JP5190819B2 - Method for producing high sucrose resistant yeast and yeast produced by this method - Google Patents

Description

  The present invention relates to the field of yeast breeding. Furthermore, the present invention relates to methods for producing bread dough, bread, confectionery, etc., using the yeast bred using the method of the present invention, and products produced by these production methods.

  Bread needs to undergo dough expansion by fermentation of baker's yeast in the production process of the product, but in order to provide a constant quality bread, it is important to closely control the fermentation of baker's yeast. In particular, depending on the type of bread dough and the bread making method, baker's yeast is subjected to environmental stress that inhibits fermentation. Therefore, establishment of a technique for producing a yeast strain having high resistance to environmental stress is desired. The high sucrose dough used for making confectionery contains a high concentration of sucrose exceeding 30% (per weight of wheat flour), and yeast fermentation is inhibited by the high osmotic pressure derived from sucrose. Therefore, development of yeast resistant to high sucrose stress is expected for the control and efficiency of baker's yeast fermentation under high sugar dough conditions, and the present invention meets the social needs.

(Conventional technology)
The baking industry and yeast manufacturing industry have been working on environmental stresses that impair fermentation by being loaded on baker's yeast during baking. In particular, efforts have been made to deal with the freezing stress that is applied in the frozen dough baking method and the high sucrose stress that is applied in the manufacture of confectionery bread. Many of them try to solve the problem by producing baker's yeast having resistance to these environmental stresses. Each yeast manufacturer has also developed and sold a high sucrose resistant yeast that is optimal for high sugar dough bread.

(Problems in the prior art)
As described above, in parallel with the practical application of high-sucrose-tolerant yeast with improved performance, research on how to enhance the high-sucrose tolerance of yeast has been actively conducted in recent years. . One of the hypotheses is known that the high trehalose content in yeast cells enhances the high sucrose tolerance of yeast. In fact, it has been reported that yeasts that have disrupted trehalose-degrading enzymes in yeast and have accumulated significant amounts of trehalose in cells have increased high sucrose resistance and freezing resistance (Patent Document 1). . In addition, it has been reported that yeast that accumulates a large amount of highly polar amino acids in cells has increased stress tolerance (Patent Document 2). However, yeasts such as baker's yeast having sufficiently high sucrose resistance have not been obtained yet. There is a demand for a yeast that can sufficiently maintain a fermentative power even in a high sucrose environment, which is an environmental stress of yeast fermentation in confectionery bread production, that is, a yeast having a sufficiently high sucrose resistance. Development of such a yeast breeding method is also desired.

Prior art document information relating to the invention of this application includes the following.
JP 11-169180 A JP 2001-238665A

  In view of the above, the present invention provides a yeast that can maintain sufficient fermentability even in a high sucrose environment, that is, a yeast having a sufficiently high sucrose resistance, and a method for breeding such a yeast. The issue is to provide. Furthermore, this invention makes it a subject to provide the manufacturing method of bread dough, bread, and confectionery using such yeast.

  The above problems have been solved by finding that a high sucrose resistant strain can be obtained by disrupting the OCAl gene or OCA2 gene, which is a phosphatase that catalyzes the dephosphorylation of phosphorylated protein.

Accordingly, the present invention provides the following inventions.
(Item 1) A method for producing a high sucrose resistant yeast, comprising:
(A) introducing a mutation into a genomic gene that hybridizes under stringent conditions to a nucleic acid having the sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 9,
Including the method.
(Item 2) The method according to item 1, wherein the mutation introduction is gene disruption.
(Item 3) The method according to Item 1, further comprising:
(B) comparing the mutant yeast with yeast having no mutation in SEQ ID NO: 1, SEQ ID NO: 3 and SEQ ID NO: 9 for sucrose resistance;
Including the method.
(Item 4) The method according to Item 1, further comprising:
(C) selecting a mutant yeast having improved sucrose resistance;
Including the method.
(Item 5) The method according to item 1, wherein the yeast is baker's yeast.
(Item 6) Yeast produced by the method according to item 1.
(Item 7) A method for producing a high sucrose bread dough, wherein the yeast produced by the method according to item 1 is used.
(Item 8) A method for producing bread using the yeast produced by the method according to item 1.
(Item 9) A method for producing confectionery using the yeast produced by the method according to item 1.
(Item 10) A method for selecting a high sucrose resistant yeast, comprising:
(A) selecting a yeast having a mutation in a genomic gene that hybridizes under stringent conditions to a nucleic acid having the sequence of SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 9,
Including the method.
(Item 11) The method according to Item 10, further comprising:
(B) comparing the mutant yeast with yeast having no mutation in SEQ ID NO: 1, SEQ ID NO: 3 and SEQ ID NO: 9 for sucrose resistance;
Including the method.
(Item 12) The method according to Item 10, further comprising:
(C) selecting a mutant yeast having improved sucrose resistance;
Including the method.
(Item 13) A diploid high sucrose-resistant yeast having a homozygous mutation in a genomic gene that hybridizes under stringent conditions to a nucleic acid having the sequence of SEQ ID NO: 1.
(Item 14) A diploid high sucrose-resistant yeast having a homozygous mutation in a genomic gene that hybridizes to a nucleic acid having the sequence of SEQ ID NO: 3 under stringent conditions.
(Item 15) A diploid high sucrose resistant yeast having a homozygous mutation in a genomic gene that hybridizes under stringent conditions to a nucleic acid having the sequence of SEQ ID NO: 9.
(Item 16) A method for producing a high sucrose bread dough using the diploid high sucrose resistant yeast according to item 13, item 14 or item 15.
(Item 17) A method for producing bread using the diploid high sucrose resistant yeast according to item 13, item 14 or item 15.
(Item 18) A method for producing a confectionery using the diploid high sucrose resistant yeast according to item 13, item 14 or item 15.
(Item 19) A composition for performing fermentation for bread production under high sucrose conditions, wherein a mutation occurs in a genomic gene that hybridizes under stringent conditions to a nucleic acid having the sequence of SEQ ID NO: 1. A composition comprising yeast having.
(Item 20) The composition according to item 19, wherein the yeast is a diploid yeast having a homozygous mutation in a genomic gene that hybridizes under stringent conditions to a nucleic acid having the sequence of SEQ ID NO: 1.
(Item 21) The first allele that hybridizes under stringent conditions to the nucleic acid having the sequence of SEQ ID NO: 1 in the yeast, and the second mutation in the second allele Item 20. The composition according to Item 19, which is a diploid yeast having
(Item 22) A method for producing a high sucrose bread dough, wherein the composition according to any one of items 19 to 21 is used.
(Item 23) A method for producing bread, using the composition according to any one of items 19 to 21.
(Item 24) The manufacturing method of confectionery using the composition as described in any one of Items 19-21.
(Item 25) A composition for performing fermentation for bread production under high sucrose conditions, wherein a mutation occurs in a genomic gene that hybridizes under stringent conditions to a nucleic acid having the sequence of SEQ ID NO: 3. A composition comprising yeast having.
(Item 26) The composition according to item 25, wherein the yeast is a diploid yeast having a homozygous mutation in a genomic gene that hybridizes under stringent conditions to a nucleic acid having the sequence of SEQ ID NO: 3.
(Item 27) The first allele that hybridizes under stringent conditions to the nucleic acid having the sequence of SEQ ID NO: 3 in the yeast, and the second mutation in the second allele 26. The composition according to item 25, which is a diploid yeast having
(Item 28) A method for producing a high sucrose bread dough, wherein the composition according to any one of items 25 to 27 is used.
(Item 29) A method for producing bread using the composition according to any one of items 25 to 27.
(Item 30) The manufacturing method of confectionery using the composition as described in any one of Items 25-27.
(Item 31) A composition for performing fermentation for bread production under high sucrose conditions, wherein a mutation occurs in a genomic gene that hybridizes under stringent conditions to a nucleic acid having the sequence of SEQ ID NO: 9. A composition comprising yeast having.
(Item 32) The composition according to item 31, wherein the yeast is a diploid yeast having a homozygous mutation in a genomic gene that hybridizes under stringent conditions to a nucleic acid having the sequence of SEQ ID NO: 9.
(Item 33) The first allele that hybridizes under stringent conditions to the nucleic acid having the sequence of SEQ ID NO: 9 in the yeast, and the second mutation in the second allele 32. The composition of item 31, which is a diploid yeast having
(Item 34) A method for producing a high sucrose bread dough, wherein the composition according to any one of items 31 to 33 is used.
(Item 35) The manufacturing method of bread using the composition as described in any one of items 31-33.
(Item 36) The manufacturing method of confectionery using the composition as described in any one of items 31-33.

