment with the HA tag inserted immediately before the stop codon of the mouse FRAG1 gene was constructed, and the YEp351GAPII-FRAG1-HA plasmid was prepared. Furthermore, a DNA fragment in which a FLAG tag was inserted immediately before the termination codon of the mouse C130090K23 gene was constructed to prepare a YEp352GAPII-C130090K23-FLAG plasmid. An immunoprecipitation experiment was performed using a yeast strain into which both the FRAG1-HA expression plasmid and the C130090K23-FLAG expression plasmid were introduced. The method is as described above. The immunoprecipitated samples were confirmed by Western blotting using FLAG antibody and HA antibody after SDS-PAGE.
FRAG1-HA protein co-precipitated with C130090K23-FLAG protein, and C130090K23-FLAG protein co-precipitated with FRAG1-HA protein (FIG. 11). From this, it was shown that FRAG1-HA protein and C130090K23-FLAG protein formed a complex.

The figure shows that the expression of GPI anchor protein Gas1 in the cwh43-disrupted strain was detected by Western blotting (A) and the figure showing the localization of Cwh43 protein under a microscope (B). It is a figure of the western blotting which shows that Gas1p can exist in a surfactant insoluble fraction (DRM) in a cwh43 destruction strain. It is a figure of the thin layer chromatography which shows the analysis result of the lipid part of the GPI anchor in a cwh43 destruction strain. cwh43 is a diagram obtained by detecting the incorporation of label into the protein when added to ^[3 H] DHS to disrupted strain. A schematic diagram (A) showing the construction of CWH43N and CWH43C and a diagram (B) showing the phenotype of the transgenic strain. The figure shows that protein expression in the CWH43N and CWH43C gene-introduced strains was confirmed by Western blotting (A), and the figure shows the thin-layer chromatography that analyzed the lipid part of the GPI anchor (B). The CWH43N and CWH43C introduced strain diagrams detects incorporation of label into the protein when added to ^[3 H] DHS. It is a figure which shows the result of immunoprecipitation and Western blotting which shows that the N terminal side and C terminal side of Cwh43 protein have couple | bonded. A schematic diagram (A) showing the construction of the CWH43 mouse homologous genes FRAG1 and C130090K23 genes, and a diagram (B) of analyzing the phenotype in a strain in which these genes were introduced into a cwh43-disrupted strain. In the strain into which mouse FRAG1 and C130090K23 genes were introduced, protein expression was detected by Western blotting (A), and thin layer chromatography analysis of the lipid part of the GPI anchor (B). It is a figure which shows the result of an immunoprecipitation and Western blotting which shows that FRAG1 protein and C130090K23 protein have couple | bonded. Reference: Lipid remodeling of GPI-anchored proteins in yeast cells

Claims (24)

A DNA encoding a protein complex having a ceramide-added GPI-anchored protein synthase activity, comprising an α subunit and a β subunit,
The DNA encoding the α subunit includes a DNA encoding a protein having the α subunit activity of the ceramide-added GPI-anchored protein synthase of any of the following (A) to (E):
The DNA encoding the β subunit includes DNA encoding a protein having the β subunit activity of the ceramide-added GPI-anchored protein synthase of any of the following (H) to (L): DNA, characterized by;
(A) DNA encoding the amino acid sequence shown in SEQ ID NO: 10 or SEQ ID NO: 27,
(B) a DNA encoding an amino acid sequence in which one to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 10 or SEQ ID NO: 27;
(C) DNA consisting of the base sequence shown in SEQ ID NO: 9 or SEQ ID NO: 26,
(D) a DNA comprising a base sequence in which one to several bases are deleted, substituted or added in the base sequence shown in SEQ ID NO: 9 or SEQ ID NO: 26;
(E) DNA that hybridizes under stringent conditions with DNA consisting of the complementary sequence of SEQ ID NO: 9 or SEQ ID NO: 26;
(H) DNA encoding the amino acid sequence represented by SEQ ID NO: 8 or SEQ ID NO: 25,
(I) a DNA encoding an amino acid sequence in which 1 to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 8 or 25;
(J) DNA consisting of the base sequence represented by SEQ ID NO: 7 or 24,
(K) DNA consisting of a base sequence in which one to several bases are deleted, substituted or added in the base sequence shown in SEQ ID NO: 7 or 24;