  Preferred embodiments of the present invention will be shown below, but those skilled in the art can appropriately implement the embodiments and the like from the description of the present invention and well-known and common techniques in the field, and the effects and effects of the present invention can be easily achieved. It should be recognized to understand.

  According to the present invention, a yeast strain having high sucrose resistance can be easily obtained. Furthermore, according to the present invention, a predetermined yeast strain can be easily made into a high sucrose resistant strain.

  The present invention will be described below. Throughout this specification, it should be understood that the singular forms also include the plural concept unless specifically stated otherwise. In addition, it is to be understood that the terms used in the present specification are used in the meaning normally used in the above field unless otherwise specified. Thus, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present specification, including definitions, will control.

(Definition of terms)
Listed below are definitions of terms particularly used in the present specification.

  As used herein, “yeast” refers to a fungus that passes most life cycles in a single cell. Representative yeasts include yeasts belonging to the genus Saccharomyces and Schizosaccharomyces, in particular Saccharomyces cerevisiae, Saccharomyces ludwigii, and Schizosaccharomyces pombe.

  As used herein, “bakery yeast” refers to a yeast belonging to Saccharomyces cerevisiae used for bread production and used for bread production.

  As used herein, the term “sucrose concentration (%)” refers to the relative concentration of sucrose with respect to the flour in the material to be fermented, unless specifically stated, more specifically 100 g flour. Refers to the number of grams of sucrose added to

  As used herein, the term “high sucrose resistance” refers to a characteristic of a yeast that exhibits a higher fermentative power than an wild-type yeast in an environment with a high sucrose concentration. Typically, as to whether or not the mutant yeast has “high sucrose resistance”, the fermentability under a 50% sucrose concentration is determined using the amount of carbon dioxide generation as an index.

In the present specification, “fermentation power” refers to the ability to produce a metabolite obtained by anaerobically degrading carbohydrates when yeast is cultured. Typically, yeast fermentation includes, but is not limited to, alcohol fermentation, glycerol fermentation, and the like. As an index indicating the fermenting power, for example, a method called “farmograph” that measures the fermenting power of bread dough by measuring carbon dioxide generated from the bread dough can be used. As the unit, for example, ml / 100 OD ₆₀₀ as the amount of gas generated by yeast having an OD ₆₀₀ of 100 can be used, but is not limited thereto. Examples of indexes other than the above include, but are not limited to, fermenting power under low sugar conditions (F10), fermenting power under high sugar conditions (F40), and maltose fermenting power (Fm). Are measured by yeast fed-batch culture).

  As used herein, the term “dough” includes “seed dough” added to bread dough as well as materials that are subjected to bread fermentation. As used herein, the term “seed dough” refers to a seed (starter) that is added to perform fermentation of bread dough, and includes a dough that contains at least a part of the fungi necessary for fermentation and compounded raw materials. Say.

  As used herein, the term “fermentation” refers to a phenomenon in which at least some of the substances in a compounded raw material are degraded by bacteria.

  As used herein, the term “high sucrose bread dough” refers to high concentrations of sucrose (including but not limited to, for example, 25%, 30%, 35%, 40%, 45%, 50 %, 55%, and 60%).

  As used herein, the term “confectionery” refers to a food product mainly made from wheat flour, containing sucrose, and manufactured through a fermentation process.

  As used herein, the term “allele” refers to one of a series of two or more different genes that occupy the same locus on a particular chromosome. The case where the same allele occupies both loci is called “homozygous”, and the case where different alleles occupy both loci is called “heterozygous”.