(L) A DNA that hybridizes under stringent conditions with a DNA consisting of a complementary sequence of SEQ ID NO: 7 or SEQ ID NO: 24. α consists subunit and β-subunit, a ceramide added GPI-anchored proteins Manufacturing nucleic acid reagent comprising a DNA encoding a protein complex having a ceramide additional GPI-anchored protein synthase activity,
The DNA encoding the α subunit includes a DNA encoding a protein having the α subunit activity of the ceramide-added GPI-anchored protein synthase of any of the following (A) to (E):
The DNA encoding the β subunit includes DNA encoding a protein having the β subunit activity of the ceramide-added GPI-anchored protein synthase of any of the following (H) to (L): wherein, the nucleic acid reagents for ceramide added GPI-anchored proteins Manufacturing;
(A) DNA encoding the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27,
(B) a DNA encoding an amino acid sequence in which 1 to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27;
(C) DNA consisting of the base sequence shown in SEQ ID NO: 5, SEQ ID NO: 9 or SEQ ID NO: 26,
(D) DNA consisting of a base sequence in which one to several bases are deleted, substituted or added in the base sequence shown in SEQ ID NO: 5, SEQ ID NO: 9 or SEQ ID NO: 26;
(E) DNA that hybridizes under stringent conditions with DNA consisting of the complementary sequence of SEQ ID NO: 5, SEQ ID NO: 9 or SEQ ID NO: 26,
(H) DNA encoding the amino acid sequence shown in SEQ ID NO: 4, SEQ ID NO: 8 or SEQ ID NO: 25,
(I) DNA encoding an amino acid sequence in which one to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 4, SEQ ID NO: 8 or SEQ ID NO: 25,
(J) DNA consisting of the base sequence shown in SEQ ID NO: 3, SEQ ID NO: 7 or SEQ ID NO: 24,
(K) a DNA comprising a base sequence in which one to several bases are deleted, substituted or added in the base sequence shown in SEQ ID NO: 3, SEQ ID NO: 7 or SEQ ID NO: 24;
(L) DNA that hybridizes under stringent conditions with DNA comprising the complementary sequence of SEQ ID NO: 3, SEQ ID NO: 7 or SEQ ID NO: 24. A DNA encoding a protein that functions as an α subunit of the protein complex according to claim 2, and a DNA encoding a protein having a ceramide-added GPI-anchored protein synthase activity alone. to, a granulation nucleic acid reagent manufactured ceramide added GPI-anchored proteins, including any of the DNA of the following (a) ~ (E), reagent;
(A) DNA encoding the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27,
(B) a DNA encoding an amino acid sequence in which 1 to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27;
(C) DNA consisting of the base sequence shown in SEQ ID NO: 5, SEQ ID NO: 9 or SEQ ID NO: 26,
(D) DNA consisting of a base sequence in which one to several bases are deleted, substituted or added in the base sequence shown in SEQ ID NO: 5, SEQ ID NO: 9 or SEQ ID NO: 26;
(E) DNA that hybridizes under stringent conditions with DNA consisting of the complementary sequence of SEQ ID NO: 5, SEQ ID NO: 9 or SEQ ID NO: 26. A ceramide-added GPI-anchored protein synthesis comprising the DNA of any of the following (A) to (E) encoding a protein that functions as a β subunit of the protein complex according to claim 2 Nucleic acid reagent for enhancing ceramide addition function to enzyme;
(A) DNA encoding the amino acid sequence shown in SEQ ID NO: 4, SEQ ID NO: 8 or SEQ ID NO: 25,
(B) DNA encoding an amino acid sequence in which one to several amino acids have been deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 4, SEQ ID NO: 8 or SEQ ID NO: 25,
(C) DNA consisting of the base sequence shown in SEQ ID NO: 3, SEQ ID NO: 7 or SEQ ID NO: 24,
(D) a DNA comprising a base sequence in which one to several bases have been deleted, substituted or added in the base sequence shown in SEQ ID NO: 3, SEQ ID NO: 7 or SEQ ID NO: 24;
(E) DNA that hybridizes under stringent conditions with DNA consisting of a complementary sequence of SEQ ID NO: 3, SEQ ID NO: 7 or SEQ ID NO: 24 ,
Here, the ceramide-added GPI-anchored protein synthase includes the following amino acid sequence (F) or (G) and is composed of a protein having a ceramide-added GPI-anchored protein synthase activity for enhancing the function of adding a ceramide Nucleic acid reagents;
(F) the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27,