  In the present specification, “polynucleotide hybridizing under stringent conditions” refers to well-known conditions commonly used in the art. Such a polynucleotide can be obtained by using colony hybridization method, plaque hybridization method, Southern blot hybridization method or the like using a polynucleotide selected from among the polynucleotides of the present invention as a probe. Specifically, hybridization was performed at 65 ° C. in the presence of 0.7 to 1.0 M NaCl using a filter on which DNA derived from colonies or plaques was immobilized, and then 0.1 to 2 times the concentration. Means a polynucleotide that can be identified by washing the filter under conditions of 65 ° C. using a SSC (saline-sodium citrate) solution (composition of 1-fold concentration of SSC solution is 150 mM sodium chloride, 15 mM sodium citrate) To do. Hybridization was performed in Molecular Cloning 2nd ed. , Current Protocols in Molecular Biology, Supplements 1-38, DNA Cloning 1: Core Techniques, A Practical Approach, Second Edition, Oxford Universe. Here, the sequence containing only the A sequence or only the T sequence is preferably excluded from the sequences that hybridize under stringent conditions. The “hybridizable polynucleotide” refers to a polynucleotide that can hybridize to another polynucleotide under the above hybridization conditions. Specifically, the hybridizable polynucleotide is a polynucleotide having at least 60% homology with the base sequence of DNA encoding a polypeptide having the amino acid sequence specifically shown in the present invention, preferably 80% The polynucleotide which has the above homology, More preferably, the polynucleotide which has 95% or more of homology can be mentioned.

As used herein, “highly stringent conditions” are designed to allow hybridization of DNA strands having a high degree of complementarity in nucleic acid sequences and to exclude hybridization of DNA having significant mismatches. Say conditions. Hybridization stringency is primarily determined by temperature, ionic strength, and the conditions of denaturing agents such as formamide. Examples of “highly stringent conditions” for such hybridization and washing are 0.0015 M sodium chloride, 0.0015 M sodium citrate, 65-68 ° C., or 0.015 M sodium chloride, 0.0015 M citric acid. Sodium, and 50% formamide, 42 ° C. For such highly stringent conditions, see Sambrook et al. , Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory (Cold Spring Harbor, N, Y. 1989); and Anderson et al. Nucleic Acid Hybridization: a Practical Approach, IV, IRL Press Limited (Oxford, England). See Limited, Oxford, England. If necessary, more stringent conditions (eg, higher temperature, lower ionic strength, higher formamide, or other denaturing agents) may be used. Other agents can be included in the hybridization and wash buffers for the purpose of reducing non-specific hybridization and / or background hybridization. Examples of such other agents include 0.1% bovine serum albumin, 0.1% polyvinyl pyrrolidone, 0.1% sodium pyrophosphate, 0.1% sodium dodecyl sulfate (NaDodSO ₄ or SDS), Ficoll, Denhardt's solution, sonicated salmon sperm DNA (or another non-complementary DNA) and dextran sulfate, but other suitable agents can also be used. The concentration and type of these additives can be varied without substantially affecting the stringency of the hybridization conditions. Hybridization experiments are usually performed at pH 6.8-7.4; however, at typical ionic strength conditions, the rate of hybridization is almost pH independent. Anderson et al. , Nucleic Acid Hybridization: a Practical Approach, Chapter 4, IRL Press Limited (Oxford, England).

Factors that affect the stability of the DNA duplex include base composition, length, and degree of base pair mismatch. Hybridization conditions can be adjusted by one of ordinary skill in the art to apply these variables and to allow different sequence related DNAs to form hybrids. The melting temperature of a perfectly matched DNA duplex can be estimated by the following equation:
T _m (° C.) = 81.5 + 16.6 (log [Na ⁺ ]) + 0.41 (% G + C) −600 / N−0.72 (% formamide)
Where N is the length of the duplex formed, [Na ⁺ ] is the molar concentration of sodium ions in the hybridization or wash solution, and% G + C is the (guanine + Cytosine) base percentage. For imperfectly matched hybrids, the melting temperature decreases by about 1 ° C. for each 1% mismatch.

  As used herein, “moderately stringent conditions” refers to conditions under which a DNA duplex having a higher degree of base pair mismatch than can be generated under “highly stringent conditions”. . Examples of representative “moderately stringent conditions” are 0.015 M sodium chloride, 0.0015 M sodium citrate, 50-65 ° C., or 0.015 M sodium chloride, 0.0015 M sodium citrate, and 20 % Formamide, 37-50 ° C. As an example, a “moderately stringent” condition of 50 ° C. in 0.015 M sodium ion tolerates a mismatch of about 21%.

  It will be appreciated by those skilled in the art that there may not be a complete distinction between “highly” stringent conditions and “moderate” stringent conditions herein. For example, at 0.015M sodium ion (no formamide), the melting temperature of a perfectly matched long DNA is about 71 ° C. In washing at 65 ° C. (same ionic strength), this allows about 6% mismatch. In order to capture more distant related sequences, one of ordinary skill in the art can simply decrease the temperature or increase the ionic strength.

For oligonucleotide probes up to about 20 nucleotides, a reasonable estimate of the melting temperature in 1M NaCl is
Tm = (2 ° C. for one AT base) + (4 ° C. for one GC base pair)
Provided by. The sodium ion concentration in 6 × sodium citrate (SSC) is 1 M (see Suggs et al., Developmental Biology Using Purified Genes, page 683, Brown and Fox (ed.) (1981)).

A natural nucleic acid encoding a protein such as a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, 4 or 10 or a variant or fragment thereof is, for example, a part of the nucleic acid sequence of SEQ ID NO: 1, 3 or 9 or its Easily separated from cDNA libraries with PCR primers and hybridization probes containing variants. A nucleic acid encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2, 4 or 10 or a variant or fragment thereof is essentially 1% bovine serum albumin (BSA); 500 mM sodium phosphate (NaPO ₄ ); 1 mM EDTA Defined by a hybridization buffer containing 7% SDS at a temperature of 42 ° C., and essentially 2 × SSC (600 mM NaCl; 60 mM sodium citrate); a wash buffer containing 0.1% SDS at 50 ° C. Hybridization comprising 1% bovine serum albumin (BSA) under low stringent conditions, more preferably essentially at a temperature of 50 ° C .; 500 mM sodium phosphate (NaPO ₄ ); 15% formamide; 1 mM EDTA; 7% SDS Buffer, and essentially 50 ° C. 1 × SSC (300 mM NaCl; 30 mM sodium citrate); 1% bovine serum albumin (BSA) under low stringent conditions defined by a wash buffer containing 1% SDS, most preferably essentially at a temperature of 50 ° C. ); 200 mM sodium phosphate (NaPO ₄ ); 15% formamide; 1 mM EDTA; hybridization buffer containing 7% SDS, and essentially 0.5 × SSC at 65 ° C. (150 mM NaCl; 15 mM sodium citrate); It can hybridize with one or a portion of the sequence shown in SEQ ID NO: 1 or 3 under low stringency conditions as defined by a wash buffer containing 0.1% SDS.

  As used herein, the percentage of “identity”, “homology” and “similarity” of sequences (such as amino acids or nucleic acids) is determined by comparing two sequences that are optimally aligned in a comparison window. . Here, the reference sequence for the optimal alignment of the two sequences (a gap may occur if the other sequences contain additions, in the part of the polynucleotide or polypeptide sequence within the comparison window, Reference sequences herein shall contain no additions or deletions) and may include additions or deletions (ie gaps). Find the number of match positions by determining the number of positions where the same nucleobase or amino acid residue is found in both sequences, and divide the number of match positions by the total number of positions in the comparison window. Is multiplied by 100 to calculate the percent identity. When used in a search, homology is assessed using an appropriate one from a variety of sequence comparison algorithms and programs well known in the art. Such algorithms and programs include TBLASTN, BLASTP, FASTA, TFASTA and CLUSTALW (Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA 85 (8): 2444-2448, Altschul et al., 1990 ,. J. Mol.Biol.215 (3): 403-410, Thompson et al., 1994, Nucleic Acids Res.22 (2): 4673-4680, Higgins et al., 1996, Methods Enzymol.266: 383-402. Altschul et al., 1990, J. Mol.Biol.215 (3): 403-410, Altschul et al. 1993, Nature Genetics 3: 266-272), but is not limited thereto. In a particularly preferred embodiment, the Basic Local Alignment Tool (BLAST) known in the prior art (eg, Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. USA 87: 2267-2268, Altschul et al., 1990). J. Mol. Biol. 215: 403-410, Altschul et al., 1993, Nature Genetics 3: 266-272, Altschul et al., 1997, Nuc. Acids Res.25: 3389-3402). Used to assess protein and nucleic acid sequence homology. In particular, a comparison or search can be achieved by performing the following operations using five dedicated BLAST programs.

(1) Compare amino acid query sequence with protein sequence database in BLASTP and BLAST3;
(2) Compare nucleotide query sequence with nucleotide sequence database at BLASTN;
(3) Comparison of a conceptual translation product obtained by converting a nucleotide query sequence (both strands) with BLASTX in six reading frames with a protein sequence database;
(4) Compare protein query sequence with TBLASTN to nucleotide sequence database converted in all six reading frames (both strands);
(5) Comparison of nucleotide query sequence converted by TBLASTX in 6 reading frames with nucleotide sequence database converted in 6 reading frames.

  The BLAST program identifies similar segments called “high-score segment pairs” between an amino acid query sequence or nucleic acid query sequence, and preferably a test sequence obtained from a protein sequence database or nucleic acid sequence database. Thus, a homologous sequence is identified. High score segment pairs are preferably identified (ie, aligned) by a scoring matrix well known in the art. Preferably, a BLOSUM62 matrix (Gonnet et al., 1992, Science 256: 1443-1445, Henikoff and Henikoff, 1993, Proteins 17: 49-61) is used as the scoring matrix. Although not as preferred as this matrix, a PAM or PAM250 matrix can also be used (see, for example, Schwartz and Dayhoff, eds., 1978, Matrixes for Detection Distance Relationships: Atlas of Protein Sequence and Stance and Stance. about). The BLAST program evaluates the statistical significance of all identified high score segment pairs and preferably selects segments that meet a user-defined threshold level of significance, such as a user-specific homology rate. It is preferred to evaluate the statistical significance of high score segment pairs using Karlin's formula for statistical significance (see Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. USA 87: 2267-2268). about).

  As used herein, “homology” of genes (eg, nucleic acid sequences, amino acid sequences, etc.) refers to the degree of identity of two or more gene sequences with each other. In the present specification, the identity of sequences (nucleic acid sequences, amino acid sequences, etc.) refers to the degree of two or more comparable sequences that are identical to each other (individual nucleic acids, amino acids, etc.). Therefore, the higher the homology between two genes, the higher the sequence identity or similarity. Whether two genes have homology can be examined by direct sequence comparison or, in the case of nucleic acids, hybridization methods under stringent conditions. When directly comparing two gene sequences, the DNA sequence between the gene sequences is typically at least 50% identical, preferably at least 70% identical, more preferably at least 80%, 90% , 95%, 96%, 97%, 98% or 99% are identical, the genes are homologous. In the present specification, “similarity” of genes (for example, nucleic acid sequences, amino acid sequences, etc.) refers to two or more gene sequences when the conservative substitution is regarded as positive (identical) in the above homology. The degree of identity with each other. Thus, when there is a conservative substitution, homology and similarity differ depending on the presence of the conservative substitution. When there is no conservative substitution, homology and similarity indicate the same numerical value.

  In this specification, the comparison of similarity, identity and homology between amino acid sequences and base sequences is calculated using FASTA, which is a sequence analysis tool, and using default parameters.

(Basic technology)
The techniques used herein are within the technical scope of the art, unless otherwise specifically indicated, microbiology, fermentation engineering, biochemistry, genetic engineering, molecular biology, genetics and related Well-known and conventional techniques in the field are used. Such techniques are well described, for example, in the documents listed below and in references cited elsewhere herein.

  Representative basic techniques used in this specification will be described below, but these are merely examples, and the present invention is not intended to be limited to the following description.

(Fed-batch culture)
The conditions for fed-batch culture are well known in the art. Although typical fed-batch culture is illustrated below, the conditions of fed-batch culture are not limited to this. A person skilled in the art can easily change the fed-batch culture conditions as appropriate.

For example, typical fed-batch culture uses 1.2 g yeast cells cultured in YMPD medium (0.3% yeast extract, 0.3% malt extract, 0.5% peptone, 3% glucose) as seed yeast. After seeding in a predetermined medium, a molasses solution (a solution obtained by adding 19.49 g / L urea and 52 g / L KH ₂ PO ₄ to waste molasses corresponding to 260 g / L sugar) at 30 ° C. This is done by continuously feeding in.

  The conditions for fed-batch culture are well known in the art, and those skilled in the art can appropriately select and modify the fed-batch culture conditions.