(G) An amino acid sequence in which one to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27 .   A recombinant vector containing the DNA according to claim 1.   A transformant transformed with the recombinant vector according to claim 5.   The transformant according to claim 6, wherein the transformant is a transformed yeast obtained by transforming yeast as a host.   A method for producing a protein complex having a ceramide-added GPI-anchored protein synthase activity, comprising culturing the transformant according to claim 6 or 7 to obtain an expression product of the DNA. A protein complex having a ceramide-added GPI-anchored protein synthase activity composed of an α subunit and a β subunit, and the α subunit includes the following amino acid sequence (A) or (B) A protein complex, wherein the β subunit comprises the following amino acid sequence (E) or (F):
(A) the amino acid sequence shown in SEQ ID NO: 10 or SEQ ID NO: 27,
(B) an amino acid sequence in which one to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 10 or SEQ ID NO: 27;
(E) Amino acid sequence shown in SEQ ID NO: 8 or SEQ ID NO: 25 (F) Amino acid sequence in which 1 to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 8 or SEQ ID NO: 25. An enzyme reagent comprising a protein complex having a ceramide-added GPI-anchored protein synthase activity comprising an α subunit and a β subunit, wherein the α subunit has the following amino acid sequence (A) or (B): A ceramide-added GPI-anchored enzyme reagent for protein synthesis comprising a protein complex, wherein the β subunit contains the following amino acid sequence (E) or (F);
(A) the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27,
(B) an amino acid sequence in which one to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27;
(E) the amino acid sequence shown in SEQ ID NO: 4, SEQ ID NO: 8 or SEQ ID NO: 25 (F) In the amino acid sequence shown in SEQ ID NO: 4, SEQ ID NO: 8 or SEQ ID NO: 25, 1 to several amino acids are deleted, A substituted or added amino acid sequence. A protein comprising the amino acid sequence of the following (A) or (B), which functions as the α subunit of the protein complex according to claim 10 , and having a ceramide-added GPI-anchored protein synthase activity alone A ceramide-added GPI-anchored enzyme reagent for protein synthesis comprising:
(A) the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27,
(B) An amino acid sequence in which 1 to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27. A protein comprising the amino acid sequence of the following (A) or (B) that functions as a β subunit of the protein complex according to claim 10 and having an activity of enhancing ceramide-added GPI-anchored protein synthase activity A ceramide-added function-enhancing reagent for a ceramide-added GPI-anchored protein synthase, comprising:
(A) SEQ ID NO: 4, the amino acid sequence shown in SEQ ID NO: 8 or SEQ ID NO: 25,
(B) an amino acid sequence in which 1 to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 4, SEQ ID NO: 8 or SEQ ID NO: 25 ,
Here, the ceramide-added GPI-anchored protein synthase includes the following amino acid sequence (C) or (D) and is composed of a protein having a ceramide-added GPI-anchored protein synthase activity for enhancing the function of adding a ceramide Nucleic acid reagents;
(C) the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27,
(D) An amino acid sequence in which one to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 6, SEQ ID NO: 10 or SEQ ID NO: 27 .   A method for producing a ceramide-added GPI-anchored protein, comprising culturing the transformant according to claim 6 or 7 and adding ceramide to a GPI-anchored protein produced by the transformant.   A method for producing a GPI-anchored protein having a ceramide added thereto, wherein the ceramide-added GPI-anchored enzyme synthesis enzyme reagent according to claim 10 or 11 is allowed to act on a GPI-anchored protein. Addition of ceramide, characterized in that a GPI-anchored protein comprising the amino acid sequence of any of the following (A) to (C) and having a ceramide-added GPI-anchored protein synthase activity acts A method for producing a GPI-anchored protein,
(A) a protein comprising the amino acid sequence represented by SEQ ID NO: 2,
(B) an amino acid sequence which is a part of the amino acid sequence shown in SEQ ID NO: 2 and comprises at least the amino acid sequence at positions 218 to 953;
(C) An amino acid sequence in which one to several amino acids are deleted, substituted or added in the amino acid sequence of (A) or (B). A protein having a ceramide-added GPI-anchored protein synthase activity, which is obtained as an expression product of any of the following DNAs (A) to (E), is allowed to act on the GPI-anchored protein: A method for producing a GPI-anchored protein to which ceramide is added,