(General techniques used in this specification)
Molecular biological techniques, biochemical techniques, microbiological techniques, and glycoscience techniques used in this specification are well known and commonly used in the art, and are described in, for example, Maniatis, T. et al. et al. (1989). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor and its 3rd Ed. (2001); Ausubel, F .; M.M. , Et al. eds, Current Protocols in Molecular Biology, John Wiley & Sons Inc. NY, 10158 (2000); Innis, M .; A. (1990). PCR Protocols: A Guide to Methods and Applications, Academic Press; A. et al. (1995). PCR Strategies, Academic Press; Sinsky, J. et al. J. et al. et al. (1999). PCR Applications: Protocols for Functional Genomics, Academic Press; Gait, M .; J. et al. (1985). Oligonucleotide Synthesis: A Practical Approach, IRL Press; Gait, M .; J. et al. (1990). Oligonucleotide Synthesis: A Practical Approach, IRL Press; Eckstein, F .; (1991). Oligonucleotides and Analogues: A Practical Approc, IRL Press; Adams, R .; L. et al. (1992). The Biochemistry of the Nucleic Acids, Chapman &Hall; Shabarova, Z. et al. et al. (1994). Advanced Organic Chemistry of Nucleic Acids, Weinheim; Blackburn, G .; M.M. et al. (1996). Nucleic Acids in Chemistry and Biology, Oxford University Press; Hermanson, G .; T.A. (1996). Bioconjugate Techniques, Academic Press; Methods in Enzymology 230, 242, 247, Academic Press, 1994; Related parts (which may be all) are incorporated by reference.

(Genetic engineering)
“Recombinant vectors” for yeast that can be used in the present invention include, but are not limited to, YEp, YCp, YIp and the like. In addition, E.I. Examples of vectors used for E. coli include pGEM-T, pUC, pBluescript, and the like.

  In this specification, any technique may be used for introducing a nucleic acid molecule into a cell, and examples thereof include transformation, transduction, and transfection. Such a technique for introducing a nucleic acid molecule is well known in the art and commonly used. For example, Ausubel F. et al. A. (1988), Current Protocols in Molecular Biology, Wiley, New York, NY; Sambrook J et al. (1987) Molecular Cloning: A Laboratory Manual, 2nd Ed. And its third edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, a separate volume of experimental medicine “Gene Transfer & Expression Analysis Experimental Method” Yodosha, 1997, and the like. Gene transfer can be confirmed using the methods described herein, such as Northern blot, Western blot analysis, or other well-known conventional techniques.

  As used herein, any method for introducing a DNA can be used as a method for introducing a recombinant vector. For example, a calcium chloride method, an electroporation method [Methods. Enzymol. , 194, 182 (1990)], lipofection method, spheroplast method [Proc. Natl. Acad. Sci. USA, 84, 1929 (1978)], lithium acetate method [J. Bacteriol. , 153, 163 (1983)], Proc. Natl. Acad. Sci. USA, 75, 1929 (1978), and a method using a particle gun (gene gun).

(Description of Preferred Embodiment)
(1. Preparation of haploid mutants of OCA1 gene, OCA2 gene or ALD2 gene)
As a method for preparing an OCA1 gene, OCA2 gene or ALD2 gene haploid mutant, for example, (1) random mutagenesis is performed, and OCA1 gene, OCA2 gene or ALD2 gene mutant is selected from a large number of candidate mutants. Examples include, but are not limited to, isolation methods and (2) mutagenesis targeting OCA1, OCA2 or ALD2 genes. The OCA1 gene, OCA2 gene or ALD2 gene mutant gene is a protein having no enzyme activity of the wild-type gene, a protein having 10% or less, a protein having 20% or less, a protein having 30% or less, a protein having 40% or less , A protein having 50% or less, a protein having 60% or less, a protein having 70% or less, or a protein having 80% or less. Methods for measuring enzyme activities of OCA1, OCA2 and ALD2 proteins are well known.

(1.1. Method using random mutagenesis)
Random mutagenesis methods include, for example, a method using a mutagen (such as, but not limited to, nitrosoguanidine), a method using ultraviolet / γ-ray irradiation, and a random insertion mutation by transposon. Include, but are not limited to, methods of triggering. After these random mutagenesis, a mutant strain containing a mutation in the OCA1, OCA2 or ALD2 gene, resulting in a decrease in the amount of the gene product of these genes and / or a decrease in the activity of the gene product. Isolate.

  Methods for quantifying the gene products of these genes include methods for measuring mRNA expressed from these genes by Northern hybridization, methods for measuring proteins expressed from these genes with anti-OCA1, anti-ALD2 or anti-OCA2 antibodies, and A method for measuring the phosphatase activity of proteins expressed from these genes is mentioned, but the method is not limited thereto. When transposon is used, the target mutant strain contains transposon inside the OCA1 gene, the OCA2 gene, or the ALD2 gene, so PCR primers that amplify these genes from both ends of the OCA1, OCA2 gene, or ALD2 gene should be used. The OCA1 gene, OCA2 gene or ALD2 gene can be used to amplify the gene, and whether or not a transposon sequence is contained in the gene can be used as an index for isolation of the target mutant strain.

Since the substrate for the phosphatase activity of the OCA1 protein and the OCA2 protein is a thyronsin group phosphorylated protein, it is possible to measure the phosphatase activity and use it as an index for isolating the target mutant strain. Phosphatase activity can be measured, for example, by measuring isotope release from an isotope-labeled protein tyrosine phosphatase substrate. Aldehyde dehydrogenase, an ALD2 protein, is an enzyme that catalyzes the reaction to oxidize aldehyde to carboxylic acid, so its dehydrogenase activity can be measured and used as an index for the isolation of the target mutant It is. Aldehyde dehydrogenase activity, e.g., measured in 50 mM Na-pyrophosphate buffer (pH 9.0), the generation of NADH with 1 mM NAD ⁺ and 5mM propionaldehyde aldehyde acetonide as a substrate with increasing _{A 340.} In the case of a crude enzyme sample, 1 mM pyrazole is added for measurement.

(1.2. Method of performing mutagenesis targeting OCA1 gene or OCA2 gene)
Since yeast is a biological species that undergoes homologous recombination with a high probability, it is possible to carry out mutagenesis targeting a target gene using the homologous recombination. For example, both ends ((a) 5 ′ untranslated region and / or amino terminal region of the open reading frame, and (b) 3 ′ untranslated region) of the target gene (OCA1 gene or OCA2 gene, or homologs thereof) And / or the carboxyl terminal region of the open reading frame) is ligated so as to sandwich a gene (for example, URA3 gene) different from the OCA1 gene or OCA2 gene to construct a gene disruption vector. From this vector, the above-mentioned DNA fragment of [the both ends of the target gene + different genes sandwiched between the ends] is amplified, and the host yeast is transformed. In the host yeast, a strain is produced in which the introduced DNA fragment is replaced with the sequence of genomic DNA by homologous recombination. Since the mutant has a gene different from the target gene in the genome, the phenotypic change caused by a gene different from the target gene (for example, change from uracil requirement to uracil non-requirement) is used as an indicator. The strain in which the desired homologous recombination has occurred is isolated. Furthermore, it is confirmed by PCR that the isolated strain is actually the strain that has produced the desired homologous recombination. As a result, a strain in which the target gene (OCA1 gene or OCA2 gene) in the genomic DNA is disrupted is isolated.