(A) DNA encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 2,
(B) DNA encoding an amino acid sequence which is a part of the amino acid sequence shown in SEQ ID NO: 2 and comprises at least the amino acid sequence at positions 218 to 953;
(C) DNA consisting of the base sequence represented by SEQ ID NO: 1,
(D) DNA that is a part of the base sequence shown in SEQ ID NO: 1 and comprises at least the 652-2859 base sequence,
(E) A DNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence of the base sequence (C) or (D). A host cell producing a GPI-anchored protein is transformed with a DNA encoding a protein having a ceramide-added GPI-anchored protein synthase activity of any of the following (A) to (E), and the transformation A method for producing a GPI-anchored protein to which ceramide is added, characterized by culturing cells,
(A) DNA encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 2,
(B) DNA encoding an amino acid sequence which is a part of the amino acid sequence shown in SEQ ID NO: 2 and comprises at least the amino acid sequence at positions 218 to 953;
(C) DNA consisting of the base sequence represented by SEQ ID NO: 1,
(D) DNA that is a part of the base sequence shown in SEQ ID NO: 1 and comprises at least the 652-2859 base sequence,
(E) A DNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence of the base sequence (C) or (D).   The method for producing a GPI-anchored protein to which ceramide is added according to claim 16, wherein the transformant is a transformed yeast obtained by transforming a yeast host.   The enzyme reagent for ceramide addition GPI anchor type protein synthesis which has the alpha subunit activity of the ceramide addition GPI anchor type protein synthase of Claim 11, and consists of a protein which has ceramide addition GPI anchor type protein synthase activity independently And a ceramide-added GPI-anchored protein synthase β-subunit activity and a ceramide-added GPI-anchored protein synthase-enhancing reagent for ceramide-added GPI-anchored protein synthase, A method for producing a GPI-anchored protein to which ceramide is added, wherein the method comprises simultaneously acting on a production cell.   When producing the ceramide-added GPI-anchored protein, a GPI-anchored protein-producing yeast cell is used to produce the ceramide-added GPI-anchored protein on the surface of the yeast cell or in the culture medium. The method for producing a ceramide-added GPI-anchored protein according to any one of claims 13 to 19.   A ceramide-added GPI-anchored protein composition is obtained using the production method according to any one of claims 13 to 20, and then the protein and the sugar chain part are enzymatically or chemically treated from the ceramide-added GPI-anchored protein. A method for producing a C-type ceramide-containing ceramide composition by cutting and removing by the above.   The C-ceramide-containing ceramide composition according to claim 21, wherein phospholipase C or phospholipase D is used when cleaving and removing the protein and sugar chain portion from the GPI-anchored protein to which ceramide is added. Manufacturing method. In the genomic DNA of Saccharomyces cerevisiae, a mutation is introduced into the ceramide-added GPI-anchored protein synthase gene corresponding to any of the following (A) to (E), or the expression of the gene is suppressed A method for producing a GPI-anchored protein to which diacylglycerol having a saturated fatty acid is added with high purity using a budding yeast, characterized by inhibiting or suppressing the synthesis of a ceramide-added GPI-anchored protein;
(A) DNA encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 2,
(B) DNA encoding an amino acid sequence which is a part of the amino acid sequence shown in SEQ ID NO: 2 and comprises at least the amino acid sequence at positions 218 to 953;
(C) DNA consisting of the base sequence represented by SEQ ID NO: 1,
(D) DNA that is a part of the base sequence shown in SEQ ID NO: 1 and comprises at least the 652-2859 base sequence,
(E) A DNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence of the base sequence (C) or (D).   24. The method for producing a GPI-anchored protein to which diacylglycerol having a saturated fatty acid is added with high purity according to claim 23, wherein a budding yeast cwh43 gene disruption strain is used as the budding yeast.