  By the above operation, mutagenesis targeting the OCA1 gene or the OCA2 gene is possible.

(2. Production of diploid mutants of OCA1, OCA2 or ALD2 genes)
Examples of a method for producing a diploid homozygous mutant of the OCA1 gene, OCA2 gene or ALD2 gene include, for example, (1) a haploid mutant of an OCA1, OCA2 or ALD2 gene and a single conjugated mutant. A method for producing a diploid mutant by crossing these haploid mutants, and (2) using two different selectable markers, using the first selectable marker and the first Examples include, but are not limited to, a method of introducing a mutation into an allele and then introducing a mutation into the second allele using the mutant strain and a second selectable marker.

(3. Modification of highly sucrose resistant mutants having mutations in genes other than the OCA1, OCA2 and ALD2 genes)
As mutations imparting high sucrose resistance, mutations to trehalose-degrading enzymes NTH1 and ATH1 are known. With these mutant strains as parent strains, mutations can be introduced into the OCA1 gene or OCA2 gene, and mutant strains having high sucrose resistance can be isolated.

  References such as scientific literature, patents and patent applications cited herein are hereby incorporated by reference in their entirety to the same extent as if each was specifically described.

  The present invention has been described with reference to the preferred embodiments for easy understanding. In the following, the present invention will be described based on examples, but the above description and the following examples are provided only for the purpose of illustration, not for the purpose of limiting the present invention. Accordingly, the scope of the present invention is not limited to the embodiments or examples specifically described in the present specification, but is limited only by the scope of the claims.

  The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to the following examples.

(Example 1: Identification of high sucrose resistance-related genes and mutants)
A set of yeast gene disruption strains composed of about 5,000 non-essential gene disruption strains was distributed from EUROSCARF (European Saccharomyces cerevisiae archive for functional analysis). Using this, an exhaustive search of gene functions related to genes involved in high sucrose resistance in yeast was performed. A high sucrose resistant mutant is a medium containing 30% sucrose (30% sucrose, 5% maltose, 0.25% ammonium sulfate, 0.5% urea, 1.6% potassium dihydrogen phosphate, 0% 0.5% sodium monohydrogen phosphate dodecahydrate, 0.06% magnesium sulfate, 0.00225% nicotinic acid, 0.0005% pantothenic acid, 0.00025% thiamine, 0.000125% pyridoxine, 0.0001% Riboflavin, 0.00005% folic acid, 0.003% isoleucine, 0.015% valine, 0.002% adenine hemisulfate salt, 0.002% arginine hydrochloride, 0.002% histidine hydrochloride monohydrate, 01% leucine, 0.003% lysine hydrochloride, 0.002% methionine, 0.005% phenylalanine, 0.02% threonine, 0.00 % Tryptophan, 0.003% tyrosine, 0.002% uracil) in a high sucrose environment and cultivating wild-type and various mutant yeasts, and measuring the carbon dioxide produced by the fermographic method to determine the fermentative power The determination was performed by selecting a strain having higher fermentative power than the wild type strain.

  As a result, in the BY4743 strain, which is a laboratory yeast, the OCA1 gene (the reading frame nucleic acid sequence is shown as SEQ ID NO: 1, the amino acid sequence is shown as SEQ ID NO: 2) and the OCA2 gene (reading frame nucleic acid sequence is SEQ ID NO: 3, amino acid sequence). It was suggested that the high sucrose tolerance may be remarkably improved by gene disruption of (shown as SEQ ID NO: 4).

  Although OCAl and OCA2 are known to be protein phosphatases associated with cell cycle control, there is no teaching or suggestion regarding their association with sucrose resistance.

(Example 2: Production of a high sucrose resistant mutant having a mutation in the OCA1 gene or OCA2 gene using a practical yeast)
In the practical yeast Y244 strain, gene disruption of the OCA1 gene and OCA2 gene was carried out to obtain a gene disrupted strain.

  A method for producing an OCA1 gene disruption strain is shown in FIG. For OCA1 amplification, an OCA1for primer having a nucleic acid sequence (TTGATGAGCTTATGACTTAC: SEQ ID NO: 5) as a forward primer and an OCA1rev primer having a nucleic acid sequence (ATGATGACGTGGATGAGTCG: SEQ ID NO: 6) as a reverse primer were used. The OCA1 gene was amplified using these primer pairs using the chromosomal DNA of S. cerevisiae S288C strain as a template. After preparing a vector in which the amplified fragment was ligated to the pGEM-T vector, the HindIII fragment was excised from the vector, and the YEp24 HindIII fragment (including the URA3 gene reading frame) was ligated. OCA1 :: URA3, which is a fusion gene of OCA1 gene and URA3 gene, was PCR amplified using the OCA1for primer and OCA1rev primer, and the amplified fragment was transformed into a uracil-requiring mutant strain of Y244 strain to disrupt the OCA1 gene Strains were isolated using uracil non-requirement as an indicator. It was confirmed by PCR using an OCA1for primer and an OCA1rev primer that an OCA1 gene disrupted strain was produced. The results are shown in FIG. A fragment of about 3.2 kb was amplified from the OCA1 gene disruption strain.

  A method for producing an OCA2 gene disruption strain is shown in FIGS. For OCA2 amplification, an OCA2for primer having a nucleic acid sequence (GTTCCATTTGGTTTATCAGC: SEQ ID NO: 7) as a forward primer and an OCA2rev primer having a nucleic acid sequence (GATATCAGCGCCGGTTCCAT: SEQ ID NO: 8) as a reverse primer were used. The OCA2 gene was amplified using the chromosomal DNA of S. cerevisiae S288C strain as a template and these primer pairs. After preparing a vector in which the amplified fragment was ligated to the pGEM-T vector, the HindIII fragment was excised from the vector, and the YEp24 HindIII fragment (including the URA3 gene reading frame) was ligated. Using the OCA2for primer and OCA2rev primer, OCA2 :: URA3, which is a fusion gene of the OCA2 gene and the URA3 gene, was PCR-amplified, and the amplified fragment was transformed into a uracil-requiring mutant of the Y244 strain to disrupt the OCA2 gene. Strains were isolated using uracil non-requirement as an indicator. It was confirmed by PCR using an OCA2for primer and an OCA2rev primer that an OCA2 gene disrupted strain was produced. The results are shown in FIG. A fragment of about 3.1 kb was amplified from the OCA2 gene disruption strain.

  These yeast strains, Y244 strain, Y244 strain Y312 strain, which is the OCA1 gene disruption strain, and Y244 strain OCA2 gene disruption strain, were deposited at the Patent Microorganism Depositary Center of the National Institute of Technology and Evaluation. . The respective deposit numbers are NITE AP-274, NITE AP-275, and NITE AP-276.

(Example 3: Characterization of a high sucrose-resistant mutant strain having a mutation in the OCA1 gene or OCA2 gene prepared from a practical yeast)
The mutant strain prepared in Example 2 was characterized. Wild strains, OCAl disrupted strains, and OCA2 disrupted strains were subjected to non-stress conditions (5% sucrose, 5% maltose, 0.25% ammonium sulfate, 0.5% urea, using a medium containing 5% sucrose concentration. 1.6% potassium dihydrogen phosphate, 0.5% sodium monohydrogen phosphate dodecahydrate, 0.06% magnesium sulfate, 0.00225% nicotinic acid, 0.0005% pantothenic acid, 0.00025% thiamine , 0.000125% pyridoxine, 0.0001% riboflavin, 0.00005% folic acid), and stress conditions using a medium containing 50% sucrose concentration (50% sucrose, 5% maltose, 0.25% ammonium sulfate) 0.5% urea, 1.6% potassium dihydrogen phosphate, 0.5% sodium monohydrogen phosphate dodecahydrate, 0.06% magnesium sulfate, .00225% nicotinic acid, 0.0005% pantothenic acid, 0.00025% thiamine, 0.000125% pyridoxine, 0.0001% riboflavin, 0.00005% folic acid) at 30 ° C. for 120 minutes with shaking at 90 rpm. The amount of carbon dioxide gas generated was measured by a farm graph method. The results are shown in FIG. 6 and FIG.

  As a result, the OCA1 gene-disrupted strain and the OCA2 gene-disrupted strain derived from the practical yeast showed extremely high (about 1.5 times) high sucrose resistance compared to the wild-type yeast. Moreover, since the normal bread dough fermentation power was also maintained high, it was shown that OCA1 gene disruption and OCA2 gene disruption are suitable methods for the production of high-sucrose resistant practical yeast.

(Example 4: Production of a high sucrose resistant mutant having a mutation in the ALD2 gene using a practical yeast)
Screening for stress-resistant strains using a set of gene-disrupted strains of non-essential genes suggested that ALD2 gene-disrupted strains show significant resistance to drought and high sucrose stress in laboratory strains. Therefore, we examined whether the ALD2 gene was disrupted in the practical yeast strain Y244 and stress tolerance was improved. The gene disruption was performed as follows.

  First, ALD2-URA3 FOR primer (5'-TATCGAAATCCCACAATTGAAAATCTCTTTAAAGCAACCGTTCAATTCAATTCATCA-3 ') and ALD2-URA3REV primer (5'-TATGTGAACTGCTTTTGTTTGAAGATAGGTATCAACACC) It was. These primers have a 40b sequence homologous to the ALD2 peripheral region added to the 5 'side of the URA3 homologous sequence. Using this amplified fragment, a uracil-requiring mutant of Y244 strain was transformed, and an ALD2 gene disruption strain was isolated using uracil non-requiring as an index. The outline is shown in FIG.

(Example 5: Characterization of a high sucrose-resistant mutant having a mutation in the ALD2 gene prepared from a practical yeast)
The mutant strain prepared in Example 4 was characterized. The wild-type strain and the ALD2-disrupted strain were subjected to drought stress by the following procedure: 1) Cells were cultured in 400 mL of YPD medium (200 mL × 2) at 30 ° C. for 24 hours; 2) The cultured cells were Using a porcelain dry plate (Nikkato Co., Ltd.), dehydrated until the water content was 68% (similar to commercially available compressed yeast); 3) Using a ventilated dryer (ESBEC), 37 Air-dried for 24 hours at a temperature of 5% (similar to dry yeast product); 4) Gas production in liquid fermentation (LF) medium (medium similar to bread dough) Measurement was performed using II (ATTO Corporation).

  Next, stress conditions using a medium containing a 50% sucrose concentration (50% sucrose, 5% maltose, 0.25% ammonium sulfate, 0.5% urea, 1.6% potassium dihydrogen phosphate, 0. 5% sodium monohydrogen phosphate dodecahydrate, 0.06% magnesium sulfate, 0.00225% nicotinic acid, 0.0005% pantothenic acid, 0.00025% thiamine, 0.000125% pyridoxine, 0.0001% riboflavin , 0.00005% folic acid) at 30 ° C. for 120 minutes with shaking at 90 rpm, and the amount of carbon dioxide generated was measured by the farming method. The results are shown in FIG.

  As a result, it was revealed that the ALD2-disrupted strain has extremely excellent drought stress tolerance and high sucrose stress tolerance.

  As mentioned above, although this invention has been illustrated using preferable embodiment of this invention, this invention should not be limited and limited to this embodiment. It is understood that the scope of the present invention should be interpreted only by the scope of the patent claims. It is understood that those skilled in the art can implement an equivalent range based on the description of the present invention and the common general technical knowledge from the description of specific preferred embodiments of the present invention. Patents, patent applications, and documents cited in this specification should be incorporated by reference as if the contents themselves were specifically described in the present specification. Understood.

  By using the yeast of the present invention, it is possible to isolate a yeast that exhibits high fermentability even in a high sucrose environment. By using such a yeast, it is possible to increase the efficiency of fermentation in a high sucrose environment in the manufacture of confectionery and the like for which it has been difficult to perform sufficient fermentation.

FIG. 1 is a diagram showing a method for producing an OCA1 gene disruption strain. FIG. 2 is a diagram showing the experimental results for confirming the production of the OCA1 gene disruption strain. FIG. 3 is a diagram showing a method for producing an OCA2 gene disruption strain. FIG. 4 is a diagram showing a method for producing an OCA2 gene disruption strain. FIG. 5 is a diagram showing the experimental results for confirming the production of the OCA2 gene disrupted strain. FIG. 6 is a diagram showing the results of comparison of fermentative power under non-stress conditions (5% sucrose concentration). FIG. 7 is a diagram showing the results of comparison of fermentative power under stress conditions (50% sucrose concentration). FIG. 8 is a diagram showing a method for preparing an ALD2 gene disruption strain. FIG. 9 is a diagram showing the results of comparing the fermentative power of ALD2 strain and wild-type strain under stress conditions (50% sucrose concentration).

SEQ ID NO: 1 OCA1 gene nucleic acid sequence SEQ ID NO: 2 OCA1 gene amino acid sequence SEQ ID NO: 3 OCA2 gene nucleic acid sequence SEQ ID NO: 4 OCA2 gene amino acid sequence SEQ ID NO: 5 OCA1 for primer SEQ ID NO: 6 OCA1 rev primer SEQ ID NO: 7 OCA2 for primer SEQ ID NO: 8 OCA2rev primer SEQ ID NO: 9 ALD2 gene nucleic acid sequence SEQ ID NO: 10 ALD2 gene amino acid sequence SEQ ID NO: 11 ALD2-URA3 FOR primer SEQ ID NO: 12 ALD2-URA3 REV primer

Claims (28)

A method of manufacturing a tio sugar tolerant yeast, the following:
(A) a step of destroying a genomic gene that hybridizes under high stringency conditions to a nucleic acid having a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3 and SEQ ID NO: 9 ;
(B) comparing the mutant yeast that has undergone gene disruption in step (a) with the yeast that has not undergone gene disruption for sucrose resistance; and
(C) selecting a mutant yeast having improved sucrose resistance;
Including the method. 2. The method according to claim 1, wherein the yeast is baker's yeast. The manufacturing method of the high sucrose bread dough using the yeast manufactured by the method of Claim 1. The manufacturing method of bread using the yeast manufactured by the method of Claim 1. The manufacturing method of confectionery using the yeast manufactured by the method of Claim 1. A selection method of tio glucose tolerance yeast, the following:
(A) selecting a yeast having a disrupted genomic gene that hybridizes under high stringency conditions to a nucleic acid having a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3 and SEQ ID NO: 9 ;
(B) comparing the mutant yeast selected in step (a) with yeast that has not undergone gene disruption for sucrose resistance; and
(C) selecting a mutant yeast having improved sucrose resistance;
Including the method. The method according to claim 6, wherein the yeast is baker's yeast. The manufacturing method of high sucrose bread dough using the yeast selected by the method of Claim 6. The manufacturing method of bread using the yeast selected by the method of Claim 6. The manufacturing method of confectionery using the yeast selected by the method of Claim 6. A composition for performing fermentation for bread production under high sucrose conditions, the composition comprising yeast and at least a portion of the ingredients
Here, the yeast is a sucrose-resistant yeast produced by the method according to claim 1, and is a genomic gene that hybridizes under high stringency conditions to a nucleic acid having the sequence of SEQ ID NO: 1. a yeast having a gene disruption mutation in,
Composition. A composition for performing fermentation for bread production under high sucrose conditions, the composition comprising yeast and at least a portion of the ingredients
  Here, the yeast is a sucrose-resistant yeast selected by the method according to claim 6, and is a genomic gene that hybridizes to a nucleic acid having the sequence of SEQ ID NO: 1 under highly stringent conditions. A yeast having a gene disruption mutation,
Composition. Diploid yeast having highly homozygous gene disruption mutation hybridizes to genomic gene under stringent conditions to a nucleic acid having the sequence set forth the yeast in SEQ ID NO: 1, according to claim 11 or 12 Composition. The manufacturing method of high sucrose bread dough using the composition as described in any one of Claims 11-13 . The manufacturing method of bread using the composition as described in any one of Claims 11-13 . The manufacturing method of confectionery using the composition as described in any one of Claims 11-13 . A composition for performing fermentation for bread production under high sucrose conditions, the composition comprising yeast and at least a portion of the ingredients
Here, the yeast is a sucrose-resistant yeast produced by the method according to claim 1, and is a genomic gene that hybridizes under high stringency conditions to a nucleic acid having the sequence of SEQ ID NO: 3. a yeast having a gene disruption mutation in,
Composition. A composition for performing fermentation for bread production under high sucrose conditions, the composition comprising yeast and at least a portion of the ingredients
  Here, the yeast is a sucrose-resistant yeast selected by the method according to claim 6, and a genomic gene that hybridizes under high stringency conditions to a nucleic acid having the sequence of SEQ ID NO: 3. A yeast having a gene disruption mutation in
Composition. Wherein the yeast is diploid yeast having highly homozygous gene disruption mutation hybridizes to genomic gene under stringent conditions to a nucleic acid having the sequence set forth in SEQ ID NO: 3, claim 17 or 18 Composition. The manufacturing method of high sucrose bread dough using the composition as described in any one of Claims 17-19 . The manufacturing method of bread using the composition as described in any one of Claims 17-19 . The manufacturing method of confectionery using the composition as described in any one of Claims 17-19 . A composition for performing fermentation for bread production under high sucrose conditions, the composition comprising yeast and at least a portion of the ingredients
Here, the yeast is a sucrose-resistant yeast produced by the method according to claim 1, and is a genomic gene that hybridizes under high stringency conditions to a nucleic acid having the sequence of SEQ ID NO: 9. a yeast having a gene disruption mutation in,
Composition. A composition for performing fermentation for bread production under high sucrose conditions, the composition comprising yeast and at least a portion of the ingredients
  Here, the yeast is a sucrose-resistant yeast selected by the method of claim 6, and a genomic gene that hybridizes to a nucleic acid having the sequence of SEQ ID NO: 9 under highly stringent conditions A yeast having a gene disruption mutation in
Composition. Wherein the yeast is diploid yeast having highly homozygous gene disruption mutation hybridizes to genomic gene under stringent conditions to a nucleic acid having the sequence set forth in SEQ ID NO: 9, claim 23 or 24 Composition. The manufacturing method of high sucrose bread dough using the composition as described in any one of Claims 23-25 . The manufacturing method of bread using the composition as described in any one of Claims 23-25 . The manufacturing method of confectionery using the composition as described in any one of Claims 23-25 .